>Feature sequence001 1131 202 gene locus_tag LOCUS_00010 gene oppC 1131 202 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 protein_id gnl|my_center|LOCUS_00010 2067 1144 gene locus_tag LOCUS_00020 gene oppB 2067 1144 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 protein_id gnl|my_center|LOCUS_00020 3787 2165 gene locus_tag LOCUS_00030 3787 2165 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_00030 5296 3995 gene locus_tag LOCUS_00040 5296 3995 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_00040 6663 5296 gene locus_tag LOCUS_00050 6663 5296 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338190.1 protein_id gnl|my_center|LOCUS_00050 7633 6674 gene locus_tag LOCUS_00060 gene speB 7633 6674 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_00060 8427 7630 gene locus_tag LOCUS_00070 8427 7630 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_00070 9365 8424 gene locus_tag LOCUS_00080 9365 8424 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121722.1 protein_id gnl|my_center|LOCUS_00080 10498 9362 gene locus_tag LOCUS_00090 10498 9362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_00090 11641 10550 gene locus_tag LOCUS_00100 11641 10550 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388773.1 protein_id gnl|my_center|LOCUS_00100 13093 11744 gene locus_tag LOCUS_00110 13093 11744 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 protein_id gnl|my_center|LOCUS_00110 13479 14504 gene locus_tag LOCUS_00120 13479 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14637 17474 gene locus_tag LOCUS_00130 14637 17474 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_00130 17471 18217 gene locus_tag LOCUS_00140 17471 18217 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_00140 18217 19092 gene locus_tag LOCUS_00150 18217 19092 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_00150 20768 19149 gene locus_tag LOCUS_00160 20768 19149 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_00160 23029 20780 gene locus_tag LOCUS_00170 gene parC 23029 20780 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336946.1 protein_id gnl|my_center|LOCUS_00170 23145 23615 gene locus_tag LOCUS_00180 23145 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23736 24569 gene locus_tag LOCUS_00190 23736 24569 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_00190 24578 24781 gene locus_tag LOCUS_00200 24578 24781 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722450.1 protein_id gnl|my_center|LOCUS_00200 24783 25355 gene locus_tag LOCUS_00210 24783 25355 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 454 378 gene locus_tag LOCUS_t00010 454 378 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3984 532 gene locus_tag LOCUS_00220 gene putA 3984 532 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643744.1 protein_id gnl|my_center|LOCUS_00220 4125 4583 gene locus_tag LOCUS_00230 4125 4583 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384952.1 protein_id gnl|my_center|LOCUS_00230 6070 4637 gene locus_tag LOCUS_00240 6070 4637 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_00240 7503 6067 gene locus_tag LOCUS_00250 7503 6067 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_00250 8938 7529 gene locus_tag LOCUS_00260 8938 7529 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_00260 10443 8935 gene locus_tag LOCUS_00270 10443 8935 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_00270 11227 10619 gene locus_tag LOCUS_00280 11227 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 12666 11227 gene locus_tag LOCUS_00290 12666 11227 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_00290 13028 13189 gene locus_tag LOCUS_00300 13028 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 13944 13186 gene locus_tag LOCUS_00310 13944 13186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338502.1 protein_id gnl|my_center|LOCUS_00310 14798 13941 gene locus_tag LOCUS_00320 14798 13941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008282.1 protein_id gnl|my_center|LOCUS_00320 15721 14795 gene locus_tag LOCUS_00330 15721 14795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969922.1 protein_id gnl|my_center|LOCUS_00330 16776 15718 gene locus_tag LOCUS_00340 16776 15718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383852.1 protein_id gnl|my_center|LOCUS_00340 18375 16777 gene locus_tag LOCUS_00350 18375 16777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973843.1 protein_id gnl|my_center|LOCUS_00350 20933 18489 gene locus_tag LOCUS_00360 20933 18489 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_00360 22066 21008 gene locus_tag LOCUS_00370 22066 21008 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258491.1 protein_id gnl|my_center|LOCUS_00370 >Feature sequence003 6093 5059 gene locus_tag LOCUS_00380 6093 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 7379 6090 gene locus_tag LOCUS_00390 7379 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 9631 7598 gene locus_tag LOCUS_00400 9631 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 11310 9628 gene locus_tag LOCUS_00410 11310 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 14440 11279 gene locus_tag LOCUS_00420 14440 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 >Feature sequence004 333 1538 gene locus_tag LOCUS_00430 333 1538 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_00430 1547 1990 gene locus_tag LOCUS_00440 1547 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2023 2568 gene locus_tag LOCUS_00450 2023 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2650 3690 gene locus_tag LOCUS_00460 2650 3690 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 protein_id gnl|my_center|LOCUS_00460 3703 6051 gene locus_tag LOCUS_00470 3703 6051 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337267.1 protein_id gnl|my_center|LOCUS_00470 6369 6668 gene locus_tag LOCUS_00480 6369 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7455 6898 gene locus_tag LOCUS_00490 7455 6898 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 protein_id gnl|my_center|LOCUS_00490 7504 8064 gene locus_tag LOCUS_00500 7504 8064 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563235.1 protein_id gnl|my_center|LOCUS_00500 11554 8096 gene locus_tag LOCUS_00510 11554 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080517709.1 protein_id gnl|my_center|LOCUS_00510 <14675 11556 gene locus_tag LOCUS_00520 <14675 11556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140422.1:SdrD B-like domain-containing protein >Feature sequence005 1486 599 gene locus_tag LOCUS_00530 1486 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 1618 1821 gene locus_tag LOCUS_00540 1618 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 1978 3201 gene locus_tag LOCUS_00550 1978 3201 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_00550 4586 3222 gene locus_tag LOCUS_00560 4586 3222 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_00560 5681 4728 gene locus_tag LOCUS_00570 5681 4728 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158657585.1 protein_id gnl|my_center|LOCUS_00570 5737 5946 gene locus_tag LOCUS_00580 5737 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 6093 8084 gene locus_tag LOCUS_00590 gene parE 6093 8084 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003707.1 protein_id gnl|my_center|LOCUS_00590 8170 8541 gene locus_tag LOCUS_00600 8170 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8576 9880 gene locus_tag LOCUS_00610 8576 9880 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 protein_id gnl|my_center|LOCUS_00610 12362 9954 gene locus_tag LOCUS_00620 gene lon 12362 9954 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337791.1 protein_id gnl|my_center|LOCUS_00620 12539 12988 gene locus_tag LOCUS_00630 12539 12988 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391820.1 protein_id gnl|my_center|LOCUS_00630 13258 12974 gene locus_tag LOCUS_00640 13258 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence006 <1 632 gene locus_tag LOCUS_00650 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721248.1:crotonyl-CoA carboxylase/reductase 818 1033 gene locus_tag LOCUS_00660 818 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 969 1688 gene locus_tag LOCUS_00670 969 1688 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970595.1 protein_id gnl|my_center|LOCUS_00670 1778 2422 gene locus_tag LOCUS_00680 1778 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2459 3970 gene locus_tag LOCUS_00690 2459 3970 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563008.1 protein_id gnl|my_center|LOCUS_00690 4702 3983 gene locus_tag LOCUS_00700 4702 3983 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537523.1 protein_id gnl|my_center|LOCUS_00700 5744 4842 gene locus_tag LOCUS_00710 5744 4842 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337312.1 protein_id gnl|my_center|LOCUS_00710 6819 5821 gene locus_tag LOCUS_00720 6819 5821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669233.1 protein_id gnl|my_center|LOCUS_00720 7910 6819 gene locus_tag LOCUS_00730 7910 6819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337314.1 protein_id gnl|my_center|LOCUS_00730 9487 7907 gene locus_tag LOCUS_00740 9487 7907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337315.1 protein_id gnl|my_center|LOCUS_00740 10492 9494 gene locus_tag LOCUS_00750 10492 9494 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_00750 11074 10652 gene locus_tag LOCUS_00760 11074 10652 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 protein_id gnl|my_center|LOCUS_00760 11637 11071 gene locus_tag LOCUS_00770 11637 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12268 11708 gene locus_tag LOCUS_00780 12268 11708 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_00780 12387 12935 gene locus_tag LOCUS_00790 12387 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence007 1745 903 gene locus_tag LOCUS_00800 1745 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 3178 1742 gene locus_tag LOCUS_00810 gene ccoG 3178 1742 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338421.1 protein_id gnl|my_center|LOCUS_00810 4222 3350 gene locus_tag LOCUS_00820 gene ccoP 4222 3350 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 protein_id gnl|my_center|LOCUS_00820 4385 4227 gene locus_tag LOCUS_00830 4385 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 5119 4394 gene locus_tag LOCUS_00840 gene ccoO 5119 4394 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720877.1 protein_id gnl|my_center|LOCUS_00840 6725 5130 gene locus_tag LOCUS_00850 gene ccoN 6725 5130 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338423.1 protein_id gnl|my_center|LOCUS_00850 7710 6961 gene locus_tag LOCUS_00860 gene fnrL 7710 6961 CDS product Crp/Fnr family transcriptional regulator FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720880.1 protein_id gnl|my_center|LOCUS_00860 7804 9159 gene locus_tag LOCUS_00870 gene hemN 7804 9159 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338144.1 protein_id gnl|my_center|LOCUS_00870 12179 9816 gene locus_tag LOCUS_00880 12179 9816 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975661.1 protein_id gnl|my_center|LOCUS_00880 <12840 12183 gene locus_tag LOCUS_00890 <12840 12183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385062.1:deoxyribose-phosphate aldolase >Feature sequence008 1128 508 gene locus_tag LOCUS_00900 gene rpsD 1128 508 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719445.1 protein_id gnl|my_center|LOCUS_00900 2087 1311 gene locus_tag LOCUS_00910 2087 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 2514 2116 gene locus_tag LOCUS_00920 2514 2116 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721251.1 protein_id gnl|my_center|LOCUS_00920 3104 2571 gene locus_tag LOCUS_00930 3104 2571 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562223.1 protein_id gnl|my_center|LOCUS_00930 3213 3971 gene locus_tag LOCUS_00940 gene rlmJ 3213 3971 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383564.1 protein_id gnl|my_center|LOCUS_00940 4368 3973 gene locus_tag LOCUS_00950 4368 3973 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337343.1 protein_id gnl|my_center|LOCUS_00950 4557 5777 gene locus_tag LOCUS_00960 4557 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 5817 6551 gene locus_tag LOCUS_00970 gene hisA 5817 6551 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_00970 6544 7302 gene locus_tag LOCUS_00980 gene hisF 6544 7302 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562844.1 protein_id gnl|my_center|LOCUS_00980 7302 7619 gene locus_tag LOCUS_00990 7302 7619 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 protein_id gnl|my_center|LOCUS_00990 7629 8057 gene locus_tag LOCUS_01000 7629 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8145 9527 gene locus_tag LOCUS_01010 8145 9527 CDS product M10 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338088.1 protein_id gnl|my_center|LOCUS_01010 10126 9524 gene locus_tag LOCUS_01020 gene recR 10126 9524 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720894.1 protein_id gnl|my_center|LOCUS_01020 10473 10126 gene locus_tag LOCUS_01030 10473 10126 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720893.1 protein_id gnl|my_center|LOCUS_01030 10989 10630 gene locus_tag LOCUS_01040 10989 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 11414 10986 gene locus_tag LOCUS_01050 11414 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 12439 11531 gene locus_tag LOCUS_01060 12439 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence009 445 1320 gene locus_tag LOCUS_01070 445 1320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969951.1 protein_id gnl|my_center|LOCUS_01070 1317 2159 gene locus_tag LOCUS_01080 1317 2159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338047.1 protein_id gnl|my_center|LOCUS_01080 2184 3173 gene locus_tag LOCUS_01090 2184 3173 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 protein_id gnl|my_center|LOCUS_01090 3368 4891 gene locus_tag LOCUS_01100 3368 4891 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_01100 5521 4946 gene locus_tag LOCUS_01110 5521 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6792 5599 gene locus_tag LOCUS_01120 6792 5599 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 protein_id gnl|my_center|LOCUS_01120 6707 6716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8174 6789 gene locus_tag LOCUS_01130 8174 6789 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 protein_id gnl|my_center|LOCUS_01130 8986 8174 gene locus_tag LOCUS_01140 8986 8174 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531095.1 protein_id gnl|my_center|LOCUS_01140 10414 9035 gene locus_tag LOCUS_01150 10414 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 11340 10411 gene locus_tag LOCUS_01160 11340 10411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969483.1 protein_id gnl|my_center|LOCUS_01160 <11897 11350 gene locus_tag LOCUS_01170 <11897 11350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019995458.1:ABC transporter ATP-binding protein >Feature sequence010 <1 1134 gene locus_tag LOCUS_01180 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338604.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1266 2597 gene locus_tag LOCUS_01190 1266 2597 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 protein_id gnl|my_center|LOCUS_01190 2643 3143 gene locus_tag LOCUS_01200 2643 3143 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338602.1 protein_id gnl|my_center|LOCUS_01200 3787 4551 gene locus_tag LOCUS_01210 3787 4551 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_01210 4610 5101 gene locus_tag LOCUS_01220 4610 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5186 6310 gene locus_tag LOCUS_01230 5186 6310 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_01230 6320 6898 gene locus_tag LOCUS_01240 6320 6898 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383642.1 protein_id gnl|my_center|LOCUS_01240 7233 6895 gene locus_tag LOCUS_01250 7233 6895 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_01250 8091 7273 gene locus_tag LOCUS_01260 gene proC 8091 7273 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140370.1 protein_id gnl|my_center|LOCUS_01260 8616 8113 gene locus_tag LOCUS_01270 8616 8113 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562659.1 protein_id gnl|my_center|LOCUS_01270 9091 8786 gene locus_tag LOCUS_01280 9091 8786 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 protein_id gnl|my_center|LOCUS_01280 9206 10090 gene locus_tag LOCUS_01290 gene lgt 9206 10090 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722324.1 protein_id gnl|my_center|LOCUS_01290 10087 11163 gene locus_tag LOCUS_01300 10087 11163 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence011 1275 22 gene locus_tag LOCUS_01310 gene hflX 1275 22 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140208.1 protein_id gnl|my_center|LOCUS_01310 1521 1282 gene locus_tag LOCUS_01320 gene hfq 1521 1282 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719962.1 protein_id gnl|my_center|LOCUS_01320 3173 1659 gene locus_tag LOCUS_01330 3173 1659 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719963.1 protein_id gnl|my_center|LOCUS_01330 4549 3173 gene locus_tag LOCUS_01340 gene trkA 4549 3173 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719964.1 protein_id gnl|my_center|LOCUS_01340 5980 4598 gene locus_tag LOCUS_01350 5980 4598 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719965.1 protein_id gnl|my_center|LOCUS_01350 8210 5982 gene locus_tag LOCUS_01360 8210 5982 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140209.1 protein_id gnl|my_center|LOCUS_01360 9694 8255 gene locus_tag LOCUS_01370 gene ntrC 9694 8255 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_01370 10767 9697 gene locus_tag LOCUS_01380 10767 9697 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_01380 <11542 10764 gene locus_tag LOCUS_01390 <11542 10764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337762.1:tRNA dihydrouridine synthase DusB >Feature sequence012 <1 1481 gene locus_tag LOCUS_01400 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113323.1:phenylacetic acid degradation bifunctional protein PaaZ 1584 3770 gene locus_tag LOCUS_01410 1584 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3770 9412 gene locus_tag LOCUS_01420 3770 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9458 10324 gene locus_tag LOCUS_01430 gene paaX 9458 10324 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813301.1 protein_id gnl|my_center|LOCUS_01430 <11522 10321 gene locus_tag LOCUS_01440 <11522 10321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337003.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence013 1931 1476 gene locus_tag LOCUS_01450 1931 1476 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 protein_id gnl|my_center|LOCUS_01450 3478 2048 gene locus_tag LOCUS_01460 3478 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 3873 3496 gene locus_tag LOCUS_01470 3873 3496 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384293.1 protein_id gnl|my_center|LOCUS_01470 5259 3979 gene locus_tag LOCUS_01480 gene glcF 5259 3979 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338662.1 protein_id gnl|my_center|LOCUS_01480 6350 5259 gene locus_tag LOCUS_01490 6350 5259 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338663.1 protein_id gnl|my_center|LOCUS_01490 7780 6347 gene locus_tag LOCUS_01500 7780 6347 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338664.1 protein_id gnl|my_center|LOCUS_01500 9914 7857 gene locus_tag LOCUS_01510 9914 7857 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 protein_id gnl|my_center|LOCUS_01510 11509 9911 gene locus_tag LOCUS_01520 11509 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence014 2284 1853 gene locus_tag LOCUS_01530 2284 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2475 3140 gene locus_tag LOCUS_01540 2475 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3137 4378 gene locus_tag LOCUS_01550 3137 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7060 4379 gene locus_tag LOCUS_01560 gene topA 7060 4379 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719330.1 protein_id gnl|my_center|LOCUS_01560 7328 8557 gene locus_tag LOCUS_01570 7328 8557 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_01570 9040 8612 gene locus_tag LOCUS_01580 9040 8612 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720750.1 protein_id gnl|my_center|LOCUS_01580 9161 10744 gene locus_tag LOCUS_01590 9161 10744 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338336.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence015 <1 648 gene locus_tag LOCUS_01600 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338456.1:acyl-CoA dehydrogenase 306 315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 645 1679 gene locus_tag LOCUS_01610 645 1679 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338455.1 protein_id gnl|my_center|LOCUS_01610 1746 1880 gene locus_tag LOCUS_01620 1746 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1968 2552 gene locus_tag LOCUS_01630 1968 2552 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383385.1 protein_id gnl|my_center|LOCUS_01630 2605 2898 gene locus_tag LOCUS_01640 2605 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 3249 2944 gene locus_tag LOCUS_01650 3249 2944 CDS product DUF6280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720413.1 protein_id gnl|my_center|LOCUS_01650 3666 5228 gene locus_tag LOCUS_01660 3666 5228 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337403.1 protein_id gnl|my_center|LOCUS_01660 5442 6482 gene locus_tag LOCUS_01670 5442 6482 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719492.1 protein_id gnl|my_center|LOCUS_01670 6527 7375 gene locus_tag LOCUS_01680 gene mreC 6527 7375 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719491.1 protein_id gnl|my_center|LOCUS_01680 7372 7908 gene locus_tag LOCUS_01690 7372 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7905 9842 gene locus_tag LOCUS_01700 gene mrdA 7905 9842 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence016 791 1876 gene locus_tag LOCUS_01710 791 1876 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_01710 1967 2863 gene locus_tag LOCUS_01720 1967 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2879 5242 gene locus_tag LOCUS_01730 2879 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6142 5321 gene locus_tag LOCUS_01740 6142 5321 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337625.1 protein_id gnl|my_center|LOCUS_01740 6675 6223 gene locus_tag LOCUS_01750 6675 6223 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337626.1 protein_id gnl|my_center|LOCUS_01750 7132 6731 gene locus_tag LOCUS_01760 7132 6731 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719789.1 protein_id gnl|my_center|LOCUS_01760 7848 7225 gene locus_tag LOCUS_01770 7848 7225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337928.1 protein_id gnl|my_center|LOCUS_01770 8775 7888 gene locus_tag LOCUS_01780 gene ppk2 8775 7888 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337927.1 protein_id gnl|my_center|LOCUS_01780 9701 8772 gene locus_tag LOCUS_01790 gene metA 9701 8772 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337925.1 protein_id gnl|my_center|LOCUS_01790 10558 9701 gene locus_tag LOCUS_01800 10558 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence017 120 758 gene locus_tag LOCUS_01810 gene scpB 120 758 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565387.1 protein_id gnl|my_center|LOCUS_01810 888 2405 gene locus_tag LOCUS_01820 888 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3493 2411 gene locus_tag LOCUS_01830 3493 2411 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337605.1 protein_id gnl|my_center|LOCUS_01830 3628 3552 gene locus_tag LOCUS_t00020 3628 3552 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4106 3696 gene locus_tag LOCUS_01840 4106 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4418 4110 gene locus_tag LOCUS_01850 gene ihfA 4418 4110 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 protein_id gnl|my_center|LOCUS_01850 5497 4520 gene locus_tag LOCUS_01860 5497 4520 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337607.1 protein_id gnl|my_center|LOCUS_01860 6569 5499 gene locus_tag LOCUS_01870 gene plsX 6569 5499 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337608.1 protein_id gnl|my_center|LOCUS_01870 6831 6625 gene locus_tag LOCUS_01880 gene rpmF 6831 6625 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719763.1 protein_id gnl|my_center|LOCUS_01880 7551 6982 gene locus_tag LOCUS_01890 7551 6982 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384171.1 protein_id gnl|my_center|LOCUS_01890 7664 8119 gene locus_tag LOCUS_01900 7664 8119 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337610.1 protein_id gnl|my_center|LOCUS_01900 9228 8116 gene locus_tag LOCUS_01910 9228 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336997.1 protein_id gnl|my_center|LOCUS_01910 9704 9306 gene locus_tag LOCUS_01920 gene msrB 9704 9306 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337611.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence018 318 43 gene locus_tag LOCUS_01930 318 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 534 1034 gene locus_tag LOCUS_01940 534 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1420 1079 gene locus_tag LOCUS_01950 1420 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1618 1890 gene locus_tag LOCUS_01960 1618 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1887 2162 gene locus_tag LOCUS_01970 1887 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2165 2410 gene locus_tag LOCUS_01980 2165 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2403 3551 gene locus_tag LOCUS_01990 2403 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3548 3817 gene locus_tag LOCUS_02000 3548 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3817 4281 gene locus_tag LOCUS_02010 3817 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4278 4508 gene locus_tag LOCUS_02020 4278 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4505 4852 gene locus_tag LOCUS_02030 4505 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 4849 5088 gene locus_tag LOCUS_02040 4849 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5064 5300 gene locus_tag LOCUS_02050 5064 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5297 5536 gene locus_tag LOCUS_02060 5297 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246457.1 protein_id gnl|my_center|LOCUS_02060 5533 6246 gene locus_tag LOCUS_02070 5533 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6333 6257 gene locus_tag LOCUS_t00030 6333 6257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6667 6410 gene locus_tag LOCUS_02080 6667 6410 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140014.1 protein_id gnl|my_center|LOCUS_02080 6796 7326 gene locus_tag LOCUS_02090 6796 7326 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 protein_id gnl|my_center|LOCUS_02090 7455 8426 gene locus_tag LOCUS_02100 7455 8426 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_02100 8484 9008 gene locus_tag LOCUS_02110 8484 9008 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 protein_id gnl|my_center|LOCUS_02110 9009 10304 gene locus_tag LOCUS_02120 9009 10304 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence019 2580 1609 gene locus_tag LOCUS_02130 gene cobS 2580 1609 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003542.1 protein_id gnl|my_center|LOCUS_02130 3476 2625 gene locus_tag LOCUS_02140 3476 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2829 2838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3567 3830 gene locus_tag LOCUS_02150 3567 3830 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337130.1 protein_id gnl|my_center|LOCUS_02150 3827 4483 gene locus_tag LOCUS_02160 3827 4483 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_02160 5754 4612 gene locus_tag LOCUS_02170 gene dapE 5754 4612 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338737.1 protein_id gnl|my_center|LOCUS_02170 5891 6667 gene locus_tag LOCUS_02180 5891 6667 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338188.1 protein_id gnl|my_center|LOCUS_02180 6689 7411 gene locus_tag LOCUS_02190 6689 7411 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 protein_id gnl|my_center|LOCUS_02190 7471 8349 gene locus_tag LOCUS_02200 7471 8349 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383561.1 protein_id gnl|my_center|LOCUS_02200 8346 9185 gene locus_tag LOCUS_02210 8346 9185 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720538.1 protein_id gnl|my_center|LOCUS_02210 9575 9189 gene locus_tag LOCUS_02220 9575 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 <10202 9578 gene locus_tag LOCUS_02230 <10202 9578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337137.