>Feature sequence001 337 59 gene locus_tag LOCUS_00010 337 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1757 753 gene locus_tag LOCUS_00020 1757 753 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_00020 3879 2149 gene locus_tag LOCUS_00030 3879 2149 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_00030 4769 3960 gene locus_tag LOCUS_00040 4769 3960 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921533.1 protein_id gnl|my_center|LOCUS_00040 5497 4766 gene locus_tag LOCUS_00050 5497 4766 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_00050 6690 5524 gene locus_tag LOCUS_00060 6690 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7863 7492 gene locus_tag LOCUS_00070 7863 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9025 8153 gene locus_tag LOCUS_00080 9025 8153 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946557.1 protein_id gnl|my_center|LOCUS_00080 9705 9064 gene locus_tag LOCUS_00090 9705 9064 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_00090 10691 9702 gene locus_tag LOCUS_00100 gene galE 10691 9702 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_00100 11860 10691 gene locus_tag LOCUS_00110 11860 10691 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_00110 12383 11862 gene locus_tag LOCUS_00120 12383 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13087 12470 gene locus_tag LOCUS_00130 13087 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13071 13250 gene locus_tag LOCUS_00140 13071 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14554 13706 gene locus_tag LOCUS_00150 14554 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15625 14612 gene locus_tag LOCUS_00160 15625 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16307 15672 gene locus_tag LOCUS_00170 16307 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18175 17693 gene locus_tag LOCUS_00180 18175 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19269 18178 gene locus_tag LOCUS_00190 19269 18178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_00190 <19894 19274 gene locus_tag LOCUS_00200 <19894 19274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088745.1:SDR family oxidoreductase >Feature sequence002 1380 478 gene locus_tag LOCUS_00210 gene murB 1380 478 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957398.1 protein_id gnl|my_center|LOCUS_00210 2792 1368 gene locus_tag LOCUS_00220 gene murC 2792 1368 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_00220 3868 2789 gene locus_tag LOCUS_00230 gene murG 3868 2789 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769484.1 protein_id gnl|my_center|LOCUS_00230 5054 3861 gene locus_tag LOCUS_00240 gene ftsW 5054 3861 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_00240 6391 5051 gene locus_tag LOCUS_00250 gene murD 6391 5051 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948316.1 protein_id gnl|my_center|LOCUS_00250 7470 6388 gene locus_tag LOCUS_00260 gene mraY 7470 6388 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_00260 8852 7455 gene locus_tag LOCUS_00270 gene murF 8852 7455 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262635.1 protein_id gnl|my_center|LOCUS_00270 10270 8849 gene locus_tag LOCUS_00280 10270 8849 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881134.1 protein_id gnl|my_center|LOCUS_00280 12143 10377 gene locus_tag LOCUS_00290 12143 10377 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946651.1 protein_id gnl|my_center|LOCUS_00290 12415 12140 gene locus_tag LOCUS_00300 12415 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 13371 12442 gene locus_tag LOCUS_00310 gene rsmH 13371 12442 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368254.1 protein_id gnl|my_center|LOCUS_00310 13824 13372 gene locus_tag LOCUS_00320 gene mraZ 13824 13372 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210443.1 protein_id gnl|my_center|LOCUS_00320 17407 14297 gene locus_tag LOCUS_00330 17407 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 18696 17410 gene locus_tag LOCUS_00340 18696 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 <19356 18737 gene locus_tag LOCUS_00350 <19356 18737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680747.1:efflux RND transporter permease subunit >Feature sequence003 <1 792 gene locus_tag LOCUS_00360 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198677105.1:M48 family metallopeptidase 3351 847 gene locus_tag LOCUS_00370 3351 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 3735 4691 gene locus_tag LOCUS_00380 gene rluC 3735 4691 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072718.1 protein_id gnl|my_center|LOCUS_00380 4694 5701 gene locus_tag LOCUS_00390 gene sppA 4694 5701 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_00390 6093 5716 gene locus_tag LOCUS_00400 6093 5716 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461457.1 protein_id gnl|my_center|LOCUS_00400 7151 6090 gene locus_tag LOCUS_00410 7151 6090 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_00410 8085 7135 gene locus_tag LOCUS_00420 gene gshB 8085 7135 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_00420 9373 8078 gene locus_tag LOCUS_00430 gene gshA 9373 8078 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_00430 9599 13468 gene locus_tag LOCUS_00440 9599 13468 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947481.1 protein_id gnl|my_center|LOCUS_00440 13465 14304 gene locus_tag LOCUS_00450 13465 14304 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_00450 14429 15118 gene locus_tag LOCUS_00460 gene mlaF 14429 15118 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 protein_id gnl|my_center|LOCUS_00460 15131 15922 gene locus_tag LOCUS_00470 gene mlaE 15131 15922 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_00470 15919 16383 gene locus_tag LOCUS_00480 gene mlaD 15919 16383 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 protein_id gnl|my_center|LOCUS_00480 16385 17089 gene locus_tag LOCUS_00490 16385 17089 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_00490 17076 17372 gene locus_tag LOCUS_00500 17076 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 >Feature sequence004 1769 102 gene locus_tag LOCUS_00510 1769 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 2193 1759 gene locus_tag LOCUS_00520 2193 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 2729 2190 gene locus_tag LOCUS_00530 2729 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3247 2729 gene locus_tag LOCUS_00540 3247 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4077 3235 gene locus_tag LOCUS_00550 4077 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4624 4070 gene locus_tag LOCUS_00560 4624 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7370 4626 gene locus_tag LOCUS_00570 7370 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8671 7367 gene locus_tag LOCUS_00580 8671 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 8972 8676 gene locus_tag LOCUS_00590 8972 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 9694 9266 gene locus_tag LOCUS_00600 9694 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9849 9691 gene locus_tag LOCUS_00610 9849 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10841 9852 gene locus_tag LOCUS_00620 10841 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 11283 10843 gene locus_tag LOCUS_00630 11283 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 11750 11280 gene locus_tag LOCUS_00640 11750 11280 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072637.1 protein_id gnl|my_center|LOCUS_00640 12205 11750 gene locus_tag LOCUS_00650 12205 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 12670 12209 gene locus_tag LOCUS_00660 12670 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 13704 12799 gene locus_tag LOCUS_00670 13704 12799 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_00670 14705 13704 gene locus_tag LOCUS_00680 14705 13704 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072631.1 protein_id gnl|my_center|LOCUS_00680 16402 15092 gene locus_tag LOCUS_00690 16402 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 <17833 16392 gene locus_tag LOCUS_00700 <17833 16392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072627.1:DUF935 domain-containing protein >Feature sequence005 <1 1642 gene locus_tag LOCUS_00710 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038389.1:bifunctional DedA family/phosphatase PAP2 family protein 2882 1704 gene locus_tag LOCUS_00720 2882 1704 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946303.1 protein_id gnl|my_center|LOCUS_00720 4144 2942 gene locus_tag LOCUS_00730 gene argJ 4144 2942 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268841.1 protein_id gnl|my_center|LOCUS_00730 6879 4156 gene locus_tag LOCUS_00740 gene secA 6879 4156 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_00740 8194 7301 gene locus_tag LOCUS_00750 gene lpxC 8194 7301 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_00750 9033 8302 gene locus_tag LOCUS_00760 gene radC 9033 8302 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_00760 9116 10333 gene locus_tag LOCUS_00770 gene coaBC 9116 10333 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 protein_id gnl|my_center|LOCUS_00770 10314 10769 gene locus_tag LOCUS_00780 gene dut 10314 10769 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164750.1 protein_id gnl|my_center|LOCUS_00780 10783 11676 gene locus_tag LOCUS_00790 gene argB 10783 11676 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_00790 11679 12236 gene locus_tag LOCUS_00800 gene ampD 11679 12236 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_00800 12229 12816 gene locus_tag LOCUS_00810 12229 12816 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206641.1 protein_id gnl|my_center|LOCUS_00810 12826 14820 gene locus_tag LOCUS_00820 12826 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 15958 14867 gene locus_tag LOCUS_00830 gene ychF 15958 14867 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418193.1 protein_id gnl|my_center|LOCUS_00830 16608 16009 gene locus_tag LOCUS_00840 gene pth 16608 16009 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_00840 17275 16622 gene locus_tag LOCUS_00850 17275 16622 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_00850 17821 17300 gene locus_tag LOCUS_00860 17821 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence006 1250 534 gene locus_tag LOCUS_00870 1250 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 2331 1321 gene locus_tag LOCUS_00880 2331 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2718 4604 gene locus_tag LOCUS_00890 2718 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4591 5526 gene locus_tag LOCUS_00900 4591 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6270 5530 gene locus_tag LOCUS_00910 6270 5530 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_00910 7637 6276 gene locus_tag LOCUS_00920 7637 6276 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_00920 8405 7677 gene locus_tag LOCUS_00930 gene lptB 8405 7677 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_00930 8928 8413 gene locus_tag LOCUS_00940 8928 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9485 8925 gene locus_tag LOCUS_00950 9485 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 10011 9487 gene locus_tag LOCUS_00960 10011 9487 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_00960 10991 10011 gene locus_tag LOCUS_00970 10991 10011 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_00970 11196 10984 gene locus_tag LOCUS_00980 11196 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 12158 11193 gene locus_tag LOCUS_00990 12158 11193 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_00990 13047 12163 gene locus_tag LOCUS_01000 gene ubiA 13047 12163 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262811.1 protein_id gnl|my_center|LOCUS_01000 15172 13088 gene locus_tag LOCUS_01010 gene recG 15172 13088 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678399.1 protein_id gnl|my_center|LOCUS_01010 15551 15165 gene locus_tag LOCUS_01020 15551 15165 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_01020 <17211 15555 gene locus_tag LOCUS_01030 <17211 15555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957490.1:bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase >Feature sequence007 190 501 gene locus_tag LOCUS_01040 190 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 933 598 gene locus_tag LOCUS_01050 933 598 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_01050 3816 997 gene locus_tag LOCUS_01060 3816 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4223 3822 gene locus_tag LOCUS_01070 4223 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5401 4304 gene locus_tag LOCUS_01080 5401 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5669 5875 gene locus_tag LOCUS_01090 5669 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5882 6772 gene locus_tag LOCUS_01100 5882 6772 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392170.1 protein_id gnl|my_center|LOCUS_01100 6916 7401 gene locus_tag LOCUS_01110 6916 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7959 8204 gene locus_tag LOCUS_01120 7959 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8250 8603 gene locus_tag LOCUS_01130 8250 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10185 8650 gene locus_tag LOCUS_01140 10185 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10421 10224 gene locus_tag LOCUS_01150 10421 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10472 11944 gene locus_tag LOCUS_01160 10472 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 12506 13030 gene locus_tag LOCUS_01170 12506 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 13152 13943 gene locus_tag LOCUS_01180 13152 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 13964 14881 gene locus_tag LOCUS_01190 13964 14881 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707167.1 protein_id gnl|my_center|LOCUS_01190 15304 14927 gene locus_tag LOCUS_01200 15304 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence008 979 731 gene locus_tag LOCUS_01210 979 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 1256 969 gene locus_tag LOCUS_01220 1256 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 1586 1356 gene locus_tag LOCUS_01230 1586 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2062 1718 gene locus_tag LOCUS_01240 2062 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 2880 2611 gene locus_tag LOCUS_01250 2880 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4520 3063 gene locus_tag LOCUS_01260 gene glcD 4520 3063 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_01260 5915 4536 gene locus_tag LOCUS_01270 5915 4536 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_01270 6601 5912 gene locus_tag LOCUS_01280 6601 5912 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_01280 8379 6751 gene locus_tag LOCUS_01290 8379 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 9005 8496 gene locus_tag LOCUS_01300 9005 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 11272 9014 gene locus_tag LOCUS_01310 11272 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 12015 11320 gene locus_tag LOCUS_01320 12015 11320 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_01320 14291 12036 gene locus_tag LOCUS_01330 14291 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15081 14296 gene locus_tag LOCUS_01340 15081 14296 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268904.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence009 178 1881 gene locus_tag LOCUS_01350 gene fliF 178 1881 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140005.1 protein_id gnl|my_center|LOCUS_01350 1881 2525 gene locus_tag LOCUS_01360 1881 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2503 2868 gene locus_tag LOCUS_01370 2503 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2865 3623 gene locus_tag LOCUS_01380 gene fliP 2865 3623 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140004.1 protein_id gnl|my_center|LOCUS_01380 3623 4711 gene locus_tag LOCUS_01390 3623 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 5839 4727 gene locus_tag LOCUS_01400 5839 4727 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338864.1 protein_id gnl|my_center|LOCUS_01400 6853 5843 gene locus_tag LOCUS_01410 6853 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8331 6862 gene locus_tag LOCUS_01420 gene flgK 8331 6862 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385165.1 protein_id gnl|my_center|LOCUS_01420 9663 8359 gene locus_tag LOCUS_01430 9663 8359 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385166.1 protein_id gnl|my_center|LOCUS_01430 10564 9743 gene locus_tag LOCUS_01440 10564 9743 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669859.1 protein_id gnl|my_center|LOCUS_01440 10672 11691 gene locus_tag LOCUS_01450 10672 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11762 12628 gene locus_tag LOCUS_01460 gene motA 11762 12628 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_01460 12628 14514 gene locus_tag LOCUS_01470 12628 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14507 15250 gene locus_tag LOCUS_01480 14507 15250 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385144.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence010 175 951 gene locus_tag LOCUS_01490 175 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 1587 985 gene locus_tag LOCUS_01500 1587 985 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175439.1 protein_id gnl|my_center|LOCUS_01500 1676 2548 gene locus_tag LOCUS_01510 1676 2548 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 protein_id gnl|my_center|LOCUS_01510 5079 2572 gene locus_tag LOCUS_01520 5079 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6528 5095 gene locus_tag LOCUS_01530 6528 5095 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_01530 7036 6752 gene locus_tag LOCUS_01540 7036 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 8432 7758 gene locus_tag LOCUS_01550 8432 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 10222 9335 gene locus_tag LOCUS_01560 10222 9335 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 protein_id gnl|my_center|LOCUS_01560 12123 10219 gene locus_tag LOCUS_01570 12123 10219 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179844.1 protein_id gnl|my_center|LOCUS_01570 12807 12127 gene locus_tag LOCUS_01580 12807 12127 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223862839.1 protein_id gnl|my_center|LOCUS_01580 12906 13529 gene locus_tag LOCUS_01590 12906 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 14427 13555 gene locus_tag LOCUS_01600 14427 13555 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202928.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence011 1110 442 gene locus_tag LOCUS_01610 1110 442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_01610 1157 2083 gene locus_tag LOCUS_01620 gene fieF 1157 2083 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 protein_id gnl|my_center|LOCUS_01620 2088 2669 gene locus_tag LOCUS_01630 2088 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_01630 2767 4044 gene locus_tag LOCUS_01640 2767 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4057 6444 gene locus_tag LOCUS_01650 gene lon 4057 6444 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_01650 6462 8438 gene locus_tag LOCUS_01660 6462 8438 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_01660 8804 9580 gene locus_tag LOCUS_01670 8804 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 10480 9665 gene locus_tag LOCUS_01680 10480 9665 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_01680 11440 10514 gene locus_tag LOCUS_01690 gene xerD 11440 10514 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_01690 11957 11418 gene locus_tag LOCUS_01700 11957 11418 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_01700 12323 11979 gene locus_tag LOCUS_01710 gene rplS 12323 11979 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_01710 13138 12410 gene locus_tag LOCUS_01720 gene trmD 13138 12410 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_01720 13641 13138 gene locus_tag LOCUS_01730 gene rimM 13641 13138 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_01730 13950 13696 gene locus_tag LOCUS_01740 gene rpsP 13950 13696 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 protein_id gnl|my_center|LOCUS_01740 14325 14101 gene locus_tag LOCUS_01750 14325 14101 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_01750 14668 14318 gene locus_tag LOCUS_01760 14668 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 >Feature sequence012 <1 1962 gene locus_tag LOCUS_01770 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC 2329 2012 gene locus_tag LOCUS_01780 2329 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2418 3293 gene locus_tag LOCUS_01790 2418 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3369 5039 gene locus_tag LOCUS_01800 3369 5039 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_01800 5164 6129 gene locus_tag LOCUS_01810 5164 6129 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_01810 6137 7657 gene locus_tag LOCUS_01820 6137 7657 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_01820 7654 11130 gene locus_tag LOCUS_01830 gene dnaE 7654 11130 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_01830 11785 11201 gene locus_tag LOCUS_01840 gene rrtA 11785 11201 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 protein_id gnl|my_center|LOCUS_01840 12555 11788 gene locus_tag LOCUS_01850 gene map 12555 11788 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_01850 12891 13673 gene locus_tag LOCUS_01860 gene rpsB 12891 13673 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947441.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence013 4095 1084 gene locus_tag LOCUS_01870 4095 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 5101 4127 gene locus_tag LOCUS_01880 5101 4127 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_01880 6165 5104 gene locus_tag LOCUS_01890 gene pdhA 6165 5104 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_01890 6309 7841 gene locus_tag LOCUS_01900 6309 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 7845 8861 gene locus_tag LOCUS_01910 7845 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8863 9903 gene locus_tag LOCUS_01920 gene pyrC 8863 9903 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073490.1 protein_id gnl|my_center|LOCUS_01920 9900 10529 gene locus_tag LOCUS_01930 gene rnt 9900 10529 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036706.1 protein_id gnl|my_center|LOCUS_01930 10925 10662 gene locus_tag LOCUS_01940 10925 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 12923 11886 gene locus_tag LOCUS_01950 gene fba 12923 11886 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_01950 <14159 13001 gene locus_tag LOCUS_01960 <14159 13001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188973.1:pyruvate kinase >Feature sequence014 492 1553 gene locus_tag LOCUS_01970 492 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1607 7780 gene locus_tag LOCUS_01980 1607 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 7905 10055 gene locus_tag LOCUS_01990 7905 10055 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_01990 10477 10094 gene locus_tag LOCUS_02000 10477 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 13293 10492 gene locus_tag LOCUS_02010 13293 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 <13873 13303 gene locus_tag LOCUS_02020 <13873 13303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105355.1:class I SAM-dependent methyltransferase >Feature sequence015 7520 6165 gene locus_tag LOCUS_02030 7520 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8852 7554 gene locus_tag LOCUS_02040 8852 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 9955 9311 gene locus_tag LOCUS_02050 9955 9311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_02050 11697 9955 gene locus_tag LOCUS_02060 11697 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 12389 11901 gene locus_tag LOCUS_02070 12389 11901 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_02070 13155 12382 gene locus_tag LOCUS_02080 gene cysZ 13155 12382 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_02080 <13725 13152 gene locus_tag LOCUS_02090 <13725 13152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091390.1:tRNA pseudouridine(38-40) synthase TruA >Feature sequence016 825 433 gene locus_tag LOCUS_02100 825 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1132 812 gene locus_tag LOCUS_02110 1132 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1408 1229 gene locus_tag LOCUS_02120 1408 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2471 1503 gene locus_tag LOCUS_02130 gene galE 2471 1503 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_02130 3655 2483 gene locus_tag LOCUS_02140 3655 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 4777 3668 gene locus_tag LOCUS_02150 4777 3668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704481.1 protein_id gnl|my_center|LOCUS_02150 5716 4787 gene locus_tag LOCUS_02160 5716 4787 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_02160 6933 5713 gene locus_tag LOCUS_02170 6933 5713 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241993.1 protein_id gnl|my_center|LOCUS_02170 8180 6930 gene locus_tag LOCUS_02180 8180 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9127 8192 gene locus_tag LOCUS_02190 9127 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11119 10223 gene locus_tag LOCUS_02200 11119 10223 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254254.1 protein_id gnl|my_center|LOCUS_02200 12485 11175 gene locus_tag LOCUS_02210 12485 11175 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478324.1 protein_id gnl|my_center|LOCUS_02210 13119 12721 gene locus_tag LOCUS_02220 13119 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence017 1126 278 gene locus_tag LOCUS_02230 gene atpB 1126 278 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_02230 1522 1136 gene locus_tag LOCUS_02240 1522 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 1749 1522 gene locus_tag LOCUS_02250 1749 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2689 1811 gene locus_tag LOCUS_02260 2689 1811 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_02260 3459 2689 gene locus_tag LOCUS_02270 gene soj 3459 2689 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_02270 4112 3456 gene locus_tag LOCUS_02280 gene rsmG 4112 3456 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652031.1 protein_id gnl|my_center|LOCUS_02280 4486 4112 gene locus_tag LOCUS_02290 4486 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 6348 4489 gene locus_tag LOCUS_02300 gene thiC 6348 4489 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_02300 6501 7343 gene locus_tag LOCUS_02310 gene serB 6501 7343 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_02310 7372 8343 gene locus_tag LOCUS_02320 7372 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8375 10333 gene locus_tag LOCUS_02330 gene xcpQ 8375 10333 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_02330 10337 11857 gene locus_tag LOCUS_02340 gene xcpR 10337 11857 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_02340 11870 13087 gene locus_tag LOCUS_02350 gene xcpS 11870 13087 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence018 2145 1 gene locus_tag LOCUS_02360 2145 1 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093473135.1 protein_id gnl|my_center|LOCUS_02360 2748 2170 gene locus_tag LOCUS_02370 2748 2170 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_02370 3340 2753 gene locus_tag LOCUS_02380 gene pilO 3340 2753 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_02380 3898 3350 gene locus_tag LOCUS_02390 3898 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 4958 3882 gene locus_tag LOCUS_02400 4958 3882 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_02400 6928 5099 gene locus_tag LOCUS_02410 gene glmS 6928 5099 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 protein_id gnl|my_center|LOCUS_02410 8323 6932 gene locus_tag LOCUS_02420 gene glmU 8323 6932 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 protein_id gnl|my_center|LOCUS_02420 8817 8395 gene locus_tag LOCUS_02430 8817 8395 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_02430 10230 8833 gene locus_tag LOCUS_02440 gene atpD 10230 8833 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 protein_id gnl|my_center|LOCUS_02440 11130 10270 gene locus_tag LOCUS_02450 gene atpG 11130 10270 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_02450 12712 11171 gene locus_tag LOCUS_02460 gene atpA 12712 11171 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence019 437 117 gene locus_tag LOCUS_02470 437 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 631 831 gene locus_tag LOCUS_02480 631 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1291 