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence020 1335 754 gene locus_tag LOCUS_02240 1335 754 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337063.1 protein_id gnl|my_center|LOCUS_02240 2321 1332 gene locus_tag LOCUS_02250 2321 1332 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337064.1 protein_id gnl|my_center|LOCUS_02250 3297 2335 gene locus_tag LOCUS_02260 3297 2335 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563827.1 protein_id gnl|my_center|LOCUS_02260 4788 3313 gene locus_tag LOCUS_02270 4788 3313 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337065.1 protein_id gnl|my_center|LOCUS_02270 6018 4798 gene locus_tag LOCUS_02280 6018 4798 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337066.1 protein_id gnl|my_center|LOCUS_02280 6830 6231 gene locus_tag LOCUS_02290 6830 6231 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722846.1 protein_id gnl|my_center|LOCUS_02290 8175 6835 gene locus_tag LOCUS_02300 8175 6835 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 protein_id gnl|my_center|LOCUS_02300 9251 8421 gene locus_tag LOCUS_02310 gene cpaB 9251 8421 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722851.1 protein_id gnl|my_center|LOCUS_02310 9649 9446 gene locus_tag LOCUS_02320 9649 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722853.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence021 1565 705 gene locus_tag LOCUS_02330 1565 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2310 1687 gene locus_tag LOCUS_02340 2310 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2920 2435 gene locus_tag LOCUS_02350 gene rpsI 2920 2435 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720163.1 protein_id gnl|my_center|LOCUS_02350 3388 2924 gene locus_tag LOCUS_02360 gene rplM 3388 2924 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_02360 3967 3530 gene locus_tag LOCUS_02370 3967 3530 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 protein_id gnl|my_center|LOCUS_02370 4019 4807 gene locus_tag LOCUS_02380 4019 4807 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 protein_id gnl|my_center|LOCUS_02380 5935 4808 gene locus_tag LOCUS_02390 5935 4808 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384470.1 protein_id gnl|my_center|LOCUS_02390 6766 5993 gene locus_tag LOCUS_02400 6766 5993 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384471.1 protein_id gnl|my_center|LOCUS_02400 6927 8138 gene locus_tag LOCUS_02410 6927 8138 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338231.1 protein_id gnl|my_center|LOCUS_02410 8204 8539 gene locus_tag LOCUS_02420 8204 8539 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384254.1 protein_id gnl|my_center|LOCUS_02420 9423 8638 gene locus_tag LOCUS_02430 9423 8638 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338233.1 protein_id gnl|my_center|LOCUS_02430 9711 9427 gene locus_tag LOCUS_02440 9711 9427 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_02440 9995 9711 gene locus_tag LOCUS_02450 9995 9711 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720613.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence022 275 691 gene locus_tag LOCUS_02460 275 691 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392718.1 protein_id gnl|my_center|LOCUS_02460 738 1550 gene locus_tag LOCUS_02470 738 1550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_02470 2865 1558 gene locus_tag LOCUS_02480 gene gltX 2865 1558 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338496.1 protein_id gnl|my_center|LOCUS_02480 1901 1910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4520 2862 gene locus_tag LOCUS_02490 4520 2862 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337405.1 protein_id gnl|my_center|LOCUS_02490 4743 6182 gene locus_tag LOCUS_02500 4743 6182 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719496.1 protein_id gnl|my_center|LOCUS_02500 7543 6230 gene locus_tag LOCUS_02510 7543 6230 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_02510 8949 7609 gene locus_tag LOCUS_02520 8949 7609 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974728.1 protein_id gnl|my_center|LOCUS_02520 9608 8946 gene locus_tag LOCUS_02530 9608 8946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640199.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence023 214 8 gene locus_tag LOCUS_02540 214 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1647 325 gene locus_tag LOCUS_02550 1647 325 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565719.1 protein_id gnl|my_center|LOCUS_02550 3497 1659 gene locus_tag LOCUS_02560 gene mutL 3497 1659 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537966.1 protein_id gnl|my_center|LOCUS_02560 4013 3543 gene locus_tag LOCUS_02570 gene lspA 4013 3543 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721489.1 protein_id gnl|my_center|LOCUS_02570 4216 5610 gene locus_tag LOCUS_02580 4216 5610 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969319.1 protein_id gnl|my_center|LOCUS_02580 5654 6250 gene locus_tag LOCUS_02590 5654 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_02590 6298 6909 gene locus_tag LOCUS_02600 6298 6909 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066588.1 protein_id gnl|my_center|LOCUS_02600 7034 7609 gene locus_tag LOCUS_02610 gene rimP 7034 7609 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338756.1 protein_id gnl|my_center|LOCUS_02610 7613 9232 gene locus_tag LOCUS_02620 gene nusA 7613 9232 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721609.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence024 1683 196 gene locus_tag LOCUS_02630 gene ffh 1683 196 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338684.1 protein_id gnl|my_center|LOCUS_02630 2289 1873 gene locus_tag LOCUS_02640 2289 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2420 3517 gene locus_tag LOCUS_02650 gene zapE 2420 3517 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383294.1 protein_id gnl|my_center|LOCUS_02650 3574 3918 gene locus_tag LOCUS_02660 3574 3918 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_02660 3935 4171 gene locus_tag LOCUS_02670 3935 4171 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 protein_id gnl|my_center|LOCUS_02670 4168 4470 gene locus_tag LOCUS_02680 4168 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4548 4808 gene locus_tag LOCUS_02690 4548 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5049 5531 gene locus_tag LOCUS_02700 5049 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6731 5523 gene locus_tag LOCUS_02710 6731 5523 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_02710 7039 6716 gene locus_tag LOCUS_02720 7039 6716 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 protein_id gnl|my_center|LOCUS_02720 9484 7121 gene locus_tag LOCUS_02730 9484 7121 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383673.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence025 2520 2053 gene locus_tag LOCUS_02740 2520 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2677 3027 gene locus_tag LOCUS_02750 2677 3027 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721377.1 protein_id gnl|my_center|LOCUS_02750 3038 3796 gene locus_tag LOCUS_02760 3038 3796 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382937.1 protein_id gnl|my_center|LOCUS_02760 3839 4081 gene locus_tag LOCUS_02770 3839 4081 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443178.1 protein_id gnl|my_center|LOCUS_02770 4179 4712 gene locus_tag LOCUS_02780 4179 4712 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563084.1 protein_id gnl|my_center|LOCUS_02780 4716 5276 gene locus_tag LOCUS_02790 4716 5276 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382940.1 protein_id gnl|my_center|LOCUS_02790 6388 5345 gene locus_tag LOCUS_02800 gene queG 6388 5345 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338745.1 protein_id gnl|my_center|LOCUS_02800 7056 6391 gene locus_tag LOCUS_02810 7056 6391 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003737.1 protein_id gnl|my_center|LOCUS_02810 7679 7110 gene locus_tag LOCUS_02820 7679 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 <9489 7901 gene locus_tag LOCUS_02830 <9489 7901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721575.1:glutamate synthase large subunit >Feature sequence026 1116 58 gene locus_tag LOCUS_02840 1116 58 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722210.1 protein_id gnl|my_center|LOCUS_02840 1410 1174 gene locus_tag LOCUS_02850 1410 1174 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_02850 1926 1426 gene locus_tag LOCUS_02860 1926 1426 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_02860 2132 2449 gene locus_tag LOCUS_02870 2132 2449 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_02870 2752 3855 gene locus_tag LOCUS_02880 2752 3855 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_02880 5013 3904 gene locus_tag LOCUS_02890 5013 3904 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392735.1 protein_id gnl|my_center|LOCUS_02890 5240 5830 gene locus_tag LOCUS_02900 5240 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9170 5754 gene locus_tag LOCUS_02910 9170 5754 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence027 307 1929 gene locus_tag LOCUS_02920 307 1929 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537965.1 protein_id gnl|my_center|LOCUS_02920 2111 1986 gene locus_tag LOCUS_02930 gene ykgO 2111 1986 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722020.1 protein_id gnl|my_center|LOCUS_02930 2253 2179 gene locus_tag LOCUS_t00040 2253 2179 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2386 3243 gene locus_tag LOCUS_02940 2386 3243 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338931.1 protein_id gnl|my_center|LOCUS_02940 4653 3382 gene locus_tag LOCUS_02950 4653 3382 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840148.1 protein_id gnl|my_center|LOCUS_02950 5654 4830 gene locus_tag LOCUS_02960 5654 4830 CDS product DUF2332 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066961.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 5860 5657 gene locus_tag LOCUS_02970 5860 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6525 5857 gene locus_tag LOCUS_02980 gene pth 6525 5857 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338521.1 protein_id gnl|my_center|LOCUS_02980 7252 6602 gene locus_tag LOCUS_02990 7252 6602 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081447059.1 protein_id gnl|my_center|LOCUS_02990 8637 7468 gene locus_tag LOCUS_03000 8637 7468 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975975.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence028 396 863 gene locus_tag LOCUS_03010 396 863 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090317.1 protein_id gnl|my_center|LOCUS_03010 955 2601 gene locus_tag LOCUS_03020 955 2601 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_03020 2611 3747 gene locus_tag LOCUS_03030 2611 3747 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_03030 4703 3744 gene locus_tag LOCUS_03040 4703 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5260 4733 gene locus_tag LOCUS_03050 5260 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5893 5348 gene locus_tag LOCUS_03060 5893 5348 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529177.1 protein_id gnl|my_center|LOCUS_03060 5988 7937 gene locus_tag LOCUS_03070 5988 7937 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993691.1 protein_id gnl|my_center|LOCUS_03070 9115 7934 gene locus_tag LOCUS_03080 9115 7934 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence029 764 264 gene locus_tag LOCUS_03090 gene def 764 264 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338558.1 protein_id gnl|my_center|LOCUS_03090 1284 757 gene locus_tag LOCUS_03100 gene def 1284 757 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383428.1 protein_id gnl|my_center|LOCUS_03100 1378 2547 gene locus_tag LOCUS_03110 1378 2547 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_03110 2660 2669 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2877 3992 gene locus_tag LOCUS_03120 2877 3992 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 protein_id gnl|my_center|LOCUS_03120 4089 5045 gene locus_tag LOCUS_03130 4089 5045 CDS product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336971.1 protein_id gnl|my_center|LOCUS_03130 5079 5927 gene locus_tag LOCUS_03140 5079 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6037 6999 gene locus_tag LOCUS_03150 6037 6999 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722606.1 protein_id gnl|my_center|LOCUS_03150 7871 6996 gene locus_tag LOCUS_03160 7871 6996 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_03160 8031 8840 gene locus_tag LOCUS_03170 8031 8840 CDS product DUF6473 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336942.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence030 1408 146 gene locus_tag LOCUS_03180 gene soxC 1408 146 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_03180 3239 1542 gene locus_tag LOCUS_03190 gene soxB 3239 1542 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_03190 4227 3364 gene locus_tag LOCUS_03200 gene soxA 4227 3364 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086298.1 protein_id gnl|my_center|LOCUS_03200 4587 4258 gene locus_tag LOCUS_03210 gene soxZ 4587 4258 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_03210 5026 4607 gene locus_tag LOCUS_03220 gene soxY 5026 4607 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_03220 5537 5067 gene locus_tag LOCUS_03230 gene soxX 5537 5067 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_03230 6477 5734 gene locus_tag LOCUS_03240 6477 5734 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314286.1 protein_id gnl|my_center|LOCUS_03240 6567 6944 gene locus_tag LOCUS_03250 6567 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_03250 6961 7335 gene locus_tag LOCUS_03260 6961 7335 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719755.1 protein_id gnl|my_center|LOCUS_03260 7335 8390 gene locus_tag LOCUS_03270 7335 8390 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence031 566 108 gene locus_tag LOCUS_03280 566 108 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383650.1 protein_id gnl|my_center|LOCUS_03280 1119 661 gene locus_tag LOCUS_03290 1119 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2221 1196 gene locus_tag LOCUS_03300 gene trpS 2221 1196 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003525.1 protein_id gnl|my_center|LOCUS_03300 2301 3002 gene locus_tag LOCUS_03310 2301 3002 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722664.1 protein_id gnl|my_center|LOCUS_03310 4543 2999 gene locus_tag LOCUS_03320 gene murJ 4543 2999 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336999.1 protein_id gnl|my_center|LOCUS_03320 7323 4540 gene locus_tag LOCUS_03330 7323 4540 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337000.1 protein_id gnl|my_center|LOCUS_03330 8484 7327 gene locus_tag LOCUS_03340 8484 7327 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence032 3060 319 gene locus_tag LOCUS_03350 gene gyrA 3060 319 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337619.1 protein_id gnl|my_center|LOCUS_03350 3791 3330 gene locus_tag LOCUS_03360 3791 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5118 3781 gene locus_tag LOCUS_03370 5118 3781 CDS product DUF5930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337885.1 protein_id gnl|my_center|LOCUS_03370 6049 5249 gene locus_tag LOCUS_03380 6049 5249 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650909.1 protein_id gnl|my_center|LOCUS_03380 6504 6046 gene locus_tag LOCUS_03390 6504 6046 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 protein_id gnl|my_center|LOCUS_03390 6716 7780 gene locus_tag LOCUS_03400 gene queA 6716 7780 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337883.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence033 479 1720 gene locus_tag LOCUS_03410 479 1720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 protein_id gnl|my_center|LOCUS_03410 2183 1707 gene locus_tag LOCUS_03420 gene soxR 2183 1707 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_03420 2274 2657 gene locus_tag LOCUS_03430 2274 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2716 3291 gene locus_tag LOCUS_03440 gene msrA 2716 3291 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_03440 3337 4206 gene locus_tag LOCUS_03450 3337 4206 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561968.1 protein_id gnl|my_center|LOCUS_03450 4494 4267 gene locus_tag LOCUS_03460 4494 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4690 5196 gene locus_tag LOCUS_03470 gene ruvC 4690 5196 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720722.1 protein_id gnl|my_center|LOCUS_03470 5193 5864 gene locus_tag LOCUS_03480 gene ruvA 5193 5864 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338315.1 protein_id gnl|my_center|LOCUS_03480 5868 6893 gene locus_tag LOCUS_03490 gene ruvB 5868 6893 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338313.1 protein_id gnl|my_center|LOCUS_03490 7406 6939 gene locus_tag LOCUS_03500 7406 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 8928 7531 gene locus_tag LOCUS_03510 8928 7531 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence034 1664 303 gene locus_tag LOCUS_03520 1664 303 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_03520 2757 1726 gene locus_tag LOCUS_03530 2757 1726 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_03530 4149 2824 gene locus_tag LOCUS_03540 4149 2824 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_03540 4745 4149 gene locus_tag LOCUS_03550 4745 4149 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_03550 5514 4738 gene locus_tag LOCUS_03560 5514 4738 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972092.1 protein_id gnl|my_center|LOCUS_03560 5667 6539 gene locus_tag LOCUS_03570 5667 6539 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529191.1 protein_id gnl|my_center|LOCUS_03570 7207 6599 gene locus_tag LOCUS_03580 7207 6599 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_03580 7394 7678 gene locus_tag LOCUS_03590 7394 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 8404 7691 gene locus_tag LOCUS_03600 8404 7691 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_03600 <9001 8495 gene locus_tag LOCUS_03610 <9001 8495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337637.1:exodeoxyribonuclease III >Feature sequence035 208 714 gene locus_tag LOCUS_03620 208 714 CDS product DUF2478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338851.1 protein_id gnl|my_center|LOCUS_03620 2153 711 gene locus_tag LOCUS_03630 2153 711 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086043.1 protein_id gnl|my_center|LOCUS_03630 3233 2205 gene locus_tag LOCUS_03640 3233 2205 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140094.1 protein_id gnl|my_center|LOCUS_03640 4427 3291 gene locus_tag LOCUS_03650 4427 3291 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719144.1 protein_id gnl|my_center|LOCUS_03650 4538 4969 gene locus_tag LOCUS_03660 4538 4969 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719143.1 protein_id gnl|my_center|LOCUS_03660 5423 4974 gene locus_tag LOCUS_03670 5423 4974 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 protein_id gnl|my_center|LOCUS_03670 5670 5425 gene locus_tag LOCUS_03680 gene moaD 5670 5425 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721437.1 protein_id gnl|my_center|LOCUS_03680 6335 5670 gene locus_tag LOCUS_03690 gene pgsA 6335 5670 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721439.1 protein_id gnl|my_center|LOCUS_03690 8278 6371 gene locus_tag LOCUS_03700 gene uvrC 8278 6371 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338696.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence036 406 738 gene locus_tag LOCUS_03710 406 738 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722422.1 protein_id gnl|my_center|LOCUS_03710 747 1469 gene locus_tag LOCUS_03720 gene recO 747 1469 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_03720 3127 1466 gene locus_tag LOCUS_03730 3127 1466 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_03730 5241 3301 gene locus_tag LOCUS_03740 5241 3301 CDS product 10S-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114857.1 protein_id gnl|my_center|LOCUS_03740 6384 5254 gene locus_tag LOCUS_03750 6384 5254 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206734.1 protein_id gnl|my_center|LOCUS_03750 7717 6572 gene locus_tag LOCUS_03760 7717 6572 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_03760 <8954 7714 gene locus_tag LOCUS_03770 <8954 7714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026617815.1:aldehyde dehydrogenase family protein >Feature sequence037 169 984 gene locus_tag LOCUS_03780 169 984 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275354.1 protein_id gnl|my_center|LOCUS_03780 2514 1054 gene locus_tag LOCUS_03790 2514 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3126 2614 gene locus_tag LOCUS_03800 3126 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3247 4233 gene locus_tag LOCUS_03810 3247 4233 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337394.1 protein_id gnl|my_center|LOCUS_03810 4260 5045 gene locus_tag LOCUS_03820 4260 5045 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385540.1 protein_id gnl|my_center|LOCUS_03820 5042 5785 gene locus_tag LOCUS_03830 5042 5785 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_03830 6368 5772 gene locus_tag LOCUS_03840 6368 5772 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_03840 7682 6372 gene locus_tag LOCUS_03850 gene paaF 7682 6372 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_03850 8116 7679 gene locus_tag LOCUS_03860 gene paaI 8116 7679 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence038 <1 661 gene locus_tag LOCUS_03870 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720845.1:ATP-dependent zinc metalloprotease FtsH 817 2493 gene locus_tag LOCUS_03880 817 2493 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 protein_id gnl|my_center|LOCUS_03880 2553 2855 gene locus_tag LOCUS_03890 2553 2855 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561857.1 protein_id gnl|my_center|LOCUS_03890 2866 3768 gene locus_tag LOCUS_03900 gene folD 2866 3768 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_03900 5516 3765 gene locus_tag LOCUS_03910 5516 3765 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_03910 5861 5535 gene locus_tag LOCUS_03920 5861 5535 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 protein_id gnl|my_center|LOCUS_03920 6798 5935 gene locus_tag LOCUS_03930 6798 5935 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_03930 8090 6873 gene locus_tag LOCUS_03940 8090 6873 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_03940 8287 8090 gene locus_tag LOCUS_03950 8287 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 8621 8298 gene locus_tag LOCUS_03960 8621 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence039 922 1833 gene locus_tag LOCUS_03970 922 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2169 2609 gene locus_tag LOCUS_03980 2169 2609 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 protein_id gnl|my_center|LOCUS_03980 3024 2680 gene locus_tag LOCUS_03990 3024 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 4209 3511 gene locus_tag LOCUS_04000 4209 3511 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920292.1 protein_id gnl|my_center|LOCUS_04000 4446 5630 gene locus_tag LOCUS_04010 gene metZ 4446 5630 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722742.1 protein_id gnl|my_center|LOCUS_04010 5804 6442 gene locus_tag LOCUS_04020 gene folE 5804 6442 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 protein_id gnl|my_center|LOCUS_04020 6485 7198 gene locus_tag LOCUS_04030 6485 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence040 1285 2055 gene locus_tag LOCUS_04040 1285 2055 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336968.1 protein_id gnl|my_center|LOCUS_04040 2048 2371 gene locus_tag LOCUS_04050 2048 2371 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_04050 2372 3244 gene locus_tag LOCUS_04060 gene znuA 2372 3244 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 protein_id gnl|my_center|LOCUS_04060 3241 3711 gene locus_tag LOCUS_04070 3241 3711 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337389.1 protein_id gnl|my_center|LOCUS_04070 3711 4763 gene locus_tag LOCUS_04080 3711 4763 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135504448.1 protein_id gnl|my_center|LOCUS_04080 5549 4743 gene locus_tag LOCUS_04090 5549 4743 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 protein_id gnl|my_center|LOCUS_04090 5671 6690 gene locus_tag LOCUS_04100 5671 6690 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719464.1 protein_id gnl|my_center|LOCUS_04100 7048 6701 gene locus_tag LOCUS_04110 7048 6701 CDS product H-type lectin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137194167.1 protein_id gnl|my_center|LOCUS_04110 7537 7139 gene locus_tag LOCUS_04120 7537 7139 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337387.1 protein_id gnl|my_center|LOCUS_04120 <8491 7553 gene locus_tag LOCUS_04130 <8491 7553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719462.1:F0F1 ATP synthase subunit beta >Feature sequence041 2 1348 gene locus_tag LOCUS_04140 gene rimO 2 1348 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008101.1 protein_id gnl|my_center|LOCUS_04140 1401 3575 gene locus_tag LOCUS_04150 1401 3575 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_04150 4916 3648 gene locus_tag LOCUS_04160 4916 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 6580 4913 gene locus_tag LOCUS_04170 gene ettA 6580 4913 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720754.1 protein_id gnl|my_center|LOCUS_04170 6743 7312 gene locus_tag LOCUS_04180 6743 7312 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence042 2912 2361 gene locus_tag LOCUS_04190 2912 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3064 3351 gene locus_tag LOCUS_04200 3064 3351 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719575.1 protein_id gnl|my_center|LOCUS_04200 3351 4286 gene locus_tag LOCUS_04210 3351 4286 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 protein_id gnl|my_center|LOCUS_04210 4667 4464 gene locus_tag LOCUS_04220 4667 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4809 5672 gene locus_tag LOCUS_04230 4809 5672 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140071.1 protein_id gnl|my_center|LOCUS_04230 5674 6051 gene locus_tag LOCUS_04240 5674 6051 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453603.1 protein_id gnl|my_center|LOCUS_04240 6117 6926 gene locus_tag LOCUS_04250 6117 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7102 7728 gene locus_tag LOCUS_04260 7102 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 8286 7744 gene locus_tag LOCUS_04270 8286 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence043 566 105 gene locus_tag LOCUS_04280 566 105 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140259.1 protein_id gnl|my_center|LOCUS_04280 735 1898 gene locus_tag LOCUS_04290 735 1898 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337540.1 protein_id gnl|my_center|LOCUS_04290 1898 3502 gene locus_tag LOCUS_04300 1898 3502 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003589.1 protein_id gnl|my_center|LOCUS_04300 3514 5475 gene locus_tag LOCUS_04310 3514 5475 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396257.1 protein_id gnl|my_center|LOCUS_04310 5468 6322 gene locus_tag LOCUS_04320 5468 6322 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396254.1 protein_id gnl|my_center|LOCUS_04320 6324 7103 gene locus_tag LOCUS_04330 6324 7103 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243515.1 protein_id gnl|my_center|LOCUS_04330 7333 7100 gene locus_tag LOCUS_04340 7333 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7658 7419 gene locus_tag LOCUS_04350 7658 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8205 7672 gene locus_tag LOCUS_04360 8205 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence044 <1 737 gene locus_tag LOCUS_04370 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003725.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase 805 2193 gene locus_tag LOCUS_04380 gene lpdA 805 2193 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382954.1 protein_id gnl|my_center|LOCUS_04380 3376 2234 gene locus_tag LOCUS_04390 gene dnaJ 3376 2234 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338764.1 protein_id gnl|my_center|LOCUS_04390 5358 3445 gene locus_tag LOCUS_04400 gene dnaK 5358 3445 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721635.1 protein_id gnl|my_center|LOCUS_04400 6040 5579 gene locus_tag LOCUS_04410 6040 5579 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206874.1 protein_id gnl|my_center|LOCUS_04410 6414 6037 gene locus_tag LOCUS_04420 6414 6037 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_04420 7241 6411 gene locus_tag LOCUS_04430 7241 6411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385425.1 protein_id gnl|my_center|LOCUS_04430 7353 8147 gene locus_tag LOCUS_04440 gene cysQ 7353 8147 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence045 447 1235 gene locus_tag LOCUS_04450 gene hisN 447 1235 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_04450 1882 1229 gene locus_tag LOCUS_04460 1882 1229 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670506.1 protein_id gnl|my_center|LOCUS_04460 1881 2549 gene locus_tag LOCUS_04470 1881 2549 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724571.1 protein_id gnl|my_center|LOCUS_04470 2546 5056 gene locus_tag LOCUS_04480 2546 5056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339447.1 protein_id gnl|my_center|LOCUS_04480 5150 5917 gene locus_tag LOCUS_04490 5150 5917 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537939.1 protein_id gnl|my_center|LOCUS_04490 6346 6044 gene locus_tag LOCUS_04500 6346 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6586 6595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7213 6695 gene locus_tag LOCUS_04510 7213 6695 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140415.1 protein_id gnl|my_center|LOCUS_04510 <8141 7246 gene locus_tag LOCUS_04520 <8141 7246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565362.1:excinuclease ABC subunit UvrA >Feature sequence046 417 1055 gene locus_tag LOCUS_04530 417 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385409.1 protein_id gnl|my_center|LOCUS_04530 1052 1564 gene locus_tag LOCUS_04540 1052 1564 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563197.1 protein_id gnl|my_center|LOCUS_04540 1561 2319 gene locus_tag LOCUS_04550 gene lptB 1561 2319 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721595.1 protein_id gnl|my_center|LOCUS_04550 2329 3636 gene locus_tag LOCUS_04560 gene rpoN 2329 3636 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533495.1 protein_id gnl|my_center|LOCUS_04560 3834 4370 gene locus_tag LOCUS_04570 gene raiA 3834 4370 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_04570 4404 4868 gene locus_tag LOCUS_04580 4404 4868 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721599.1 protein_id gnl|my_center|LOCUS_04580 6313 4847 gene locus_tag LOCUS_04590 6313 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538034.1 protein_id gnl|my_center|LOCUS_04590 7992 6310 gene locus_tag LOCUS_04600 7992 6310 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence047 <1 559 gene locus_tag LOCUS_04610 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868964.1:phosphate/phosphite/phosphonate ABC transporter substrate-binding protein 556 1977 gene locus_tag LOCUS_04620 556 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1978 3219 gene locus_tag LOCUS_04630 1978 3219 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975717.1 protein_id gnl|my_center|LOCUS_04630 3377 3895 gene locus_tag LOCUS_04640 3377 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3911 6364 gene locus_tag LOCUS_04650 3911 6364 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_04650 6586 6510 gene locus_tag LOCUS_t00050 6586 6510 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6710 6904 gene locus_tag LOCUS_04660 6710 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 <7997 6905 gene locus_tag LOCUS_04670 <7997 6905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222071.1:glycosyltransferase >Feature sequence048 826 77 gene locus_tag LOCUS_04680 826 77 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 protein_id gnl|my_center|LOCUS_04680 2176 884 gene locus_tag LOCUS_04690 2176 884 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336959.1 protein_id gnl|my_center|LOCUS_04690 3395 2178 gene locus_tag LOCUS_04700 3395 2178 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722555.1 protein_id gnl|my_center|LOCUS_04700 4551 3535 gene locus_tag LOCUS_04710 4551 3535 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_04710 5827 5114 gene locus_tag LOCUS_04720 5827 5114 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 protein_id gnl|my_center|LOCUS_04720 6507 5824 gene locus_tag LOCUS_04730 6507 5824 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_04730 7553 6504 gene locus_tag LOCUS_04740 7553 6504 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722549.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence049 1845 934 gene locus_tag LOCUS_04750 1845 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1969 3702 gene locus_tag LOCUS_04760 gene ilvD 1969 3702 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383299.1 protein_id gnl|my_center|LOCUS_04760 3683 4351 gene locus_tag LOCUS_04770 3683 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 4355 4966 gene locus_tag LOCUS_04780 4355 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5035 6219 gene locus_tag LOCUS_04790 5035 6219 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972073.1 protein_id gnl|my_center|LOCUS_04790 6760 6230 gene locus_tag LOCUS_04800 6760 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6865 7605 gene locus_tag LOCUS_04810 6865 7605 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence050 2605 809 gene locus_tag LOCUS_04820 2605 809 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_04820 3283 2696 gene locus_tag LOCUS_04830 3283 2696 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385295.1 protein_id gnl|my_center|LOCUS_04830 3905 3342 gene locus_tag LOCUS_04840 3905 3342 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538005.1 protein_id gnl|my_center|LOCUS_04840 4028 4207 gene locus_tag LOCUS_04850 4028 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4835 4278 gene locus_tag LOCUS_04860 4835 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6289 4832 gene locus_tag LOCUS_04870 6289 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6811 6299 gene locus_tag LOCUS_04880 6811 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 7450 6842 gene locus_tag LOCUS_04890 7450 6842 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence051 1306 359 gene locus_tag LOCUS_04900 1306 359 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337390.1 protein_id gnl|my_center|LOCUS_04900 1753 1331 gene locus_tag LOCUS_04910 1753 1331 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_04910 2681 1797 gene locus_tag LOCUS_04920 2681 1797 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337391.1 protein_id gnl|my_center|LOCUS_04920 3608 2688 gene locus_tag LOCUS_04930 3608 2688 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383738.1 protein_id gnl|my_center|LOCUS_04930 3719 4405 gene locus_tag LOCUS_04940 3719 4405 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402174.1 protein_id gnl|my_center|LOCUS_04940 4530 4817 gene locus_tag LOCUS_04950 gene groES 4530 4817 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_04950 4851 6497 gene locus_tag LOCUS_04960 gene groL 4851 6497 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719474.1 protein_id gnl|my_center|LOCUS_04960 6721 7062 gene locus_tag LOCUS_04970 6721 7062 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence052 117 1163 gene locus_tag LOCUS_04980 117 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04980 800 809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1254 1607 gene locus_tag LOCUS_04990 1254 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1650 1725 gene locus_tag LOCUS_t00060 1650 1725 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4051 1793 gene locus_tag LOCUS_05000 4051 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4174 5253 gene locus_tag LOCUS_05010 4174 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 5324 6940 gene locus_tag LOCUS_05020 5324 6940 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_05020 <7657 6961 gene locus_tag LOCUS_05030 <7657 6961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337700.1:glucose-6-phosphate isomerase >Feature sequence053 904 1902 gene locus_tag LOCUS_05040 904 1902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 protein_id gnl|my_center|LOCUS_05040 1975 2874 gene locus_tag LOCUS_05050 1975 2874 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393024.1 protein_id gnl|my_center|LOCUS_05050 2867 3886 gene locus_tag LOCUS_05060 2867 3886 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328718.1 protein_id gnl|my_center|LOCUS_05060 4099 3890 gene locus_tag LOCUS_05070 4099 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4683 4096 gene locus_tag LOCUS_05080 4683 4096 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_05080 4826 5326 gene locus_tag LOCUS_05090 4826 5326 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972905.1 protein_id gnl|my_center|LOCUS_05090 5319 5678 gene locus_tag LOCUS_05100 5319 5678 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_05100 5771 7252 gene locus_tag LOCUS_05110 gene hisS 5771 7252 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339406.1 protein_id gnl|my_center|LOCUS_05110 7252 7557 gene locus_tag LOCUS_05120 7252 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence054 1639 485 gene locus_tag LOCUS_05130 1639 485 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338788.1 protein_id gnl|my_center|LOCUS_05130 2229 1630 gene locus_tag LOCUS_05140 2229 1630 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 protein_id gnl|my_center|LOCUS_05140 3314 2226 gene locus_tag LOCUS_05150 gene ribA 3314 2226 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338539.1 protein_id gnl|my_center|LOCUS_05150 3467 4153 gene locus_tag LOCUS_05160 3467 4153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_05160 5173 4202 gene locus_tag LOCUS_05170 gene pip 5173 4202 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538042.1 protein_id gnl|my_center|LOCUS_05170 5231 5971 gene locus_tag LOCUS_05180 5231 5971 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338766.1 protein_id gnl|my_center|LOCUS_05180 6407 5958 gene locus_tag LOCUS_05190 6407 5958 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 protein_id gnl|my_center|LOCUS_05190 7249 6404 gene locus_tag LOCUS_05200 7249 6404 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365317.1 protein_id gnl|my_center|LOCUS_05200 7506 7246 gene locus_tag LOCUS_05210 gene grxC 7506 7246 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence055 1703 855 gene locus_tag LOCUS_05220 1703 855 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338741.1 protein_id gnl|my_center|LOCUS_05220 1945 1703 gene locus_tag LOCUS_05230 1945 1703 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383143.1 protein_id gnl|my_center|LOCUS_05230 2742 2065 gene locus_tag LOCUS_05240 2742 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3664 2744 gene locus_tag LOCUS_05250 3664 2744 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 protein_id gnl|my_center|LOCUS_05250 3716 4288 gene locus_tag LOCUS_05260 3716 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328006.1 protein_id gnl|my_center|LOCUS_05260 4288 5115 gene locus_tag LOCUS_05270 gene mutM 4288 5115 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385127.1 protein_id gnl|my_center|LOCUS_05270 5171 5947 gene locus_tag LOCUS_05280 5171 5947 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721912.1 protein_id gnl|my_center|LOCUS_05280 6032 6298 gene locus_tag LOCUS_05290 gene rpsT 6032 6298 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385126.1 protein_id gnl|my_center|LOCUS_05290 6672 7118 gene locus_tag LOCUS_05300 6672 7118 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078099.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence056 2634 1471 gene locus_tag LOCUS_05310 2634 1471 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_05310 3282 2644 gene locus_tag LOCUS_05320 3282 2644 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385058.1 protein_id gnl|my_center|LOCUS_05320 4000 3314 gene locus_tag LOCUS_05330 4000 3314 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_05330 5250 3997 gene locus_tag LOCUS_05340 gene phaZ 5250 3997 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390504.1 protein_id gnl|my_center|LOCUS_05340 5398 5718 gene locus_tag LOCUS_05350 5398 5718 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721290.1 protein_id gnl|my_center|LOCUS_05350 5809 5884 gene locus_tag LOCUS_t00070 5809 5884 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6030 7133 gene locus_tag LOCUS_05360 6030 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence057 154 747 gene locus_tag LOCUS_05370 gene hisB 154 747 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 protein_id gnl|my_center|LOCUS_05370 744 1385 gene locus_tag LOCUS_05380 gene hisH 744 1385 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337344.1 protein_id gnl|my_center|LOCUS_05380 3680 1536 gene locus_tag LOCUS_05390 3680 1536 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140090.1 protein_id gnl|my_center|LOCUS_05390 3866 6421 gene locus_tag LOCUS_05400 gene pepN 3866 6421 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337133.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence058 5886 448 gene locus_tag LOCUS_05410 5886 448 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338903.1 protein_id gnl|my_center|LOCUS_05410 6553 5939 gene locus_tag LOCUS_05420 6553 5939 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337853.1 protein_id gnl|my_center|LOCUS_05420 <7414 6550 gene locus_tag LOCUS_05430 <7414 6550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140080.1:XdhC family protein >Feature sequence059 623 1456 gene locus_tag LOCUS_05440 623 1456 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338675.1 protein_id gnl|my_center|LOCUS_05440 1554 2207 gene locus_tag LOCUS_05450 1554 2207 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538099.1 protein_id gnl|my_center|LOCUS_05450 2314 3087 gene locus_tag LOCUS_05460 2314 3087 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721367.1 protein_id gnl|my_center|LOCUS_05460 3084 3965 gene locus_tag LOCUS_05470 3084 3965 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_05470 4073 5398 gene locus_tag LOCUS_05480 4073 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05480 5287 6096 gene locus_tag LOCUS_05490 5287 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05490 5316 5325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6093 6773 gene locus_tag LOCUS_05500 6093 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7031 6831 gene locus_tag LOCUS_05510 7031 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence060 1770 559 gene locus_tag LOCUS_05520 1770 559 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564438.1 protein_id gnl|my_center|LOCUS_05520 2378 1773 gene locus_tag LOCUS_05530 2378 1773 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337546.1 protein_id gnl|my_center|LOCUS_05530 2921 2388 gene locus_tag LOCUS_05540 2921 2388 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719665.1 protein_id gnl|my_center|LOCUS_05540 3277 2912 gene locus_tag LOCUS_05550 3277 2912 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719664.1 protein_id gnl|my_center|LOCUS_05550 4139 3648 gene locus_tag LOCUS_05560 4139 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4350 4274 gene locus_tag LOCUS_t00080 4350 4274 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4453 4377 gene locus_tag LOCUS_t00090 4453 4377 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4628 6715 gene locus_tag LOCUS_05570 4628 6715 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 protein_id gnl|my_center|LOCUS_05570 6880 6805 gene locus_tag LOCUS_t00100 6880 6805 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 163 393 gene locus_tag LOCUS_05580 163 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 567 2696 gene locus_tag LOCUS_05590 gene scpA 567 2696 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_05590 2744 3538 gene locus_tag LOCUS_05600 2744 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3556 5835 gene locus_tag LOCUS_05610 3556 5835 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336861.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence062 <1 596 gene locus_tag LOCUS_05620 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133034483.1:M20 aminoacylase family protein 596 2014 gene locus_tag LOCUS_05630 596 2014 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965780.1 protein_id gnl|my_center|LOCUS_05630 2011 3645 gene locus_tag LOCUS_05640 2011 3645 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 protein_id gnl|my_center|LOCUS_05640 3651 4691 gene locus_tag LOCUS_05650 3651 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4804 5232 gene locus_tag LOCUS_05660 gene rfaE2 4804 5232 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_05660 5409 5735 gene locus_tag LOCUS_05670 gene yajC 5409 5735 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence063 <1 594 gene locus_tag LOCUS_05680 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721891.1:flagellar basal body L-ring protein FlgH 604 1122 gene locus_tag LOCUS_05690 604 1122 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140007.1 protein_id gnl|my_center|LOCUS_05690 1955 1119 gene locus_tag LOCUS_05700 1955 1119 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_05700 3322 1952 gene locus_tag LOCUS_05710 3322 1952 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140017.1 protein_id gnl|my_center|LOCUS_05710 3905 3567 gene locus_tag LOCUS_05720 3905 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4058 4711 gene locus_tag LOCUS_05730 4058 4711 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383285.1 protein_id gnl|my_center|LOCUS_05730 6366 4708 gene locus_tag LOCUS_05740 6366 4708 CDS product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_05740 <7175 6511 gene locus_tag LOCUS_05750 <7175 6511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721972.1:aspartate-semialdehyde dehydrogenase >Feature sequence064 528 1085 gene locus_tag LOCUS_05760 528 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 998 1627 gene locus_tag LOCUS_05770 998 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1064 1073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1981 2121 gene locus_tag LOCUS_05780 1981 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2082 2636 gene locus_tag LOCUS_05790 2082 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3087 2647 gene locus_tag LOCUS_05800 3087 2647 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_05800 3227 4087 gene locus_tag LOCUS_05810 3227 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5368 4097 gene locus_tag LOCUS_05820 gene guaD 5368 4097 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975653.1 protein_id gnl|my_center|LOCUS_05820 6603 5371 gene locus_tag LOCUS_05830 6603 5371 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528235.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence065 2390 882 gene locus_tag LOCUS_05840 2390 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3904 2561 gene locus_tag LOCUS_05850 gene ftsA 3904 2561 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719268.1 protein_id gnl|my_center|LOCUS_05850 4770 3901 gene locus_tag LOCUS_05860 4770 3901 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337245.1 protein_id gnl|my_center|LOCUS_05860 5552 4758 gene locus_tag LOCUS_05870 5552 4758 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337244.1 protein_id gnl|my_center|LOCUS_05870 6764 5832 gene locus_tag LOCUS_05880 gene murB 6764 5832 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337243.1 protein_id gnl|my_center|LOCUS_05880 7003 6761 gene locus_tag LOCUS_05890 7003 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence066 707 1510 gene locus_tag LOCUS_05900 707 1510 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383017.1 protein_id gnl|my_center|LOCUS_05900 1572 2171 gene locus_tag LOCUS_05910 1572 2171 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338205.1 protein_id gnl|my_center|LOCUS_05910 2168 2827 gene locus_tag LOCUS_05920 2168 2827 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 protein_id gnl|my_center|LOCUS_05920 3006 4553 gene locus_tag LOCUS_05930 3006 4553 CDS product phosphate ABC transporter substrate-binding/OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669810.1 protein_id gnl|my_center|LOCUS_05930 4646 6235 gene locus_tag LOCUS_05940 4646 6235 CDS product phosphate ABC transporter substrate-binding/OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669810.1 protein_id gnl|my_center|LOCUS_05940 7150 6302 gene locus_tag LOCUS_05950 7150 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence067 444 199 gene locus_tag LOCUS_05960 444 199 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530645.1 protein_id gnl|my_center|LOCUS_05960 2697 448 gene locus_tag LOCUS_05970 2697 448 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_05970 3170 2694 gene locus_tag LOCUS_05980 3170 2694 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_05980 4030 3167 gene locus_tag LOCUS_05990 4030 3167 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_05990 5650 4139 gene locus_tag LOCUS_06000 5650 4139 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369093.1 protein_id gnl|my_center|LOCUS_06000 6719 6165 gene locus_tag LOCUS_06010 6719 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence068 323 78 gene locus_tag LOCUS_06020 323 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 463 1596 gene locus_tag LOCUS_06030 463 1596 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975704.1 protein_id gnl|my_center|LOCUS_06030 1578 2624 gene locus_tag LOCUS_06040 1578 2624 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327827.1 protein_id gnl|my_center|LOCUS_06040 3126 2779 gene locus_tag LOCUS_06050 3126 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4987 3119 gene locus_tag LOCUS_06060 4987 3119 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338655.1 protein_id gnl|my_center|LOCUS_06060 6101 5124 gene locus_tag LOCUS_06070 gene ubiA 6101 5124 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338654.1 protein_id gnl|my_center|LOCUS_06070 6455 6464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6529 6828 gene locus_tag LOCUS_06080 6529 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06080 >Feature sequence069 1608 493 gene locus_tag LOCUS_06090 1608 493 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338864.1 protein_id gnl|my_center|LOCUS_06090 2622 1612 gene locus_tag LOCUS_06100 2622 1612 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385164.1 protein_id gnl|my_center|LOCUS_06100 4083 2623 gene locus_tag LOCUS_06110 gene flgK 4083 2623 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385165.1 protein_id gnl|my_center|LOCUS_06110 5402 4101 gene locus_tag LOCUS_06120 5402 4101 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385166.1 protein_id gnl|my_center|LOCUS_06120 6344 5490 gene locus_tag LOCUS_06130 6344 5490 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669859.1 protein_id gnl|my_center|LOCUS_06130 <7023 6439 gene locus_tag LOCUS_06140 <7023 6439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390370.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase >Feature sequence070 1501 2907 gene locus_tag LOCUS_06150 gene pccR 1501 2907 CDS product propionyl-CoA assimilation transcriptional regulator PccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719339.1 protein_id gnl|my_center|LOCUS_06150 3063 4403 gene locus_tag LOCUS_06160 3063 4403 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920799.1 protein_id gnl|my_center|LOCUS_06160 4407 5726 gene locus_tag LOCUS_06170 gene preA 4407 5726 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_06170 5801 6688 gene locus_tag LOCUS_06180 5801 6688 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704897.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence071 <1 1322 gene locus_tag LOCUS_06190 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337384.1:ATP-dependent Clp protease ATP-binding subunit ClpA 3045 1435 gene locus_tag LOCUS_06200 3045 1435 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140137.1 protein_id gnl|my_center|LOCUS_06200 4254 3049 gene locus_tag LOCUS_06210 4254 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337381.1 protein_id gnl|my_center|LOCUS_06210 4482 5408 gene locus_tag LOCUS_06220 4482 5408 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_06220 5412 5861 gene locus_tag LOCUS_06230 5412 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6413 5865 gene locus_tag LOCUS_06240 6413 5865 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337380.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence072 <1 1294 gene locus_tag LOCUS_06250 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337678.1:outer membrane protein assembly factor BamA 1304 1885 gene locus_tag LOCUS_06260 1304 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1882 2355 gene locus_tag LOCUS_06270 gene fabZ 1882 2355 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719864.1 protein_id gnl|my_center|LOCUS_06270 2358 2594 gene locus_tag LOCUS_06280 2358 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06280 2558 2567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2639 3175 gene locus_tag LOCUS_06290 2639 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06290 3179 4000 gene locus_tag LOCUS_06300 gene lpxI 3179 4000 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337681.1 protein_id gnl|my_center|LOCUS_06300 3997 5169 gene locus_tag LOCUS_06310 gene lpxB 3997 5169 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_06310 6500 5205 gene locus_tag LOCUS_06320 gene gltA 6500 5205 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337142.