836 gene locus_tag LOCUS_02490 1291 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1781 1284 gene locus_tag LOCUS_02500 1781 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2298 1786 gene locus_tag LOCUS_02510 2298 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 2890 2300 gene locus_tag LOCUS_02520 2890 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3726 2992 gene locus_tag LOCUS_02530 3726 2992 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_02530 4023 5561 gene locus_tag LOCUS_02540 gene murJ 4023 5561 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_02540 5571 6509 gene locus_tag LOCUS_02550 gene ribF 5571 6509 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_02550 6519 9356 gene locus_tag LOCUS_02560 gene ileS 6519 9356 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073365.1 protein_id gnl|my_center|LOCUS_02560 9372 9845 gene locus_tag LOCUS_02570 gene lspA 9372 9845 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_02570 9958 10797 gene locus_tag LOCUS_02580 gene ispH 9958 10797 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_02580 10843 11661 gene locus_tag LOCUS_02590 10843 11661 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_02590 <12740 11712 gene locus_tag LOCUS_02600 <12740 11712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868962.1:cysteine desulfurase NifS >Feature sequence020 288 4328 gene locus_tag LOCUS_02610 288 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4465 8277 gene locus_tag LOCUS_02620 4465 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8472 9767 gene locus_tag LOCUS_02630 8472 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10670 9789 gene locus_tag LOCUS_02640 gene bioB 10670 9789 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_02640 10851 11873 gene locus_tag LOCUS_02650 10851 11873 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence021 2682 2594 gene locus_tag LOCUS_t00010 2682 2594 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2777 2704 gene locus_tag LOCUS_t00020 2777 2704 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2882 2807 gene locus_tag LOCUS_t00030 2882 2807 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3616 2933 gene locus_tag LOCUS_02660 3616 2933 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_02660 5065 3638 gene locus_tag LOCUS_02670 gene mucD 5065 3638 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_02670 5548 5102 gene locus_tag LOCUS_02680 gene mucC 5548 5102 CDS product alginate biosynthesis regulator MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_02680 6133 5552 gene locus_tag LOCUS_02690 6133 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6736 6164 gene locus_tag LOCUS_02700 gene rpoE 6736 6164 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_02700 6832 8487 gene locus_tag LOCUS_02710 gene nadB 6832 8487 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405338.1 protein_id gnl|my_center|LOCUS_02710 8885 8484 gene locus_tag LOCUS_02720 8885 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9006 10766 gene locus_tag LOCUS_02730 9006 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 <12206 10772 gene locus_tag LOCUS_02740 <12206 10772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005493728.1:endopeptidase La >Feature sequence022 564 235 gene locus_tag LOCUS_02750 564 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 894 574 gene locus_tag LOCUS_02760 894 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1589 978 gene locus_tag LOCUS_02770 1589 978 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919634.1 protein_id gnl|my_center|LOCUS_02770 2657 1857 gene locus_tag LOCUS_02780 2657 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3138 3305 gene locus_tag LOCUS_02790 3138 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5793 4552 gene locus_tag LOCUS_02800 5793 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6500 5805 gene locus_tag LOCUS_02810 6500 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6963 7712 gene locus_tag LOCUS_02820 6963 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 7709 8548 gene locus_tag LOCUS_02830 7709 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8578 9159 gene locus_tag LOCUS_02840 8578 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10900 11400 gene locus_tag LOCUS_02850 10900 11400 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence023 3 1103 gene locus_tag LOCUS_02860 3 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 1963 1163 gene locus_tag LOCUS_02870 gene suhB 1963 1163 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380594.1 protein_id gnl|my_center|LOCUS_02870 2045 2773 gene locus_tag LOCUS_02880 gene trmJ 2045 2773 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958024.1 protein_id gnl|my_center|LOCUS_02880 2777 3514 gene locus_tag LOCUS_02890 gene cysE 2777 3514 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_02890 3688 4011 gene locus_tag LOCUS_02900 gene clpS 3688 4011 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_02900 4013 6280 gene locus_tag LOCUS_02910 gene clpA 4013 6280 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213323.1 protein_id gnl|my_center|LOCUS_02910 6495 6277 gene locus_tag LOCUS_02920 gene infA 6495 6277 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770719.1 protein_id gnl|my_center|LOCUS_02920 7684 6794 gene locus_tag LOCUS_02930 7684 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 9031 7736 gene locus_tag LOCUS_02940 9031 7736 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036840.1 protein_id gnl|my_center|LOCUS_02940 9703 9056 gene locus_tag LOCUS_02950 9703 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10325 9705 gene locus_tag LOCUS_02960 10325 9705 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_02960 11259 10501 gene locus_tag LOCUS_02970 11259 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 11396 11551 gene locus_tag LOCUS_02980 11396 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence024 1474 356 gene locus_tag LOCUS_02990 1474 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3473 1761 gene locus_tag LOCUS_03000 3473 1761 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_03000 4931 3480 gene locus_tag LOCUS_03010 4931 3480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_03010 5221 5751 gene locus_tag LOCUS_03020 gene moaB 5221 5751 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617455.1 protein_id gnl|my_center|LOCUS_03020 5768 6994 gene locus_tag LOCUS_03030 5768 6994 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_03030 7004 7579 gene locus_tag LOCUS_03040 gene mobA 7004 7579 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213171.1 protein_id gnl|my_center|LOCUS_03040 7937 8929 gene locus_tag LOCUS_03050 7937 8929 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013653377.1 protein_id gnl|my_center|LOCUS_03050 8977 9321 gene locus_tag LOCUS_03060 8977 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence025 2760 172 gene locus_tag LOCUS_03070 gene clpB 2760 172 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_03070 2960 3619 gene locus_tag LOCUS_03080 2960 3619 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947023.1 protein_id gnl|my_center|LOCUS_03080 3708 5054 gene locus_tag LOCUS_03090 3708 5054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770760.1 protein_id gnl|my_center|LOCUS_03090 5821 5051 gene locus_tag LOCUS_03100 5821 5051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_03100 6747 5818 gene locus_tag LOCUS_03110 6747 5818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_03110 6841 7122 gene locus_tag LOCUS_03120 6841 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 7094 9022 gene locus_tag LOCUS_03130 7094 9022 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_03130 9019 9708 gene locus_tag LOCUS_03140 gene tsaB 9019 9708 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 protein_id gnl|my_center|LOCUS_03140 9787 10383 gene locus_tag LOCUS_03150 9787 10383 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence026 <1 1052 gene locus_tag LOCUS_03160 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070440.1:TrkH family potassium uptake protein 1059 1670 gene locus_tag LOCUS_03170 1059 1670 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_03170 1673 2233 gene locus_tag LOCUS_03180 1673 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3093 2230 gene locus_tag LOCUS_03190 gene metF 3093 2230 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_03190 4581 3163 gene locus_tag LOCUS_03200 gene ahcY 4581 3163 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 protein_id gnl|my_center|LOCUS_03200 5782 4613 gene locus_tag LOCUS_03210 gene metK 5782 4613 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 protein_id gnl|my_center|LOCUS_03210 6079 6642 gene locus_tag LOCUS_03220 6079 6642 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_03220 6798 8786 gene locus_tag LOCUS_03230 gene tkt 6798 8786 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 protein_id gnl|my_center|LOCUS_03230 8830 9831 gene locus_tag LOCUS_03240 gene gap 8830 9831 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_03240 9967 11148 gene locus_tag LOCUS_03250 9967 11148 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence027 132 1685 gene locus_tag LOCUS_03260 gene purH 132 1685 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 protein_id gnl|my_center|LOCUS_03260 1701 2987 gene locus_tag LOCUS_03270 gene purD 1701 2987 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_03270 3007 3516 gene locus_tag LOCUS_03280 gene purE 3007 3516 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_03280 3519 4067 gene locus_tag LOCUS_03290 3519 4067 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 protein_id gnl|my_center|LOCUS_03290 4106 5026 gene locus_tag LOCUS_03300 gene hemF 4106 5026 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 protein_id gnl|my_center|LOCUS_03300 5138 5509 gene locus_tag LOCUS_03310 5138 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6071 5598 gene locus_tag LOCUS_03320 6071 5598 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 protein_id gnl|my_center|LOCUS_03320 7024 6068 gene locus_tag LOCUS_03330 7024 6068 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_03330 7725 7312 gene locus_tag LOCUS_03340 7725 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 11404 7715 gene locus_tag LOCUS_03350 gene metH 11404 7715 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095026.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence028 137 871 gene locus_tag LOCUS_03360 137 871 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_03360 1428 892 gene locus_tag LOCUS_03370 1428 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2464 1535 gene locus_tag LOCUS_03380 2464 1535 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_03380 2934 4475 gene locus_tag LOCUS_03390 2934 4475 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_03390 4517 5176 gene locus_tag LOCUS_03400 4517 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5241 5687 gene locus_tag LOCUS_03410 5241 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6643 5744 gene locus_tag LOCUS_03420 6643 5744 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_03420 6791 8194 gene locus_tag LOCUS_03430 6791 8194 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390153.1 protein_id gnl|my_center|LOCUS_03430 8353 9159 gene locus_tag LOCUS_03440 8353 9159 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970966.1 protein_id gnl|my_center|LOCUS_03440 9224 9233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9308 11485 gene locus_tag LOCUS_03450 9308 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence029 5178 5936 gene locus_tag LOCUS_03460 gene pssA 5178 5936 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_03460 6673 5933 gene locus_tag LOCUS_03470 6673 5933 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268329.1 protein_id gnl|my_center|LOCUS_03470 7228 6686 gene locus_tag LOCUS_03480 7228 6686 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_03480 7552 7292 gene locus_tag LOCUS_03490 7552 7292 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945172.1 protein_id gnl|my_center|LOCUS_03490 7849 7646 gene locus_tag LOCUS_03500 7849 7646 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 protein_id gnl|my_center|LOCUS_03500 9592 8063 gene locus_tag LOCUS_03510 9592 8063 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461421.1 protein_id gnl|my_center|LOCUS_03510 10647 9901 gene locus_tag LOCUS_03520 10647 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11048 10788 gene locus_tag LOCUS_03530 11048 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence030 2 580 gene locus_tag LOCUS_03540 2 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 601 1809 gene locus_tag LOCUS_03550 601 1809 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_03550 3165 1837 gene locus_tag LOCUS_03560 3165 1837 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_03560 4023 3175 gene locus_tag LOCUS_03570 4023 3175 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_03570 4561 4013 gene locus_tag LOCUS_03580 4561 4013 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_03580 6022 4568 gene locus_tag LOCUS_03590 gene rng 6022 4568 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_03590 6609 6019 gene locus_tag LOCUS_03600 6609 6019 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105015.1 protein_id gnl|my_center|LOCUS_03600 7079 6609 gene locus_tag LOCUS_03610 gene rlmH 7079 6609 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776107.1 protein_id gnl|my_center|LOCUS_03610 7426 7076 gene locus_tag LOCUS_03620 gene rsfS 7426 7076 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_03620 8042 7428 gene locus_tag LOCUS_03630 gene nadD 8042 7428 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_03630 9327 8062 gene locus_tag LOCUS_03640 9327 8062 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_03640 10364 9351 gene locus_tag LOCUS_03650 gene holA 10364 9351 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_03650 10867 10361 gene locus_tag LOCUS_03660 gene lptE 10867 10361 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947077.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence031 1679 990 gene locus_tag LOCUS_03670 1679 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1052 1061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3478 1769 gene locus_tag LOCUS_03680 3478 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192726.1 protein_id gnl|my_center|LOCUS_03680 3611 4420 gene locus_tag LOCUS_03690 3611 4420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_03690 4489 4788 gene locus_tag LOCUS_03700 4489 4788 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946328.1 protein_id gnl|my_center|LOCUS_03700 4801 6324 gene locus_tag LOCUS_03710 4801 6324 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_03710 6321 7064 gene locus_tag LOCUS_03720 6321 7064 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_03720 7508 7077 gene locus_tag LOCUS_03730 7508 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7604 8356 gene locus_tag LOCUS_03740 gene surE 7604 8356 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_03740 8353 9417 gene locus_tag LOCUS_03750 8353 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 <10880 9425 gene locus_tag LOCUS_03760 <10880 9425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123134.1:mercuric reductase >Feature sequence032 1286 453 gene locus_tag LOCUS_03770 gene proC 1286 453 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_03770 1979 1317 gene locus_tag LOCUS_03780 1979 1317 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_03780 2074 3108 gene locus_tag LOCUS_03790 2074 3108 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_03790 3767 3105 gene locus_tag LOCUS_03800 3767 3105 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_03800 3859 4344 gene locus_tag LOCUS_03810 3859 4344 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 protein_id gnl|my_center|LOCUS_03810 6147 4360 gene locus_tag LOCUS_03820 gene aspS 6147 4360 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_03820 6440 6159 gene locus_tag LOCUS_03830 6440 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 6923 6531 gene locus_tag LOCUS_03840 6923 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_03840 8057 6960 gene locus_tag LOCUS_03850 gene tgt 8057 6960 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021291.1 protein_id gnl|my_center|LOCUS_03850 9094 8054 gene locus_tag LOCUS_03860 gene queA 9094 8054 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 protein_id gnl|my_center|LOCUS_03860 9210 9285 gene locus_tag LOCUS_t00040 9210 9285 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9350 9436 gene locus_tag LOCUS_t00050 9350 9436 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10390 9446 gene locus_tag LOCUS_03870 10390 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 10360 10369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence033 2239 1760 gene locus_tag LOCUS_03880 gene rimI 2239 1760 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_03880 2345 2920 gene locus_tag LOCUS_03890 2345 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2914 3495 gene locus_tag LOCUS_03900 2914 3495 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797827.1 protein_id gnl|my_center|LOCUS_03900 3492 4091 gene locus_tag LOCUS_03910 3492 4091 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_03910 4140 6476 gene locus_tag LOCUS_03920 4140 6476 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_03920 6442 7242 gene locus_tag LOCUS_03930 6442 7242 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_03930 7232 8434 gene locus_tag LOCUS_03940 7232 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_03940 8437 9276 gene locus_tag LOCUS_03950 8437 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 9283 10305 gene locus_tag LOCUS_03960 9283 10305 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_03960 10292 10798 gene locus_tag LOCUS_03970 10292 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence034 3563 1482 gene locus_tag LOCUS_03980 3563 1482 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_03980 4867 3560 gene locus_tag LOCUS_03990 4867 3560 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_03990 7299 4864 gene locus_tag LOCUS_04000 7299 4864 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947452.1 protein_id gnl|my_center|LOCUS_04000 8165 7296 gene locus_tag LOCUS_04010 8165 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_04010 8452 8327 gene locus_tag LOCUS_04020 8452 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 9411 8596 gene locus_tag LOCUS_04030 9411 8596 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_04030 9584 9868 gene locus_tag LOCUS_04040 9584 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence035 2053 3102 gene locus_tag LOCUS_04050 2053 3102 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_04050 3186 6221 gene locus_tag LOCUS_04060 3186 6221 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_04060 6237 8306 gene locus_tag LOCUS_04070 gene metG 6237 8306 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_04070 8431 9021 gene locus_tag LOCUS_04080 gene rsxA 8431 9021 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072471.1 protein_id gnl|my_center|LOCUS_04080 9025 9573 gene locus_tag LOCUS_04090 gene rsxB 9025 9573 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence036 2082 490 gene locus_tag LOCUS_04100 2082 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2319 2468 gene locus_tag LOCUS_04110 2319 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2481 3098 gene locus_tag LOCUS_04120 gene lexA 2481 3098 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897067.1 protein_id gnl|my_center|LOCUS_04120 5021 3123 gene locus_tag LOCUS_04130 gene mnmG 5021 3123 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074340.1 protein_id gnl|my_center|LOCUS_04130 5528 5046 gene locus_tag LOCUS_04140 5528 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7195 5522 gene locus_tag LOCUS_04150 7195 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 7419 7237 gene locus_tag LOCUS_04160 7419 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7534 8160 gene locus_tag LOCUS_04170 7534 8160 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_04170 8174 8647 gene locus_tag LOCUS_04180 8174 8647 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_04180 9059 9379 gene locus_tag LOCUS_04190 9059 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 9713 9453 gene locus_tag LOCUS_04200 9713 9453 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_04200 10009 9710 gene locus_tag LOCUS_04210 10009 9710 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261655.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence037 2368 1343 gene locus_tag LOCUS_04220 2368 1343 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_04220 2507 3406 gene locus_tag LOCUS_04230 gene oxyR 2507 3406 CDS product hydrogen peroxide-inducible genes transcriptional activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 protein_id gnl|my_center|LOCUS_04230 3517 4719 gene locus_tag LOCUS_04240 3517 4719 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_04240 4747 5454 gene locus_tag LOCUS_04250 4747 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5451 6092 gene locus_tag LOCUS_04260 5451 6092 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_04260 6126 7082 gene locus_tag LOCUS_04270 6126 7082 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_04270 7079 7864 gene locus_tag LOCUS_04280 7079 7864 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598575.1 protein_id gnl|my_center|LOCUS_04280 7867 8940 gene locus_tag LOCUS_04290 7867 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9808 8981 gene locus_tag LOCUS_04300 9808 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence038 1046 483 gene locus_tag LOCUS_04310 gene rfbC 1046 483 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_04310 1489 1046 gene locus_tag LOCUS_04320 1489 1046 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_04320 1872 1474 gene locus_tag LOCUS_04330 1872 1474 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 protein_id gnl|my_center|LOCUS_04330 4113 1888 gene locus_tag LOCUS_04340 4113 1888 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 protein_id gnl|my_center|LOCUS_04340 5296 4145 gene locus_tag LOCUS_04350 5296 4145 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 protein_id gnl|my_center|LOCUS_04350 5748 5323 gene locus_tag LOCUS_04360 5748 5323 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 protein_id gnl|my_center|LOCUS_04360 7355 6102 gene locus_tag LOCUS_04370 gene lysA 7355 6102 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_04370 8702 7485 gene locus_tag LOCUS_04380 gene sat 8702 7485 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_04380 <10119 8770 gene locus_tag LOCUS_04390 <10119 8770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001889848.1:exopolysaccharide biosynthesis glycosyltransferase VpsL >Feature sequence039 31 426 gene locus_tag LOCUS_04400 31 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1392 1009 gene locus_tag LOCUS_04410 gene gloA 1392 1009 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124389.1 protein_id gnl|my_center|LOCUS_04410 2218 1421 gene locus_tag LOCUS_04420 gene speD 2218 1421 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_04420 2635 2225 gene locus_tag LOCUS_04430 2635 2225 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_04430 3050 2625 gene locus_tag LOCUS_04440 3050 2625 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_04440 3867 3070 gene locus_tag LOCUS_04450 gene trpC 3867 3070 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767891.1 protein_id gnl|my_center|LOCUS_04450 4899 3874 gene locus_tag LOCUS_04460 gene trpD 4899 3874 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_04460 5486 4896 gene locus_tag LOCUS_04470 5486 4896 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_04470 6977 5499 gene locus_tag LOCUS_04480 gene trpE 6977 5499 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_04480 7591 6977 gene locus_tag LOCUS_04490 gene can 7591 6977 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_04490 8282 7611 gene locus_tag LOCUS_04500 8282 7611 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 protein_id gnl|my_center|LOCUS_04500 8956 8282 gene locus_tag LOCUS_04510 gene rpe 8956 8282 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_04510 <10048 9057 gene locus_tag LOCUS_04520 <10048 9057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000453372.1:membrane protein >Feature sequence040 2286 3242 gene locus_tag LOCUS_04530 gene trxB 2286 3242 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_04530 3261 4226 gene locus_tag LOCUS_04540 3261 4226 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_04540 4391 5419 gene locus_tag LOCUS_04550 gene recA 4391 5419 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_04550 5440 5880 gene locus_tag LOCUS_04560 gene recX 5440 5880 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688187.1 protein_id gnl|my_center|LOCUS_04560 5884 8133 gene locus_tag LOCUS_04570 gene alaS 5884 8133 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947525.1 protein_id gnl|my_center|LOCUS_04570 8095 8104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8147 8335 gene locus_tag LOCUS_04580 8147 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 8340 9566 gene locus_tag LOCUS_04590 8340 9566 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_04590 9648 9739 gene locus_tag LOCUS_t00060 9648 9739 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9755 9831 gene locus_tag LOCUS_t00070 9755 9831 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 387 758 gene locus_tag LOCUS_04600 387 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1013 2182 gene locus_tag LOCUS_04610 1013 2182 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 protein_id gnl|my_center|LOCUS_04610 2193 2696 gene locus_tag LOCUS_04620 2193 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2728 2871 gene locus_tag LOCUS_04630 2728 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2868 3110 gene locus_tag LOCUS_04640 2868 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3563 3186 gene locus_tag LOCUS_04650 3563 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 3562 5646 gene locus_tag LOCUS_04660 3562 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5636 6040 gene locus_tag LOCUS_04670 5636 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6037 6246 gene locus_tag LOCUS_04680 6037 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6249 7208 gene locus_tag LOCUS_04690 6249 7208 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113193.1 protein_id gnl|my_center|LOCUS_04690 7540 8748 gene locus_tag LOCUS_04700 7540 8748 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098087.1 protein_id gnl|my_center|LOCUS_04700 8882 9055 gene locus_tag LOCUS_04710 8882 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 9027 9560 gene locus_tag LOCUS_04720 9027 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence042 1511 471 gene locus_tag LOCUS_04730 1511 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 2270 1692 gene locus_tag LOCUS_04740 2270 1692 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 protein_id gnl|my_center|LOCUS_04740 1704 1713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3464 2364 gene locus_tag LOCUS_04750 3464 2364 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728054.1 protein_id gnl|my_center|LOCUS_04750 4265 3498 gene locus_tag LOCUS_04760 4265 3498 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_04760 4741 4265 gene locus_tag LOCUS_04770 4741 4265 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929580.1 protein_id gnl|my_center|LOCUS_04770 5911 4817 gene locus_tag LOCUS_04780 5911 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_04780 6455 6081 gene locus_tag LOCUS_04790 6455 6081 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180940249.1 protein_id gnl|my_center|LOCUS_04790 7330 6494 gene locus_tag LOCUS_04800 7330 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 7510 7767 gene locus_tag LOCUS_04810 7510 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 <9816 8222 gene locus_tag LOCUS_04820 <9816 8222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968641.1:acyl-CoA dehydrogenase C-terminal domain-containing protein >Feature sequence043 205 579 gene locus_tag LOCUS_04830 205 579 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_04830 751 1899 gene locus_tag LOCUS_04840 751 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2408 1896 gene locus_tag LOCUS_04850 gene folA 2408 1896 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_04850 3217 2423 gene locus_tag LOCUS_04860 