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence073 231 1073 gene locus_tag LOCUS_06330 231 1073 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537526.1 protein_id gnl|my_center|LOCUS_06330 1075 1377 gene locus_tag LOCUS_06340 1075 1377 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383675.1 protein_id gnl|my_center|LOCUS_06340 1415 1720 gene locus_tag LOCUS_06350 1415 1720 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383676.1 protein_id gnl|my_center|LOCUS_06350 1720 3429 gene locus_tag LOCUS_06360 gene ureC 1720 3429 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537527.1 protein_id gnl|my_center|LOCUS_06360 3999 4448 gene locus_tag LOCUS_06370 gene ureE 3999 4448 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720469.1 protein_id gnl|my_center|LOCUS_06370 4438 5085 gene locus_tag LOCUS_06380 4438 5085 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739341.1 protein_id gnl|my_center|LOCUS_06380 5082 5705 gene locus_tag LOCUS_06390 gene ureG 5082 5705 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537530.1 protein_id gnl|my_center|LOCUS_06390 6241 6023 gene locus_tag LOCUS_06400 6241 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 6426 6827 gene locus_tag LOCUS_06410 6426 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence074 <1 1324 gene locus_tag LOCUS_06420 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338570.1:type I secretion system permease/ATPase 1321 2610 gene locus_tag LOCUS_06430 1321 2610 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 protein_id gnl|my_center|LOCUS_06430 3747 2611 gene locus_tag LOCUS_06440 3747 2611 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336763.1 protein_id gnl|my_center|LOCUS_06440 4829 3795 gene locus_tag LOCUS_06450 gene mutY 4829 3795 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486227.1 protein_id gnl|my_center|LOCUS_06450 4913 5470 gene locus_tag LOCUS_06460 4913 5470 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 protein_id gnl|my_center|LOCUS_06460 5470 6099 gene locus_tag LOCUS_06470 5470 6099 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921714.1 protein_id gnl|my_center|LOCUS_06470 6485 6102 gene locus_tag LOCUS_06480 6485 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence075 <1 625 gene locus_tag LOCUS_06490 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706484.1:bifunctional lysylphosphatidylglycerol flippase/synthetase MprF note possible pseudo, frameshifted 601 610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1610 852 gene locus_tag LOCUS_06500 1610 852 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338237.1 protein_id gnl|my_center|LOCUS_06500 1715 3199 gene locus_tag LOCUS_06510 gene glpD 1715 3199 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669370.1 protein_id gnl|my_center|LOCUS_06510 4399 3200 gene locus_tag LOCUS_06520 gene ubiM 4399 3200 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951321.1 protein_id gnl|my_center|LOCUS_06520 5208 4459 gene locus_tag LOCUS_06530 5208 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6161 5211 gene locus_tag LOCUS_06540 gene cysK 6161 5211 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence076 2323 863 gene locus_tag LOCUS_06550 gene zwf 2323 863 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562257.1 protein_id gnl|my_center|LOCUS_06550 3188 2526 gene locus_tag LOCUS_06560 3188 2526 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_06560 4214 3216 gene locus_tag LOCUS_06570 4214 3216 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_06570 5217 4207 gene locus_tag LOCUS_06580 5217 4207 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551979.1 protein_id gnl|my_center|LOCUS_06580 5325 5669 gene locus_tag LOCUS_06590 5325 5669 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969026.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence077 3515 807 gene locus_tag LOCUS_06600 gene secA 3515 807 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338761.1 protein_id gnl|my_center|LOCUS_06600 3766 4620 gene locus_tag LOCUS_06610 3766 4620 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721622.1 protein_id gnl|my_center|LOCUS_06610 4631 5878 gene locus_tag LOCUS_06620 gene argJ 4631 5878 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338759.1 protein_id gnl|my_center|LOCUS_06620 5875 6273 gene locus_tag LOCUS_06630 5875 6273 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence078 721 278 gene locus_tag LOCUS_06640 721 278 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 protein_id gnl|my_center|LOCUS_06640 1846 797 gene locus_tag LOCUS_06650 1846 797 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976315.1 protein_id gnl|my_center|LOCUS_06650 2932 1880 gene locus_tag LOCUS_06660 2932 1880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532921.1 protein_id gnl|my_center|LOCUS_06660 4439 2916 gene locus_tag LOCUS_06670 4439 2916 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532922.1 protein_id gnl|my_center|LOCUS_06670 4572 5837 gene locus_tag LOCUS_06680 gene mtnK 4572 5837 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532923.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence079 <1 894 gene locus_tag LOCUS_06690 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228854.1:cystathionine beta-lyase PatB 1579 908 gene locus_tag LOCUS_06700 gene gph 1579 908 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338841.1 protein_id gnl|my_center|LOCUS_06700 2133 1579 gene locus_tag LOCUS_06710 2133 1579 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_06710 2830 2135 gene locus_tag LOCUS_06720 2830 2135 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721822.1 protein_id gnl|my_center|LOCUS_06720 3513 2827 gene locus_tag LOCUS_06730 gene rpe 3513 2827 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975097.1 protein_id gnl|my_center|LOCUS_06730 4919 3573 gene locus_tag LOCUS_06740 4919 3573 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_06740 6133 5069 gene locus_tag LOCUS_06750 gene fba 6133 5069 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338843.1 protein_id gnl|my_center|LOCUS_06750 <6766 6138 gene locus_tag LOCUS_06760 <6766 6138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383968.1:phosphoglycerate kinase >Feature sequence080 533 237 gene locus_tag LOCUS_06770 533 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 964 530 gene locus_tag LOCUS_06780 gene rnpA 964 530 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721421.1 protein_id gnl|my_center|LOCUS_06780 1118 984 gene locus_tag LOCUS_06790 gene rpmH 1118 984 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531576.1 protein_id gnl|my_center|LOCUS_06790 1371 2099 gene locus_tag LOCUS_06800 1371 2099 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338687.1 protein_id gnl|my_center|LOCUS_06800 2096 3508 gene locus_tag LOCUS_06810 2096 3508 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_06810 4572 3505 gene locus_tag LOCUS_06820 4572 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4789 6177 gene locus_tag LOCUS_06830 4789 6177 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 protein_id gnl|my_center|LOCUS_06830 6240 6316 gene locus_tag LOCUS_t00110 6240 6316 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 74 1666 gene locus_tag LOCUS_06840 gene serA 74 1666 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243413.1 protein_id gnl|my_center|LOCUS_06840 2308 1721 gene locus_tag LOCUS_06850 2308 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2468 2710 gene locus_tag LOCUS_06860 2468 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2954 4246 gene locus_tag LOCUS_06870 2954 4246 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537502.1 protein_id gnl|my_center|LOCUS_06870 4246 4461 gene locus_tag LOCUS_06880 4246 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4458 5102 gene locus_tag LOCUS_06890 4458 5102 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537504.1 protein_id gnl|my_center|LOCUS_06890 5158 5496 gene locus_tag LOCUS_06900 5158 5496 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_06900 5699 6286 gene locus_tag LOCUS_06910 5699 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence082 2958 460 gene locus_tag LOCUS_06920 2958 460 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339417.1 protein_id gnl|my_center|LOCUS_06920 3138 3920 gene locus_tag LOCUS_06930 3138 3920 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970519.1 protein_id gnl|my_center|LOCUS_06930 3966 4760 gene locus_tag LOCUS_06940 3966 4760 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence083 511 1764 gene locus_tag LOCUS_06950 gene tyrS 511 1764 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384847.1 protein_id gnl|my_center|LOCUS_06950 2963 1998 gene locus_tag LOCUS_06960 2963 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3695 3093 gene locus_tag LOCUS_06970 3695 3093 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161524.1 protein_id gnl|my_center|LOCUS_06970 4201 3692 gene locus_tag LOCUS_06980 4201 3692 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383969.1 protein_id gnl|my_center|LOCUS_06980 4767 4270 gene locus_tag LOCUS_06990 gene coaD 4767 4270 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720119.1 protein_id gnl|my_center|LOCUS_06990 6018 4816 gene locus_tag LOCUS_07000 6018 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 6459 6022 gene locus_tag LOCUS_07010 6459 6022 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence084 101 1192 gene locus_tag LOCUS_07020 101 1192 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562231.1 protein_id gnl|my_center|LOCUS_07020 1226 1489 gene locus_tag LOCUS_07030 1226 1489 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719929.1 protein_id gnl|my_center|LOCUS_07030 1496 2707 gene locus_tag LOCUS_07040 1496 2707 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337737.1 protein_id gnl|my_center|LOCUS_07040 3294 2704 gene locus_tag LOCUS_07050 3294 2704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056046.1 protein_id gnl|my_center|LOCUS_07050 3848 3297 gene locus_tag LOCUS_07060 3848 3297 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337738.1 protein_id gnl|my_center|LOCUS_07060 4011 5564 gene locus_tag LOCUS_07070 4011 5564 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537591.1 protein_id gnl|my_center|LOCUS_07070 <6686 5571 gene locus_tag LOCUS_07080 <6686 5571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337780.1:3-dehydroquinate synthase >Feature sequence085 840 751 gene locus_tag LOCUS_t00120 840 751 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 951 1100 gene locus_tag LOCUS_07090 951 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1667 1146 gene locus_tag LOCUS_07100 1667 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3390 1735 gene locus_tag LOCUS_07110 gene nirS 3390 1735 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_07110 3527 3979 gene locus_tag LOCUS_07120 3527 3979 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565637.1 protein_id gnl|my_center|LOCUS_07120 4001 5362 gene locus_tag LOCUS_07130 4001 5362 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 protein_id gnl|my_center|LOCUS_07130 5364 6170 gene locus_tag LOCUS_07140 5364 6170 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence086 1276 464 gene locus_tag LOCUS_07150 gene map 1276 464 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338595.1 protein_id gnl|my_center|LOCUS_07150 2032 1328 gene locus_tag LOCUS_07160 gene sfsA 2032 1328 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188483638.1 protein_id gnl|my_center|LOCUS_07160 2078 2803 gene locus_tag LOCUS_07170 2078 2803 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383303.1 protein_id gnl|my_center|LOCUS_07170 3071 2796 gene locus_tag LOCUS_07180 3071 2796 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383068.1 protein_id gnl|my_center|LOCUS_07180 3477 3073 gene locus_tag LOCUS_07190 gene mce 3477 3073 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 protein_id gnl|my_center|LOCUS_07190 4078 3506 gene locus_tag LOCUS_07200 4078 3506 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_07200 6369 4102 gene locus_tag LOCUS_07210 gene ptsP 6369 4102 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563776.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence087 1426 89 gene locus_tag LOCUS_07220 gene secY 1426 89 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336953.1 protein_id gnl|my_center|LOCUS_07220 2030 1572 gene locus_tag LOCUS_07230 gene rplO 2030 1572 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385304.1 protein_id gnl|my_center|LOCUS_07230 2458 2270 gene locus_tag LOCUS_07240 gene rpmD 2458 2270 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385305.1 protein_id gnl|my_center|LOCUS_07240 3048 2470 gene locus_tag LOCUS_07250 gene rpsE 3048 2470 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722522.1 protein_id gnl|my_center|LOCUS_07250 3418 3059 gene locus_tag LOCUS_07260 gene rplR 3418 3059 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722520.1 protein_id gnl|my_center|LOCUS_07260 3963 3430 gene locus_tag LOCUS_07270 gene rplF 3963 3430 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722518.1 protein_id gnl|my_center|LOCUS_07270 4372 3974 gene locus_tag LOCUS_07280 gene rpsH 4372 3974 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385309.1 protein_id gnl|my_center|LOCUS_07280 4690 4385 gene locus_tag LOCUS_07290 gene rpsN 4690 4385 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385310.1 protein_id gnl|my_center|LOCUS_07290 5261 4710 gene locus_tag LOCUS_07300 gene rplE 5261 4710 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385311.1 protein_id gnl|my_center|LOCUS_07300 5568 5254 gene locus_tag LOCUS_07310 gene rplX 5568 5254 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722510.1 protein_id gnl|my_center|LOCUS_07310 5936 5568 gene locus_tag LOCUS_07320 gene rplN 5936 5568 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_07320 6239 6009 gene locus_tag LOCUS_07330 gene rpsQ 6239 6009 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385314.1 protein_id gnl|my_center|LOCUS_07330 6451 6251 gene locus_tag LOCUS_07340 gene rpmC 6451 6251 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence088 1280 732 gene locus_tag LOCUS_07350 1280 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1829 1302 gene locus_tag LOCUS_07360 1829 1302 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338204.1 protein_id gnl|my_center|LOCUS_07360 3181 1829 gene locus_tag LOCUS_07370 3181 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3457 3371 gene locus_tag LOCUS_t00130 3457 3371 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3562 4221 gene locus_tag LOCUS_07380 gene lipB 3562 4221 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 protein_id gnl|my_center|LOCUS_07380 4366 6003 gene locus_tag LOCUS_07390 gene ctaD 4366 6003 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337048.1 protein_id gnl|my_center|LOCUS_07390 6064 6555 gene locus_tag LOCUS_07400 6064 6555 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385179.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence089 300 914 gene locus_tag LOCUS_07410 300 914 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719677.1 protein_id gnl|my_center|LOCUS_07410 911 1216 gene locus_tag LOCUS_07420 gene nuoK 911 1216 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719678.1 protein_id gnl|my_center|LOCUS_07420 1220 3190 gene locus_tag LOCUS_07430 gene nuoL 1220 3190 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537946.1 protein_id gnl|my_center|LOCUS_07430 3192 4739 gene locus_tag LOCUS_07440 3192 4739 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719680.1 protein_id gnl|my_center|LOCUS_07440 4752 6194 gene locus_tag LOCUS_07450 gene nuoN 4752 6194 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719681.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence090 585 163 gene locus_tag LOCUS_07460 gene dksA 585 163 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383036.1 protein_id gnl|my_center|LOCUS_07460 733 1572 gene locus_tag LOCUS_07470 733 1572 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_07470 1569 2012 gene locus_tag LOCUS_07480 1569 2012 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 protein_id gnl|my_center|LOCUS_07480 2111 2281 gene locus_tag LOCUS_07490 2111 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2281 3465 gene locus_tag LOCUS_07500 2281 3465 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 protein_id gnl|my_center|LOCUS_07500 3462 3800 gene locus_tag LOCUS_07510 3462 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3797 4405 gene locus_tag LOCUS_07520 3797 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4402 5001 gene locus_tag LOCUS_07530 4402 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5066 5749 gene locus_tag LOCUS_07540 5066 5749 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337631.1 protein_id gnl|my_center|LOCUS_07540 <6562 5746 gene locus_tag LOCUS_07550 <6562 5746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932765.1:FAD-dependent oxidoreductase >Feature sequence091 450 1457 gene locus_tag LOCUS_07560 450 1457 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_07560 1454 2815 gene locus_tag LOCUS_07570 gene cobB 1454 2815 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_07570 2940 3581 gene locus_tag LOCUS_07580 2940 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 3584 3997 gene locus_tag LOCUS_07590 3584 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 4007 4267 gene locus_tag LOCUS_07600 4007 4267 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_07600 4257 5153 gene locus_tag LOCUS_07610 4257 5153 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_07610 5201 5431 gene locus_tag LOCUS_07620 5201 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5451 6161 gene locus_tag LOCUS_07630 5451 6161 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence092 1092 70 gene locus_tag LOCUS_07640 1092 70 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975993.1 protein_id gnl|my_center|LOCUS_07640 2305 1127 gene locus_tag LOCUS_07650 2305 1127 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938575.1 protein_id gnl|my_center|LOCUS_07650 3289 2306 gene locus_tag LOCUS_07660 gene galE 3289 2306 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338390.1 protein_id gnl|my_center|LOCUS_07660 4182 3289 gene locus_tag LOCUS_07670 gene galU 4182 3289 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563200.1 protein_id gnl|my_center|LOCUS_07670 5182 4256 gene locus_tag LOCUS_07680 5182 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07680 5569 5249 gene locus_tag LOCUS_07690 5569 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6354 5566 gene locus_tag LOCUS_07700 6354 5566 CDS product manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence093 <1 1408 gene locus_tag LOCUS_07710 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528794.1:DEAD/DEAH box helicase 1481 2086 gene locus_tag LOCUS_07720 1481 2086 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_07720 2167 2910 gene locus_tag LOCUS_07730 gene ubiE 2167 2910 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721909.1 protein_id gnl|my_center|LOCUS_07730 2907 4427 gene locus_tag LOCUS_07740 gene ubiB 2907 4427 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140011.1 protein_id gnl|my_center|LOCUS_07740 4747 4823 gene locus_tag LOCUS_t00140 4747 4823 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <6382 5164 gene locus_tag LOCUS_07750 <6382 5164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338740.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence094 712 68 gene locus_tag LOCUS_07760 712 68 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530908.1 protein_id gnl|my_center|LOCUS_07760 836 2161 gene locus_tag LOCUS_07770 836 2161 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153438978.1 protein_id gnl|my_center|LOCUS_07770 2174 3424 gene locus_tag LOCUS_07780 2174 3424 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 protein_id gnl|my_center|LOCUS_07780 3504 4265 gene locus_tag LOCUS_07790 3504 4265 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_07790 4294 5754 gene locus_tag LOCUS_07800 gene hydA 4294 5754 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530910.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence095 430 8 gene locus_tag LOCUS_07810 gene ndk 430 8 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720049.1 protein_id gnl|my_center|LOCUS_07810 1823 498 gene locus_tag LOCUS_07820 1823 498 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037317.1 protein_id gnl|my_center|LOCUS_07820 1933 3792 gene locus_tag LOCUS_07830 1933 3792 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337826.1 protein_id gnl|my_center|LOCUS_07830 3794 4417 gene locus_tag LOCUS_07840 3794 4417 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_07840 4414 4995 gene locus_tag LOCUS_07850 4414 4995 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337828.1 protein_id gnl|my_center|LOCUS_07850 5089 5916 gene locus_tag LOCUS_07860 5089 5916 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005856056.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence096 1713 916 gene locus_tag LOCUS_07870 1713 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2357 1752 gene locus_tag LOCUS_07880 gene leuD 2357 1752 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_07880 3770 2370 gene locus_tag LOCUS_07890 gene leuC 3770 2370 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338550.1 protein_id gnl|my_center|LOCUS_07890 4365 3979 gene locus_tag LOCUS_07900 4365 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4939 4358 gene locus_tag LOCUS_07910 4939 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 <6295 5105 gene locus_tag LOCUS_07920 <6295 5105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338958.1:carboxypeptidase M32 >Feature sequence097 1189 449 gene locus_tag LOCUS_07930 1189 449 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533144.1 protein_id gnl|my_center|LOCUS_07930 1758 1207 gene locus_tag LOCUS_07940 1758 1207 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513813.1 protein_id gnl|my_center|LOCUS_07940 1835 2683 gene locus_tag LOCUS_07950 1835 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4159 2711 gene locus_tag LOCUS_07960 4159 2711 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_07960 5766 4159 gene locus_tag LOCUS_07970 5766 4159 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 protein_id gnl|my_center|LOCUS_07970 <6288 5766 gene locus_tag LOCUS_07980 <6288 5766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531216.1:ABC transporter permease >Feature sequence098 2036 354 gene locus_tag LOCUS_07990 2036 354 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_07990 2202 2858 gene locus_tag LOCUS_08000 2202 2858 CDS product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563682.1 protein_id gnl|my_center|LOCUS_08000 3726 2977 gene locus_tag LOCUS_08010 3726 2977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_08010 4226 3720 gene locus_tag LOCUS_08020 4226 3720 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721508.1 protein_id gnl|my_center|LOCUS_08020 4822 4223 gene locus_tag LOCUS_08030 4822 4223 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_08030 5743 4838 gene locus_tag LOCUS_08040 gene truB 5743 4838 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338723.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence099 <1 1318 gene locus_tag LOCUS_08050 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391770.1:sensor histidine kinase 1329 2579 gene locus_tag LOCUS_08060 1329 2579 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969803.1 protein_id gnl|my_center|LOCUS_08060 2821 3834 gene locus_tag LOCUS_08070 gene dctP 2821 3834 CDS product TRAP transporter solute-binding subunit DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476112.1 protein_id gnl|my_center|LOCUS_08070 3895 4584 gene locus_tag LOCUS_08080 3895 4584 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_08080 4588 5964 gene locus_tag LOCUS_08090 4588 5964 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence100 999 1832 gene locus_tag LOCUS_08100 gene mazG 999 1832 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 protein_id gnl|my_center|LOCUS_08100 1905 2912 gene locus_tag LOCUS_08110 1905 2912 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 protein_id gnl|my_center|LOCUS_08110 3669 2968 gene locus_tag LOCUS_08120 3669 2968 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_08120 3751 4458 gene locus_tag LOCUS_08130 3751 4458 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968439.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence101 122 1327 gene locus_tag LOCUS_08140 122 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 576 585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1339 2004 gene locus_tag LOCUS_08150 1339 2004 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338889.1 protein_id gnl|my_center|LOCUS_08150 4368 2026 gene locus_tag LOCUS_08160 4368 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5237 4365 gene locus_tag LOCUS_08170 gene motA 5237 4365 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_08170 5889 5314 gene locus_tag LOCUS_08180 5889 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence102 1719 931 gene locus_tag LOCUS_08190 gene hmeA 1719 931 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_08190 2159 1716 gene locus_tag LOCUS_08200 2159 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4099 2162 gene locus_tag LOCUS_08210 4099 2162 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_08210 5658 4099 gene locus_tag LOCUS_08220 gene dsrK 5658 4099 CDS product [DsrC]-trisulfide reductase DsrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938585.1 protein_id gnl|my_center|LOCUS_08220 6150 5671 gene locus_tag LOCUS_08230 6150 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence103 1963 44 gene locus_tag LOCUS_08240 1963 44 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088232.1 protein_id gnl|my_center|LOCUS_08240 2087 2620 gene locus_tag LOCUS_08250 2087 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2620 3207 gene locus_tag LOCUS_08260 2620 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3332 3949 gene locus_tag LOCUS_08270 3332 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3986 4174 gene locus_tag LOCUS_08280 3986 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence104 66 239 gene locus_tag LOCUS_08290 66 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 335 420 gene locus_tag LOCUS_t00150 335 420 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 491 1336 gene locus_tag LOCUS_08300 491 1336 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039137.1 protein_id gnl|my_center|LOCUS_08300 1456 2361 gene locus_tag LOCUS_08310 1456 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2529 3458 gene locus_tag LOCUS_08320 2529 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3599 4501 gene locus_tag LOCUS_08330 3599 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4561 5463 gene locus_tag LOCUS_08340 4561 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 <6038 5504 gene locus_tag LOCUS_08350 <6038 5504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041669564.1:GTP 3',8-cyclase MoaA >Feature sequence105 2351 1128 gene locus_tag LOCUS_08360 gene hemA 2351 1128 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337894.1 protein_id gnl|my_center|LOCUS_08360 2986 2489 gene locus_tag LOCUS_08370 2986 2489 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139949.1 protein_id gnl|my_center|LOCUS_08370 3335 3075 gene locus_tag LOCUS_08380 3335 3075 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338469.1 protein_id gnl|my_center|LOCUS_08380 3462 4670 gene locus_tag LOCUS_08390 3462 4670 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383982.1 protein_id gnl|my_center|LOCUS_08390 4663 5070 gene locus_tag LOCUS_08400 4663 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5075 5557 gene locus_tag LOCUS_08410 5075 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence106 <1 671 gene locus_tag LOCUS_08420 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020493270.1:branched-chain amino acid ABC transporter permease 683 1441 gene locus_tag LOCUS_08430 683 1441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_08430 1438 2163 gene locus_tag LOCUS_08440 1438 2163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_08440 2230 4173 gene locus_tag LOCUS_08450 gene acs 2230 4173 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561943.1 protein_id gnl|my_center|LOCUS_08450 5234 4221 gene locus_tag LOCUS_08460 5234 4221 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 protein_id gnl|my_center|LOCUS_08460 5669 5244 gene locus_tag LOCUS_08470 5669 5244 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382949.