3217 2423 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_04860 4005 3214 gene locus_tag LOCUS_04870 gene lgt 4005 3214 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_04870 4071 4496 gene locus_tag LOCUS_04880 4071 4496 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888099.1 protein_id gnl|my_center|LOCUS_04880 4599 5975 gene locus_tag LOCUS_04890 4599 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6116 7480 gene locus_tag LOCUS_04900 6116 7480 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_04900 7511 8143 gene locus_tag LOCUS_04910 7511 8143 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_04910 8160 8636 gene locus_tag LOCUS_04920 gene trmL 8160 8636 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459569.1 protein_id gnl|my_center|LOCUS_04920 8643 9581 gene locus_tag LOCUS_04930 8643 9581 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence044 <1 1190 gene locus_tag LOCUS_04940 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771609.1:elongation factor Tu 1196 1507 gene locus_tag LOCUS_04950 gene rpsJ 1196 1507 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181007.1 protein_id gnl|my_center|LOCUS_04950 1518 2156 gene locus_tag LOCUS_04960 gene rplC 1518 2156 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 protein_id gnl|my_center|LOCUS_04960 2174 2788 gene locus_tag LOCUS_04970 gene rplD 2174 2788 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 protein_id gnl|my_center|LOCUS_04970 2785 3075 gene locus_tag LOCUS_04980 gene rplW 2785 3075 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_04980 3092 3919 gene locus_tag LOCUS_04990 gene rplB 3092 3919 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397049.1 protein_id gnl|my_center|LOCUS_04990 3934 4206 gene locus_tag LOCUS_05000 gene rpsS 3934 4206 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_05000 4223 4555 gene locus_tag LOCUS_05010 gene rplV 4223 4555 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027193.1 protein_id gnl|my_center|LOCUS_05010 4565 5239 gene locus_tag LOCUS_05020 gene rpsC 4565 5239 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_05020 5255 5665 gene locus_tag LOCUS_05030 gene rplP 5255 5665 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 protein_id gnl|my_center|LOCUS_05030 5666 5848 gene locus_tag LOCUS_05040 gene rpmC 5666 5848 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625888.1 protein_id gnl|my_center|LOCUS_05040 5861 6124 gene locus_tag LOCUS_05050 gene rpsQ 5861 6124 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_05050 6163 6531 gene locus_tag LOCUS_05060 gene rplN 6163 6531 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_05060 6568 6888 gene locus_tag LOCUS_05070 gene rplX 6568 6888 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 protein_id gnl|my_center|LOCUS_05070 6903 7442 gene locus_tag LOCUS_05080 gene rplE 6903 7442 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 protein_id gnl|my_center|LOCUS_05080 7452 7757 gene locus_tag LOCUS_05090 gene rpsN 7452 7757 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_05090 7770 8168 gene locus_tag LOCUS_05100 gene rpsH 7770 8168 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_05100 8178 8708 gene locus_tag LOCUS_05110 gene rplF 8178 8708 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_05110 8711 9073 gene locus_tag LOCUS_05120 gene rplR 8711 9073 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014360.1 protein_id gnl|my_center|LOCUS_05120 9095 9619 gene locus_tag LOCUS_05130 gene rpsE 9095 9619 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence045 <1 1029 gene locus_tag LOCUS_05140 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000138976.1:uroporphyrinogen-III C-methyltransferase 1026 2234 gene locus_tag LOCUS_05150 1026 2234 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_05150 2365 3210 gene locus_tag LOCUS_05160 gene rpoH 2365 3210 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421372.1 protein_id gnl|my_center|LOCUS_05160 3363 4400 gene locus_tag LOCUS_05170 3363 4400 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_05170 4458 5315 gene locus_tag LOCUS_05180 gene hpnD 4458 5315 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_05180 5335 6624 gene locus_tag LOCUS_05190 gene hpnE 5335 6624 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_05190 7182 6616 gene locus_tag LOCUS_05200 7182 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7462 7175 gene locus_tag LOCUS_05210 7462 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7700 7374 gene locus_tag LOCUS_05220 7700 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9281 7887 gene locus_tag LOCUS_05230 gene hemN 9281 7887 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_05230 9730 9284 gene locus_tag LOCUS_05240 9730 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence046 101 475 gene locus_tag LOCUS_05250 101 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 484 2739 gene locus_tag LOCUS_05260 gene rlmKL 484 2739 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_05260 2724 2927 gene locus_tag LOCUS_05270 2724 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2956 5454 gene locus_tag LOCUS_05280 2956 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6065 5466 gene locus_tag LOCUS_05290 6065 5466 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_05290 6489 6067 gene locus_tag LOCUS_05300 6489 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015694.1 protein_id gnl|my_center|LOCUS_05300 6675 6965 gene locus_tag LOCUS_05310 6675 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 7008 8645 gene locus_tag LOCUS_05320 7008 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 9304 8753 gene locus_tag LOCUS_05330 9304 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence047 4271 84 gene locus_tag LOCUS_05340 gene rpoC 4271 84 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_05340 2053 2062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8372 4320 gene locus_tag LOCUS_05350 gene rpoB 8372 4320 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_05350 8863 8486 gene locus_tag LOCUS_05360 gene rplL 8863 8486 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence048 733 86 gene locus_tag LOCUS_05370 733 86 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260948.1 protein_id gnl|my_center|LOCUS_05370 868 1992 gene locus_tag LOCUS_05380 868 1992 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_05380 1983 5036 gene locus_tag LOCUS_05390 1983 5036 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_05390 6393 5017 gene locus_tag LOCUS_05400 gene mgtE 6393 5017 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_05400 7345 6452 gene locus_tag LOCUS_05410 7345 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8412 7357 gene locus_tag LOCUS_05420 gene hemE 8412 7357 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_05420 <9145 8428 gene locus_tag LOCUS_05430 <9145 8428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039203.1:orotidine-5'-phosphate decarboxylase >Feature sequence049 528 151 gene locus_tag LOCUS_05440 528 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 917 591 gene locus_tag LOCUS_05450 917 591 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 protein_id gnl|my_center|LOCUS_05450 2361 1075 gene locus_tag LOCUS_05460 gene hemL 2361 1075 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_05460 2991 2362 gene locus_tag LOCUS_05470 gene thiE 2991 2362 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_05470 3775 2981 gene locus_tag LOCUS_05480 3775 2981 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_05480 3799 3963 gene locus_tag LOCUS_05490 3799 3963 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947264.1 protein_id gnl|my_center|LOCUS_05490 4905 4252 gene locus_tag LOCUS_05500 4905 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 5239 5946 gene locus_tag LOCUS_05510 5239 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972674.1 protein_id gnl|my_center|LOCUS_05510 6049 6447 gene locus_tag LOCUS_05520 6049 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6450 7082 gene locus_tag LOCUS_05530 gene xcpW 6450 7082 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_05530 7069 8073 gene locus_tag LOCUS_05540 gene xcpX 7069 8073 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence050 117 632 gene locus_tag LOCUS_05550 117 632 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_05550 653 1636 gene locus_tag LOCUS_05560 gene lpxD 653 1636 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_05560 1644 2108 gene locus_tag LOCUS_05570 gene fabZ 1644 2108 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 protein_id gnl|my_center|LOCUS_05570 2126 2923 gene locus_tag LOCUS_05580 gene lpxA 2126 2923 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946259.1 protein_id gnl|my_center|LOCUS_05580 2930 4084 gene locus_tag LOCUS_05590 gene lpxB 2930 4084 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869121.1 protein_id gnl|my_center|LOCUS_05590 4091 4861 gene locus_tag LOCUS_05600 4091 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5759 4899 gene locus_tag LOCUS_05610 5759 4899 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_05610 5930 7270 gene locus_tag LOCUS_05620 gene hflK 5930 7270 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262723.1 protein_id gnl|my_center|LOCUS_05620 7272 8150 gene locus_tag LOCUS_05630 gene hflC 7272 8150 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_05630 8174 8359 gene locus_tag LOCUS_05640 8174 8359 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence051 172 375 gene locus_tag LOCUS_05650 gene rpmE 172 375 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_05650 497 2008 gene locus_tag LOCUS_05660 497 2008 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_05660 3450 2017 gene locus_tag LOCUS_05670 gene gatB 3450 2017 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_05670 4933 3479 gene locus_tag LOCUS_05680 gene gatA 4933 3479 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_05680 5238 4951 gene locus_tag LOCUS_05690 gene gatC 5238 4951 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_05690 5382 6428 gene locus_tag LOCUS_05700 gene mreB 5382 6428 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_05700 6577 7341 gene locus_tag LOCUS_05710 6577 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 8588 7338 gene locus_tag LOCUS_05720 8588 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence052 2106 1204 gene locus_tag LOCUS_05730 2106 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2330 2106 gene locus_tag LOCUS_05740 2330 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3148 3420 gene locus_tag LOCUS_05750 3148 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3696 4553 gene locus_tag LOCUS_05760 3696 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4694 5947 gene locus_tag LOCUS_05770 4694 5947 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199991.1 protein_id gnl|my_center|LOCUS_05770 5973 8078 gene locus_tag LOCUS_05780 5973 8078 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_05780 8638 8084 gene locus_tag LOCUS_05790 8638 8084 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence053 481 1635 gene locus_tag LOCUS_05800 481 1635 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_05800 1716 1964 gene locus_tag LOCUS_05810 1716 1964 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332579.1 protein_id gnl|my_center|LOCUS_05810 1961 2374 gene locus_tag LOCUS_05820 1961 2374 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_05820 2527 2790 gene locus_tag LOCUS_05830 2527 2790 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_05830 2783 3076 gene locus_tag LOCUS_05840 2783 3076 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_05840 3174 4337 gene locus_tag LOCUS_05850 3174 4337 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_05850 4745 4374 gene locus_tag LOCUS_05860 4745 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4901 6472 gene locus_tag LOCUS_05870 4901 6472 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_05870 6472 7359 gene locus_tag LOCUS_05880 6472 7359 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 protein_id gnl|my_center|LOCUS_05880 7356 8252 gene locus_tag LOCUS_05890 7356 8252 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974303.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence054 3351 2656 gene locus_tag LOCUS_05900 3351 2656 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_05900 3432 4535 gene locus_tag LOCUS_05910 3432 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5914 4541 gene locus_tag LOCUS_05920 5914 4541 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_05920 6504 5920 gene locus_tag LOCUS_05930 gene dolP 6504 5920 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 protein_id gnl|my_center|LOCUS_05930 6898 6527 gene locus_tag LOCUS_05940 6898 6527 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958409.1 protein_id gnl|my_center|LOCUS_05940 <8782 6963 gene locus_tag LOCUS_05950 <8782 6963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948679.1:penicillin-binding protein activator >Feature sequence055 55 783 gene locus_tag LOCUS_05960 55 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 821 1663 gene locus_tag LOCUS_05970 821 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1832 2659 gene locus_tag LOCUS_05980 1832 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3461 2700 gene locus_tag LOCUS_05990 gene birA 3461 2700 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658158.1 protein_id gnl|my_center|LOCUS_05990 3907 3491 gene locus_tag LOCUS_06000 3907 3491 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_06000 5080 3986 gene locus_tag LOCUS_06010 gene nadA 5080 3986 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_06010 5486 5103 gene locus_tag LOCUS_06020 5486 5103 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_06020 6122 5604 gene locus_tag LOCUS_06030 gene yjgA 6122 5604 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166287.1 protein_id gnl|my_center|LOCUS_06030 7501 6137 gene locus_tag LOCUS_06040 gene rhlB 7501 6137 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161632431.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence056 648 205 gene locus_tag LOCUS_06050 648 205 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_06050 1315 728 gene locus_tag LOCUS_06060 gene sodB 1315 728 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007299.1 protein_id gnl|my_center|LOCUS_06060 1428 2495 gene locus_tag LOCUS_06070 1428 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2736 2500 gene locus_tag LOCUS_06080 2736 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_06080 3123 2806 gene locus_tag LOCUS_06090 3123 2806 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_06090 3398 3123 gene locus_tag LOCUS_06100 3398 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4443 3610 gene locus_tag LOCUS_06110 4443 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5072 4605 gene locus_tag LOCUS_06120 5072 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5955 5200 gene locus_tag LOCUS_06130 gene rlmB 5955 5200 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_06130 8100 5959 gene locus_tag LOCUS_06140 gene rnr 8100 5959 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945853.1 protein_id gnl|my_center|LOCUS_06140 <8665 8140 gene locus_tag LOCUS_06150 <8665 8140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028520.1:formylglycine-generating enzyme family protein >Feature sequence057 53 691 gene locus_tag LOCUS_06160 53 691 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044436927.1 protein_id gnl|my_center|LOCUS_06160 853 1002 gene locus_tag LOCUS_06170 853 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1409 1071 gene locus_tag LOCUS_06180 1409 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2440 1409 gene locus_tag LOCUS_06190 gene xerC 2440 1409 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_06190 2790 2419 gene locus_tag LOCUS_06200 2790 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3109 2777 gene locus_tag LOCUS_06210 3109 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6436 3704 gene locus_tag LOCUS_06220 6436 3704 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204748.1 protein_id gnl|my_center|LOCUS_06220 6726 6538 gene locus_tag LOCUS_06230 6726 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 8212 6989 gene locus_tag LOCUS_06240 8212 6989 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence058 2377 743 gene locus_tag LOCUS_06250 2377 743 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057811.1 protein_id gnl|my_center|LOCUS_06250 3860 2367 gene locus_tag LOCUS_06260 gene malQ 3860 2367 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_06260 5572 3857 gene locus_tag LOCUS_06270 5572 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6886 5618 gene locus_tag LOCUS_06280 gene glgC 6886 5618 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_06280 <8499 6900 gene locus_tag LOCUS_06290 <8499 6900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932668.1:glucose-6-phosphate isomerase >Feature sequence059 1369 1004 gene locus_tag LOCUS_06300 1369 1004 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_06300 4287 1402 gene locus_tag LOCUS_06310 4287 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5530 4301 gene locus_tag LOCUS_06320 5530 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5976 5533 gene locus_tag LOCUS_06330 5976 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6892 6152 gene locus_tag LOCUS_06340 6892 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7832 7284 gene locus_tag LOCUS_06350 7832 7284 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_06350 <8490 7866 gene locus_tag LOCUS_06360 <8490 7866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037400622.1:class I SAM-dependent methyltransferase >Feature sequence060 573 1745 gene locus_tag LOCUS_06370 573 1745 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444497.1 protein_id gnl|my_center|LOCUS_06370 1770 2639 gene locus_tag LOCUS_06380 1770 2639 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_06380 2646 3287 gene locus_tag LOCUS_06390 gene lipB 2646 3287 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_06390 3284 4117 gene locus_tag LOCUS_06400 gene asd 3284 4117 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811301.1 protein_id gnl|my_center|LOCUS_06400 4829 4074 gene locus_tag LOCUS_06410 4829 4074 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_06410 4941 5267 gene locus_tag LOCUS_06420 gene yhbY 4941 5267 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389225.1 protein_id gnl|my_center|LOCUS_06420 5747 5268 gene locus_tag LOCUS_06430 5747 5268 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012301.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence061 <1 881 gene locus_tag LOCUS_06440 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918179.1:phosphate ABC transporter permease subunit PstC 888 2060 gene locus_tag LOCUS_06450 gene pstA 888 2060 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918180.1 protein_id gnl|my_center|LOCUS_06450 2093 2866 gene locus_tag LOCUS_06460 gene pstB 2093 2866 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337598.1 protein_id gnl|my_center|LOCUS_06460 3198 3986 gene locus_tag LOCUS_06470 3198 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4062 4571 gene locus_tag LOCUS_06480 4062 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4577 4726 gene locus_tag LOCUS_06490 4577 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5003 5257 gene locus_tag LOCUS_06500 5003 5257 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_06500 5250 5519 gene locus_tag LOCUS_06510 5250 5519 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_06510 5529 5705 gene locus_tag LOCUS_06520 5529 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 5832 6122 gene locus_tag LOCUS_06530 5832 6122 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_06530 6125 6550 gene locus_tag LOCUS_06540 6125 6550 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_06540 6708 7286 gene locus_tag LOCUS_06550 6708 7286 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_06550 7384 7998 gene locus_tag LOCUS_06560 7384 7998 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence062 995 219 gene locus_tag LOCUS_06570 995 219 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_06570 1133 1546 gene locus_tag LOCUS_06580 1133 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1624 1884 gene locus_tag LOCUS_06590 1624 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1881 3302 gene locus_tag LOCUS_06600 gene hxsB 1881 3302 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_06600 3289 4344 gene locus_tag LOCUS_06610 3289 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5428 4904 gene locus_tag LOCUS_06620 5428 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5535 5717 gene locus_tag LOCUS_06630 5535 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 7064 5787 gene locus_tag LOCUS_06640 7064 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 7358 7152 gene locus_tag LOCUS_06650 7358 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8026 7442 gene locus_tag LOCUS_06660 8026 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence063 623 279 gene locus_tag LOCUS_06670 623 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1300 620 gene locus_tag LOCUS_06680 1300 620 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015334830.1 protein_id gnl|my_center|LOCUS_06680 1788 1297 gene locus_tag LOCUS_06690 1788 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1963 2688 gene locus_tag LOCUS_06700 1963 2688 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946969.1 protein_id gnl|my_center|LOCUS_06700 2773 4029 gene locus_tag LOCUS_06710 gene dcm 2773 4029 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_06710 4388 4074 gene locus_tag LOCUS_06720 4388 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4496 6523 gene locus_tag LOCUS_06730 4496 6523 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_06730 6562 7692 gene locus_tag LOCUS_06740 6562 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence064 <1 600 gene locus_tag LOCUS_06750 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072348.1:cytochrome-c oxidase, cbb3-type subunit III 625 1674 gene locus_tag LOCUS_06760 gene argC 625 1674 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_06760 1695 2696 gene locus_tag LOCUS_06770 1695 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3983 2778 gene locus_tag LOCUS_06780 3983 2778 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_06780 4751 4014 gene locus_tag LOCUS_06790 4751 4014 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403106.1 protein_id gnl|my_center|LOCUS_06790 5431 4748 gene locus_tag LOCUS_06800 5431 4748 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_06800 6051 5524 gene locus_tag LOCUS_06810 6051 5524 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_06810 6410 6063 gene locus_tag LOCUS_06820 6410 6063 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719755.1 protein_id gnl|my_center|LOCUS_06820 6462 6650 gene locus_tag LOCUS_06830 6462 6650 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_06830 6668 7111 gene locus_tag LOCUS_06840 6668 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7127 7717 gene locus_tag LOCUS_06850 7127 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence065 270 653 gene locus_tag LOCUS_06860 270 653 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_06860 650 877 gene locus_tag LOCUS_06870 650 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 891 2657 gene locus_tag LOCUS_06880 891 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2710 3264 gene locus_tag LOCUS_06890 gene rfbC 2710 3264 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_06890 3294 4127 gene locus_tag LOCUS_06900 gene rfbD 3294 4127 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_06900 4120 4950 gene locus_tag LOCUS_06910 4120 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4943 6175 gene locus_tag LOCUS_06920 4943 6175 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_06920 6166 7395 gene locus_tag LOCUS_06930 6166 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence066 <1 567 gene locus_tag LOCUS_06940 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257681.1:class I SAM-dependent DNA methyltransferase note possible pseudo, frameshifted 439 448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 522 1076 gene locus_tag LOCUS_06950 522 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06950 1628 2374 gene locus_tag LOCUS_06960 1628 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2381 3019 gene locus_tag LOCUS_06970 2381 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06970 3208 4089 gene locus_tag LOCUS_06980 3208 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4608 4384 gene locus_tag LOCUS_06990 4608 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4733 4984 gene locus_tag LOCUS_07000 4733 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4981 5274 gene locus_tag LOCUS_07010 4981 5274 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence067 1815 1739 gene locus_tag LOCUS_t00080 1815 1739 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3794 2583 gene locus_tag LOCUS_07020 3794 2583 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_07020 5222 3855 gene locus_tag LOCUS_07030 5222 3855 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_07030 5337 5678 gene locus_tag LOCUS_07040 gene cutA 5337 5678 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209122.1 protein_id gnl|my_center|LOCUS_07040 5813 6574 gene locus_tag LOCUS_07050 5813 6574 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_07050 6630 6920 gene locus_tag LOCUS_07060 6630 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6917 7210 gene locus_tag LOCUS_07070 6917 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 7422 7979 gene locus_tag LOCUS_07080 7422 7979 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence068 2579 1266 gene locus_tag LOCUS_07090 2579 1266 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_07090 2858 3298 gene locus_tag LOCUS_07100 2858 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4397 3330 gene locus_tag LOCUS_07110 gene mtnA 4397 3330 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_07110 4480 5796 gene locus_tag LOCUS_07120 4480 5796 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_07120 5783 6517 gene locus_tag LOCUS_07130 5783 6517 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_07130 6539 7183 gene locus_tag LOCUS_07140 gene gph 6539 7183 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_07140 <8082 7191 gene locus_tag LOCUS_07150 <8082 7191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072295.1:rhodanese-related sulfurtransferase >Feature sequence069 2723 861 gene locus_tag LOCUS_07160 gene mrdA 2723 861 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_07160 3155 2727 gene locus_tag LOCUS_07170 gene mreD 3155 2727 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_07170 3832 3293 gene locus_tag LOCUS_07180 3832 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3955 4866 gene locus_tag LOCUS_07190 3955 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4863 5309 gene locus_tag LOCUS_07200 4863 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5360 6211 gene locus_tag LOCUS_07210 5360 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6236 6703 gene locus_tag LOCUS_07220 6236 6703 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_07220 7349 6714 gene locus_tag LOCUS_07230 7349 6714 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948424.