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence107 1460 1825 gene locus_tag LOCUS_08480 1460 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1922 2251 gene locus_tag LOCUS_08490 gene clpS 1922 2251 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338417.1 protein_id gnl|my_center|LOCUS_08490 2273 3280 gene locus_tag LOCUS_08500 2273 3280 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338416.1 protein_id gnl|my_center|LOCUS_08500 3348 4151 gene locus_tag LOCUS_08510 3348 4151 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720866.1 protein_id gnl|my_center|LOCUS_08510 4933 4214 gene locus_tag LOCUS_08520 4933 4214 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383062.1 protein_id gnl|my_center|LOCUS_08520 5061 5675 gene locus_tag LOCUS_08530 5061 5675 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383061.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence108 1835 909 gene locus_tag LOCUS_08540 1835 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2262 1840 gene locus_tag LOCUS_08550 2262 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3716 2262 gene locus_tag LOCUS_08560 gene guaB 3716 2262 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720025.1 protein_id gnl|my_center|LOCUS_08560 4848 3877 gene locus_tag LOCUS_08570 4848 3877 CDS product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337808.1 protein_id gnl|my_center|LOCUS_08570 4949 5905 gene locus_tag LOCUS_08580 gene speB 4949 5905 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence109 147 614 gene locus_tag LOCUS_08590 147 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1453 611 gene locus_tag LOCUS_08600 1453 611 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720888.1 protein_id gnl|my_center|LOCUS_08600 1566 2144 gene locus_tag LOCUS_08610 1566 2144 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720887.1 protein_id gnl|my_center|LOCUS_08610 2285 2416 gene locus_tag LOCUS_08620 2285 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2460 3146 gene locus_tag LOCUS_08630 2460 3146 CDS product molecular chaperone DjiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720970.1 protein_id gnl|my_center|LOCUS_08630 3146 4192 gene locus_tag LOCUS_08640 3146 4192 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence110 560 336 gene locus_tag LOCUS_08650 560 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 737 2758 gene locus_tag LOCUS_08660 gene tkt 737 2758 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537909.1 protein_id gnl|my_center|LOCUS_08660 2829 3833 gene locus_tag LOCUS_08670 gene gap 2829 3833 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720117.1 protein_id gnl|my_center|LOCUS_08670 3876 4025 gene locus_tag LOCUS_08680 3876 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4188 4490 gene locus_tag LOCUS_08690 4188 4490 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719640.1 protein_id gnl|my_center|LOCUS_08690 4611 5588 gene locus_tag LOCUS_08700 gene pdhA 4611 5588 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537613.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence111 37 111 gene locus_tag LOCUS_t00160 37 111 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1311 466 gene locus_tag LOCUS_08710 1311 466 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_08710 3207 1390 gene locus_tag LOCUS_08720 gene phaC 3207 1390 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 protein_id gnl|my_center|LOCUS_08720 3307 3633 gene locus_tag LOCUS_08730 3307 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3696 4928 gene locus_tag LOCUS_08740 3696 4928 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919258.1 protein_id gnl|my_center|LOCUS_08740 4921 5250 gene locus_tag LOCUS_08750 4921 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence112 332 979 gene locus_tag LOCUS_08760 gene aat 332 979 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338055.1 protein_id gnl|my_center|LOCUS_08760 1407 943 gene locus_tag LOCUS_08770 1407 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1864 1400 gene locus_tag LOCUS_08780 gene mlaD 1864 1400 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_08780 2242 1871 gene locus_tag LOCUS_08790 2242 1871 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 protein_id gnl|my_center|LOCUS_08790 3536 2271 gene locus_tag LOCUS_08800 gene clpX 3536 2271 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384524.1 protein_id gnl|my_center|LOCUS_08800 4281 3649 gene locus_tag LOCUS_08810 4281 3649 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720342.1 protein_id gnl|my_center|LOCUS_08810 <5752 4444 gene locus_tag LOCUS_08820 <5752 4444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720285.1:trigger factor >Feature sequence113 1172 504 gene locus_tag LOCUS_08830 1172 504 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337014.1 protein_id gnl|my_center|LOCUS_08830 2048 1257 gene locus_tag LOCUS_08840 2048 1257 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 protein_id gnl|my_center|LOCUS_08840 2664 2080 gene locus_tag LOCUS_08850 2664 2080 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337013.1 protein_id gnl|my_center|LOCUS_08850 2857 2666 gene locus_tag LOCUS_08860 2857 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3804 2848 gene locus_tag LOCUS_08870 gene cyoE 3804 2848 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722694.1 protein_id gnl|my_center|LOCUS_08870 4720 3824 gene locus_tag LOCUS_08880 gene coxB 4720 3824 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337012.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence114 1251 1700 gene locus_tag LOCUS_08890 1251 1700 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719293.1 protein_id gnl|my_center|LOCUS_08890 1805 3196 gene locus_tag LOCUS_08900 gene fumC 1805 3196 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337260.1 protein_id gnl|my_center|LOCUS_08900 3254 3439 gene locus_tag LOCUS_08910 3254 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3436 3663 gene locus_tag LOCUS_08920 3436 3663 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 protein_id gnl|my_center|LOCUS_08920 4937 3636 gene locus_tag LOCUS_08930 4937 3636 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence115 <1 860 gene locus_tag LOCUS_08940 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037401363.1:FAD-binding oxidoreductase 1248 2663 gene locus_tag LOCUS_08950 1248 2663 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385170.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence116 2173 2871 gene locus_tag LOCUS_08960 gene pyrF 2173 2871 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382860.1 protein_id gnl|my_center|LOCUS_08960 3476 2949 gene locus_tag LOCUS_08970 3476 2949 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385193.1 protein_id gnl|my_center|LOCUS_08970 4042 3518 gene locus_tag LOCUS_08980 4042 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4729 4217 gene locus_tag LOCUS_08990 4729 4217 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385193.1 protein_id gnl|my_center|LOCUS_08990 5486 4851 gene locus_tag LOCUS_09000 5486 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5386 5601 gene locus_tag LOCUS_09010 5386 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence117 <1 537 gene locus_tag LOCUS_09020 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338924.1:asparaginase 842 2020 gene locus_tag LOCUS_09030 842 2020 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_09030 2469 2143 gene locus_tag LOCUS_09040 gene hspQ 2469 2143 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 protein_id gnl|my_center|LOCUS_09040 2567 3448 gene locus_tag LOCUS_09050 2567 3448 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_09050 3457 5106 gene locus_tag LOCUS_09060 3457 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence118 213 560 gene locus_tag LOCUS_09070 213 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 841 1011 gene locus_tag LOCUS_09080 841 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1013 1690 gene locus_tag LOCUS_09090 1013 1690 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091061.1 protein_id gnl|my_center|LOCUS_09090 2713 1721 gene locus_tag LOCUS_09100 2713 1721 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714050.1 protein_id gnl|my_center|LOCUS_09100 3232 2789 gene locus_tag LOCUS_09110 3232 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3446 4810 gene locus_tag LOCUS_09120 3446 4810 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338528.1 protein_id gnl|my_center|LOCUS_09120 5058 4864 gene locus_tag LOCUS_09130 5058 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5297 5091 gene locus_tag LOCUS_09140 5297 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence119 1733 741 gene locus_tag LOCUS_09150 gene pdxA 1733 741 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337833.1 protein_id gnl|my_center|LOCUS_09150 2935 1730 gene locus_tag LOCUS_09160 2935 1730 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003627.1 protein_id gnl|my_center|LOCUS_09160 5070 2956 gene locus_tag LOCUS_09170 gene lptD 5070 2956 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337831.1 protein_id gnl|my_center|LOCUS_09170 5510 5067 gene locus_tag LOCUS_09180 5510 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence120 764 153 gene locus_tag LOCUS_09190 764 153 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_09190 1440 820 gene locus_tag LOCUS_09200 1440 820 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087129.1 protein_id gnl|my_center|LOCUS_09200 2706 1444 gene locus_tag LOCUS_09210 gene mtaB 2706 1444 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383138.1 protein_id gnl|my_center|LOCUS_09210 3545 2703 gene locus_tag LOCUS_09220 gene dapF 3545 2703 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538114.1 protein_id gnl|my_center|LOCUS_09220 3704 3779 gene locus_tag LOCUS_t00170 3704 3779 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4279 3827 gene locus_tag LOCUS_09230 4279 3827 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338542.1 protein_id gnl|my_center|LOCUS_09230 4471 5547 gene locus_tag LOCUS_09240 gene kynU 4471 5547 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338098.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence121 4695 4318 gene locus_tag LOCUS_09250 gene rplL 4695 4318 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385332.1 protein_id gnl|my_center|LOCUS_09250 5287 4775 gene locus_tag LOCUS_09260 gene rplJ 5287 4775 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385333.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence122 2025 1141 gene locus_tag LOCUS_09270 2025 1141 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338667.1 protein_id gnl|my_center|LOCUS_09270 3011 2022 gene locus_tag LOCUS_09280 3011 2022 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_09280 3099 3686 gene locus_tag LOCUS_09290 3099 3686 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 protein_id gnl|my_center|LOCUS_09290 4131 3673 gene locus_tag LOCUS_09300 4131 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5568 4198 gene locus_tag LOCUS_09310 5568 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence123 1159 329 gene locus_tag LOCUS_09320 1159 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1612 1163 gene locus_tag LOCUS_09330 1612 1163 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_09330 2076 1612 gene locus_tag LOCUS_09340 gene dut 2076 1612 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338344.1 protein_id gnl|my_center|LOCUS_09340 3266 2073 gene locus_tag LOCUS_09350 gene coaBC 3266 2073 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_09350 3759 3358 gene locus_tag LOCUS_09360 3759 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3903 4442 gene locus_tag LOCUS_09370 gene cobU 3903 4442 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_09370 4439 5026 gene locus_tag LOCUS_09380 4439 5026 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338348.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence124 1622 282 gene locus_tag LOCUS_09390 1622 282 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723944.1 protein_id gnl|my_center|LOCUS_09390 1823 2038 gene locus_tag LOCUS_09400 1823 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2231 2893 gene locus_tag LOCUS_09410 2231 2893 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720123.1 protein_id gnl|my_center|LOCUS_09410 2984 3196 gene locus_tag LOCUS_09420 2984 3196 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_09420 3336 3533 gene locus_tag LOCUS_09430 gene secE 3336 3533 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536180.1 protein_id gnl|my_center|LOCUS_09430 3695 4228 gene locus_tag LOCUS_09440 gene nusG 3695 4228 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722468.1 protein_id gnl|my_center|LOCUS_09440 4325 4753 gene locus_tag LOCUS_09450 gene rplK 4325 4753 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531410.1 protein_id gnl|my_center|LOCUS_09450 4759 5457 gene locus_tag LOCUS_09460 gene rplA 4759 5457 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722474.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence125 245 646 gene locus_tag LOCUS_09470 245 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1092 643 gene locus_tag LOCUS_09480 1092 643 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425026.1 protein_id gnl|my_center|LOCUS_09480 1167 1571 gene locus_tag LOCUS_09490 1167 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1583 1864 gene locus_tag LOCUS_09500 gene merP 1583 1864 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732275.1 protein_id gnl|my_center|LOCUS_09500 1877 2113 gene locus_tag LOCUS_09510 gene merF 1877 2113 CDS product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_09510 2113 3537 gene locus_tag LOCUS_09520 gene merA 2113 3537 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_09520 3689 3856 gene locus_tag LOCUS_09530 3689 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4216 4007 gene locus_tag LOCUS_09540 4216 4007 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_09540 4407 4733 gene locus_tag LOCUS_09550 4407 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 protein_id gnl|my_center|LOCUS_09550 4777 5130 gene locus_tag LOCUS_09560 4777 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence126 1 150 gene locus_tag LOCUS_09570 1 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 152 1183 gene locus_tag LOCUS_09580 152 1183 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338635.1 protein_id gnl|my_center|LOCUS_09580 1206 2012 gene locus_tag LOCUS_09590 1206 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2263 2577 gene locus_tag LOCUS_09600 gene sdhC 2263 2577 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563028.1 protein_id gnl|my_center|LOCUS_09600 2589 2963 gene locus_tag LOCUS_09610 gene sdhD 2589 2963 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615499.1 protein_id gnl|my_center|LOCUS_09610 2979 4787 gene locus_tag LOCUS_09620 gene sdhA 2979 4787 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528876.1 protein_id gnl|my_center|LOCUS_09620 4799 5077 gene locus_tag LOCUS_09630 4799 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5079 5306 gene locus_tag LOCUS_09640 5079 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence127 2331 592 gene locus_tag LOCUS_09650 2331 592 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338717.1 protein_id gnl|my_center|LOCUS_09650 3667 2384 gene locus_tag LOCUS_09660 3667 2384 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139983.1 protein_id gnl|my_center|LOCUS_09660 4584 3664 gene locus_tag LOCUS_09670 gene htpX 4584 3664 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531758.1 protein_id gnl|my_center|LOCUS_09670 4630 4818 gene locus_tag LOCUS_09680 4630 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4881 5324 gene locus_tag LOCUS_09690 4881 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence128 1034 24 gene locus_tag LOCUS_09700 1034 24 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_09700 2268 1036 gene locus_tag LOCUS_09710 2268 1036 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_09710 2395 2577 gene locus_tag LOCUS_09720 2395 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2715 2639 gene locus_tag LOCUS_t00180 2715 2639 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2821 3867 gene locus_tag LOCUS_09730 gene purM 2821 3867 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337122.1 protein_id gnl|my_center|LOCUS_09730 3864 4457 gene locus_tag LOCUS_09740 gene purN 3864 4457 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140088.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence129 477 1196 gene locus_tag LOCUS_09750 gene rph 477 1196 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921545.1 protein_id gnl|my_center|LOCUS_09750 1189 1797 gene locus_tag LOCUS_09760 gene rdgB 1189 1797 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338801.1 protein_id gnl|my_center|LOCUS_09760 1794 2171 gene locus_tag LOCUS_09770 1794 2171 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721714.1 protein_id gnl|my_center|LOCUS_09770 2168 3319 gene locus_tag LOCUS_09780 gene hemW 2168 3319 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 protein_id gnl|my_center|LOCUS_09780 4189 3311 gene locus_tag LOCUS_09790 4189 3311 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721719.1 protein_id gnl|my_center|LOCUS_09790 5024 4215 gene locus_tag LOCUS_09800 5024 4215 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385472.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence130 <1 516 gene locus_tag LOCUS_09810 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140012.1:DNA replication/repair protein RecF 513 944 gene locus_tag LOCUS_09820 513 944 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_09820 958 1446 gene locus_tag LOCUS_09830 958 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1443 1961 gene locus_tag LOCUS_09840 1443 1961 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096519.1 protein_id gnl|my_center|LOCUS_09840 2013 4427 gene locus_tag LOCUS_09850 gene gyrB 2013 4427 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721924.1 protein_id gnl|my_center|LOCUS_09850 4854 4447 gene locus_tag LOCUS_09860 4854 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 <5449 4865 gene locus_tag LOCUS_09870 <5449 4865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887942.1:cytochrome c biogenesis CcdA family protein >Feature sequence131 1948 470 gene locus_tag LOCUS_09880 1948 470 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_09880 3010 1985 gene locus_tag LOCUS_09890 3010 1985 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104490930.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09890 3025 3034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3391 3939 gene locus_tag LOCUS_09900 3391 3939 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 protein_id gnl|my_center|LOCUS_09900 5048 3942 gene locus_tag LOCUS_09910 5048 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5177 5091 gene locus_tag LOCUS_t00190 5177 5091 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 397 170 gene locus_tag LOCUS_09920 397 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5179 959 gene locus_tag LOCUS_09930 gene rpoC 5179 959 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336949.1 protein_id gnl|my_center|LOCUS_09930 5447 5226 gene locus_tag LOCUS_09940 5447 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence133 <1 853 gene locus_tag LOCUS_09950 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338560.1:chromosome segregation protein SMC 850 1449 gene locus_tag LOCUS_09960 850 1449 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313741.1 protein_id gnl|my_center|LOCUS_09960 2206 1586 gene locus_tag LOCUS_09970 2206 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2777 2211 gene locus_tag LOCUS_09980 2777 2211 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228620.1 protein_id gnl|my_center|LOCUS_09980 3343 2864 gene locus_tag LOCUS_09990 gene smpB 3343 2864 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532594.1 protein_id gnl|my_center|LOCUS_09990 4222 3347 gene locus_tag LOCUS_10000 gene dapA 4222 3347 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841738.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence134 15 165 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggtctatccccgcgtgggcgggggagcc 526 230 gene locus_tag LOCUS_10010 gene cas2e 526 230 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_10010 1404 526 gene locus_tag LOCUS_10020 gene cas1e 1404 526 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_10020 2147 1398 gene locus_tag LOCUS_10030 2147 1398 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_10030 2839 2144 gene locus_tag LOCUS_10040 gene cas5e 2839 2144 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_10040 3963 2839 gene locus_tag LOCUS_10050 gene cas7e 3963 2839 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_10050 4525 3956 gene locus_tag LOCUS_10060 4525 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388096.1 protein_id gnl|my_center|LOCUS_10060 <5412 4512 gene locus_tag LOCUS_10070 <5412 4512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388094.1:CRISPR-associated protein Cse1 >Feature sequence135 776 39 gene locus_tag LOCUS_10080 776 39 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_10080 1012 788 gene locus_tag LOCUS_10090 1012 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1136 1399 gene locus_tag LOCUS_10100 1136 1399 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720309.1 protein_id gnl|my_center|LOCUS_10100 1403 2341 gene locus_tag LOCUS_10110 1403 2341 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530921.1 protein_id gnl|my_center|LOCUS_10110 2334 3302 gene locus_tag LOCUS_10120 2334 3302 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_10120 3822 3364 gene locus_tag LOCUS_10130 3822 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4665 4009 gene locus_tag LOCUS_10140 4665 4009 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337503.1 protein_id gnl|my_center|LOCUS_10140 <5383 4662 gene locus_tag LOCUS_10150 <5383 4662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719608.1:amidophosphoribosyltransferase >Feature sequence136 9 581 gene locus_tag LOCUS_10160 9 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 639 2255 gene locus_tag LOCUS_10170 639 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2392 3387 gene locus_tag LOCUS_10180 2392 3387 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_10180 3496 4872 gene locus_tag LOCUS_10190 gene pstC 3496 4872 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence137 355 161 gene locus_tag LOCUS_10200 355 161 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723397.1 protein_id gnl|my_center|LOCUS_10200 377 967 gene locus_tag LOCUS_10210 377 967 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338954.1 protein_id gnl|my_center|LOCUS_10210 1484 957 gene locus_tag LOCUS_10220 1484 957 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 protein_id gnl|my_center|LOCUS_10220 2152 1481 gene locus_tag LOCUS_10230 gene gmk 2152 1481 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 protein_id gnl|my_center|LOCUS_10230 2322 2969 gene locus_tag LOCUS_10240 2322 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3020 3259 gene locus_tag LOCUS_10250 3020 3259 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_10250 4095 3256 gene locus_tag LOCUS_10260 gene serB 4095 3256 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640406.1 protein_id gnl|my_center|LOCUS_10260 <5357 4095 gene locus_tag LOCUS_10270 <5357 4095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337849.1:3-deoxy-7-phosphoheptulonate synthase class II >Feature sequence138 1956 1801 gene locus_tag LOCUS_10280 1956 1801 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 protein_id gnl|my_center|LOCUS_10280 2062 3045 gene locus_tag LOCUS_10290 2062 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3415 3035 gene locus_tag LOCUS_10300 3415 3035 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139977.1 protein_id gnl|my_center|LOCUS_10300 4979 3426 gene locus_tag LOCUS_10310 4979 3426 CDS product DUF5928 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537864.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence139 <1 1111 gene locus_tag LOCUS_10320 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722428.1:phosphoenolpyruvate carboxykinase 1180 2682 gene locus_tag LOCUS_10330 1180 2682 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_10330 3510 2671 gene locus_tag LOCUS_10340 3510 2671 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537472.1 protein_id gnl|my_center|LOCUS_10340 5052 3529 gene locus_tag LOCUS_10350 5052 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence140 2665 554 gene locus_tag LOCUS_10360 gene ligA 2665 554 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337614.1 protein_id gnl|my_center|LOCUS_10360 3427 2720 gene locus_tag LOCUS_10370 3427 2720 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719770.1 protein_id gnl|my_center|LOCUS_10370 3810 3532 gene locus_tag LOCUS_10380 3810 3532 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719769.1 protein_id gnl|my_center|LOCUS_10380 3931 5070 gene locus_tag LOCUS_10390 gene mnmA 3931 5070 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence141 1327 638 gene locus_tag LOCUS_10400 gene rnc 1327 638 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722419.1 protein_id gnl|my_center|LOCUS_10400 2133 1324 gene locus_tag LOCUS_10410 gene lepB 2133 1324 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722417.1 protein_id gnl|my_center|LOCUS_10410 2603 2190 gene locus_tag LOCUS_10420 gene acpS 2603 2190 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383417.1 protein_id gnl|my_center|LOCUS_10420 3388 2600 gene locus_tag LOCUS_10430 3388 2600 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722415.1 protein_id gnl|my_center|LOCUS_10430 4076 3423 gene locus_tag LOCUS_10440 4076 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <5310 4089 gene locus_tag LOCUS_10450 <5310 4089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193365330.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence142 3593 1155 gene locus_tag LOCUS_10460 3593 1155 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 protein_id gnl|my_center|LOCUS_10460 4889 3621 gene locus_tag LOCUS_10470 gene lysA 4889 3621 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720913.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence143 1811 1518 gene locus_tag LOCUS_10480 1811 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3024 1813 gene locus_tag LOCUS_10490 3024 1813 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337305.1 protein_id gnl|my_center|LOCUS_10490 3674 3039 gene locus_tag LOCUS_10500 3674 3039 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090153.1 protein_id gnl|my_center|LOCUS_10500 5040 3880 gene locus_tag LOCUS_10510 5040 3880 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_10510 5248 5057 gene locus_tag LOCUS_10520 5248 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence144 204 25 gene locus_tag LOCUS_10530 204 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 735 322 gene locus_tag LOCUS_10540 gene rplP 735 322 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385315.1 protein_id gnl|my_center|LOCUS_10540 1466 756 gene locus_tag LOCUS_10550 gene rpsC 1466 756 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385316.1 protein_id gnl|my_center|LOCUS_10550 1855 1466 gene locus_tag LOCUS_10560 gene rplV 1855 1466 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 protein_id gnl|my_center|LOCUS_10560 2136 1858 gene locus_tag LOCUS_10570 gene rpsS 2136 1858 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722496.1 protein_id gnl|my_center|LOCUS_10570 2979 2140 gene locus_tag LOCUS_10580 gene rplB 2979 2140 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722495.1 protein_id gnl|my_center|LOCUS_10580 3387 3091 gene locus_tag LOCUS_10590 3387 3091 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385319.1 protein_id gnl|my_center|LOCUS_10590 4004 3384 gene locus_tag LOCUS_10600 gene rplD 4004 3384 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722493.1 protein_id gnl|my_center|LOCUS_10600 4717 4001 gene locus_tag LOCUS_10610 gene rplC 4717 4001 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563652.1 protein_id gnl|my_center|LOCUS_10610 5038 4730 gene locus_tag LOCUS_10620 gene rpsJ 5038 4730 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385322.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence145 1045 260 gene locus_tag LOCUS_10630 1045 260 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337932.1 protein_id gnl|my_center|LOCUS_10630 1197 2456 gene locus_tag LOCUS_10640 1197 2456 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942940.1 protein_id gnl|my_center|LOCUS_10640 2551 3204 gene locus_tag LOCUS_10650 2551 3204 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538104.1 protein_id gnl|my_center|LOCUS_10650 3194 4636 gene locus_tag LOCUS_10660 3194 4636 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538103.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence146 <1 1580 gene locus_tag LOCUS_10670 <1 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532602.1:sulfotransferase 1632 2123 gene locus_tag LOCUS_10680 1632 2123 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419118.1 protein_id gnl|my_center|LOCUS_10680 3143 2238 gene locus_tag LOCUS_10690 gene thyX 3143 2238 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_10690 3233 4084 gene locus_tag LOCUS_10700 3233 4084 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_10700 4081 4512 gene locus_tag LOCUS_10710 4081 4512 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720555.1 protein_id gnl|my_center|LOCUS_10710 <5163 4514 gene locus_tag LOCUS_10720 <5163 4514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383536.1:tryptophan synthase subunit beta >Feature sequence147 <1 625 gene locus_tag LOCUS_10730 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563794.1:ketol-acid reductoisomerase 703 1137 gene locus_tag LOCUS_10740 703 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1650 1138 gene locus_tag LOCUS_10750 1650 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1912 1538 gene locus_tag LOCUS_10760 1912 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1823 2830 gene locus_tag LOCUS_10770 gene hemB 1823 2830 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719957.1 protein_id gnl|my_center|LOCUS_10770 3024 3581 gene locus_tag LOCUS_10780 3024 3581 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719958.1 protein_id gnl|my_center|LOCUS_10780 5143 4049 gene locus_tag LOCUS_10790 5143 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence148 <1 1202 gene locus_tag LOCUS_10800 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337692.1:MFS transporter 2020 1199 gene locus_tag LOCUS_10810 2020 1199 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337691.1 protein_id gnl|my_center|LOCUS_10810 3680 2025 gene locus_tag LOCUS_10820 gene cimA 3680 2025 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003601.1 protein_id gnl|my_center|LOCUS_10820 5050 3677 gene locus_tag LOCUS_10830 gene cysS 5050 3677 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383869.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence149 562 1254 gene locus_tag LOCUS_10840 562 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2259 1264 gene locus_tag LOCUS_10850 2259 1264 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_10850 3121 2261 gene locus_tag LOCUS_10860 3121 2261 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966658.1 protein_id gnl|my_center|LOCUS_10860 3826 3125 gene locus_tag LOCUS_10870 3826 3125 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_10870 3934 4140 gene locus_tag LOCUS_10880 gene rpsU 3934 4140 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720900.1 protein_id gnl|my_center|LOCUS_10880 <5134 4247 gene locus_tag LOCUS_10890 <5134 4247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384544.1:TIGR01620 family protein >Feature sequence150 535 1131 gene locus_tag LOCUS_10900 535 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1128 2459 gene locus_tag LOCUS_10910 1128 2459 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_10910 2781 3596 gene locus_tag LOCUS_10920 2781 3596 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104424.1 protein_id gnl|my_center|LOCUS_10920 3589 4374 gene locus_tag LOCUS_10930 3589 4374 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence151 1106 507 gene locus_tag LOCUS_10940 1106 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2971 1103 gene locus_tag LOCUS_10950 2971 1103 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338776.1 protein_id gnl|my_center|LOCUS_10950 <5105 3153 gene locus_tag LOCUS_10960 <5105 3153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331369.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence152 1410 409 gene locus_tag LOCUS_10970 1410 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383383.1 protein_id gnl|my_center|LOCUS_10970 1902 1432 gene locus_tag LOCUS_10980 gene greA 1902 1432 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722610.1 protein_id gnl|my_center|LOCUS_10980 2133 3788 gene locus_tag LOCUS_10990 2133 3788 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336975.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence153 484 1533 gene locus_tag LOCUS_11000 484 1533 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528618.1 protein_id gnl|my_center|LOCUS_11000 1546 1956 gene locus_tag LOCUS_11010 1546 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5066 1953 gene locus_tag LOCUS_11020 gene cobN 5066 1953 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975897.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence154 1499 492 gene locus_tag LOCUS_11030 1499 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2731 1496 gene locus_tag LOCUS_11040 2731 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3275 2745 gene locus_tag LOCUS_11050 3275 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4292 3279 gene locus_tag LOCUS_11060 4292 3279 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 protein_id gnl|my_center|LOCUS_11060 <5082 4289 gene locus_tag LOCUS_11070 <5082 4289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222986.1:DegT/DnrJ/EryC1/StrS aminotransferase family protein >Feature sequence155 370 600 gene locus_tag LOCUS_11080 370 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 737 1276 gene locus_tag LOCUS_11090 737 1276 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383947.1 protein_id gnl|my_center|LOCUS_11090 1293 2480 gene locus_tag LOCUS_11100 1293 2480 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337511.1 protein_id gnl|my_center|LOCUS_11100 2597 2902 gene locus_tag LOCUS_11110 2597 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2899 3486 gene locus_tag LOCUS_11120 2899 3486 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537610.1 protein_id gnl|my_center|LOCUS_11120 3483 3815 gene locus_tag LOCUS_11130 3483 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 3812 4231 gene locus_tag LOCUS_11140 3812 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4247 4660 gene locus_tag LOCUS_11150 4247 4660 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383953.1 protein_id gnl|my_center|LOCUS_11150 4660 4974 gene locus_tag LOCUS_11160 4660 4974 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence156 <1 574 gene locus_tag LOCUS_11170 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338407.1:MBL fold metallo-hydrolase 571 1506 gene locus_tag LOCUS_11180 571 1506 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_11180 2441 1503 gene locus_tag LOCUS_11190 2441 1503 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_11190 3701 2445 gene locus_tag LOCUS_11200 3701 2445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_11200 4835 3759 gene locus_tag LOCUS_11210 4835 3759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence157 554 1429 gene locus_tag LOCUS_11220 gene tsf 554 1429 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719943.1 protein_id gnl|my_center|LOCUS_11220 1569 2306 gene locus_tag LOCUS_11230 gene pyrH 1569 2306 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383887.1 protein_id gnl|my_center|LOCUS_11230 2329 2892 gene locus_tag LOCUS_11240 gene frr 2329 2892 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337674.1 protein_id gnl|my_center|LOCUS_11240 2929 3723 gene locus_tag LOCUS_11250 2929 3723 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384344.1 protein_id gnl|my_center|LOCUS_11250 3724 4884 gene locus_tag LOCUS_11260 gene dxr 3724 4884 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337676.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence158 1321 2508 gene locus_tag LOCUS_11270 1321 2508 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338101.1 protein_id gnl|my_center|LOCUS_11270 2968 2492 gene locus_tag LOCUS_11280 2968 2492 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396040.1 protein_id gnl|my_center|LOCUS_11280 3783 2965 gene locus_tag LOCUS_11290 3783 2965 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086528.1 protein_id gnl|my_center|LOCUS_11290 4757 3873 gene locus_tag LOCUS_11300 4757 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence159 45 227 gene locus_tag LOCUS_11310 gene yacG 45 227 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720789.1 protein_id gnl|my_center|LOCUS_11310 318 392 gene locus_tag LOCUS_t00200 318 392 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 598 1671 gene locus_tag LOCUS_11320 598 1671 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_11320 1717 3669 gene locus_tag LOCUS_11330 1717 3669 CDS product phosphate ABC transporter substrate-binding/OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669810.1 protein_id gnl|my_center|LOCUS_11330 3750 4466 gene locus_tag LOCUS_11340 3750 4466 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973090.1 protein_id gnl|my_center|LOCUS_11340 <5037 4451 gene locus_tag LOCUS_11350 <5037 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338785.1:class I SAM-dependent RNA methyltransferase >Feature sequence160 1314 862 gene locus_tag LOCUS_11360 1314 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 1673 1338 gene locus_tag LOCUS_11370 1673 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11370 2026 2844 gene locus_tag LOCUS_11380 2026 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2841 3821 gene locus_tag LOCUS_11390 2841 3821 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_11390 3844 4617 gene locus_tag LOCUS_11400 3844 4617 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917928.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence161 414 2693 gene locus_tag LOCUS_11410 414 2693 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_11410 3350 2700 gene locus_tag LOCUS_11420 3350 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3895 3353 gene locus_tag LOCUS_11430 3895 3353 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030355.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence162 213 1148 gene locus_tag LOCUS_11440 213 1148 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721320.1 protein_id gnl|my_center|LOCUS_11440 1145 2401 gene locus_tag LOCUS_11450 gene pyrC 1145 2401 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338650.1 protein_id gnl|my_center|LOCUS_11450 2404 3042 gene locus_tag LOCUS_11460 gene plsY 2404 3042 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563048.1 protein_id gnl|my_center|LOCUS_11460 3104 3592 gene locus_tag LOCUS_11470 3104 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3653 4048 gene locus_tag LOCUS_11480 3653 4048 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 protein_id gnl|my_center|LOCUS_11480 4887 4156 gene locus_tag LOCUS_11490 4887 4156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202429.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence163 <1 938 gene locus_tag LOCUS_11500 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338198.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 2856 907 gene locus_tag LOCUS_11510 2856 907 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537791.1 protein_id gnl|my_center|LOCUS_11510 4118 2955 gene locus_tag LOCUS_11520 4118 2955 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338467.1 protein_id gnl|my_center|LOCUS_11520 4911 4177 gene locus_tag LOCUS_11530 4911 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence164 <1 900 gene locus_tag LOCUS_11540 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339445.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 1031 1570 gene locus_tag LOCUS_11550 1031 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1580 1876 gene locus_tag LOCUS_11560 1580 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1929 2975 gene locus_tag LOCUS_11570 1929 2975 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339444.1 protein_id gnl|my_center|LOCUS_11570 2975 3469 gene locus_tag LOCUS_11580 gene ybeY 2975 3469 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339443.1 protein_id gnl|my_center|LOCUS_11580 3515 4405 gene locus_tag LOCUS_11590 3515 4405 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339442.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence165 291 653 gene locus_tag LOCUS_11600 gene rpsF 291 653 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338020.1 protein_id gnl|my_center|LOCUS_11600 670 897 gene locus_tag LOCUS_11610 gene rpsR 670 897 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720283.1 protein_id gnl|my_center|LOCUS_11610 908 1534 gene locus_tag LOCUS_11620 gene rplI 908 1534 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 protein_id gnl|my_center|LOCUS_11620 1602 2234 gene locus_tag LOCUS_11630 1602 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3055 2342 gene locus_tag LOCUS_11640 3055 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3310 4788 gene locus_tag LOCUS_11650 3310 4788 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence166 732 1250 gene locus_tag LOCUS_11660 732 1250 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919184.1 protein_id gnl|my_center|LOCUS_11660 2224 1262 gene locus_tag LOCUS_11670 gene msrP 2224 1262 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_11670 2298 4067 gene locus_tag LOCUS_11680 2298 4067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337255.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence167 342 914 gene locus_tag LOCUS_11690 342 914 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722215.1 protein_id gnl|my_center|LOCUS_11690 982 1866 gene locus_tag LOCUS_11700 gene trxA 982 1866 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_11700 1873 2508 gene locus_tag LOCUS_11710 1873 2508 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562559.1 protein_id gnl|my_center|LOCUS_11710 2505 2693 gene locus_tag LOCUS_11720 2505 2693 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383144.1 protein_id gnl|my_center|LOCUS_11720 3929 3555 gene locus_tag LOCUS_11730 3929 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 <4819 3953 gene locus_tag LOCUS_11740 <4819 3953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338178.1:L-serine ammonia-lyase >Feature sequence168 1452 526 gene locus_tag LOCUS_11750 1452 526 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810463.1 protein_id gnl|my_center|LOCUS_11750 1606 2952 gene locus_tag LOCUS_11760 1606 2952 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338589.1 protein_id gnl|my_center|LOCUS_11760 2939 3715 gene locus_tag LOCUS_11770 2939 3715 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338590.1 protein_id gnl|my_center|LOCUS_11770 4110 4352 gene locus_tag LOCUS_11780 4110 4352 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722116.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence169 673 224 gene locus_tag LOCUS_11790 673 224 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639987.1 protein_id gnl|my_center|LOCUS_11790 940 1389 gene locus_tag LOCUS_11800 gene petA 940 1389 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722009.1 protein_id gnl|my_center|LOCUS_11800 1401 2717 gene locus_tag LOCUS_11810 gene petB 1401 2717 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722007.1 protein_id gnl|my_center|LOCUS_11810 2740 3522 gene locus_tag LOCUS_11820 gene petC 2740 3522 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722004.1 protein_id gnl|my_center|LOCUS_11820 4266 3568 gene locus_tag LOCUS_11830 4266 3568 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338929.1 protein_id gnl|my_center|LOCUS_11830 <4815 4250 gene locus_tag LOCUS_11840 <4815 4250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338928.1:thiamine/thiamine pyrophosphate ABC transporter permease ThiP >Feature sequence170 196 1335 gene locus_tag LOCUS_11850 196 1335 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003715.1 protein_id gnl|my_center|LOCUS_11850 1338 1640 gene locus_tag LOCUS_11860 1338 1640 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338575.1 protein_id gnl|my_center|LOCUS_11860 1644 2837 gene locus_tag LOCUS_11870 1644 2837 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 protein_id gnl|my_center|LOCUS_11870 2834 3388 gene locus_tag LOCUS_11880 gene rsmD 2834 3388 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383306.1 protein_id gnl|my_center|LOCUS_11880 4350 3385 gene locus_tag LOCUS_11890 4350 3385 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence171 1 162 gene locus_tag LOCUS_11900 1 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 159 1325 gene locus_tag LOCUS_11910 159 1325 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_11910 4408 1322 gene locus_tag LOCUS_11920 4408 1322 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence172 1493 369 gene locus_tag LOCUS_11930 gene prfB 1493 369 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720136.1 protein_id gnl|my_center|LOCUS_11930 4109 1560 gene locus_tag LOCUS_11940 4109 1560 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337888.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence173 286 295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 464 1243 gene locus_tag LOCUS_11950 464 1243 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 protein_id gnl|my_center|LOCUS_11950 1370 1819 gene locus_tag LOCUS_11960 1370 1819 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086302.1 protein_id gnl|my_center|LOCUS_11960 3574 2201 gene locus_tag LOCUS_11970 3574 2201 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 protein_id gnl|my_center|LOCUS_11970 <4778 3588 gene locus_tag LOCUS_11980 <4778 3588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972360.1:Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha >Feature sequence174 983 294 gene locus_tag LOCUS_11990 gene dnaQ 983 294 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 protein_id gnl|my_center|LOCUS_11990 1567 983 gene locus_tag LOCUS_12000 gene coaE 1567 983 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083466.1 protein_id gnl|my_center|LOCUS_12000 2394 1564 gene locus_tag LOCUS_12010 2394 1564 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338809.1 protein_id gnl|my_center|LOCUS_12010 2981 2391 gene locus_tag LOCUS_12020 2981 2391 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917893.1 protein_id gnl|my_center|LOCUS_12020 3804 2983 gene locus_tag LOCUS_12030 3804 2983 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence175 94 1035 gene locus_tag LOCUS_12040 94 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1117 2001 gene locus_tag LOCUS_12050 1117 2001 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947574.1 protein_id gnl|my_center|LOCUS_12050 2011 3789 gene locus_tag LOCUS_12060 2011 3789 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_12060 3806 4465 gene locus_tag LOCUS_12070 3806 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4763 4515 gene locus_tag LOCUS_12080 4763 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence176 2465 1761 gene locus_tag LOCUS_12090 2465 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3661 2462 gene locus_tag LOCUS_12100 3661 2462 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_12100 4290 3658 gene locus_tag LOCUS_12110 4290 3658 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence177 635 423 gene locus_tag LOCUS_12120 635 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 825 628 gene locus_tag LOCUS_12130 825 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1744 833 gene locus_tag LOCUS_12140 1744 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1975 3273 gene locus_tag LOCUS_12150 gene dsrA 1975 3273 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_12150 3346 4428 gene locus_tag LOCUS_12160 gene dsrB 3346 4428 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence178 <1 1197 gene locus_tag LOCUS_12170 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337311.1:MATE family efflux transporter 1714 1370 gene locus_tag LOCUS_12180 gene arsC 1714 1370 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 protein_id gnl|my_center|LOCUS_12180 2772 1711 gene locus_tag LOCUS_12190 2772 1711 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338626.1 protein_id gnl|my_center|LOCUS_12190 3107 2769 gene locus_tag LOCUS_12200 3107 2769 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 protein_id gnl|my_center|LOCUS_12200 4515 3139 gene locus_tag LOCUS_12210 4515 3139 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence179 316 1545 gene locus_tag LOCUS_12220 gene fabB 316 1545 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382947.1 protein_id gnl|my_center|LOCUS_12220 1552 2340 gene locus_tag LOCUS_12230 1552 2340 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339104.1 protein_id gnl|my_center|LOCUS_12230 2357 2914 gene locus_tag LOCUS_12240 2357 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3010 3699 gene locus_tag LOCUS_12250 3010 3699 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537251.1 protein_id gnl|my_center|LOCUS_12250 3696 4523 gene locus_tag LOCUS_12260 3696 4523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337350.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence180 355 282 gene locus_tag LOCUS_t00210 355 282 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 662 2008 gene locus_tag LOCUS_12270 gene glmU 662 2008 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337537.1 protein_id gnl|my_center|LOCUS_12270 2005 2679 gene locus_tag LOCUS_12280 2005 2679 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385033.1 protein_id gnl|my_center|LOCUS_12280 2971 2666 gene locus_tag LOCUS_12290 2971 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 <4662 3166 gene locus_tag LOCUS_12300 <4662 3166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534776.1:acyl-CoA synthetase >Feature sequence181 409 852 gene locus_tag LOCUS_12310 409 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 863 1741 gene locus_tag LOCUS_12320 863 1741 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_12320 1772 2746 gene locus_tag LOCUS_12330 1772 2746 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_12330 2751 3290 gene locus_tag LOCUS_12340 2751 3290 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 protein_id gnl|my_center|LOCUS_12340 4617 3406 gene locus_tag LOCUS_12350 4617 3406 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140066.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence182 1918 656 gene locus_tag LOCUS_12360 gene purD 1918 656 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337026.1 protein_id gnl|my_center|LOCUS_12360 2253 3686 gene locus_tag LOCUS_12370 gene xseA 2253 3686 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383570.1 protein_id gnl|my_center|LOCUS_12370 4318 3692 gene locus_tag LOCUS_12380 4318 3692 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence183 57 1352 gene locus_tag LOCUS_12390 57 1352 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337061.1 protein_id gnl|my_center|LOCUS_12390 1339 2136 gene locus_tag LOCUS_12400 1339 2136 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_12400 2171 2929 gene locus_tag LOCUS_12410 2171 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3534 2926 gene locus_tag LOCUS_12420 3534 2926 CDS product inner membrane-spanning protein YciB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722725.1 protein_id gnl|my_center|LOCUS_12420 4455 3553 gene locus_tag LOCUS_12430 4455 3553 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337022.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence184 1413 721 gene locus_tag LOCUS_12440 1413 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1790 1557 gene locus_tag LOCUS_12450 1790 1557 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719616.1 protein_id gnl|my_center|LOCUS_12450 2714 1977 gene locus_tag LOCUS_12460 gene fabG 2714 1977 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_12460 3651 2707 gene locus_tag LOCUS_12470 gene fabD 3651 2707 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337657.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence185 1911 526 gene locus_tag LOCUS_12480 1911 526 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971526.1 protein_id gnl|my_center|LOCUS_12480 1999 2277 gene locus_tag LOCUS_12490 1999 2277 CDS product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338213.1 protein_id gnl|my_center|LOCUS_12490 2399 3094 gene locus_tag LOCUS_12500 2399 3094 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 protein_id gnl|my_center|LOCUS_12500 3087 4154 gene locus_tag LOCUS_12510 3087 4154 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence186 2227 437 gene locus_tag LOCUS_12520 2227 437 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719253.1 protein_id gnl|my_center|LOCUS_12520 2577 2224 gene locus_tag LOCUS_12530 2577 2224 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719252.1 protein_id gnl|my_center|LOCUS_12530 3590 2574 gene locus_tag LOCUS_12540 gene rsmH 3590 2574 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337235.1 protein_id gnl|my_center|LOCUS_12540 4087 3593 gene locus_tag LOCUS_12550 gene mraZ 4087 3593 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337234.