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence070 2060 978 gene locus_tag LOCUS_07240 gene gmd 2060 978 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_07240 3092 2073 gene locus_tag LOCUS_07250 gene rfbB 3092 2073 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548761.1 protein_id gnl|my_center|LOCUS_07250 3973 3083 gene locus_tag LOCUS_07260 gene rfbD 3973 3083 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_07260 4928 4050 gene locus_tag LOCUS_07270 gene rfbA 4928 4050 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_07270 6322 4958 gene locus_tag LOCUS_07280 6322 4958 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_07280 6625 6335 gene locus_tag LOCUS_07290 6625 6335 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_07290 7779 6622 gene locus_tag LOCUS_07300 7779 6622 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence071 <1 1038 gene locus_tag LOCUS_07310 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063871.1:filamentous hemagglutinin transporter protein FhaC >Feature sequence072 714 977 gene locus_tag LOCUS_07320 714 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1000 2094 gene locus_tag LOCUS_07330 gene ald 1000 2094 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_07330 2115 2912 gene locus_tag LOCUS_07340 gene cpdA 2115 2912 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262651.1 protein_id gnl|my_center|LOCUS_07340 3296 2913 gene locus_tag LOCUS_07350 3296 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3401 6316 gene locus_tag LOCUS_07360 3401 6316 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence073 1758 1312 gene locus_tag LOCUS_07370 gene dksA 1758 1312 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262608.1 protein_id gnl|my_center|LOCUS_07370 2281 2625 gene locus_tag LOCUS_07380 2281 2625 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_07380 2642 2989 gene locus_tag LOCUS_07390 gene arsC 2642 2989 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262403.1 protein_id gnl|my_center|LOCUS_07390 3546 3986 gene locus_tag LOCUS_07400 3546 3986 CDS product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421309.1 protein_id gnl|my_center|LOCUS_07400 3999 4868 gene locus_tag LOCUS_07410 3999 4868 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421307.1 protein_id gnl|my_center|LOCUS_07410 4908 5498 gene locus_tag LOCUS_07420 4908 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5557 6501 gene locus_tag LOCUS_07430 5557 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7225 6647 gene locus_tag LOCUS_07440 7225 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence074 890 1822 gene locus_tag LOCUS_07450 890 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1824 4025 gene locus_tag LOCUS_07460 1824 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4033 4530 gene locus_tag LOCUS_07470 4033 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 5163 4669 gene locus_tag LOCUS_07480 5163 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5732 5256 gene locus_tag LOCUS_07490 5732 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7043 6117 gene locus_tag LOCUS_07500 7043 6117 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence075 8 84 gene locus_tag LOCUS_t00090 8 84 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1437 577 gene locus_tag LOCUS_07510 1437 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1717 2019 gene locus_tag LOCUS_07520 1717 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2016 2387 gene locus_tag LOCUS_07530 2016 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2384 3262 gene locus_tag LOCUS_07540 2384 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3263 4096 gene locus_tag LOCUS_07550 3263 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4111 5235 gene locus_tag LOCUS_07560 4111 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5244 6128 gene locus_tag LOCUS_07570 5244 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6501 6130 gene locus_tag LOCUS_07580 gene acpS 6501 6130 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_07580 6820 6653 gene locus_tag LOCUS_07590 6820 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 7223 6936 gene locus_tag LOCUS_07600 7223 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence076 1870 395 gene locus_tag LOCUS_07610 gene ubiD 1870 395 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215917.1 protein_id gnl|my_center|LOCUS_07610 2628 1879 gene locus_tag LOCUS_07620 2628 1879 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_07620 2915 3118 gene locus_tag LOCUS_07630 2915 3118 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638174.1 protein_id gnl|my_center|LOCUS_07630 3885 3172 gene locus_tag LOCUS_07640 gene lpxH 3885 3172 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212234.1 protein_id gnl|my_center|LOCUS_07640 4456 3887 gene locus_tag LOCUS_07650 4456 3887 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_07650 4514 5941 gene locus_tag LOCUS_07660 gene gltX 4514 5941 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958261.1 protein_id gnl|my_center|LOCUS_07660 5935 7326 gene locus_tag LOCUS_07670 gene cysS 5935 7326 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence077 294 1514 gene locus_tag LOCUS_07680 294 1514 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 protein_id gnl|my_center|LOCUS_07680 1842 2429 gene locus_tag LOCUS_07690 1842 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2419 3798 gene locus_tag LOCUS_07700 gene mpl 2419 3798 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770120.1 protein_id gnl|my_center|LOCUS_07700 3795 4400 gene locus_tag LOCUS_07710 gene ubiX 3795 4400 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379089.1 protein_id gnl|my_center|LOCUS_07710 4613 4458 gene locus_tag LOCUS_07720 gene rpmG 4613 4458 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 protein_id gnl|my_center|LOCUS_07720 4867 4631 gene locus_tag LOCUS_07730 gene rpmB 4867 4631 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_07730 5211 6128 gene locus_tag LOCUS_07740 5211 6128 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_07740 6151 6978 gene locus_tag LOCUS_07750 6151 6978 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence078 144 965 gene locus_tag LOCUS_07760 gene dapD 144 965 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_07760 969 2114 gene locus_tag LOCUS_07770 gene dapE 969 2114 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_07770 2107 3261 gene locus_tag LOCUS_07780 2107 3261 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 protein_id gnl|my_center|LOCUS_07780 3251 3847 gene locus_tag LOCUS_07790 gene metW 3251 3847 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_07790 5723 3909 gene locus_tag LOCUS_07800 gene typA 5723 3909 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_07800 6233 5745 gene locus_tag LOCUS_07810 gene ispF 6233 5745 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_07810 6922 6230 gene locus_tag LOCUS_07820 gene ispD 6922 6230 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 protein_id gnl|my_center|LOCUS_07820 7184 6927 gene locus_tag LOCUS_07830 gene ftsB 7184 6927 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420699.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence079 209 1069 gene locus_tag LOCUS_07840 gene folD 209 1069 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654480.1 protein_id gnl|my_center|LOCUS_07840 1614 1195 gene locus_tag LOCUS_07850 1614 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1709 2899 gene locus_tag LOCUS_07860 gene alaC 1709 2899 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 protein_id gnl|my_center|LOCUS_07860 2901 4214 gene locus_tag LOCUS_07870 2901 4214 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_07870 4247 5329 gene locus_tag LOCUS_07880 gene thrC 4247 5329 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_07880 5343 6341 gene locus_tag LOCUS_07890 5343 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6861 6331 gene locus_tag LOCUS_07900 6861 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence080 704 285 gene locus_tag LOCUS_07910 704 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1786 935 gene locus_tag LOCUS_07920 1786 935 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818638.1 protein_id gnl|my_center|LOCUS_07920 3210 1783 gene locus_tag LOCUS_07930 gene xseA 3210 1783 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 protein_id gnl|my_center|LOCUS_07930 3280 4746 gene locus_tag LOCUS_07940 gene guaB 3280 4746 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_07940 4750 6336 gene locus_tag LOCUS_07950 gene guaA 4750 6336 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037329.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence081 1298 267 gene locus_tag LOCUS_07960 1298 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2077 1514 gene locus_tag LOCUS_07970 gene dcd 2077 1514 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 protein_id gnl|my_center|LOCUS_07970 3178 2096 gene locus_tag LOCUS_07980 gene apbC 3178 2096 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_07980 3300 5498 gene locus_tag LOCUS_07990 gene uvrD 3300 5498 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383420.1 protein_id gnl|my_center|LOCUS_07990 5519 5830 gene locus_tag LOCUS_08000 gene glpE 5519 5830 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085081.1 protein_id gnl|my_center|LOCUS_08000 5806 6966 gene locus_tag LOCUS_08010 5806 6966 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531771.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence082 1 771 gene locus_tag LOCUS_08020 1 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 793 1122 gene locus_tag LOCUS_08030 793 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2252 1239 gene locus_tag LOCUS_08040 2252 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2493 2236 gene locus_tag LOCUS_08050 2493 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3172 2531 gene locus_tag LOCUS_08060 3172 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3981 3250 gene locus_tag LOCUS_08070 3981 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5246 4653 gene locus_tag LOCUS_08080 5246 4653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086905.1 protein_id gnl|my_center|LOCUS_08080 5890 5243 gene locus_tag LOCUS_08090 5890 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5988 6947 gene locus_tag LOCUS_08100 5988 6947 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085570.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence083 1451 585 gene locus_tag LOCUS_08110 gene nadC 1451 585 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946543.1 protein_id gnl|my_center|LOCUS_08110 1561 1636 gene locus_tag LOCUS_t00100 1561 1636 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1816 3024 gene locus_tag LOCUS_08120 1816 3024 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_08120 3071 3328 gene locus_tag LOCUS_08130 3071 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08130 3385 3678 gene locus_tag LOCUS_08140 3385 3678 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994576.1 protein_id gnl|my_center|LOCUS_08140 3778 4641 gene locus_tag LOCUS_08150 3778 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4766 4972 gene locus_tag LOCUS_08160 4766 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4975 5280 gene locus_tag LOCUS_08170 4975 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5277 5555 gene locus_tag LOCUS_08180 5277 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 5558 5806 gene locus_tag LOCUS_08190 5558 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5781 6146 gene locus_tag LOCUS_08200 5781 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence084 429 1073 gene locus_tag LOCUS_08210 gene dsbA 429 1073 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_08210 1699 1091 gene locus_tag LOCUS_08220 1699 1091 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_08220 1811 1887 gene locus_tag LOCUS_t00110 1811 1887 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1929 2420 gene locus_tag LOCUS_08230 gene rimP 1929 2420 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_08230 2438 3979 gene locus_tag LOCUS_08240 gene nusA 2438 3979 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_08240 3992 6499 gene locus_tag LOCUS_08250 gene infB 3992 6499 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_08250 6505 6882 gene locus_tag LOCUS_08260 gene rbfA 6505 6882 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence085 291 467 gene locus_tag LOCUS_08270 291 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 457 4176 gene locus_tag LOCUS_08280 457 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4256 5026 gene locus_tag LOCUS_08290 4256 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5061 6086 gene locus_tag LOCUS_08300 5061 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6167 6673 gene locus_tag LOCUS_08310 6167 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6611 6620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence086 450 1157 gene locus_tag LOCUS_08320 450 1157 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_08320 1884 2855 gene locus_tag LOCUS_08330 1884 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2953 4140 gene locus_tag LOCUS_08340 2953 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5577 4198 gene locus_tag LOCUS_08350 gene hflX 5577 4198 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_08350 5853 5611 gene locus_tag LOCUS_08360 gene hfq 5853 5611 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_08360 6863 5922 gene locus_tag LOCUS_08370 gene miaA 6863 5922 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814337.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence087 1593 5375 gene locus_tag LOCUS_08380 1593 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence088 156 752 gene locus_tag LOCUS_08390 156 752 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_08390 763 1068 gene locus_tag LOCUS_08400 gene nuoK 763 1068 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215628.1 protein_id gnl|my_center|LOCUS_08400 1070 3046 gene locus_tag LOCUS_08410 gene nuoL 1070 3046 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_08410 3056 4573 gene locus_tag LOCUS_08420 3056 4573 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_08420 4590 6026 gene locus_tag LOCUS_08430 gene nuoN 4590 6026 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_08430 6034 6708 gene locus_tag LOCUS_08440 6034 6708 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence089 1574 228 gene locus_tag LOCUS_08450 1574 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2044 1676 gene locus_tag LOCUS_08460 2044 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2730 2062 gene locus_tag LOCUS_08470 2730 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3315 2743 gene locus_tag LOCUS_08480 3315 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3783 3370 gene locus_tag LOCUS_08490 3783 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4331 3783 gene locus_tag LOCUS_08500 4331 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4696 5595 gene locus_tag LOCUS_08510 4696 5595 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966070.1 protein_id gnl|my_center|LOCUS_08510 5592 5900 gene locus_tag LOCUS_08520 5592 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence090 247 1215 gene locus_tag LOCUS_08530 gene ispB 247 1215 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479642.1 protein_id gnl|my_center|LOCUS_08530 1303 2871 gene locus_tag LOCUS_08540 1303 2871 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 protein_id gnl|my_center|LOCUS_08540 3732 2884 gene locus_tag LOCUS_08550 3732 2884 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_08550 6317 3858 gene locus_tag LOCUS_08560 6317 3858 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_08560 <6971 6368 gene locus_tag LOCUS_08570 <6971 6368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114538.1:lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase >Feature sequence091 <1 771 gene locus_tag LOCUS_08580 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948238.1:FAD-binding oxidoreductase 1016 768 gene locus_tag LOCUS_08590 1016 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2056 1013 gene locus_tag LOCUS_08600 2056 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2526 2059 gene locus_tag LOCUS_08610 2526 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3017 2523 gene locus_tag LOCUS_08620 3017 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3281 3021 gene locus_tag LOCUS_08630 3281 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3572 3291 gene locus_tag LOCUS_08640 3572 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4466 3780 gene locus_tag LOCUS_08650 4466 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5415 4492 gene locus_tag LOCUS_08660 5415 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6878 5472 gene locus_tag LOCUS_08670 6878 5472 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence092 2625 1249 gene locus_tag LOCUS_08680 gene rseP 2625 1249 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_08680 3840 2650 gene locus_tag LOCUS_08690 gene ispC 3840 2650 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_08690 4673 3837 gene locus_tag LOCUS_08700 4673 3837 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_08700 5440 4685 gene locus_tag LOCUS_08710 gene uppS 5440 4685 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_08710 6017 5463 gene locus_tag LOCUS_08720 gene frr 6017 5463 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_08720 6744 6004 gene locus_tag LOCUS_08730 gene pyrH 6744 6004 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence093 1481 462 gene locus_tag LOCUS_08740 1481 462 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202925.1 protein_id gnl|my_center|LOCUS_08740 2310 1507 gene locus_tag LOCUS_08750 2310 1507 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963421.1 protein_id gnl|my_center|LOCUS_08750 2855 2307 gene locus_tag LOCUS_08760 2855 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3738 3974 gene locus_tag LOCUS_08770 3738 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6132 5128 gene locus_tag LOCUS_08780 6132 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 <6877 6226 gene locus_tag LOCUS_08790 <6877 6226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208043.1:Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB >Feature sequence094 928 2001 gene locus_tag LOCUS_08800 928 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2001 2573 gene locus_tag LOCUS_08810 2001 2573 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_08810 2566 3258 gene locus_tag LOCUS_08820 2566 3258 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307333.1 protein_id gnl|my_center|LOCUS_08820 4419 3262 gene locus_tag LOCUS_08830 gene algW 4419 3262 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_08830 4457 5215 gene locus_tag LOCUS_08840 4457 5215 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 protein_id gnl|my_center|LOCUS_08840 6295 5282 gene locus_tag LOCUS_08850 6295 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence095 734 72 gene locus_tag LOCUS_08860 gene tolQ 734 72 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_08860 1131 724 gene locus_tag LOCUS_08870 gene ybgC 1131 724 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072691.1 protein_id gnl|my_center|LOCUS_08870 2199 1132 gene locus_tag LOCUS_08880 gene ruvB 2199 1132 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_08880 2789 2196 gene locus_tag LOCUS_08890 gene ruvA 2789 2196 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 protein_id gnl|my_center|LOCUS_08890 3301 2786 gene locus_tag LOCUS_08900 gene ruvC 3301 2786 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_08900 4060 3314 gene locus_tag LOCUS_08910 4060 3314 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_08910 4184 5272 gene locus_tag LOCUS_08920 gene aroC 4184 5272 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262335.1 protein_id gnl|my_center|LOCUS_08920 5285 6454 gene locus_tag LOCUS_08930 5285 6454 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence096 <1 1489 gene locus_tag LOCUS_08940 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035771.1:chaperonin GroEL 1612 2535 gene locus_tag LOCUS_08950 gene ilvE 1612 2535 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_08950 2545 2751 gene locus_tag LOCUS_08960 2545 2751 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_08960 2748 3659 gene locus_tag LOCUS_08970 2748 3659 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_08970 3644 4747 gene locus_tag LOCUS_08980 3644 4747 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_08980 5140 4844 gene locus_tag LOCUS_08990 5140 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5266 5192 gene locus_tag LOCUS_t00120 5266 5192 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 2 685 gene locus_tag LOCUS_09000 2 685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_09000 812 1150 gene locus_tag LOCUS_09010 gene iscA 812 1150 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301571.1 protein_id gnl|my_center|LOCUS_09010 1151 1579 gene locus_tag LOCUS_09020 gene ndk 1151 1579 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_09020 1602 2747 gene locus_tag LOCUS_09030 1602 2747 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_09030 2831 4111 gene locus_tag LOCUS_09040 2831 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4116 5381 gene locus_tag LOCUS_09050 gene hisS 4116 5381 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 protein_id gnl|my_center|LOCUS_09050 5393 6028 gene locus_tag LOCUS_09060 5393 6028 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence098 650 312 gene locus_tag LOCUS_09070 650 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 922 2418 gene locus_tag LOCUS_09080 922 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2554 2880 gene locus_tag LOCUS_09090 2554 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2924 3619 gene locus_tag LOCUS_09100 2924 3619 CDS product tellurite resistance protein TerY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875478.1 protein_id gnl|my_center|LOCUS_09100 3643 3966 gene locus_tag LOCUS_09110 3643 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3981 4250 gene locus_tag LOCUS_09120 3981 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4253 4705 gene locus_tag LOCUS_09130 4253 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4712 6040 gene locus_tag LOCUS_09140 4712 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6030 6407 gene locus_tag LOCUS_09150 6030 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6400 6621 gene locus_tag LOCUS_09160 6400 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence099 566 1477 gene locus_tag LOCUS_09170 gene fabD 566 1477 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020093.1 protein_id gnl|my_center|LOCUS_09170 1511 2236 gene locus_tag LOCUS_09180 gene fabG 1511 2236 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_09180 2360 2602 gene locus_tag LOCUS_09190 gene acpP 2360 2602 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 protein_id gnl|my_center|LOCUS_09190 2708 3949 gene locus_tag LOCUS_09200 gene fabF 2708 3949 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_09200 3949 5343 gene locus_tag LOCUS_09210 3949 5343 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_09210 5315 6166 gene locus_tag LOCUS_09220 gene pabC 5315 6166 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence100 319 1194 gene locus_tag LOCUS_09230 319 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1194 2867 gene locus_tag LOCUS_09240 1194 2867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_09240 2864 4702 gene locus_tag LOCUS_09250 2864 4702 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_09250 4714 5130 gene locus_tag LOCUS_09260 4714 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5130 5282 gene locus_tag LOCUS_09270 5130 5282 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_09270 5298 6476 gene locus_tag LOCUS_09280 5298 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence101 2892 1858 gene locus_tag LOCUS_09290 gene pheS 2892 1858 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_09290 3317 2958 gene locus_tag LOCUS_09300 gene rplT 3317 2958 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_09300 3554 3357 gene locus_tag LOCUS_09310 gene rpmI 3554 3357 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_09310 4114 3602 gene locus_tag LOCUS_09320 gene infC 4114 3602 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_09320 5643 4171 gene locus_tag LOCUS_09330 gene thrS 5643 4171 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 6076 5651 gene locus_tag LOCUS_09340 6076 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 5654 5663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6245 6169 gene locus_tag LOCUS_t00130 6245 6169 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence102 94 1770 gene locus_tag LOCUS_09350 94 1770 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_09350 2060 2749 gene locus_tag LOCUS_09360 2060 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3568 5058 gene locus_tag LOCUS_09370 3568 5058 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_09370 5084 5503 gene locus_tag LOCUS_09380 5084 5503 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence103 1 129 gene locus_tag LOCUS_09390 1 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 132 794 gene locus_tag LOCUS_09400 132 794 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_09400 787 1902 gene locus_tag LOCUS_09410 gene ribBA 787 1902 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122865.1 protein_id gnl|my_center|LOCUS_09410 1918 2391 gene locus_tag LOCUS_09420 gene ribE 1918 2391 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938494.1 protein_id gnl|my_center|LOCUS_09420 2388 2822 gene locus_tag LOCUS_09430 gene nusB 2388 2822 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 protein_id gnl|my_center|LOCUS_09430 2835 3809 gene locus_tag LOCUS_09440 gene thiL 2835 3809 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 protein_id gnl|my_center|LOCUS_09440 3781 4275 gene locus_tag LOCUS_09450 3781 4275 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_09450 4808 4410 gene locus_tag LOCUS_09460 4808 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5505 5167 gene locus_tag LOCUS_09470 5505 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6105 5605 gene locus_tag LOCUS_09480 6105 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 6346 6161 gene locus_tag LOCUS_09490 6346 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence104 1042 1779 gene locus_tag LOCUS_09500 1042 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1779 2690 gene locus_tag LOCUS_09510 1779 2690 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_09510 2687 3493 gene locus_tag LOCUS_09520 2687 3493 CDS product TIGR04325 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084681.1 protein_id gnl|my_center|LOCUS_09520 3549 4208 gene locus_tag LOCUS_09530 3549 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4292 5329 gene locus_tag LOCUS_09540 4292 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5529 5374 gene locus_tag LOCUS_09550 5529 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6047 5832 gene locus_tag LOCUS_09560 6047 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence105 <1 811 gene locus_tag LOCUS_09570 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143177.1:Fic family protein 1045 1569 gene locus_tag LOCUS_09580 1045 1569 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_09580 1566 1721 gene locus_tag LOCUS_09590 1566 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2551 2946 gene locus_tag LOCUS_09600 2551 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4458 3415 gene locus_tag LOCUS_09610 4458 3415 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_09610 5365 5817 gene locus_tag LOCUS_09620 5365 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5887 6315 gene locus_tag LOCUS_09630 5887 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence106 <1 568 gene locus_tag LOCUS_09640 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022333.1:3-deoxy-manno-octulosonate cytidylyltransferase 565 726 gene locus_tag LOCUS_09650 565 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 756 1214 gene locus_tag LOCUS_09660 756 1214 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_09660 1461 2264 gene locus_tag LOCUS_09670 1461 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2515 2715 gene locus_tag LOCUS_09680 2515 2715 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_09680 2712 3011 gene locus_tag LOCUS_09690 2712 3011 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_09690 3070 3327 gene locus_tag LOCUS_09700 3070 3327 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_09700 3284 3293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3650 4021 gene locus_tag LOCUS_09710 3650 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4143 4739 gene locus_tag LOCUS_09720 4143 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4902 6137 gene locus_tag LOCUS_09730 4902 6137 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence107 880 110 gene locus_tag LOCUS_09740 gene bioH 880 110 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 protein_id gnl|my_center|LOCUS_09740 1521 880 gene locus_tag LOCUS_09750 1521 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4375 1598 gene locus_tag LOCUS_09760 4375 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5448 4423 gene locus_tag LOCUS_09770 5448 4423 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_09770 6406 5450 gene locus_tag LOCUS_09780 gene leuB 6406 5450 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence108 <1 880 gene locus_tag LOCUS_09790 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946340.1:Fe-S cluster assembly protein SufD 877 2136 gene locus_tag LOCUS_09800 877 2136 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09800 