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence187 53 346 gene locus_tag LOCUS_12560 53 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1964 411 gene locus_tag LOCUS_12570 1964 411 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337785.1 protein_id gnl|my_center|LOCUS_12570 2105 3670 gene locus_tag LOCUS_12580 gene guaA 2105 3670 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565333.1 protein_id gnl|my_center|LOCUS_12580 3661 3936 gene locus_tag LOCUS_12590 3661 3936 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455023.1 protein_id gnl|my_center|LOCUS_12590 3936 4295 gene locus_tag LOCUS_12600 3936 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence188 1591 416 gene locus_tag LOCUS_12610 1591 416 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_12610 1805 3955 gene locus_tag LOCUS_12620 1805 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence189 1573 1097 gene locus_tag LOCUS_12630 gene moaC 1573 1097 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_12630 2362 1574 gene locus_tag LOCUS_12640 gene trpC 2362 1574 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383898.1 protein_id gnl|my_center|LOCUS_12640 3381 2362 gene locus_tag LOCUS_12650 gene trpD 3381 2362 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337147.1 protein_id gnl|my_center|LOCUS_12650 3959 3378 gene locus_tag LOCUS_12660 3959 3378 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence190 3678 2740 gene locus_tag LOCUS_12670 3678 2740 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095491983.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence191 1913 198 gene locus_tag LOCUS_12680 gene metG 1913 198 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 protein_id gnl|my_center|LOCUS_12680 2094 2804 gene locus_tag LOCUS_12690 2094 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2907 3656 gene locus_tag LOCUS_12700 2907 3656 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_12700 4348 3665 gene locus_tag LOCUS_12710 4348 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence192 <1 834 gene locus_tag LOCUS_12720 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140005.1:flagellar basal-body MS-ring/collar protein FliF 834 1442 gene locus_tag LOCUS_12730 834 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1432 1722 gene locus_tag LOCUS_12740 1432 1722 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385161.1 protein_id gnl|my_center|LOCUS_12740 1724 2449 gene locus_tag LOCUS_12750 gene fliP 1724 2449 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140004.1 protein_id gnl|my_center|LOCUS_12750 2507 3268 gene locus_tag LOCUS_12760 2507 3268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_12760 <4282 3265 gene locus_tag LOCUS_12770 <4282 3265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721996.1:chorismate synthase >Feature sequence193 1622 3022 gene locus_tag LOCUS_12780 1622 3022 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339645.1 protein_id gnl|my_center|LOCUS_12780 3015 4109 gene locus_tag LOCUS_12790 3015 4109 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339644.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence194 2004 1132 gene locus_tag LOCUS_12800 2004 1132 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721831.1 protein_id gnl|my_center|LOCUS_12800 3030 2020 gene locus_tag LOCUS_12810 3030 2020 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669849.1 protein_id gnl|my_center|LOCUS_12810 3127 4095 gene locus_tag LOCUS_12820 gene cbbR 3127 4095 CDS product LysR family transcriptional regulator CbbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338845.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence195 <1 696 gene locus_tag LOCUS_12830 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927084.1:bifunctional aldolase/short-chain dehydrogenase 916 1713 gene locus_tag LOCUS_12840 gene cysE 916 1713 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 protein_id gnl|my_center|LOCUS_12840 3705 1756 gene locus_tag LOCUS_12850 gene thrS 3705 1756 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338194.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence196 362 586 gene locus_tag LOCUS_12860 362 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 715 915 gene locus_tag LOCUS_12870 gene rpmI 715 915 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383043.1 protein_id gnl|my_center|LOCUS_12870 928 1287 gene locus_tag LOCUS_12880 gene rplT 928 1287 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722591.1 protein_id gnl|my_center|LOCUS_12880 1412 2494 gene locus_tag LOCUS_12890 gene pheS 1412 2494 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383045.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence197 729 1556 gene locus_tag LOCUS_12900 729 1556 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338780.1 protein_id gnl|my_center|LOCUS_12900 1657 2598 gene locus_tag LOCUS_12910 1657 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3234 2641 gene locus_tag LOCUS_12920 3234 2641 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385466.1 protein_id gnl|my_center|LOCUS_12920 <4102 3247 gene locus_tag LOCUS_12930 <4102 3247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721709.1:heat-inducible transcriptional repressor HrcA >Feature sequence198 624 160 gene locus_tag LOCUS_12940 624 160 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338743.1 protein_id gnl|my_center|LOCUS_12940 825 1697 gene locus_tag LOCUS_12950 825 1697 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721560.1 protein_id gnl|my_center|LOCUS_12950 1838 3193 gene locus_tag LOCUS_12960 1838 3193 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence199 1758 991 gene locus_tag LOCUS_12970 gene gloB 1758 991 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337385.1 protein_id gnl|my_center|LOCUS_12970 1825 2631 gene locus_tag LOCUS_12980 1825 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719458.1 protein_id gnl|my_center|LOCUS_12980 2899 3429 gene locus_tag LOCUS_12990 2899 3429 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719459.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence200 1321 674 gene locus_tag LOCUS_13000 1321 674 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719695.1 protein_id gnl|my_center|LOCUS_13000 2095 1322 gene locus_tag LOCUS_13010 gene surE 2095 1322 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337560.1 protein_id gnl|my_center|LOCUS_13010 3512 2223 gene locus_tag LOCUS_13020 gene serS 3512 2223 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563716.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence201 279 713 gene locus_tag LOCUS_13030 279 713 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719611.1 protein_id gnl|my_center|LOCUS_13030 710 1021 gene locus_tag LOCUS_13040 710 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1040 2410 gene locus_tag LOCUS_13050 gene radA 1040 2410 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719610.1 protein_id gnl|my_center|LOCUS_13050 2422 3036 gene locus_tag LOCUS_13060 2422 3036 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719609.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence202 <1 906 gene locus_tag LOCUS_13070 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533363.1:ornithine cyclodeaminase 975 1967 gene locus_tag LOCUS_13080 gene dusA 975 1967 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384482.1 protein_id gnl|my_center|LOCUS_13080 1957 2784 gene locus_tag LOCUS_13090 1957 2784 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384626.1 protein_id gnl|my_center|LOCUS_13090 3455 2778 gene locus_tag LOCUS_13100 3455 2778 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400587.1 protein_id gnl|my_center|LOCUS_13100 3799 3572 gene locus_tag LOCUS_13110 3799 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence203 1433 915 gene locus_tag LOCUS_13120 1433 915 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337160.1 protein_id gnl|my_center|LOCUS_13120 1829 1476 gene locus_tag LOCUS_13130 1829 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2183 1932 gene locus_tag LOCUS_13140 gene rpmB 2183 1932 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337158.1 protein_id gnl|my_center|LOCUS_13140 3312 2284 gene locus_tag LOCUS_13150 gene meaB 3312 2284 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337157.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence204 1700 645 gene locus_tag LOCUS_13160 1700 645 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384490.1 protein_id gnl|my_center|LOCUS_13160 2512 1886 gene locus_tag LOCUS_13170 2512 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 2576 2585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3852 2971 gene locus_tag LOCUS_13180 gene metF 3852 2971 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719324.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence205 895 245 gene locus_tag LOCUS_13190 895 245 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_13190 1056 1514 gene locus_tag LOCUS_13200 1056 1514 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720606.1 protein_id gnl|my_center|LOCUS_13200 1511 2554 gene locus_tag LOCUS_13210 1511 2554 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384248.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence206 2429 924 gene locus_tag LOCUS_13220 2429 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 <3945 2544 gene locus_tag LOCUS_13230 <3945 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_107891887.1:PAS-domain containing protein >Feature sequence207 126 629 gene locus_tag LOCUS_13240 126 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1056 595 gene locus_tag LOCUS_13250 1056 595 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069459025.1 protein_id gnl|my_center|LOCUS_13250 1204 2310 gene locus_tag LOCUS_13260 gene hppD 1204 2310 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532312.1 protein_id gnl|my_center|LOCUS_13260 2310 2657 gene locus_tag LOCUS_13270 2310 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence208 <1 516 gene locus_tag LOCUS_13280 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385153.1:transglycosylase SLT domain-containing protein 516 2603 gene locus_tag LOCUS_13290 gene flhA 516 2603 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385152.1 protein_id gnl|my_center|LOCUS_13290 2600 3379 gene locus_tag LOCUS_13300 2600 3379 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338876.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence209 1744 320 gene locus_tag LOCUS_13310 1744 320 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_13310 2555 1878 gene locus_tag LOCUS_13320 2555 1878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338479.1 protein_id gnl|my_center|LOCUS_13320 3834 2548 gene locus_tag LOCUS_13330 3834 2548 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338480.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence210 127 504 gene locus_tag LOCUS_13340 127 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 784 512 gene locus_tag LOCUS_13350 784 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 937 2658 gene locus_tag LOCUS_13360 937 2658 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921205.1 protein_id gnl|my_center|LOCUS_13360 3159 2662 gene locus_tag LOCUS_13370 3159 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 <3874 3156 gene locus_tag LOCUS_13380 <3874 3156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141839.1:TIGR03032 family protein >Feature sequence211 2037 1639 gene locus_tag LOCUS_13390 2037 1639 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719358.1 protein_id gnl|my_center|LOCUS_13390 2542 2162 gene locus_tag LOCUS_13400 2542 2162 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719359.1 protein_id gnl|my_center|LOCUS_13400 2683 3120 gene locus_tag LOCUS_13410 2683 3120 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_13410 3117 3617 gene locus_tag LOCUS_13420 3117 3617 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence212 703 350 gene locus_tag LOCUS_13430 gene rpoZ 703 350 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722412.1 protein_id gnl|my_center|LOCUS_13430 1381 776 gene locus_tag LOCUS_13440 1381 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1467 2042 gene locus_tag LOCUS_13450 1467 2042 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722410.1 protein_id gnl|my_center|LOCUS_13450 2084 3064 gene locus_tag LOCUS_13460 gene ispH 2084 3064 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 protein_id gnl|my_center|LOCUS_13460 3061 3414 gene locus_tag LOCUS_13470 3061 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence213 1202 570 gene locus_tag LOCUS_13480 1202 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1864 1244 gene locus_tag LOCUS_13490 1864 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2781 1861 gene locus_tag LOCUS_13500 2781 1861 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719447.1 protein_id gnl|my_center|LOCUS_13500 <3834 2778 gene locus_tag LOCUS_13510 <3834 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337377.1:histidinol-phosphate transaminase >Feature sequence214 206 1705 gene locus_tag LOCUS_13520 206 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2465 1692 gene locus_tag LOCUS_13530 gene truA 2465 1692 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384546.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence215 2118 973 gene locus_tag LOCUS_13540 2118 973 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337638.1 protein_id gnl|my_center|LOCUS_13540 2197 2529 gene locus_tag LOCUS_13550 gene erpA 2197 2529 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 protein_id gnl|my_center|LOCUS_13550 3430 2522 gene locus_tag LOCUS_13560 3430 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence216 8 775 gene locus_tag LOCUS_13570 8 775 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945810.1 protein_id gnl|my_center|LOCUS_13570 787 1302 gene locus_tag LOCUS_13580 787 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338652.1 protein_id gnl|my_center|LOCUS_13580 1377 2747 gene locus_tag LOCUS_13590 1377 2747 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338651.1 protein_id gnl|my_center|LOCUS_13590 2802 3677 gene locus_tag LOCUS_13600 2802 3677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence217 210 1019 gene locus_tag LOCUS_13610 210 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 <3746 1030 gene locus_tag LOCUS_13620 <3746 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974607.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence218 <1 1183 gene locus_tag LOCUS_13630 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337236.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1180 2559 gene locus_tag LOCUS_13640 gene murF 1180 2559 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337237.1 protein_id gnl|my_center|LOCUS_13640 2559 3644 gene locus_tag LOCUS_13650 gene mraY 2559 3644 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719256.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence219 794 447 gene locus_tag LOCUS_13660 794 447 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_13660 1240 914 gene locus_tag LOCUS_13670 1240 914 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174939.1 protein_id gnl|my_center|LOCUS_13670 1310 1918 gene locus_tag LOCUS_13680 1310 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531186.1 protein_id gnl|my_center|LOCUS_13680 1986 3323 gene locus_tag LOCUS_13690 1986 3323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338909.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence220 1055 129 gene locus_tag LOCUS_13700 1055 129 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 protein_id gnl|my_center|LOCUS_13700 1666 1085 gene locus_tag LOCUS_13710 1666 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 protein_id gnl|my_center|LOCUS_13710 2547 1651 gene locus_tag LOCUS_13720 gene hemF 2547 1651 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338414.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence221 <1 1761 gene locus_tag LOCUS_13730 <1 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083146.1:NosR/NirI family protein 1772 3685 gene locus_tag LOCUS_13740 gene nosZ 1772 3685 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence222 1921 254 gene locus_tag LOCUS_13750 1921 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2187 2678 gene locus_tag LOCUS_13760 2187 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2687 3127 gene locus_tag LOCUS_13770 2687 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence223 721 47 gene locus_tag LOCUS_13780 721 47 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_13780 2230 773 gene locus_tag LOCUS_13790 2230 773 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528279.1 protein_id gnl|my_center|LOCUS_13790 3620 2337 gene locus_tag LOCUS_13800 3620 2337 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933527.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence224 758 30 gene locus_tag LOCUS_13810 758 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1401 760 gene locus_tag LOCUS_13820 1401 760 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 protein_id gnl|my_center|LOCUS_13820 1531 2148 gene locus_tag LOCUS_13830 1531 2148 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337043.1 protein_id gnl|my_center|LOCUS_13830 2663 2226 gene locus_tag LOCUS_13840 2663 2226 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337040.1 protein_id gnl|my_center|LOCUS_13840 3118 2660 gene locus_tag LOCUS_13850 3118 2660 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722770.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence225 1424 96 gene locus_tag LOCUS_13860 1424 96 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338061.1 protein_id gnl|my_center|LOCUS_13860 1476 2396 gene locus_tag LOCUS_13870 1476 2396 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 protein_id gnl|my_center|LOCUS_13870 3087 2371 gene locus_tag LOCUS_13880 3087 2371 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_13880 <3647 3080 gene locus_tag LOCUS_13890 <3647 3080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337348.1:3-oxoadipate enol-lactonase >Feature sequence226 284 793 gene locus_tag LOCUS_13900 284 793 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563763.1 protein_id gnl|my_center|LOCUS_13900 2172 799 gene locus_tag LOCUS_13910 2172 799 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338046.1 protein_id gnl|my_center|LOCUS_13910 2217 2744 gene locus_tag LOCUS_13920 2217 2744 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence227 971 2911 gene locus_tag LOCUS_13930 971 2911 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338628.1 protein_id gnl|my_center|LOCUS_13930 <3628 2908 gene locus_tag LOCUS_13940 <3628 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721286.1:succinate dehydrogenase iron-sulfur subunit >Feature sequence228 <1 749 gene locus_tag LOCUS_13950 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337124.1:ribonuclease D 746 1483 gene locus_tag LOCUS_13960 746 1483 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877850.1 protein_id gnl|my_center|LOCUS_13960 1508 1930 gene locus_tag LOCUS_13970 1508 1930 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337126.1 protein_id gnl|my_center|LOCUS_13970 1950 2960 gene locus_tag LOCUS_13980 gene bmt 1950 2960 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence229 399 1025 gene locus_tag LOCUS_13990 399 1025 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 protein_id gnl|my_center|LOCUS_13990 2508 1096 gene locus_tag LOCUS_14000 gene glnA 2508 1096 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384998.1 protein_id gnl|my_center|LOCUS_14000 2862 2524 gene locus_tag LOCUS_14010 2862 2524 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence230 3 332 gene locus_tag LOCUS_14020 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 392 2896 gene locus_tag LOCUS_14030 gene infB 392 2896 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338758.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence231 <1 1768 gene locus_tag LOCUS_14040 <1 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385008.1:arginine--tRNA ligase 1839 2762 gene locus_tag LOCUS_14050 1839 2762 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337864.1 protein_id gnl|my_center|LOCUS_14050 2773 3579 gene locus_tag LOCUS_14060 2773 3579 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720098.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence232 521 2020 gene locus_tag LOCUS_14070 521 2020 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565364.1 protein_id gnl|my_center|LOCUS_14070 2111 3262 gene locus_tag LOCUS_14080 2111 3262 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338029.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence233 1582 665 gene locus_tag LOCUS_14090 1582 665 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486301.1 protein_id gnl|my_center|LOCUS_14090 3126 1582 gene locus_tag LOCUS_14100 3126 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337781.1 protein_id gnl|my_center|LOCUS_14100 3076 3390 gene locus_tag LOCUS_14110 3076 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence234 814 431 gene locus_tag LOCUS_14120 814 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 442 451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1031 1822 gene locus_tag LOCUS_14130 1031 1822 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537440.1 protein_id gnl|my_center|LOCUS_14130 <3576 1887 gene locus_tag LOCUS_14140 <3576 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337759.1:penicillin acylase family protein >Feature sequence235 >Feature sequence236 395 937 gene locus_tag LOCUS_14150 gene hpt 395 937 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384474.1 protein_id gnl|my_center|LOCUS_14150 1677 934 gene locus_tag LOCUS_14160 1677 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3497 1677 gene locus_tag LOCUS_14170 3497 1677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384175.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence237 1356 178 gene locus_tag LOCUS_14180 1356 178 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008201.1 protein_id gnl|my_center|LOCUS_14180 1555 2148 gene locus_tag LOCUS_14190 1555 2148 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_14190 2148 2960 gene locus_tag LOCUS_14200 gene fetB 2148 2960 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence238 <1 543 gene locus_tag LOCUS_14210 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389287.1:chloride channel protein 897 553 gene locus_tag LOCUS_14220 897 553 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719125.1 protein_id gnl|my_center|LOCUS_14220 2758 968 gene locus_tag LOCUS_14230 2758 968 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337127.1 protein_id gnl|my_center|LOCUS_14230 2850 3167 gene locus_tag LOCUS_14240 2850 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence239 1237 623 gene locus_tag LOCUS_14250 1237 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1488 1318 gene locus_tag LOCUS_14260 1488 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3026 1620 gene locus_tag LOCUS_14270 3026 1620 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence240 910 272 gene locus_tag LOCUS_14280 910 272 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_14280 996 1619 gene locus_tag LOCUS_14290 996 1619 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 protein_id gnl|my_center|LOCUS_14290 2562 1954 gene locus_tag LOCUS_14300 2562 1954 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_14300 3254 2559 gene locus_tag LOCUS_14310 3254 2559 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence241 1196 120 gene locus_tag LOCUS_14320 1196 120 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_14320 2192 1200 gene locus_tag LOCUS_14330 2192 1200 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_14330 3022 2204 gene locus_tag LOCUS_14340 3022 2204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_14340 3486 3019 gene locus_tag LOCUS_14350 3486 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence242 2155 1214 gene locus_tag LOCUS_14360 gene trxB 2155 1214 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722320.1 protein_id gnl|my_center|LOCUS_14360 2453 2953 gene locus_tag LOCUS_14370 2453 2953 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence243 1101 424 gene locus_tag LOCUS_14380 1101 424 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_14380 1177 1935 gene locus_tag LOCUS_14390 1177 1935 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338103.1 protein_id gnl|my_center|LOCUS_14390 2928 1945 gene locus_tag LOCUS_14400 2928 1945 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965071.1 protein_id gnl|my_center|LOCUS_14400 <3478 2934 gene locus_tag LOCUS_14410 <3478 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719321.1:inositol monophosphatase family protein >Feature sequence244 464 1270 gene locus_tag LOCUS_14420 464 1270 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_14420 2542 1274 gene locus_tag LOCUS_14430 2542 1274 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_14430 3186 2539 gene locus_tag LOCUS_14440 3186 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence245 1 153 gene locus_tag LOCUS_14450 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 150 1130 gene locus_tag LOCUS_14460 150 1130 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238915.1 protein_id gnl|my_center|LOCUS_14460 1223 2044 gene locus_tag LOCUS_14470 1223 2044 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529669.1 protein_id gnl|my_center|LOCUS_14470 2041 2754 gene locus_tag LOCUS_14480 2041 2754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence246 251 433 gene locus_tag LOCUS_14490 251 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 420 429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 441 833 gene locus_tag LOCUS_14500 441 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14500 845 1576 gene locus_tag LOCUS_14510 845 1576 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339418.1 protein_id gnl|my_center|LOCUS_14510 1569 2360 gene locus_tag LOCUS_14520 1569 2360 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262760.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence247 1554 553 gene locus_tag LOCUS_14530 1554 553 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 protein_id gnl|my_center|LOCUS_14530 2055 1708 gene locus_tag LOCUS_14540 2055 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2508 2125 gene locus_tag LOCUS_14550 2508 2125 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721067.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence248 1996 974 gene locus_tag LOCUS_14560 1996 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2084 2884 gene locus_tag LOCUS_14570 gene trmD 2084 2884 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080517624.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence249 2234 801 gene locus_tag LOCUS_14580 2234 801 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722232.1 protein_id gnl|my_center|LOCUS_14580 2357 2974 gene locus_tag LOCUS_14590 2357 2974 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722229.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence250 1426 2742 gene locus_tag LOCUS_14600 1426 2742 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067367.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence251 1150 518 gene locus_tag LOCUS_14610 gene maiA 1150 518 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984023.1 protein_id gnl|my_center|LOCUS_14610 1575 1147 gene locus_tag LOCUS_14620 1575 1147 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_14620 1670 2956 gene locus_tag LOCUS_14630 gene fahA 1670 2956 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083174.1 protein_id gnl|my_center|LOCUS_14630 3202 3283 gene locus_tag LOCUS_t00220 3202 3283 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence252 757 1365 gene locus_tag LOCUS_14640 757 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1365 1568 gene locus_tag LOCUS_14650 1365 1568 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_14650 1640 2554 gene locus_tag LOCUS_14660 1640 2554 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 protein_id gnl|my_center|LOCUS_14660 <3381 2561 gene locus_tag LOCUS_14670 <3381 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337039.1:phosphoglucosamine mutase >Feature sequence253 1 2946 gene locus_tag LOCUS_14680 1 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence254 283 918 gene locus_tag LOCUS_14690 283 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1086 2864 gene locus_tag LOCUS_14700 gene xsc 1086 2864 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331273.