2133 2588 gene locus_tag LOCUS_09810 2133 2588 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_09810 2591 3154 gene locus_tag LOCUS_09820 gene sufT 2591 3154 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_09820 3162 3482 gene locus_tag LOCUS_09830 3162 3482 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_09830 3506 3862 gene locus_tag LOCUS_09840 gene erpA 3506 3862 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_09840 4390 4986 gene locus_tag LOCUS_09850 4390 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5007 5696 gene locus_tag LOCUS_09860 5007 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence109 628 20 gene locus_tag LOCUS_09870 628 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1938 709 gene locus_tag LOCUS_09880 1938 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2718 2044 gene locus_tag LOCUS_09890 2718 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3174 2734 gene locus_tag LOCUS_09900 3174 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5081 3309 gene locus_tag LOCUS_09910 5081 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 6123 5086 gene locus_tag LOCUS_09920 6123 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence110 <1 755 gene locus_tag LOCUS_09930 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104536.1:phage portal protein 706 1968 gene locus_tag LOCUS_09940 706 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1980 2318 gene locus_tag LOCUS_09950 1980 2318 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104534.1 protein_id gnl|my_center|LOCUS_09950 2331 3314 gene locus_tag LOCUS_09960 2331 3314 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 protein_id gnl|my_center|LOCUS_09960 3380 3703 gene locus_tag LOCUS_09970 3380 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3847 5244 gene locus_tag LOCUS_09980 3847 5244 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_09980 5237 5818 gene locus_tag LOCUS_09990 5237 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence111 <1 1134 gene locus_tag LOCUS_10000 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811412.1:heme lyase CcmF/NrfE family subunit 1131 1658 gene locus_tag LOCUS_10010 1131 1658 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_10010 1651 2130 gene locus_tag LOCUS_10020 1651 2130 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 protein_id gnl|my_center|LOCUS_10020 2138 3433 gene locus_tag LOCUS_10030 gene ccmI 2138 3433 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_10030 3440 4015 gene locus_tag LOCUS_10040 3440 4015 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_10040 4088 4792 gene locus_tag LOCUS_10050 4088 4792 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence112 1519 986 gene locus_tag LOCUS_10060 1519 986 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_10060 2834 1512 gene locus_tag LOCUS_10070 2834 1512 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105055.1 protein_id gnl|my_center|LOCUS_10070 3410 2862 gene locus_tag LOCUS_10080 3410 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3723 3415 gene locus_tag LOCUS_10090 3723 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4889 3726 gene locus_tag LOCUS_10100 4889 3726 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815218.1 protein_id gnl|my_center|LOCUS_10100 <6178 5070 gene locus_tag LOCUS_10110 <6178 5070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880679.1:tetratricopeptide repeat-containing sulfotransferase family protein >Feature sequence113 2378 1605 gene locus_tag LOCUS_10120 gene djlA 2378 1605 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_10120 3311 2394 gene locus_tag LOCUS_10130 3311 2394 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056735.1 protein_id gnl|my_center|LOCUS_10130 5560 3353 gene locus_tag LOCUS_10140 5560 3353 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_10140 6037 5573 gene locus_tag LOCUS_10150 gene nsrR 6037 5573 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence114 >Feature sequence115 804 106 gene locus_tag LOCUS_10160 804 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1609 797 gene locus_tag LOCUS_10170 1609 797 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040933466.1 protein_id gnl|my_center|LOCUS_10170 2820 1606 gene locus_tag LOCUS_10180 2820 1606 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_10180 3475 2831 gene locus_tag LOCUS_10190 3475 2831 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_10190 3941 3468 gene locus_tag LOCUS_10200 3941 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4422 3946 gene locus_tag LOCUS_10210 gene greA 4422 3946 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707083.1 protein_id gnl|my_center|LOCUS_10210 <6142 4419 gene locus_tag LOCUS_10220 <6142 4419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037013.1:carbamoyl-phosphate synthase large subunit >Feature sequence116 2102 729 gene locus_tag LOCUS_10230 2102 729 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_10230 2296 3492 gene locus_tag LOCUS_10240 gene tyrS 2296 3492 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_10240 3518 4420 gene locus_tag LOCUS_10250 3518 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4506 5588 gene locus_tag LOCUS_10260 4506 5588 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence117 5 1234 gene locus_tag LOCUS_10270 gene trpB 5 1234 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947035.1 protein_id gnl|my_center|LOCUS_10270 1231 2040 gene locus_tag LOCUS_10280 gene trpA 1231 2040 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694852.1 protein_id gnl|my_center|LOCUS_10280 2093 2938 gene locus_tag LOCUS_10290 gene accD 2093 2938 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947071.1 protein_id gnl|my_center|LOCUS_10290 2955 4247 gene locus_tag LOCUS_10300 gene folC 2955 4247 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225490.1 protein_id gnl|my_center|LOCUS_10300 4316 4801 gene locus_tag LOCUS_10310 4316 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4820 5344 gene locus_tag LOCUS_10320 gene cvpA 4820 5344 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420022.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence118 1180 275 gene locus_tag LOCUS_10330 1180 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1662 1931 gene locus_tag LOCUS_10340 1662 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1934 2272 gene locus_tag LOCUS_10350 1934 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3640 2327 gene locus_tag LOCUS_10360 3640 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5009 3726 gene locus_tag LOCUS_10370 5009 3726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965625.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence119 1164 271 gene locus_tag LOCUS_10380 gene rsgA 1164 271 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694198.1 protein_id gnl|my_center|LOCUS_10380 1658 1167 gene locus_tag LOCUS_10390 1658 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 2391 1627 gene locus_tag LOCUS_10400 2391 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 1637 1646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2375 2926 gene locus_tag LOCUS_10410 gene orn 2375 2926 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 protein_id gnl|my_center|LOCUS_10410 2919 3323 gene locus_tag LOCUS_10420 2919 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3310 3948 gene locus_tag LOCUS_10430 gene pyrE 3310 3948 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806179.1 protein_id gnl|my_center|LOCUS_10430 3983 4381 gene locus_tag LOCUS_10440 3983 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4392 4661 gene locus_tag LOCUS_10450 4392 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence120 2586 1993 gene locus_tag LOCUS_10460 2586 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2932 3546 gene locus_tag LOCUS_10470 2932 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3987 3559 gene locus_tag LOCUS_10480 3987 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 <5999 5141 gene locus_tag LOCUS_10490 <5999 5141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011946719.1:ribonucleotide-diphosphate reductase subunit beta >Feature sequence121 1246 296 gene locus_tag LOCUS_10500 1246 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1817 1239 gene locus_tag LOCUS_10510 1817 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3987 2701 gene locus_tag LOCUS_10520 gene wzx 3987 2701 CDS product O-antigen flipase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119725.1 protein_id gnl|my_center|LOCUS_10520 5597 4068 gene locus_tag LOCUS_10530 5597 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5854 5594 gene locus_tag LOCUS_10540 5854 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence122 389 1084 gene locus_tag LOCUS_10550 gene dnaQ 389 1084 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957503.1 protein_id gnl|my_center|LOCUS_10550 1097 1552 gene locus_tag LOCUS_10560 1097 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1754 1596 gene locus_tag LOCUS_10570 1754 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1991 1788 gene locus_tag LOCUS_10580 1991 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1915 3597 gene locus_tag LOCUS_10590 1915 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3602 4165 gene locus_tag LOCUS_10600 3602 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4196 4681 gene locus_tag LOCUS_10610 4196 4681 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930569.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence123 1271 402 gene locus_tag LOCUS_10620 gene speE 1271 402 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_10620 1347 3233 gene locus_tag LOCUS_10630 gene speA 1347 3233 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399746.1 protein_id gnl|my_center|LOCUS_10630 3242 3703 gene locus_tag LOCUS_10640 3242 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence124 415 930 gene locus_tag LOCUS_10650 415 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 927 1451 gene locus_tag LOCUS_10660 927 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2116 1448 gene locus_tag LOCUS_10670 2116 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329496.1 protein_id gnl|my_center|LOCUS_10670 2332 3864 gene locus_tag LOCUS_10680 gene argA 2332 3864 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 protein_id gnl|my_center|LOCUS_10680 4609 3866 gene locus_tag LOCUS_10690 4609 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 <5799 4692 gene locus_tag LOCUS_10700 <5799 4692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116398.1:DUF11 domain-containing protein >Feature sequence125 491 1339 gene locus_tag LOCUS_10710 491 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1444 2445 gene locus_tag LOCUS_10720 1444 2445 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 protein_id gnl|my_center|LOCUS_10720 3678 2500 gene locus_tag LOCUS_10730 3678 2500 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_10730 4731 3754 gene locus_tag LOCUS_10740 4731 3754 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463475.1 protein_id gnl|my_center|LOCUS_10740 4957 4868 gene locus_tag LOCUS_t00140 4957 4868 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 525 346 gene locus_tag LOCUS_10750 525 346 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_10750 1523 540 gene locus_tag LOCUS_10760 gene lpxK 1523 540 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957852.1 protein_id gnl|my_center|LOCUS_10760 3313 1529 gene locus_tag LOCUS_10770 gene msbA 3313 1529 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456206.1 protein_id gnl|my_center|LOCUS_10770 3763 3341 gene locus_tag LOCUS_10780 3763 3341 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 protein_id gnl|my_center|LOCUS_10780 4401 3760 gene locus_tag LOCUS_10790 4401 3760 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_10790 4987 4442 gene locus_tag LOCUS_10800 gene pgsA 4987 4442 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 protein_id gnl|my_center|LOCUS_10800 <5718 4994 gene locus_tag LOCUS_10810 <5718 4994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113354.1:excinuclease ABC subunit UvrC >Feature sequence127 1215 358 gene locus_tag LOCUS_10820 gene ccsA 1215 358 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_10820 2176 1241 gene locus_tag LOCUS_10830 2176 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4944 2242 gene locus_tag LOCUS_10840 4944 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 <5650 4954 gene locus_tag LOCUS_10850 <5650 4954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943842.1:6-bladed beta-propeller >Feature sequence128 702 905 gene locus_tag LOCUS_10860 702 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1313 939 gene locus_tag LOCUS_10870 1313 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2881 1751 gene locus_tag LOCUS_10880 2881 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3996 3340 gene locus_tag LOCUS_10890 3996 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4331 4056 gene locus_tag LOCUS_10900 4331 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4490 4642 gene locus_tag LOCUS_10910 4490 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4725 5387 gene locus_tag LOCUS_10920 4725 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence129 1294 563 gene locus_tag LOCUS_10930 gene pgl 1294 563 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_10930 2074 1334 gene locus_tag LOCUS_10940 2074 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3572 2118 gene locus_tag LOCUS_10950 3572 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3722 4525 gene locus_tag LOCUS_10960 3722 4525 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_10960 4952 4554 gene locus_tag LOCUS_10970 4952 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence130 473 1474 gene locus_tag LOCUS_10980 473 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1471 3894 gene locus_tag LOCUS_10990 1471 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4981 3908 gene locus_tag LOCUS_11000 4981 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence131 3084 694 gene locus_tag LOCUS_11010 gene nuoG 3084 694 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_11010 4375 3095 gene locus_tag LOCUS_11020 gene nuoF 4375 3095 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_11020 4878 4378 gene locus_tag LOCUS_11030 gene nuoE 4878 4378 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_11030 <5430 4875 gene locus_tag LOCUS_11040 <5430 4875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185833.1:NADH-quinone oxidoreductase subunit D >Feature sequence132 1480 383 gene locus_tag LOCUS_11050 1480 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1616 2365 gene locus_tag LOCUS_11060 1616 2365 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_11060 2350 3426 gene locus_tag LOCUS_11070 2350 3426 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_11070 4769 3423 gene locus_tag LOCUS_11080 gene glmM 4769 3423 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence133 135 704 gene locus_tag LOCUS_11090 135 704 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024661285.1 protein_id gnl|my_center|LOCUS_11090 3499 713 gene locus_tag LOCUS_11100 gene glnE 3499 713 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266458.1 protein_id gnl|my_center|LOCUS_11100 3680 5086 gene locus_tag LOCUS_11110 gene glnA 3680 5086 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence134 2 952 gene locus_tag LOCUS_11120 2 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 949 3147 gene locus_tag LOCUS_11130 949 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 3156 4037 gene locus_tag LOCUS_11140 3156 4037 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_11140 4054 4743 gene locus_tag LOCUS_11150 4054 4743 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365839.1 protein_id gnl|my_center|LOCUS_11150 4740 5201 gene locus_tag LOCUS_11160 gene nikR 4740 5201 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence135 318 124 gene locus_tag LOCUS_11170 318 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 655 320 gene locus_tag LOCUS_11180 655 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1119 643 gene locus_tag LOCUS_11190 1119 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1586 1116 gene locus_tag LOCUS_11200 1586 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1843 1583 gene locus_tag LOCUS_11210 1843 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2309 2055 gene locus_tag LOCUS_11220 2309 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2533 2309 gene locus_tag LOCUS_11230 2533 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4413 2530 gene locus_tag LOCUS_11240 4413 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475919.1 protein_id gnl|my_center|LOCUS_11240 5313 4447 gene locus_tag LOCUS_11250 5313 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence136 3151 44 gene locus_tag LOCUS_11260 gene cas9 3151 44 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_11260 3575 3805 gene locus_tag LOCUS_11270 3575 3805 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_11270 3808 4008 gene locus_tag LOCUS_11280 3808 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11280 <5373 4346 gene locus_tag LOCUS_11290 <5373 4346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769896.1:Dot/Icm type IV secretion system effector CoxFIC1 >Feature sequence137 864 367 gene locus_tag LOCUS_11300 864 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1208 1615 gene locus_tag LOCUS_11310 1208 1615 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149585.1 protein_id gnl|my_center|LOCUS_11310 1612 2610 gene locus_tag LOCUS_11320 1612 2610 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 protein_id gnl|my_center|LOCUS_11320 3338 2676 gene locus_tag LOCUS_11330 3338 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4039 3545 gene locus_tag LOCUS_11340 4039 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4394 4621 gene locus_tag LOCUS_11350 4394 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5021 5245 gene locus_tag LOCUS_11360 5021 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5337 5250 gene locus_tag LOCUS_t00150 5337 5250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 608 267 gene locus_tag LOCUS_11370 608 267 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 protein_id gnl|my_center|LOCUS_11370 1117 749 gene locus_tag LOCUS_11380 1117 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1589 1371 gene locus_tag LOCUS_11390 1589 1371 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_11390 1741 1586 gene locus_tag LOCUS_11400 1741 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2141 1776 gene locus_tag LOCUS_11410 2141 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4259 2247 gene locus_tag LOCUS_11420 gene ligA 4259 2247 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172221.1 protein_id gnl|my_center|LOCUS_11420 4948 4262 gene locus_tag LOCUS_11430 gene lolD 4948 4262 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033709.1 protein_id gnl|my_center|LOCUS_11430 5351 4941 gene locus_tag LOCUS_11440 5351 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence139 357 1946 gene locus_tag LOCUS_11450 357 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2120 2842 gene locus_tag LOCUS_11460 2120 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2855 3079 gene locus_tag LOCUS_11470 2855 3079 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_11470 3079 4338 gene locus_tag LOCUS_11480 gene murA 3079 4338 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_11480 4345 4980 gene locus_tag LOCUS_11490 gene hisG 4345 4980 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence140 1495 869 gene locus_tag LOCUS_11500 1495 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2676 1492 gene locus_tag LOCUS_11510 2676 1492 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094854.1 protein_id gnl|my_center|LOCUS_11510 3165 2716 gene locus_tag LOCUS_11520 3165 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4537 3191 gene locus_tag LOCUS_11530 4537 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence141 869 159 gene locus_tag LOCUS_11540 869 159 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405125.1 protein_id gnl|my_center|LOCUS_11540 1134 856 gene locus_tag LOCUS_11550 1134 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1795 1523 gene locus_tag LOCUS_11560 1795 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4962 1792 gene locus_tag LOCUS_11570 4962 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence142 4157 3438 gene locus_tag LOCUS_11580 4157 3438 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_11580 4364 4170 gene locus_tag LOCUS_11590 4364 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5253 4375 gene locus_tag LOCUS_11600 gene dapA 5253 4375 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence143 897 175 gene locus_tag LOCUS_11610 897 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 991 1941 gene locus_tag LOCUS_11620 gene rluD 991 1941 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266591.1 protein_id gnl|my_center|LOCUS_11620 1941 2663 gene locus_tag LOCUS_11630 gene etrA 1941 2663 CDS product electron transport transcriptional regulator EtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072343.1 protein_id gnl|my_center|LOCUS_11630 4672 2927 gene locus_tag LOCUS_11640 4672 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence144 3 281 gene locus_tag LOCUS_11650 3 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 278 817 gene locus_tag LOCUS_11660 278 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1073 998 gene locus_tag LOCUS_t00160 1073 998 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1371 1162 gene locus_tag LOCUS_11670 1371 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1428 1751 gene locus_tag LOCUS_11680 gene grxD 1428 1751 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_11680 1816 3048 gene locus_tag LOCUS_11690 gene ccoG 1816 3048 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 protein_id gnl|my_center|LOCUS_11690 3052 3492 gene locus_tag LOCUS_11700 3052 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3545 3760 gene locus_tag LOCUS_11710 3545 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3757 4167 gene locus_tag LOCUS_11720 3757 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence145 477 172 gene locus_tag LOCUS_11730 477 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2544 544 gene locus_tag LOCUS_11740 2544 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2951 2598 gene locus_tag LOCUS_11750 2951 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4195 3047 gene locus_tag LOCUS_11760 4195 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4304 4990 gene locus_tag LOCUS_11770 4304 4990 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence146 <1 3015 gene locus_tag LOCUS_11780 <1 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070862.1:efflux RND transporter permease subunit 3129 3917 gene locus_tag LOCUS_11790 3129 3917 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_11790 4046 4672 gene locus_tag LOCUS_11800 4046 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence147 1662 1174 gene locus_tag LOCUS_11810 gene ccmE 1662 1174 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_11810 2520 1846 gene locus_tag LOCUS_11820 gene ccmC 2520 1846 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_11820 3231 2602 gene locus_tag LOCUS_11830 gene ccmB 3231 2602 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982362.1 protein_id gnl|my_center|LOCUS_11830 3899 3282 gene locus_tag LOCUS_11840 gene ccmA 3899 3282 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525610.1 protein_id gnl|my_center|LOCUS_11840 3991 4287 gene locus_tag LOCUS_11850 3991 4287 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence148 951 1481 gene locus_tag LOCUS_11860 951 1481 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461721.1 protein_id gnl|my_center|LOCUS_11860 2223 1483 gene locus_tag LOCUS_11870 2223 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2931 2434 gene locus_tag LOCUS_11880 2931 2434 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_11880 3701 2937 gene locus_tag LOCUS_11890 3701 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5083 3698 gene locus_tag LOCUS_11900 gene tilS 5083 3698 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence149 1499 219 gene locus_tag LOCUS_11910 1499 219 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_11910 2473 1496 gene locus_tag LOCUS_11920 2473 1496 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_11920 3036 2470 gene locus_tag LOCUS_11930 gene pyrR 3036 2470 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_11930 3437 2979 gene locus_tag LOCUS_11940 gene ruvX 3437 2979 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356737.1 protein_id gnl|my_center|LOCUS_11940 4006 3434 gene locus_tag LOCUS_11950 4006 3434 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_11950 4839 4003 gene locus_tag LOCUS_11960 4839 4003 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence150 2152 356 gene locus_tag LOCUS_11970 gene fimW 2152 356 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_11970 3315 2269 gene locus_tag LOCUS_11980 gene epmB 3315 2269 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_11980 3356 3925 gene locus_tag LOCUS_11990 gene efp 3356 3925 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_11990 3958 4905 gene locus_tag LOCUS_12000 gene epmA 3958 4905 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770152.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence151 484 966 gene locus_tag LOCUS_12010 484 966 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_12010 972 1895 gene locus_tag LOCUS_12020 972 1895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_12020 1909 2688 gene locus_tag LOCUS_12030 1909 2688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_12030 2725 3027 gene locus_tag LOCUS_12040 2725 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3011 3280 gene locus_tag LOCUS_12050 3011 3280 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041364541.1 protein_id gnl|my_center|LOCUS_12050 3317 4165 gene locus_tag LOCUS_12060 3317 4165 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966077.1 protein_id gnl|my_center|LOCUS_12060 4775 4305 gene locus_tag LOCUS_12070 4775 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence152 357 1013 gene locus_tag LOCUS_12080 gene ftsE 357 1013 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_12080 1010 2101 gene locus_tag LOCUS_12090 gene ftsX 1010 2101 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_12090 2648 2160 gene locus_tag LOCUS_12100 2648 2160 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 protein_id gnl|my_center|LOCUS_12100 3732 2773 gene locus_tag LOCUS_12110 3732 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4782 3736 gene locus_tag LOCUS_12120 4782 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence153 837 181 gene locus_tag LOCUS_12130 837 181 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_12130 1289 843 gene locus_tag LOCUS_12140 gene mlaD 1289 843 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_12140 2116 1286 gene locus_tag LOCUS_12150 2116 1286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_12150 2901 2113 gene locus_tag LOCUS_12160 2901 2113 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_12160 3416 2904 gene locus_tag LOCUS_12170 3416 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3559 4440 gene locus_tag LOCUS_12180 3559 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence154 1510 2523 gene locus_tag LOCUS_12190 gene tsaD 1510 2523 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_12190 2888 2565 gene locus_tag LOCUS_12200 2888 2565 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_12200 3066 3413 gene locus_tag LOCUS_12210 3066 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4334 3486 gene locus_tag LOCUS_12220 gene galU 4334 3486 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851421.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence155 <1 1077 gene locus_tag LOCUS_12230 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176758209.1:S8 family peptidase 1117 1193 gene locus_tag LOCUS_t00170 1117 1193 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2071 1286 gene locus_tag LOCUS_12240 gene xth 2071 1286 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_12240 2496 2068 gene locus_tag LOCUS_12250 2496 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3365 2493 gene locus_tag LOCUS_12260 gene prmC 3365 2493 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958568.1 protein_id gnl|my_center|LOCUS_12260 4450 3368 gene locus_tag LOCUS_12270 gene prfA 4450 3368 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_12270 <4952 4447 gene locus_tag LOCUS_12280 <4952 4447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095001.1:glutamyl-tRNA reductase >Feature sequence156 1031 621 gene locus_tag LOCUS_12290 1031 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2058 1159 gene locus_tag LOCUS_12300 gene prmA 2058 1159 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817286.1 protein_id gnl|my_center|LOCUS_12300 3406 2066 gene locus_tag LOCUS_12310 gene accC 3406 2066 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_12310 3880 3428 gene locus_tag LOCUS_12320 gene accB 3880 3428 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_12320 4384 3905 gene locus_tag LOCUS_12330 gene aroQ 4384 3905 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence157 901 272 gene locus_tag LOCUS_12340 gene sspA 901 272 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_12340 1069 3183 gene locus_tag LOCUS_12350 1069 3183 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704719.1 protein_id gnl|my_center|LOCUS_12350 3194 4264 gene locus_tag LOCUS_12360 gene mutY 3194 4264 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767127.1 protein_id gnl|my_center|LOCUS_12360 4270 4545 gene locus_tag LOCUS_12370 4270 4545 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947644.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence158 277 948 gene locus_tag LOCUS_12380 gene rnc 277 948 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_12380 935 1846 gene locus_tag LOCUS_12390 gene era 935 1846 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704750.1 protein_id gnl|my_center|LOCUS_12390 1853 2575 gene locus_tag LOCUS_12400 gene pdxJ 1853 2575 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772027.1 protein_id gnl|my_center|LOCUS_12400 2593 2967 gene locus_tag LOCUS_12410 gene acpS 2593 2967 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence159 247 612 gene locus_tag LOCUS_12420 247 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1144 800 gene locus_tag LOCUS_12430 1144 800 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence160 1991 339 gene locus_tag LOCUS_12440 1991 339 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_12440 4739 2130 gene locus_tag LOCUS_12450 4739 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence161 831 385 gene locus_tag LOCUS_12460 831 385 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708225.1 protein_id gnl|my_center|LOCUS_12460 1123 836 gene locus_tag LOCUS_12470 1123 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1578 1162 gene locus_tag LOCUS_12480 gene arfB 1578 1162 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_12480 1932 1591 gene locus_tag LOCUS_12490 gene phnA 1932 1591 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_12490 2177 2503 gene locus_tag LOCUS_12500 2177 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2632 3018 gene locus_tag LOCUS_12510 2632 3018 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_12510 3879 3079 gene locus_tag LOCUS_12520 gene dapB 3879 3079 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689993.1 protein_id gnl|my_center|LOCUS_12520 <4879 3882 gene locus_tag LOCUS_12530 <4879 3882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005157034.1:molecular chaperone DnaJ >Feature sequence162 50 787 gene locus_tag LOCUS_12540 50 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 787 1659 gene locus_tag LOCUS_12550 gene sucD 787 1659 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597642.1 protein_id gnl|my_center|LOCUS_12550 1666 3321 gene locus_tag LOCUS_12560 1666 3321 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_12560 3573 3331 gene locus_tag LOCUS_12570 3573 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4148 3585 gene locus_tag LOCUS_12580 4148 3585 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220007.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence163 <1 700 gene locus_tag LOCUS_12590 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002554476.1:MoxR family ATPase 766 1665 gene locus_tag LOCUS_12600 766 1665 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_12600 1662 2183 gene locus_tag LOCUS_12610 1662 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2171 3241 gene locus_tag LOCUS_12620 2171 3241 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence164 <1 1846 gene locus_tag LOCUS_12630 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014749525.1:acyltransferase family protein 1860 2621 gene locus_tag LOCUS_12640 1860 2621 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_12640 2848 3552 gene locus_tag LOCUS_12650 2848 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence165 921 40 gene locus_tag LOCUS_12660 921 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2046 934 gene locus_tag LOCUS_12670 gene pheA 2046 934 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_12670 3209 2043 gene locus_tag LOCUS_12680 3209 2043 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_12680 4298 3216 gene locus_tag LOCUS_12690 gene serC 4298 3216 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence166 291 1763 gene locus_tag LOCUS_12700 gene nhaD 291 1763 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_12700 2555 1770 gene locus_tag LOCUS_12710 2555 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3143 2559 gene locus_tag LOCUS_12720 gene plsY 3143 2559 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418652.1 protein_id gnl|my_center|LOCUS_12720 3222 3578 gene locus_tag LOCUS_12730 gene folB 3222 3578 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_12730 3586 4080 gene locus_tag LOCUS_12740 gene folK 3586 4080 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_12740 <4730 4067 gene locus_tag LOCUS_12750 <4730 4067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443912.1:pteridine reductase >Feature sequence167 594 1097 gene locus_tag LOCUS_12760 594 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1543 1205 gene locus_tag LOCUS_12770 1543 1205 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196851.1 protein_id gnl|my_center|LOCUS_12770 2691 1657 gene locus_tag LOCUS_12780 2691 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4568 2859 gene locus_tag LOCUS_12790 gene dnaG 4568 2859 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence168 1851 1027 gene locus_tag LOCUS_12800 1851 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 3047 1896 gene locus_tag LOCUS_12810 3047 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3793 3089 gene locus_tag LOCUS_12820 3793 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4548 3811 gene locus_tag LOCUS_12830 4548 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence169 357 761 gene locus_tag LOCUS_12840 357 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 835 1428 gene locus_tag LOCUS_12850 835 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2060 3148 gene locus_tag LOCUS_12860 2060 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3151 3624 gene locus_tag LOCUS_12870 3151 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3729 4106 gene locus_tag LOCUS_12880 3729 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4184 4441 gene locus_tag LOCUS_12890 4184 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence170 2123 1389 gene locus_tag LOCUS_12900 2123 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2545 2123 gene locus_tag LOCUS_12910 2545 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4438 2948 gene locus_tag LOCUS_12920 4438 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence171 634 1128 gene locus_tag LOCUS_12930 634 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1224 1985 gene locus_tag LOCUS_12940 1224 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2053 2889 gene locus_tag LOCUS_12950 2053 2889 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_12950 2892 3779 gene locus_tag LOCUS_12960 2892 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4390 3776 gene locus_tag LOCUS_12970 4390 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence172 671 746 gene locus_tag LOCUS_t00180 671 746 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 779 855 gene locus_tag LOCUS_t00190 779 855 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1340 2275 gene locus_tag LOCUS_12980 1340 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2290 2931 gene locus_tag LOCUS_12990 2290 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4256 2928 gene locus_tag LOCUS_13000 4256 2928 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence173 1939 338 gene locus_tag LOCUS_13010 1939 338 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_13010 2805 2005 gene locus_tag LOCUS_13020 2805 2005 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 protein_id gnl|my_center|LOCUS_13020 4204 2960 gene locus_tag LOCUS_13030 4204 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4639 4466 gene locus_tag LOCUS_13040 4639 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence174 360 1661 gene locus_tag LOCUS_13050 gene rsmB 360 1661 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958533.1 protein_id gnl|my_center|LOCUS_13050 1674 2255 gene locus_tag LOCUS_13060 1674 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2237 4387 gene locus_tag LOCUS_13070 2237 4387 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence175 900 238 gene locus_tag LOCUS_13080 900 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1288 1749 gene locus_tag LOCUS_13090 1288 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1879 2466 gene locus_tag LOCUS_13100 1879 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2825 3436 gene locus_tag LOCUS_13110 2825 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3620 3820 gene locus_tag LOCUS_13120 3620 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3882 4178 gene locus_tag LOCUS_13130 3882 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence176 <1 679 gene locus_tag LOCUS_13140 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091343.1:NAD(+) kinase 686 2371 gene locus_tag LOCUS_13150 gene recN 686 2371 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420633.1 protein_id gnl|my_center|LOCUS_13150 3017 2388 gene locus_tag LOCUS_13160 3017 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3466 3056 gene locus_tag LOCUS_13170 gene fur 3466 3056 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_13170 3494 3811 gene locus_tag LOCUS_13180 3494 3811 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121740.1 protein_id gnl|my_center|LOCUS_13180 4160 3819 gene locus_tag LOCUS_13190 4160 3819 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 protein_id gnl|my_center|LOCUS_13190 4584 4153 gene locus_tag LOCUS_13200 4584 4153 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005773021.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence177 711 7 gene locus_tag LOCUS_13210 711 7 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 protein_id gnl|my_center|LOCUS_13210 2482 719 gene locus_tag LOCUS_13220 gene sdhA 2482 719 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188402.1 protein_id gnl|my_center|LOCUS_13220 2817 2485 gene locus_tag LOCUS_13230 2817 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3221 2814 gene locus_tag LOCUS_13240 gene sdhC 3221 2814 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_13240 3337 4260 gene locus_tag LOCUS_13250 gene ygfZ 3337 4260 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209940.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence178 370 1323 gene locus_tag LOCUS_13260 370 1323 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393683.1 protein_id gnl|my_center|LOCUS_13260 1331 1564 gene locus_tag LOCUS_13270 1331 1564 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_13270 1675 2994 gene locus_tag LOCUS_13280 1675 2994 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_13280 3196 4047 gene locus_tag LOCUS_13290 3196 4047 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence179 672 1265 gene locus_tag LOCUS_13300 gene hisB 672 1265 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_13300 1269 1913 gene locus_tag LOCUS_13310 gene hisH 1269 1913 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_13310 1921 2658 gene locus_tag LOCUS_13320 gene hisA 1921 2658 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372206.1 protein_id gnl|my_center|LOCUS_13320 2659 3432 gene locus_tag LOCUS_13330 gene hisF 2659 3432 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_13330 3429 3821 gene locus_tag LOCUS_13340 gene hisI 3429 3821 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403068.1 protein_id gnl|my_center|LOCUS_13340 3818 4132 gene locus_tag LOCUS_13350 3818 4132 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_13350 4191 4430 gene locus_tag LOCUS_13360 gene tatA 4191 4430 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073885.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence180 1328 777 gene locus_tag LOCUS_13370 gene hslV 1328 777 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_13370 2269 1355 gene locus_tag LOCUS_13380 gene xerC 2269 1355 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_13380 2973 2272 gene locus_tag LOCUS_13390 2973 2272 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_13390 3808 3098 gene locus_tag LOCUS_13400 gene dapF 3808 3098 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655521.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13400 4362 3838 gene locus_tag LOCUS_13410 gene ppa 4362 3838 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence181 2182 668 gene locus_tag LOCUS_13420 2182 668 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_13420 2469 3236 gene locus_tag LOCUS_13430 2469 3236 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_13430 3673 3254 gene locus_tag LOCUS_13440 3673 3254 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence182 2348 240 gene locus_tag LOCUS_13450 2348 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2689 2345 gene locus_tag LOCUS_13460 2689 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3383 2718 gene locus_tag LOCUS_13470 3383 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13470 2738 2747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence183 1237 551 gene locus_tag LOCUS_13480 1237 551 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_13480 1359 2255 gene locus_tag LOCUS_13490 1359 2255 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_13490 3645 2257 gene locus_tag LOCUS_13500 gene cusS 3645 2257 CDS product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253852.1 protein_id gnl|my_center|LOCUS_13500 4325 3642 gene locus_tag LOCUS_13510 4325 3642 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence184 <1 559 gene locus_tag LOCUS_13520 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707370.1:cytochrome ubiquinol oxidase subunit I 576 1676 gene locus_tag LOCUS_13530 gene cydB 576 1676 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_13530 1648 1797 gene locus_tag LOCUS_13540 1648 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1930 2793 gene locus_tag LOCUS_13550 1930 2793 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_13550 3031 3549 gene locus_tag LOCUS_13560 3031 3549 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143383.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence185 1897 443 gene locus_tag LOCUS_13570 gene gcvPB 1897 443 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_13570 2419 1922 gene locus_tag LOCUS_13580 gene tpx 2419 1922 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 protein_id gnl|my_center|LOCUS_13580 3792 2425 gene locus_tag LOCUS_13590 gene gcvPA 3792 2425 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_13590 4193 3801 gene locus_tag LOCUS_13600 gene gcvH 4193 3801 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence186 2304 1642 gene locus_tag LOCUS_13610 gene coq7 2304 1642 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214319.1 protein_id gnl|my_center|LOCUS_13610 3423 2305 gene locus_tag LOCUS_13620 3423 2305 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209608.1 protein_id gnl|my_center|LOCUS_13620 3629 4366 gene locus_tag LOCUS_13630 3629 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence187 <1 1089 gene locus_tag LOCUS_13640 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037640.1:polyribonucleotide nucleotidyltransferase 1578 3140 gene locus_tag LOCUS_13650 1578 3140 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence188 223 1239 gene locus_tag LOCUS_13660 gene ilvC 223 1239 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_13660 1381 2748 gene locus_tag LOCUS_13670 1381 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2828 3655 gene locus_tag LOCUS_13680 2828 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 <4421 3659 gene locus_tag LOCUS_13690 <4421 3659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024666072.1:ABC-F family ATPase >Feature sequence189 1715 168 gene locus_tag LOCUS_13700 gene gpmI 1715 168 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_13700 1857 2282 gene locus_tag LOCUS_13710 1857 2282 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029413.1 protein_id gnl|my_center|LOCUS_13710 2307 2837 gene locus_tag LOCUS_13720 gene secB 2307 2837 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035459.1 protein_id gnl|my_center|LOCUS_13720 2841 3839 gene locus_tag LOCUS_13730 gene gpsA 2841 3839 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208975.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence190 2756 3289 gene locus_tag LOCUS_13740 2756 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3267 3578 gene locus_tag LOCUS_13750 3267 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence191 2192 3052 gene locus_tag LOCUS_13760 2192 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3094 3906 gene locus_tag LOCUS_13770 3094 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence192 1326 175 gene locus_tag LOCUS_13780 1326 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3203 1356 gene locus_tag LOCUS_13790 3203 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4353 3187 gene locus_tag LOCUS_13800 4353 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence193 1257 280 gene locus_tag LOCUS_13810 1257 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1941 1258 gene locus_tag LOCUS_13820 1941 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4016 1941 gene locus_tag LOCUS_13830 4016 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence194 3795 766 gene locus_tag LOCUS_13840 3795 766 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence195 2461 1481 gene locus_tag LOCUS_13850 2461 1481 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_13850 3501 2458 gene locus_tag LOCUS_13860 gene plsX 3501 2458 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_13860 3680 3516 gene locus_tag LOCUS_13870 gene rpmF 3680 3516 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420138.1 protein_id gnl|my_center|LOCUS_13870 4309 3755 gene locus_tag LOCUS_13880 4309 3755 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence196 530 33 gene locus_tag LOCUS_13890 530 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 955 527 gene locus_tag LOCUS_13900 955 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13900 1662 1156 gene locus_tag LOCUS_13910 1662 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2854 1880 gene locus_tag LOCUS_13920 2854 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 <4345 2869 gene locus_tag LOCUS_13930 <4345 2869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815301.1:copper resistance system multicopper oxidase >Feature sequence197 1835 1029 gene locus_tag LOCUS_13940 1835 1029 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_13940 3283 1838 gene locus_tag LOCUS_13950 3283 1838 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072785.1 protein_id gnl|my_center|LOCUS_13950 <4339 3280 gene locus_tag LOCUS_13960 <4339 3280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707637.1:excinuclease ABC subunit UvrA >Feature sequence198 <1 683 gene locus_tag LOCUS_13970 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391107.1:SCO family protein 1340 663 gene locus_tag LOCUS_13980 1340 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3339 1570 gene locus_tag LOCUS_13990 3339 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3993 3514 gene locus_tag LOCUS_14000 3993 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence199 577 1173 gene locus_tag LOCUS_14010 577 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1321 1545 gene locus_tag LOCUS_14020 1321 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1548 2432 gene locus_tag LOCUS_14030 1548 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2446 3771 gene locus_tag LOCUS_14040 2446 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3773 4237 gene locus_tag LOCUS_14050 3773 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence200 136 570 gene locus_tag LOCUS_14060 gene rplO 136 570 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021585.1 protein_id gnl|my_center|LOCUS_14060 575 1906 gene locus_tag LOCUS_14070 gene secY 575 1906 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_14070 2141 2497 gene locus_tag LOCUS_14080 gene rpsM 2141 2497 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 protein_id gnl|my_center|LOCUS_14080 2511 2900 gene locus_tag LOCUS_14090 gene rpsK 2511 2900 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_14090 2939 3568 gene locus_tag LOCUS_14100 gene rpsD 2939 3568 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence201 396 1682 gene locus_tag LOCUS_14110 396 1682 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815728.1 protein_id gnl|my_center|LOCUS_14110 1675 3198 gene locus_tag LOCUS_14120 1675 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence202 590 117 gene locus_tag LOCUS_14130 590 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 965 2032 gene locus_tag LOCUS_14140 965 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2042 2752 gene locus_tag LOCUS_14150 2042 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2749 3123 gene locus_tag LOCUS_14160 2749 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3162 4103 gene locus_tag LOCUS_14170 3162 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence203 492 1526 gene locus_tag LOCUS_14180 gene gmd 492 1526 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056622.1 protein_id gnl|my_center|LOCUS_14180 1550 2452 gene locus_tag LOCUS_14190 1550 2452 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963753.1 protein_id gnl|my_center|LOCUS_14190 2454 3473 gene locus_tag LOCUS_14200 2454 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence204 <1 806 gene locus_tag LOCUS_14210 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase 3059 822 gene locus_tag LOCUS_14220 3059 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 <4201 3324 gene locus_tag LOCUS_14230 <4201 3324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909061.1:aspartate ammonia-lyase >Feature sequence205 1599 847 gene locus_tag LOCUS_14240 1599 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2613 1690 gene locus_tag LOCUS_14250 2613 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3177 2626 gene locus_tag LOCUS_14260 3177 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3727 3179 gene locus_tag LOCUS_14270 3727 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence206 2717 654 gene locus_tag LOCUS_14280 gene glyS 2717 654 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040948212.1 protein_id gnl|my_center|LOCUS_14280 3612 2707 gene locus_tag LOCUS_14290 gene glyQ 3612 2707 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 protein_id gnl|my_center|LOCUS_14290 <4170 3637 gene locus_tag LOCUS_14300 <4170 3637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:TRAP transporter substrate-binding protein DctP >Feature sequence207 34 422 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtgcggcagtgaac 1244 627 gene locus_tag LOCUS_14310 gene cas6f 1244 627 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_14310 2314 1241 gene locus_tag LOCUS_14320 gene csy3 2314 1241 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_14320 3531 2332 gene locus_tag LOCUS_14330 3531 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 <4157 3528 gene locus_tag LOCUS_14340 <4157 3528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415806.1:type I-F CRISPR-associated protein Csy1 >Feature sequence208 349 1329 gene locus_tag LOCUS_14350 gene algZ 349 1329 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_14350 1310 2053 gene locus_tag LOCUS_14360 gene algR 1310 2053 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_14360 2081 3010 gene locus_tag LOCUS_14370 gene hemC 2081 3010 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 protein_id gnl|my_center|LOCUS_14370 3141 3806 gene locus_tag LOCUS_14380 3141 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence209 <1 514 gene locus_tag LOCUS_14390 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003368564.1:enoyl-ACP reductase FabI 533 790 gene locus_tag LOCUS_14400 533 790 CDS product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_14400 803 1375 gene locus_tag LOCUS_14410 803 1375 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_14410 1743 2381 gene locus_tag LOCUS_14420 1743 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2391 3491 gene locus_tag LOCUS_14430 2391 3491 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 protein_id gnl|my_center|LOCUS_14430 <4112 3529 gene locus_tag LOCUS_14440 <4112 3529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000835021.1:anhydro-N-acetylmuramic acid kinase >Feature sequence210 998 306 gene locus_tag LOCUS_14450 gene aat 998 306 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_14450 1414 1007 gene locus_tag LOCUS_14460 gene queF 1414 1007 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_14460 1604 2038 gene locus_tag LOCUS_14470 1604 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence211 877 2091 gene locus_tag LOCUS_14480 877 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence212 2874 82 gene locus_tag LOCUS_14490 gene ppc 2874 82 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_14490 <4060 3031 gene locus_tag LOCUS_14500 <4060 3031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162470643.1:lysine--tRNA ligase >Feature sequence213 51 126 gene locus_tag LOCUS_t00200 51 126 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1300 152 gene locus_tag LOCUS_14510 1300 152 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120816036.1 protein_id gnl|my_center|LOCUS_14510 1455 1297 gene locus_tag LOCUS_14520 1455 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2689 1445 gene locus_tag LOCUS_14530 2689 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3062 2679 gene locus_tag LOCUS_14540 3062 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence214 1289 12 gene locus_tag LOCUS_14550 gene clpX 1289 12 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_14550 1923 1321 gene locus_tag LOCUS_14560 gene clpP 1923 1321 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_14560 3241 1934 gene locus_tag LOCUS_14570 gene tig 3241 1934 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095856.1 protein_id gnl|my_center|LOCUS_14570 3366 3282 gene locus_tag LOCUS_t00210 3366 3282 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3957 3484 gene locus_tag LOCUS_14580 3957 3484 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence215 1276 1800 gene locus_tag LOCUS_14590 1276 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3263 1758 gene locus_tag LOCUS_14600 gene lnt 3263 1758 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_14600 <4014 3308 gene locus_tag LOCUS_14610 <4014 3308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093161.1:HlyC/CorC family transporter >Feature sequence216 1464 1132 gene locus_tag LOCUS_14620 1464 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2148 1537 gene locus_tag LOCUS_14630 2148 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2820 2176 gene locus_tag LOCUS_14640 2820 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3618 2842 gene locus_tag LOCUS_14650 3618 2842 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940035.1 protein_id gnl|my_center|LOCUS_14650 4008 3622 gene locus_tag LOCUS_14660 4008 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence217 553 239 gene locus_tag LOCUS_14670 gene rplU 553 239 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_14670 812 1537 gene locus_tag LOCUS_14680 812 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_14680 3542 1545 gene locus_tag LOCUS_14690 3542 1545 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence218 973 29 gene locus_tag LOCUS_14700 gene secF 973 29 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_14700 2839 977 gene locus_tag LOCUS_14710 gene secD 2839 977 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_14710 3205 2855 gene locus_tag LOCUS_14720 gene yajC 3205 2855 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 protein_id gnl|my_center|LOCUS_14720 3432 3716 gene locus_tag LOCUS_14730 3432 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence219 227 418 gene locus_tag LOCUS_14740 227 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 426 1502 gene locus_tag LOCUS_14750 426 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3016 1499 gene locus_tag LOCUS_14760 3016 1499 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 protein_id gnl|my_center|LOCUS_14760 3534 3028 gene locus_tag LOCUS_14770 3534 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence220 779 69 gene locus_tag LOCUS_14780 779 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1930 776 gene locus_tag LOCUS_14790 1930 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2604 2206 gene locus_tag LOCUS_14800 2604 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3470 3111 gene locus_tag LOCUS_14810 3470 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence221 <1 769 gene locus_tag LOCUS_14820 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025566951.1:NADH-quinone oxidoreductase subunit L 927 2261 gene locus_tag LOCUS_14830 927 2261 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_14830 2261 3652 gene locus_tag LOCUS_14840 gene fpoN 2261 3652 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence222 914 51 gene locus_tag LOCUS_14850 914 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1052 1222 gene locus_tag LOCUS_14860 1052 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_14860 1223 1489 gene locus_tag LOCUS_14870 1223 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2420 1701 gene locus_tag LOCUS_14880 2420 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14880 2735 2496 gene locus_tag LOCUS_14890 2735 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence223 <1 783 gene locus_tag LOCUS_14900 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770152.1:elongation factor P--(R)-beta-lysine ligase 897 1472 gene locus_tag LOCUS_14910 897 1472 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_14910 1855 2697 gene locus_tag LOCUS_14920 1855 2697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence224 1497 76 gene locus_tag LOCUS_14930 1497 76 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_14930 1521 3134 gene locus_tag LOCUS_14940 1521 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence225 157 390 gene locus_tag LOCUS_14950 157 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2553 700 gene locus_tag LOCUS_14960 2553 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3439 2942 gene locus_tag LOCUS_14970 3439 2942 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence226 513 1382 gene locus_tag LOCUS_14980 513 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1500 1928 gene locus_tag LOCUS_14990 gene rplM 1500 1928 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_14990 1945 2337 gene locus_tag LOCUS_15000 gene rpsI 1945 2337 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 protein_id gnl|my_center|LOCUS_15000 2572 3756 gene locus_tag LOCUS_15010 gene nhaA 2572 3756 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence227 426 181 gene locus_tag LOCUS_15020 426 181 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_15020 970 443 gene locus_tag LOCUS_15030 970 443 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103010.1 protein_id gnl|my_center|LOCUS_15030 2365 1007 gene locus_tag LOCUS_15040 gene gorA 2365 1007 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989611.1 protein_id gnl|my_center|LOCUS_15040 3644 2367 gene locus_tag LOCUS_15050 3644 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence228 322 813 gene locus_tag LOCUS_15060 322 813 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_15060 823 1041 gene locus_tag LOCUS_15070 823 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1028 2176 gene locus_tag LOCUS_15080 1028 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2806 2147 gene locus_tag LOCUS_15090 gene bioD 2806 2147 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_15090 3702 2806 gene locus_tag LOCUS_15100 gene bioC 3702 2806 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957596.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence229 2876 2508 gene locus_tag LOCUS_15110 2876 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3338 3009 gene locus_tag LOCUS_15120 3338 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence230 1353 73 gene locus_tag LOCUS_15130 1353 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3724 1346 gene locus_tag LOCUS_15140 3724 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1518 1527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence231 907 2328 gene locus_tag LOCUS_15150 907 2328 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_15150 2347 3684 gene locus_tag LOCUS_15160 2347 3684 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence232 <1 1252 gene locus_tag LOCUS_15170 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057783.1:class I SAM-dependent methyltransferase 1789 1430 gene locus_tag LOCUS_15180 1789 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2958 1858 gene locus_tag LOCUS_15190 2958 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3296 3380 gene locus_tag LOCUS_t00220 3296 3380 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3398 3471 gene locus_tag LOCUS_t00230 3398 3471 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3496 3571 gene locus_tag LOCUS_t00240 3496 3571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence233 1353 94 gene locus_tag LOCUS_15200 1353 94 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_15200 2124 1438 gene locus_tag LOCUS_15210 2124 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2819 2121 gene locus_tag LOCUS_15220 2819 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3513 2839 gene locus_tag LOCUS_15230 gene purN 3513 2839 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence234 257 820 gene locus_tag LOCUS_15240 257 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 838 1866 gene locus_tag LOCUS_15250 838 1866 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_15250 1878 3353 gene locus_tag LOCUS_15260 1878 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence235 757 359 gene locus_tag LOCUS_15270 gene vapC 757 359 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651560.1 protein_id gnl|my_center|LOCUS_15270 990 757 gene locus_tag LOCUS_15280 990 757 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649046.1 protein_id gnl|my_center|LOCUS_15280 3713 1131 gene locus_tag LOCUS_15290 3713 1131 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence236 643 1869 gene locus_tag LOCUS_15300 643 1869 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 protein_id gnl|my_center|LOCUS_15300 1975 3018 gene locus_tag LOCUS_15310 1975 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence237 <1 583 gene locus_tag LOCUS_15320 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005619689.1:phosphoribosylanthranilate isomerase 573 1271 gene locus_tag LOCUS_15330 573 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1285 2541 gene locus_tag LOCUS_15340 1285 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence238 157 849 gene locus_tag LOCUS_15350 157 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2349 1564 gene locus_tag LOCUS_15360 2349 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3124 2351 gene locus_tag LOCUS_15370 gene pgeF 3124 2351 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261321.1 protein_id gnl|my_center|LOCUS_15370 <3646 3121 gene locus_tag LOCUS_15380 <3646 3121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249403.1:ribosome biogenesis GTPase Der >Feature sequence239 <1 952 gene locus_tag LOCUS_15390 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097294.1:LysM peptidoglycan-binding domain-containing protein 927 2102 gene locus_tag LOCUS_15400 gene dprA 927 2102 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_15400 2127 2609 gene locus_tag LOCUS_15410 2127 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence240 3292 1355 gene locus_tag LOCUS_15420 gene gyrB 3292 1355 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence241 <1 1121 gene locus_tag LOCUS_15430 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091383.1:amidophosphoribosyltransferase 1140 2315 gene locus_tag LOCUS_15440 1140 2315 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770586.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence242 <1 536 gene locus_tag LOCUS_15450 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026312796.1:type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein 567 1475 gene locus_tag LOCUS_15460 567 1475 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_15460 2067 1534 gene locus_tag LOCUS_15470 2067 1534 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_15470 3297 2287 gene locus_tag LOCUS_15480 3297 2287 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071718.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence243 904 98 gene locus_tag LOCUS_15490 gene folP 904 98 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913082.1 protein_id gnl|my_center|LOCUS_15490 2868 919 gene locus_tag LOCUS_15500 gene ftsH 2868 919 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_15500 3575 2955 gene locus_tag LOCUS_15510 gene rlmE 3575 2955 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence244 742 209 gene locus_tag LOCUS_15520 742 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1266 739 gene locus_tag LOCUS_15530 1266 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2658 1276 gene locus_tag LOCUS_15540 gene nrfD 2658 1276 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_15540 3548 2700 gene locus_tag LOCUS_15550 3548 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence245 244 513 gene locus_tag LOCUS_15560 244 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 707 2383 gene locus_tag LOCUS_15570 gene yidC 707 2383 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence246 1320 1661 gene locus_tag LOCUS_15580 1320 1661 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_15580 1675 3561 gene locus_tag LOCUS_15590 gene dsbD 1675 3561 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931570.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence247 802 413 gene locus_tag LOCUS_15600 802 413 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_15600 1023 805 gene locus_tag LOCUS_15610 1023 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1505 1107 gene locus_tag LOCUS_15620 1505 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1731 1489 gene locus_tag LOCUS_15630 1731 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2226 1810 gene locus_tag LOCUS_15640 2226 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 <3568 2270 gene locus_tag LOCUS_15650 <3568 2270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113833.1:flotillin family protein >Feature sequence248 1542 400 gene locus_tag LOCUS_15660 1542 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1598 1741 gene locus_tag LOCUS_15670 1598 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3256 2039 gene locus_tag LOCUS_15680 3256 2039 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence249 222 19 gene locus_tag LOCUS_15690 222 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 318 2210 gene locus_tag LOCUS_15700 gene glmS 318 2210 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_15700 3296 2274 gene locus_tag LOCUS_15710 gene galE 3296 2274 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence250 816 331 gene locus_tag LOCUS_15720 gene msrB 816 331 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 protein_id gnl|my_center|LOCUS_15720 1637 906 gene locus_tag LOCUS_15730 1637 906 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_15730 2599 1640 gene locus_tag LOCUS_15740 2599 1640 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 protein_id gnl|my_center|LOCUS_15740 3025 2642 gene locus_tag LOCUS_15750 3025 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence251 1757 825 gene locus_tag LOCUS_15760 gene mdh 1757 825 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_15760 3033 1777 gene locus_tag LOCUS_15770 3033 1777 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266374.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence252 261 1109 gene locus_tag LOCUS_15780 gene rsmI 261 1109 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770442.1 protein_id gnl|my_center|LOCUS_15780 1877 1269 gene locus_tag LOCUS_15790 gene coaE 1877 1269 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772796.1 protein_id gnl|my_center|LOCUS_15790 2744 1884 gene locus_tag LOCUS_15800 2744 1884 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_15800 <3481 2794 gene locus_tag LOCUS_15810 <3481 2794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070775.1:type II secretion system F family protein >Feature sequence253 481 1812 gene locus_tag LOCUS_15820 481 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2020 3384 gene locus_tag LOCUS_15830 gene rhlE 2020 3384 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704814.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence254 <1 530 gene locus_tag LOCUS_15840 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763027.1:ATP phosphoribosyltransferase regulatory subunit 523 1827 gene locus_tag LOCUS_15850 523 1827 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_15850 3102 1903 gene locus_tag LOCUS_15860 gene bioF 3102 1903 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence255 1810 2856 gene locus_tag LOCUS_15870 gene hrcA 1810 2856 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence256 3 2306 gene locus_tag LOCUS_15880 3 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2320 2580 gene locus_tag LOCUS_15890 2320 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965331.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence257 617 297 gene locus_tag LOCUS_15900 617 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1824 1354 gene locus_tag LOCUS_15910 1824 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2406 2002 gene locus_tag LOCUS_15920 2406 2002 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_15920 2759 2412 gene locus_tag LOCUS_15930 2759 2412 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence258 395 81 gene locus_tag LOCUS_15940 395 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 3038 573 gene locus_tag LOCUS_15950 3038 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence259 420 70 gene locus_tag LOCUS_15960 420 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 438 1652 gene locus_tag LOCUS_15970 438 1652 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_15970 1652 2554 gene locus_tag LOCUS_15980 gene argF 1652 2554 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence260 344 2269 gene locus_tag LOCUS_15990 gene btuB 344 2269 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_15990 2285 2893 gene locus_tag LOCUS_16000 2285 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence261 295 1287 gene locus_tag LOCUS_16010 295 1287 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703607.1 protein_id gnl|my_center|LOCUS_16010 1304 2998 gene locus_tag LOCUS_16020 1304 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence262 20 1192 gene locus_tag LOCUS_16030 gene odhB 20 1192 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_16030 2502 1201 gene locus_tag LOCUS_16040 2502 1201 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_16040 2648 3238 gene locus_tag LOCUS_16050 2648 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence263 <1 597 gene locus_tag LOCUS_16060 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119704.1:GTP 3',8-cyclase MoaA 630 1130 gene locus_tag LOCUS_16070 gene moaC 630 1130 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_16070 1127 1363 gene locus_tag LOCUS_16080 1127 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16080 1369 1827 gene locus_tag LOCUS_16090 gene moaE 1369 1827 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_16090 2001 2327 gene locus_tag LOCUS_16100 2001 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence264 813 307 gene locus_tag LOCUS_16110 813 307 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016073.1 protein_id gnl|my_center|LOCUS_16110 1870 911 gene locus_tag LOCUS_16120 1870 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2704 1892 gene locus_tag LOCUS_16130 2704 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3293 2865 gene locus_tag LOCUS_16140 3293 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence265 608 2248 gene locus_tag LOCUS_16150 608 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2248 2697 gene locus_tag LOCUS_16160 2248 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence266 2336 435 gene locus_tag LOCUS_16170 2336 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 <3259 2341 gene locus_tag LOCUS_16180 <3259 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037676.1:NAD(P)-binding domain-containing protein >Feature sequence267 907 176 gene locus_tag LOCUS_16190 907 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1804 932 gene locus_tag LOCUS_16200 gene metF 1804 932 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_16200 2374 1805 gene locus_tag LOCUS_16210 gene dcd 2374 1805 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 protein_id gnl|my_center|LOCUS_16210 <3256 2434 gene locus_tag LOCUS_16220 <3256 2434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772431.1:16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA >Feature sequence268 <1 1442 gene locus_tag LOCUS_16230 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958589.1:type I DNA topoisomerase 1530 1946 gene locus_tag LOCUS_16240 1530 1946 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence269 2 562 gene locus_tag LOCUS_16250 2 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 572 1624 gene locus_tag LOCUS_16260 gene nagZ 572 1624 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_16260 1624 2733 gene locus_tag LOCUS_16270 1624 2733 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence270 427 1326 gene locus_tag LOCUS_16280 427 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 <3245 1310 gene locus_tag LOCUS_16290 <3245 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence271 <1 1242 gene locus_tag LOCUS_16300 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003121316.1:phosphate regulon sensor histidine kinase PhoR 1348 2499 gene locus_tag LOCUS_16310 1348 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence272 1697 480 gene locus_tag LOCUS_16320 1697 480 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946380.1 protein_id gnl|my_center|LOCUS_16320 1916 1704 gene locus_tag LOCUS_16330 1916 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2142 2732 gene locus_tag LOCUS_16340 gene wrbA 2142 2732 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946383.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence273 1074 13 gene locus_tag LOCUS_16350 1074 13 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_16350 2359 1022 gene locus_tag LOCUS_16360 2359 1022 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_16360 <3180 2390 gene locus_tag LOCUS_16370 <3180 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957840.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence274 1376 729 gene locus_tag LOCUS_16380 1376 729 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_16380 1749 2750 gene locus_tag LOCUS_16390 1749 2750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337843.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence275 1415 984 gene locus_tag LOCUS_16400 gene iscR 1415 984 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_16400 1561 1647 gene locus_tag LOCUS_t00250 1561 1647 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1723 2103 gene locus_tag LOCUS_16410 gene queD 1723 2103 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_16410 2100 2906 gene locus_tag LOCUS_16420 gene folE2 2100 2906 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence276 1129 377 gene locus_tag LOCUS_16430 1129 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence277 480 2279 gene locus_tag LOCUS_16440 gene lepA 480 2279 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 protein_id gnl|my_center|LOCUS_16440 2276 3067 gene locus_tag LOCUS_16450 gene lepB 2276 3067 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958009.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence278 2 136 gene locus_tag LOCUS_16460 2 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 161 1276 gene locus_tag LOCUS_16470 gene tapW 161 1276 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_16470 1970 1281 gene locus_tag LOCUS_16480 1970 1281 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_16480 <3142 1977 gene locus_tag LOCUS_16490 <3142 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001264066.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence279 1485 982 gene locus_tag LOCUS_16500 1485 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2882 1968 gene locus_tag LOCUS_16510 2882 1968 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254254.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence280 <1 1165 gene locus_tag LOCUS_16520 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970207.1:glutamate synthase large subunit 1158 2591 gene locus_tag LOCUS_16530 1158 2591 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence281 257 1480 gene locus_tag LOCUS_16540 257 1480 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_16540 1505 2251 gene locus_tag LOCUS_16550 1505 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2262 2831 gene locus_tag LOCUS_16560 2262 2831 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940415.1 protein_id gnl|my_center|LOCUS_16560 2986 2816 gene locus_tag LOCUS_16570 2986 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence282 631 873 gene locus_tag LOCUS_16580 631 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 867 1133 gene locus_tag LOCUS_16590 867 1133 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_16590 2880 1525 gene locus_tag LOCUS_16600 gene radA 2880 1525 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770187.1 protein_id gnl|my_center|LOCUS_16600 3092 2880 gene locus_tag LOCUS_16610 3092 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence283 1430 900 gene locus_tag LOCUS_16620 1430 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence284 405 1478 gene locus_tag LOCUS_16630 gene rlmD 405 1478 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073303.1 protein_id gnl|my_center|LOCUS_16630 1834 1475 gene locus_tag LOCUS_16640 1834 1475 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_16640 2259 1849 gene locus_tag LOCUS_16650 2259 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2588 2433 gene locus_tag LOCUS_16660 2588 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence285 <1 1215 gene locus_tag LOCUS_16670 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401567.1:argininosuccinate lyase 1822 1175 gene locus_tag LOCUS_16680 1822 1175 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531477.1 protein_id gnl|my_center|LOCUS_16680 2291 1809 gene locus_tag LOCUS_16690 2291 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2429 2869 gene locus_tag LOCUS_16700 2429 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence286 2451 304 gene locus_tag LOCUS_16710 2451 304 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence287 583 1698 gene locus_tag LOCUS_16720 583 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence288 1709 696 gene locus_tag LOCUS_16730 1709 696 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_16730 2785 1709 gene locus_tag LOCUS_16740 2785 1709 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence289 <1 2030 gene locus_tag LOCUS_16750 <1 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:choice-of-anchor D domain-containing protein <3010 2019 gene locus_tag LOCUS_16760 <3010 2019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763035.1:YgiQ family radical SAM protein >Feature sequence290 1318 314 gene locus_tag LOCUS_16770 1318 314 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_16770 2675 1371 gene locus_tag LOCUS_16780 2675 1371 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence291 <1 2638 gene locus_tag LOCUS_16790 <1 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816260.1:aconitate hydratase AcnA >Feature sequence292 229 846 gene locus_tag LOCUS_16800 gene yihA 229 846 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341625.1 protein_id gnl|my_center|LOCUS_16800 2934 1081 gene locus_tag LOCUS_16810 2934 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence293 2368 98 gene locus_tag LOCUS_16820 2368 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2972 2637 gene locus_tag LOCUS_16830 2972 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence294 2100 1096 gene locus_tag LOCUS_16840 2100 1096 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_16840 2276 2446 gene locus_tag LOCUS_16850 2276 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2430 2439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence295 <1 569 gene locus_tag LOCUS_16860 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102990626.1:peptide chain release factor 2 998 609 gene locus_tag LOCUS_16870 998 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2307 1027 gene locus_tag LOCUS_16880 2307 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 <2964 2329 gene locus_tag LOCUS_16890 <2964 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107220.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence296 142 894 gene locus_tag LOCUS_16900 142 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1005 1562 gene locus_tag LOCUS_16910 1005 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence297 195 22 gene locus_tag LOCUS_16920 195 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1177 380 gene locus_tag LOCUS_16930 1177 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 404 413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1194 2198 gene locus_tag LOCUS_16940 gene murB 1194 2198 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009919043.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence298 1944 250 gene locus_tag LOCUS_16950 1944 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 <2941 1963 gene locus_tag LOCUS_16960 <2941 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein >Feature sequence299 315 1004 gene locus_tag LOCUS_16970 315 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1172 1687 gene locus_tag LOCUS_16980 1172 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence300 609 238 gene locus_tag LOCUS_16990 609 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1166 642 gene locus_tag LOCUS_17000 1166 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1843 1196 gene locus_tag LOCUS_17010 1843 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2551 1934 gene locus_tag LOCUS_17020 2551 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence301 <1 915 gene locus_tag LOCUS_17030 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945831.1:pyridoxal phosphate-dependent aminotransferase 1691 921 gene locus_tag LOCUS_17040 1691 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_17040 2297 1746 gene locus_tag LOCUS_17050 2297 1746 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_17050 <2873 2299 gene locus_tag LOCUS_17060 <2873 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225159.1:S41 family peptidase >Feature sequence302 2706 286 gene locus_tag LOCUS_17070 2706 286 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence303 <1 679 gene locus_tag LOCUS_17080 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810490.1:squalene synthase HpnC 816 1952 gene locus_tag LOCUS_17090 816 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1970 2863 gene locus_tag LOCUS_17100 gene cysM 1970 2863 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence304 14 1135 gene locus_tag LOCUS_17110 14 1135 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_17110 1142 1828 gene locus_tag LOCUS_17120 1142 1828 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_17120 1828 2424 gene locus_tag LOCUS_17130 1828 2424 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence305 561 37 gene locus_tag LOCUS_17140 gene folK 561 37 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_17140 1883 558 gene locus_tag LOCUS_17150 gene pcnB 1883 558 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444485.1 protein_id gnl|my_center|LOCUS_17150 2308 1979 gene locus_tag LOCUS_17160 2308 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence306 549 1844 gene locus_tag LOCUS_17170 gene dnaB 549 1844 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946475.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence307 1209 292 gene locus_tag LOCUS_17180 1209 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_17180 1521 1291 gene locus_tag LOCUS_17190 gene rpsR 1521 1291 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083042.1 protein_id gnl|my_center|LOCUS_17190 2001 1531 gene locus_tag LOCUS_17200 gene rpsF 2001 1531 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856034.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence308 <1 591 gene locus_tag LOCUS_17210 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932617.1:5,6-dimethylbenzimidazole synthase 1293 631 gene locus_tag LOCUS_17220 gene yrfG 1293 631 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_17220 1292 1864 gene locus_tag LOCUS_17230 gene nudE 1292 1864 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 protein_id gnl|my_center|LOCUS_17230 1861 2652 gene locus_tag LOCUS_17240 gene cysQ 1861 2652 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106799.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence309 1234 359 gene locus_tag LOCUS_17250 1234 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368614.1 protein_id gnl|my_center|LOCUS_17250 2389 2144 gene locus_tag LOCUS_17260 2389 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2606 2370 gene locus_tag LOCUS_17270 2606 2370 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence310 <1 1839 gene locus_tag LOCUS_17280 <1 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113794.1:valine--tRNA ligase 2196 1855 gene locus_tag LOCUS_17290 2196 1855 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence311 1562 1050 gene locus_tag LOCUS_17300 1562 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2252 1632 gene locus_tag LOCUS_17310 2252 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence312 950 594 gene locus_tag LOCUS_17320 950 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1090 1551 gene locus_tag LOCUS_17330 gene rnhA 1090 1551 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968914.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence313 1050 925 gene locus_tag LOCUS_17340 1050 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2366 1434 gene locus_tag LOCUS_17350 2366 1434 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_17350 2623 2369 gene locus_tag LOCUS_17360 2623 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence314 1654 155 gene locus_tag LOCUS_17370 1654 155 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044930.1 protein_id gnl|my_center|LOCUS_17370 <2788 1704 gene locus_tag LOCUS_17380 <2788 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092658.1:formate-dependent phosphoribosylglycinamide formyltransferase >Feature sequence315 511 2613 gene locus_tag LOCUS_17390 gene fusA 511 2613 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence316 1097 660 gene locus_tag LOCUS_17400 gene tsaE 1097 660 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095283.1 protein_id gnl|my_center|LOCUS_17400 1723 1097 gene locus_tag LOCUS_17410 gene hflD 1723 1097 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 protein_id gnl|my_center|LOCUS_17410 <2763 1708 gene locus_tag LOCUS_17420 <2763 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007019485.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence317 351 151 gene locus_tag LOCUS_17430 351 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 888 1310 gene locus_tag LOCUS_17440 gene umuD 888 1310 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_17440 1315 2604 gene locus_tag LOCUS_17450 1315 2604 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457648.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence318 402 1364 gene locus_tag LOCUS_17460 402 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2312 1434 gene locus_tag LOCUS_17470 gene htpX 2312 1434 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369784.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence319 144 341 gene locus_tag LOCUS_17480 144 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 951 316 gene locus_tag LOCUS_17490 951 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1632 1384 gene locus_tag LOCUS_17500 1632 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2717 1626 gene locus_tag LOCUS_17510 2717 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence320 854 354 gene locus_tag LOCUS_17520 854 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1083 1256 gene locus_tag LOCUS_17530 1083 1256 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098330.1 protein_id gnl|my_center|LOCUS_17530 1292 2410 gene locus_tag LOCUS_17540 1292 2410 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence321 340 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 431 1612 gene locus_tag LOCUS_17550 431 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 <2719 1633 gene locus_tag LOCUS_17560 <2719 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071579.1:LPS export ABC transporter permease LptG >Feature sequence322 2215 1238 gene locus_tag LOCUS_17570 2215 1238 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167741.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence323 3 212 gene locus_tag LOCUS_17580 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 205 1101 gene locus_tag LOCUS_17590 205 1101 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 protein_id gnl|my_center|LOCUS_17590 1094 2251 gene locus_tag LOCUS_17600 1094 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence324 1964 369 gene locus_tag LOCUS_17610 1964 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence325 2406 982 gene locus_tag LOCUS_17620 2406 982 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100179914.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence326 649 311 gene locus_tag LOCUS_17630 649 311 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_17630 1443 1234 gene locus_tag LOCUS_17640 gene merF 1443 1234 CDS product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_17640 1516 1932 gene locus_tag LOCUS_17650 1516 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2042 2533 gene locus_tag LOCUS_17660 2042 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence327 1072 524 gene locus_tag LOCUS_17670 gene def 1072 524 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_17670 1330 1124 gene locus_tag LOCUS_17680 1330 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 2238 1318 gene locus_tag LOCUS_17690 2238 1318 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 1380 1389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence328 90 776 gene locus_tag LOCUS_17700 90 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 858 1520 gene locus_tag LOCUS_17710 858 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533245.1 protein_id gnl|my_center|LOCUS_17710 1517 2359 gene locus_tag LOCUS_17720 1517 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence329 1038 1047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2105 1128 gene locus_tag LOCUS_17730 2105 1128 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167741.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence330 >Feature sequence331 1400 147 gene locus_tag LOCUS_17740 gene icd 1400 147 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_17740 1547 2506 gene locus_tag LOCUS_17750 gene accA 1547 2506 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364825.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence332 >Feature sequence333 934 2328 gene locus_tag LOCUS_17760 934 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence334 2043 676 gene locus_tag LOCUS_17770 gene miaB 2043 676 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence335 <1 1033 gene locus_tag LOCUS_17780 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958569.1:multidrug effflux MFS transporter 2367 1210 gene locus_tag LOCUS_17790 2367 1210 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817289.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence336 1267 254 gene locus_tag LOCUS_17800 1267 254 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_17800 1896 1264 gene locus_tag LOCUS_17810 gene tmk 1896 1264 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_17810 <2536 1886 gene locus_tag LOCUS_17820 <2536 1886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000592627.1:endolytic transglycosylase MltG >Feature sequence337 786 199 gene locus_tag LOCUS_17830 786 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 <2524 783 gene locus_tag LOCUS_17840 <2524 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875575.1:DUF1887 family CARF protein >Feature sequence338 <1 833 gene locus_tag LOCUS_17850 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706451.1:electron transport complex subunit RsxC 840 1913 gene locus_tag LOCUS_17860 gene rsxD 840 1913 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231887.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence339 889 542 gene locus_tag LOCUS_17870 889 542 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 protein_id gnl|my_center|LOCUS_17870 1057 1200 gene locus_tag LOCUS_17880 1057 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 <2496 1617 gene locus_tag LOCUS_17890 <2496 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000281123.1:mercury(II) reductase >Feature sequence340 164 331 gene locus_tag LOCUS_17900 164 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 328 747 gene locus_tag LOCUS_17910 328 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1107 1229 gene locus_tag LOCUS_17920 1107 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1461 2309 gene locus_tag LOCUS_17930 1461 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence341 1190 528 gene locus_tag LOCUS_17940 1190 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1362 1886 gene locus_tag LOCUS_17950 1362 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1876 2304 gene locus_tag LOCUS_17960 1876 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence342 1825 1010 gene locus_tag LOCUS_17970 gene htrB 1825 1010 CDS product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858051.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence343 262 1347 gene locus_tag LOCUS_17980 gene aroB 262 1347 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence344 <2428 1521 gene locus_tag LOCUS_17990 <2428 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958090.1:PD-(D/E)XK nuclease family protein >Feature sequence345 908 2356 gene locus_tag LOCUS_18000 gene glgA 908 2356 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence346 904 2271 gene locus_tag LOCUS_18010 904 2271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence347 <1 680 gene locus_tag LOCUS_18020 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266923.1:membrane-bound lytic murein transglycosylase MltF 1205 702 gene locus_tag LOCUS_18030 1205 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1346 1422 gene locus_tag LOCUS_t00260 1346 1422 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1468 1544 gene locus_tag LOCUS_t00270 1468 1544 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1554 1629 gene locus_tag LOCUS_t00280 1554 1629 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1684 1759 gene locus_tag LOCUS_t00290 1684 1759 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence348 1536 955 gene locus_tag LOCUS_18040 1536 955 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_18040 2384 1641 gene locus_tag LOCUS_18050 gene rluB 2384 1641 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence349 >Feature sequence350 1004 246 gene locus_tag LOCUS_18060 1004 246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702850.1 protein_id gnl|my_center|LOCUS_18060 2201 1104 gene locus_tag LOCUS_18070 2201 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence351 2176 1061 gene locus_tag LOCUS_18080 2176 1061 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence352 2353 620 gene locus_tag LOCUS_18090 gene pilB 2353 620 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence353 <1 1531 gene locus_tag LOCUS_18100 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092366.1:CTP synthase 1534 2367 gene locus_tag LOCUS_18110 gene kdsA 1534 2367 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958364.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence354 2259 910 gene locus_tag LOCUS_18120 gene vpoC 2259 910 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence355 647 96 gene locus_tag LOCUS_18130 647 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1533 916 gene locus_tag LOCUS_18140 1533 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence356 508 44 gene locus_tag LOCUS_18150 508 44 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_18150 739 527 gene locus_tag LOCUS_18160 739 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1805 885 gene locus_tag LOCUS_18170 1805 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence357 1366 632 gene locus_tag LOCUS_18180 1366 632 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769491.1 protein_id gnl|my_center|LOCUS_18180 2271 1363 gene locus_tag LOCUS_18190 2271 1363 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence358 272 1072 gene locus_tag LOCUS_18200 272 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147333463.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence359 685 182 gene locus_tag LOCUS_18210 685 182 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_18210 1201 719 gene locus_tag LOCUS_18220 1201 719 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 protein_id gnl|my_center|LOCUS_18220 2284 1310 gene locus_tag LOCUS_18230 gene cysK 2284 1310 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267110.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence360 <1 1246 gene locus_tag LOCUS_18240 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099190.1:2-octaprenyl-6-methoxyphenyl hydroxylase >Feature sequence361 <2330 1206 gene locus_tag LOCUS_18250 <2330 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791295.1:glucoamylase family protein >Feature sequence362 <1 562 gene locus_tag LOCUS_18260 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000199604.1:type I restriction-modification system subunit M 559 1782 gene locus_tag LOCUS_18270 559 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence363 1343 96 gene locus_tag LOCUS_18280 1343 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_18280 2167 1340 gene locus_tag LOCUS_18290 2167 1340 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837305.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence364 337 1980 gene locus_tag LOCUS_18300 gene ubiB 337 1980 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence365 1617 1306 gene locus_tag LOCUS_18310 1617 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2029 1781 gene locus_tag LOCUS_18320 2029 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence366 543 1997 gene locus_tag LOCUS_18330 543 1997 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence367 >Feature sequence368 1166 420 gene locus_tag LOCUS_18340 gene ubiE 1166 420 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 protein_id gnl|my_center|LOCUS_18340 1515 1159 gene locus_tag LOCUS_18350 1515 1159 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_18350 <2240 1524 gene locus_tag LOCUS_18360 <2240 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073857.1:ATP-dependent protease ATPase subunit HslU >Feature sequence369 764 486 gene locus_tag LOCUS_18370 764 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1210 824 gene locus_tag LOCUS_18380 1210 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 <2236 1353 gene locus_tag LOCUS_18390 <2236 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207142.1:WYL domain-containing protein >Feature sequence370 102 1517 gene locus_tag LOCUS_18400 gene leuC 102 1517 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208284.1 protein_id gnl|my_center|LOCUS_18400 1524 2171 gene locus_tag LOCUS_18410 gene leuD 1524 2171 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence371 >Feature sequence372 >Feature sequence373 1281 49 gene locus_tag LOCUS_18420 1281 49 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_18420 553 562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2207 1285 gene locus_tag LOCUS_18430 <2207 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887814.1:MoxR family ATPase >Feature sequence374 <2187 1444 gene locus_tag LOCUS_18440 <2187 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028389601.1:exodeoxyribonuclease III >Feature sequence375 66 935 gene locus_tag LOCUS_18450 gene kdsA 66 935 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_18450 1405 995 gene locus_tag LOCUS_18460 1405 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence376 477 211 gene locus_tag LOCUS_18470 477 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 838 608 gene locus_tag LOCUS_18480 838 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 865 1311 gene locus_tag LOCUS_18490 865 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1830 2117 gene locus_tag LOCUS_18500 1830 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence377 <1 1100 gene locus_tag LOCUS_18510 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931741.1:adenosylmethionine--8-amino-7-oxononanoate transaminase 1220 1531 gene locus_tag LOCUS_18520 1220 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 <2173 1595 gene locus_tag LOCUS_18530 <2173 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065059.1:DNA repair protein RecN >Feature sequence378 >Feature sequence379 211 77 gene locus_tag LOCUS_18540 211 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1052 300 gene locus_tag LOCUS_18550 1052 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1482 1045 gene locus_tag LOCUS_18560 1482 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence380 <2164 1131 gene locus_tag LOCUS_18570 <2164 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770757.1:SurA N-terminal domain-containing protein >Feature sequence381 <2146 1066 gene locus_tag LOCUS_18580 <2146 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB >Feature sequence382 876 61 gene locus_tag LOCUS_18590 876 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1692 889 gene locus_tag LOCUS_18600 gene rsmA 1692 889 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence383 272 45 gene locus_tag LOCUS_18610 272 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 740 940 gene locus_tag LOCUS_18620 740 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence384 <1 1238 gene locus_tag LOCUS_18630 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein >Feature sequence385 654 872 gene locus_tag LOCUS_18640 654 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 865 1203 gene locus_tag LOCUS_18650 865 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence386 >Feature sequence387 >Feature sequence388 >Feature sequence389 314 388 gene locus_tag LOCUS_t00300 314 388 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 692 1639 gene locus_tag LOCUS_18660 692 1639 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946290.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence390 <1 687 gene locus_tag LOCUS_18670 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071782.1:bifunctional uridylyltransferase/uridylyl-removing protein GlnD 1946 849 gene locus_tag LOCUS_18680 1946 849 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18680 >Feature sequence391 78 1292 gene locus_tag LOCUS_18690 gene ispG 78 1292 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063934.1 protein_id gnl|my_center|LOCUS_18690 1545 1315 gene locus_tag LOCUS_18700 1545 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence392 13 276 gene locus_tag LOCUS_18710 gene rpmA 13 276 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874345.1 protein_id gnl|my_center|LOCUS_18710 361 1380 gene locus_tag LOCUS_18720 gene cgtA 361 1380 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence393 1319 1990 gene locus_tag LOCUS_18730 gene rpiA 1319 1990 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence394 1717 953 gene locus_tag LOCUS_18740 1717 953 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence395 >Feature sequence396 >Feature sequence397 187 1089 gene locus_tag LOCUS_18750 187 1089 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_18750 1076 1765 gene locus_tag LOCUS_18760 1076 1765 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence398 <1 642 gene locus_tag LOCUS_18770 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772922.1:Fe-S cluster assembly protein SufB 660 1415 gene locus_tag LOCUS_18780 gene sufC 660 1415 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence399 1348 785 gene locus_tag LOCUS_18790 1348 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 <2030 1450 gene locus_tag LOCUS_18800 <2030 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763760.1:ComF family protein >Feature sequence400 <1 1002 gene locus_tag LOCUS_18810 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001194680.1:glycolate oxidase subunit GlcF 1013 1765 gene locus_tag LOCUS_18820 1013 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence401 <1 1224 gene locus_tag LOCUS_18830 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118829520.1:peptide MFS transporter >Feature sequence402 >Feature sequence403 1839 1504 gene locus_tag LOCUS_18840 1839 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence404 <2010 1299 gene locus_tag LOCUS_18850 <2010 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958364.1:3-deoxy-8-phosphooctulonate synthase >Feature sequence405 430 921 gene locus_tag LOCUS_18860 430 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 918 1691 gene locus_tag LOCUS_18870 918 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence406 <1 1192 gene locus_tag LOCUS_18880 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385474.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1182 1811 gene locus_tag LOCUS_18890 gene rsmG 1182 1811 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338804.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence407 1128 334 gene locus_tag LOCUS_18900 1128 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 <1996 1132 gene locus_tag LOCUS_18910 <1996 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144956692.1:DDE-type integrase/transposase/recombinase >Feature sequence408 586 236 gene locus_tag LOCUS_18920 586 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 <1985 594 gene locus_tag LOCUS_18930 <1985 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207562.1:proline--tRNA ligase >Feature sequence409 <1976 953 gene locus_tag LOCUS_18940 <1976 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000646007.1:L-threonine 3-dehydrogenase >Feature sequence410 1597 689 gene locus_tag LOCUS_18950 1597 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence411 1413 814 gene locus_tag LOCUS_18960 1413 814 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403113.1 protein_id gnl|my_center|LOCUS_18960 <1950 1438 gene locus_tag LOCUS_18970 <1950 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_186447661.1:cytochrome c biogenesis protein DipZ >Feature sequence412 <1 1915 gene locus_tag LOCUS_18980 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857980.1:acyl-[ACP]--phospholipid O-acyltransferase >Feature sequence413 769 143 gene locus_tag LOCUS_18990 769 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18990 1139 918 gene locus_tag LOCUS_19000 1139 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 927 936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1939 1194 gene locus_tag LOCUS_19010 <1939 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145225398.1:restriction endonuclease subunit S >Feature sequence414 >Feature sequence415 <1 1274 gene locus_tag LOCUS_19020 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938822.1:MBL fold metallo-hydrolase <1924 1294 gene locus_tag LOCUS_19030 <1924 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011235810.1:cation diffusion facilitator family transporter >Feature sequence416 484 1008 gene locus_tag LOCUS_19040 484 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1005 1613 gene locus_tag LOCUS_19050 1005 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence417 1175 75 gene locus_tag LOCUS_19060 gene thiO 1175 75 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_19060 1650 1219 gene locus_tag LOCUS_19070 1650 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence418 331 26 gene locus_tag LOCUS_19080 331 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 552 328 gene locus_tag LOCUS_19090 552 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1330 848 gene locus_tag LOCUS_19100 1330 848 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206733.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence419 <1888 1023 gene locus_tag LOCUS_19110 <1888 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816905.1:(2E,6E)-farnesyl diphosphate synthase >Feature sequence420 921 148 gene locus_tag LOCUS_19120 921 148 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_19120 1625 1053 gene locus_tag LOCUS_19130 1625 1053 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence421 >Feature sequence422 >Feature sequence423 328 717 gene locus_tag LOCUS_19140 gene apaG 328 717 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence424 >Feature sequence425 1851 1030 gene locus_tag LOCUS_19150 1851 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence426 2 1795 gene locus_tag LOCUS_19160 2 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence427 93 332 gene locus_tag LOCUS_19170 93 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1329 751 gene locus_tag LOCUS_19180 1329 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence428 646 900 gene locus_tag LOCUS_19190 646 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence429 >Feature sequence430 >Feature sequence431 30 1307 gene locus_tag LOCUS_19200 gene purD 30 1307 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence432 917 1699 gene locus_tag LOCUS_19210 917 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence433 500 195 gene locus_tag LOCUS_19220 500 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 693 1337 gene locus_tag LOCUS_19230 693 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence434 1395 589 gene locus_tag LOCUS_19240 1395 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1640 1398 gene locus_tag LOCUS_19250 1640 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence435 14 568 gene locus_tag LOCUS_19260 14 568 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261326.1 protein_id gnl|my_center|LOCUS_19260 616 1377 gene locus_tag LOCUS_19270 616 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence436 1594 386 gene locus_tag LOCUS_19280 gene argJ 1594 386 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence437 958 359 gene locus_tag LOCUS_19290 958 359 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence438 294 1643 gene locus_tag LOCUS_19300 294 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1071 1080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence439 <1 846 gene locus_tag LOCUS_19310 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920935.1:acetolactate synthase large subunit >Feature sequence440 128 361 gene locus_tag LOCUS_19320 128 361 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924721.1 protein_id gnl|my_center|LOCUS_19320 1601 393 gene locus_tag LOCUS_19330 1601 393 CDS product IS256-like element ISEc39 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343613.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence441 >Feature sequence442 <1 589 gene locus_tag LOCUS_19340 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926941.1:acetate--CoA ligase >Feature sequence443 140 1558 gene locus_tag LOCUS_19350 140 1558 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence444 1030 521 gene locus_tag LOCUS_19360 gene def 1030 521 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence445 >Feature sequence446 <1588 654 gene locus_tag LOCUS_19370 <1588 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211671.1:selenide, water dikinase SelD >Feature sequence447 >Feature sequence448 >Feature sequence449 <1560 36 gene locus_tag LOCUS_19380 <1560 36 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946295.1:gamma-glutamyltransferase >Feature sequence450 1242 73 gene locus_tag LOCUS_19390 1242 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence451 786 133 gene locus_tag LOCUS_19400 786 133 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_19400 1337 1038 gene locus_tag LOCUS_19410 1337 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence452 <1529 333 gene locus_tag LOCUS_19420 <1529 333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003698035.1:type IV pilus secretin PilQ >Feature sequence453 >Feature sequence454