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence255 1039 389 gene locus_tag LOCUS_14710 gene yihA 1039 389 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385283.1 protein_id gnl|my_center|LOCUS_14710 1788 1036 gene locus_tag LOCUS_14720 1788 1036 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338691.1 protein_id gnl|my_center|LOCUS_14720 <3357 1788 gene locus_tag LOCUS_14730 <3357 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038142527.1:membrane protein insertase YidC >Feature sequence256 383 1492 gene locus_tag LOCUS_14740 383 1492 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_14740 1647 2111 gene locus_tag LOCUS_14750 1647 2111 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467599.1 protein_id gnl|my_center|LOCUS_14750 2092 2862 gene locus_tag LOCUS_14760 2092 2862 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence257 652 990 gene locus_tag LOCUS_14770 652 990 CDS product DUF6476 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719562.1 protein_id gnl|my_center|LOCUS_14770 987 2942 gene locus_tag LOCUS_14780 gene dnaG 987 2942 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338201.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence258 1198 488 gene locus_tag LOCUS_14790 1198 488 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337269.1 protein_id gnl|my_center|LOCUS_14790 1766 1191 gene locus_tag LOCUS_14800 1766 1191 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337270.1 protein_id gnl|my_center|LOCUS_14800 2900 1770 gene locus_tag LOCUS_14810 2900 1770 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669217.1 protein_id gnl|my_center|LOCUS_14810 3331 3134 gene locus_tag LOCUS_14820 3331 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence259 1435 512 gene locus_tag LOCUS_14830 1435 512 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 protein_id gnl|my_center|LOCUS_14830 2307 1432 gene locus_tag LOCUS_14840 2307 1432 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_14840 <3315 2308 gene locus_tag LOCUS_14850 <3315 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139995.1:NADP-dependent malic enzyme >Feature sequence260 1386 115 gene locus_tag LOCUS_14860 1386 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1902 1507 gene locus_tag LOCUS_14870 1902 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence261 813 400 gene locus_tag LOCUS_14880 813 400 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_14880 940 1332 gene locus_tag LOCUS_14890 940 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1596 1405 gene locus_tag LOCUS_14900 1596 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1777 2223 gene locus_tag LOCUS_14910 1777 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 <3307 2239 gene locus_tag LOCUS_14920 <3307 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005618952.1:siroheme synthase CysG >Feature sequence262 <1 1411 gene locus_tag LOCUS_14930 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388358.1:phosphate ABC transporter permease PstA 1423 2208 gene locus_tag LOCUS_14940 gene pstB 1423 2208 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382998.1 protein_id gnl|my_center|LOCUS_14940 2221 2937 gene locus_tag LOCUS_14950 gene phoU 2221 2937 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence263 <1 697 gene locus_tag LOCUS_14960 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384879.1:5-bromo-4-chloroindolyl phosphate hydrolysis family protein 711 1901 gene locus_tag LOCUS_14970 711 1901 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 protein_id gnl|my_center|LOCUS_14970 1956 2831 gene locus_tag LOCUS_14980 1956 2831 CDS product DUF2927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337360.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence264 >Feature sequence265 2998 851 gene locus_tag LOCUS_14990 2998 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14990 910 919 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence266 1638 421 gene locus_tag LOCUS_15000 1638 421 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061601.1 protein_id gnl|my_center|LOCUS_15000 1783 1792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2033 3118 gene locus_tag LOCUS_15010 gene gcvT 2033 3118 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650750.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence267 1272 1610 gene locus_tag LOCUS_15020 1272 1610 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_15020 1660 2958 gene locus_tag LOCUS_15030 gene amt 1660 2958 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence268 499 29 gene locus_tag LOCUS_15040 499 29 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722912.1 protein_id gnl|my_center|LOCUS_15040 643 843 gene locus_tag LOCUS_15050 643 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1652 840 gene locus_tag LOCUS_15060 1652 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2405 1665 gene locus_tag LOCUS_15070 2405 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2860 2450 gene locus_tag LOCUS_15080 2860 2450 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence269 1939 779 gene locus_tag LOCUS_15090 gene argE 1939 779 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338096.1 protein_id gnl|my_center|LOCUS_15090 2132 3136 gene locus_tag LOCUS_15100 2132 3136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence270 364 1026 gene locus_tag LOCUS_15110 364 1026 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_15110 2354 1260 gene locus_tag LOCUS_15120 2354 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_15120 <3204 2501 gene locus_tag LOCUS_15130 <3204 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337358.1:SPFH domain-containing protein >Feature sequence271 860 18 gene locus_tag LOCUS_15140 860 18 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 protein_id gnl|my_center|LOCUS_15140 1821 862 gene locus_tag LOCUS_15150 gene tatC 1821 862 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383013.1 protein_id gnl|my_center|LOCUS_15150 2281 1823 gene locus_tag LOCUS_15160 gene tatB 2281 1823 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719691.1 protein_id gnl|my_center|LOCUS_15160 2521 2306 gene locus_tag LOCUS_15170 gene tatA 2521 2306 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719690.1 protein_id gnl|my_center|LOCUS_15170 <3193 2660 gene locus_tag LOCUS_15180 <3193 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020477356.1:ABC transporter ATP-binding protein >Feature sequence272 <1 684 gene locus_tag LOCUS_15190 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339405.1:ATP phosphoribosyltransferase regulatory subunit 684 1403 gene locus_tag LOCUS_15200 gene hisG 684 1403 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724462.1 protein_id gnl|my_center|LOCUS_15200 2078 1389 gene locus_tag LOCUS_15210 2078 1389 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_15210 2599 2123 gene locus_tag LOCUS_15220 gene nusB 2599 2123 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841646.1 protein_id gnl|my_center|LOCUS_15220 3150 2599 gene locus_tag LOCUS_15230 3150 2599 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720942.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence273 1282 95 gene locus_tag LOCUS_15240 1282 95 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_15240 1736 2437 gene locus_tag LOCUS_15250 1736 2437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_15250 2434 3144 gene locus_tag LOCUS_15260 2434 3144 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence274 1960 1286 gene locus_tag LOCUS_15270 1960 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence275 1771 2118 gene locus_tag LOCUS_15280 gene uraH 1771 2118 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528242.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence276 1668 787 gene locus_tag LOCUS_15290 gene sucD 1668 787 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721254.1 protein_id gnl|my_center|LOCUS_15290 2868 1672 gene locus_tag LOCUS_15300 gene sucC 2868 1672 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence277 727 1431 gene locus_tag LOCUS_15310 727 1431 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338569.1 protein_id gnl|my_center|LOCUS_15310 1418 2020 gene locus_tag LOCUS_15320 1418 2020 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561627.1 protein_id gnl|my_center|LOCUS_15320 2309 2031 gene locus_tag LOCUS_15330 2309 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 <3153 2309 gene locus_tag LOCUS_15340 <3153 2309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161601244.1:ferrochelatase >Feature sequence278 481 1257 gene locus_tag LOCUS_15350 481 1257 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564427.1 protein_id gnl|my_center|LOCUS_15350 1254 2927 gene locus_tag LOCUS_15360 1254 2927 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719684.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence279 <1 1006 gene locus_tag LOCUS_15370 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337784.1:DUF6456 domain-containing protein 1909 1169 gene locus_tag LOCUS_15380 gene tpiA 1909 1169 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence280 824 360 gene locus_tag LOCUS_15390 824 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2023 824 gene locus_tag LOCUS_15400 2023 824 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337629.1 protein_id gnl|my_center|LOCUS_15400 2096 2767 gene locus_tag LOCUS_15410 2096 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972674.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence281 845 42 gene locus_tag LOCUS_15420 gene ybgF 845 42 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338401.1 protein_id gnl|my_center|LOCUS_15420 1373 873 gene locus_tag LOCUS_15430 gene pal 1373 873 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720848.1 protein_id gnl|my_center|LOCUS_15430 2772 1441 gene locus_tag LOCUS_15440 gene tolB 2772 1441 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720849.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence282 2128 1616 gene locus_tag LOCUS_15450 2128 1616 CDS product DUF6446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384809.1 protein_id gnl|my_center|LOCUS_15450 3062 2145 gene locus_tag LOCUS_15460 3062 2145 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337033.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence283 1688 1527 gene locus_tag LOCUS_15470 gene ccoS 1688 1527 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919284.1 protein_id gnl|my_center|LOCUS_15470 <3110 1685 gene locus_tag LOCUS_15480 <3110 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338419.1:heavy metal translocating P-type ATPase >Feature sequence284 434 1012 gene locus_tag LOCUS_15490 434 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1405 1028 gene locus_tag LOCUS_15500 1405 1028 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence285 <1 2187 gene locus_tag LOCUS_15510 <1 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388093.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence286 1801 929 gene locus_tag LOCUS_15520 1801 929 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085124.1 protein_id gnl|my_center|LOCUS_15520 2717 1884 gene locus_tag LOCUS_15530 gene miaA 2717 1884 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337672.1 protein_id gnl|my_center|LOCUS_15530 2898 3026 gene locus_tag LOCUS_15540 2898 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence287 486 28 gene locus_tag LOCUS_15550 486 28 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 protein_id gnl|my_center|LOCUS_15550 2470 491 gene locus_tag LOCUS_15560 2470 491 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence288 536 27 gene locus_tag LOCUS_15570 536 27 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811104.1 protein_id gnl|my_center|LOCUS_15570 988 578 gene locus_tag LOCUS_15580 988 578 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971242.1 protein_id gnl|my_center|LOCUS_15580 1416 1078 gene locus_tag LOCUS_15590 1416 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841891.1 protein_id gnl|my_center|LOCUS_15590 2243 1416 gene locus_tag LOCUS_15600 gene dapD 2243 1416 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721542.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence289 584 593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1203 985 gene locus_tag LOCUS_15610 gene infA 1203 985 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384801.1 protein_id gnl|my_center|LOCUS_15610 2112 1342 gene locus_tag LOCUS_15620 2112 1342 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918580.1 protein_id gnl|my_center|LOCUS_15620 2620 2162 gene locus_tag LOCUS_15630 2620 2162 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338371.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence290 733 930 gene locus_tag LOCUS_15640 733 930 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967526.1 protein_id gnl|my_center|LOCUS_15640 1311 988 gene locus_tag LOCUS_15650 1311 988 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389769.1 protein_id gnl|my_center|LOCUS_15650 2234 1320 gene locus_tag LOCUS_15660 2234 1320 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_15660 <2993 2318 gene locus_tag LOCUS_15670 <2993 2318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074078.1:ABC transporter ATP-binding protein >Feature sequence291 899 6 gene locus_tag LOCUS_15680 899 6 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970347.1 protein_id gnl|my_center|LOCUS_15680 950 1651 gene locus_tag LOCUS_15690 950 1651 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_15690 1648 1971 gene locus_tag LOCUS_15700 1648 1971 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720923.1 protein_id gnl|my_center|LOCUS_15700 2443 1982 gene locus_tag LOCUS_15710 2443 1982 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence292 1634 2287 gene locus_tag LOCUS_15720 gene fsa 1634 2287 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence293 882 391 gene locus_tag LOCUS_15730 gene accB 882 391 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384520.1 protein_id gnl|my_center|LOCUS_15730 1740 985 gene locus_tag LOCUS_15740 1740 985 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337891.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence294 2274 2005 gene locus_tag LOCUS_15750 gene rpsO 2274 2005 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385566.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence295 1394 354 gene locus_tag LOCUS_15760 gene nuoH 1394 354 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385020.1 protein_id gnl|my_center|LOCUS_15760 <2938 1398 gene locus_tag LOCUS_15770 <2938 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140171.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence296 921 139 gene locus_tag LOCUS_15780 gene modA 921 139 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_15780 1452 1000 gene locus_tag LOCUS_15790 1452 1000 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563806.1 protein_id gnl|my_center|LOCUS_15790 1639 2820 gene locus_tag LOCUS_15800 gene carA 1639 2820 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722785.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence297 <1 748 gene locus_tag LOCUS_15810 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337556.1:peptide chain release factor 3 1996 776 gene locus_tag LOCUS_15820 1996 776 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566727.1 protein_id gnl|my_center|LOCUS_15820 2579 1989 gene locus_tag LOCUS_15830 2579 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence298 >Feature sequence299 967 1704 gene locus_tag LOCUS_15840 gene rpiA 967 1704 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338176.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence300 1758 451 gene locus_tag LOCUS_15850 1758 451 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_15850 2768 1755 gene locus_tag LOCUS_15860 2768 1755 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence301 <1 662 gene locus_tag LOCUS_15870 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937588.1:sulfate permease 665 1063 gene locus_tag LOCUS_15880 gene ybgC 665 1063 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_15880 1171 1875 gene locus_tag LOCUS_15890 gene tolQ 1171 1875 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720852.1 protein_id gnl|my_center|LOCUS_15890 1877 2347 gene locus_tag LOCUS_15900 gene tolR 1877 2347 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence302 <1 823 gene locus_tag LOCUS_15910 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383235.1:dihydrolipoyl dehydrogenase 1580 990 gene locus_tag LOCUS_15920 1580 990 CDS product gamma-glutamyl kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384261.1 protein_id gnl|my_center|LOCUS_15920 1763 2827 gene locus_tag LOCUS_15930 gene recA 1763 2827 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720615.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence303 2788 1274 gene locus_tag LOCUS_15940 gene trpE 2788 1274 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643621.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence304 1121 96 gene locus_tag LOCUS_15950 1121 96 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_15950 1685 1188 gene locus_tag LOCUS_15960 1685 1188 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 protein_id gnl|my_center|LOCUS_15960 1725 2639 gene locus_tag LOCUS_15970 gene rocF 1725 2639 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337620.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence305 <1 684 gene locus_tag LOCUS_15980 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060486286.1:acetylglutamate kinase 761 1561 gene locus_tag LOCUS_15990 761 1561 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_15990 1696 2205 gene locus_tag LOCUS_16000 1696 2205 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338695.1 protein_id gnl|my_center|LOCUS_16000 2852 2208 gene locus_tag LOCUS_16010 2852 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence306 1448 24 gene locus_tag LOCUS_16020 gene xseA 1448 24 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383570.1 protein_id gnl|my_center|LOCUS_16020 1531 2793 gene locus_tag LOCUS_16030 gene purD 1531 2793 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337026.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence307 <1 592 gene locus_tag LOCUS_16040 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385557.1:adenine deaminase 589 2073 gene locus_tag LOCUS_16050 589 2073 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721991.1 protein_id gnl|my_center|LOCUS_16050 2262 2537 gene locus_tag LOCUS_16060 2262 2537 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence308 <1 817 gene locus_tag LOCUS_16070 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530061.1:LssY C-terminal domain-containing protein 2249 858 gene locus_tag LOCUS_16080 gene ahcY 2249 858 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722208.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence309 <1 1569 gene locus_tag LOCUS_16090 <1 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140189.1:sarcosine oxidase subunit alpha family protein 1562 2128 gene locus_tag LOCUS_16100 1562 2128 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337661.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence310 1887 1183 gene locus_tag LOCUS_16110 1887 1183 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence311 243 1529 gene locus_tag LOCUS_16120 gene pncB 243 1529 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338912.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence312 94 1014 gene locus_tag LOCUS_16130 gene sppA 94 1014 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327051.1 protein_id gnl|my_center|LOCUS_16130 1113 1394 gene locus_tag LOCUS_16140 gene ihfB 1113 1394 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383532.1 protein_id gnl|my_center|LOCUS_16140 1407 1742 gene locus_tag LOCUS_16150 1407 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1742 2380 gene locus_tag LOCUS_16160 1742 2380 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence313 373 732 gene locus_tag LOCUS_16170 373 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 732 1274 gene locus_tag LOCUS_16180 732 1274 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_16180 1338 2414 gene locus_tag LOCUS_16190 gene cobW 1338 2414 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence314 106 17 gene locus_tag LOCUS_t00230 106 17 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 864 172 gene locus_tag LOCUS_16200 864 172 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 protein_id gnl|my_center|LOCUS_16200 1439 861 gene locus_tag LOCUS_16210 1439 861 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841687.1 protein_id gnl|my_center|LOCUS_16210 1621 2094 gene locus_tag LOCUS_16220 1621 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence315 1 540 gene locus_tag LOCUS_16230 1 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 607 2415 gene locus_tag LOCUS_16240 607 2415 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337665.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence316 271 1035 gene locus_tag LOCUS_16250 271 1035 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338520.1 protein_id gnl|my_center|LOCUS_16250 1046 2119 gene locus_tag LOCUS_16260 1046 2119 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence317 1232 810 gene locus_tag LOCUS_16270 1232 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1336 2466 gene locus_tag LOCUS_16280 1336 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2724 2638 gene locus_tag LOCUS_t00240 2724 2638 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence318 3 644 gene locus_tag LOCUS_16290 3 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 646 1068 gene locus_tag LOCUS_16300 646 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1946 1083 gene locus_tag LOCUS_16310 1946 1083 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence319 487 1311 gene locus_tag LOCUS_16320 487 1311 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_16320 2300 1308 gene locus_tag LOCUS_16330 2300 1308 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338461.1 protein_id gnl|my_center|LOCUS_16330 2361 2582 gene locus_tag LOCUS_16340 2361 2582 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720934.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence320 291 644 gene locus_tag LOCUS_16350 291 644 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 protein_id gnl|my_center|LOCUS_16350 1001 1204 gene locus_tag LOCUS_16360 1001 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2179 1283 gene locus_tag LOCUS_16370 2179 1283 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence321 997 1536 gene locus_tag LOCUS_16380 997 1536 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence322 365 637 gene locus_tag LOCUS_16390 365 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1681 980 gene locus_tag LOCUS_16400 1681 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 <2717 1688 gene locus_tag LOCUS_16410 <2717 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583970.1:glycosyltransferase family 4 protein >Feature sequence323 2555 1458 gene locus_tag LOCUS_16420 2555 1458 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence324 <1 738 gene locus_tag LOCUS_16430 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339409.1:molybdopterin-dependent oxidoreductase 735 1655 gene locus_tag LOCUS_16440 gene xdhC 735 1655 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538138.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence325 414 1112 gene locus_tag LOCUS_16450 414 1112 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561962.1 protein_id gnl|my_center|LOCUS_16450 1583 2062 gene locus_tag LOCUS_16460 1583 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 <2693 2119 gene locus_tag LOCUS_16470 <2693 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338324.1:isoleucine--tRNA ligase >Feature sequence326 1 282 gene locus_tag LOCUS_16480 gene hisI 1 282 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337616.1 protein_id gnl|my_center|LOCUS_16480 284 655 gene locus_tag LOCUS_16490 284 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1467 652 gene locus_tag LOCUS_16500 gene gluQRS 1467 652 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337617.1 protein_id gnl|my_center|LOCUS_16500 <2689 1455 gene locus_tag LOCUS_16510 <2689 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337618.1:methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO >Feature sequence327 <1 922 gene locus_tag LOCUS_16520 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337349.1:threonine/serine dehydratase 919 1992 gene locus_tag LOCUS_16530 919 1992 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence328 >Feature sequence329 807 190 gene locus_tag LOCUS_16540 807 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1530 811 gene locus_tag LOCUS_16550 1530 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 <2686 1530 gene locus_tag LOCUS_16560 <2686 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022265.1:APC family permease >Feature sequence330 <1 569 gene locus_tag LOCUS_16570 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337693.1:DNA-3-methyladenine glycosylase 566 1234 gene locus_tag LOCUS_16580 566 1234 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_16580 1792 1346 gene locus_tag LOCUS_16590 1792 1346 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_16590 2379 1801 gene locus_tag LOCUS_16600 2379 1801 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_16600 2568 2652 gene locus_tag LOCUS_t00250 2568 2652 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence331 <1 968 gene locus_tag LOCUS_16610 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337504.1:alanine racemase 962 1288 gene locus_tag LOCUS_16620 962 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1285 1647 gene locus_tag LOCUS_16630 1285 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1667 2500 gene locus_tag LOCUS_16640 1667 2500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence332 509 1276 gene locus_tag LOCUS_16650 gene yaaA 509 1276 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039000301.1 protein_id gnl|my_center|LOCUS_16650 1328 1939 gene locus_tag LOCUS_16660 1328 1939 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538033.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence333 539 1645 gene locus_tag LOCUS_16670 539 1645 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339405.1 protein_id gnl|my_center|LOCUS_16670 1645 2352 gene locus_tag LOCUS_16680 gene hisG 1645 2352 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724462.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence334 <1 805 gene locus_tag LOCUS_16690 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337233.1:Mrp/NBP35 family ATP-binding protein 809 1255 gene locus_tag LOCUS_16700 809 1255 CDS product DUF6505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970359.1 protein_id gnl|my_center|LOCUS_16700 1371 2075 gene locus_tag LOCUS_16710 1371 2075 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066599.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence335 <1 1013 gene locus_tag LOCUS_16720 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338512.1:aspartate--tRNA ligase 2334 1186 gene locus_tag LOCUS_16730 2334 1186 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337635.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence336 >Feature sequence337 2608 134 gene locus_tag LOCUS_16740 gene hrpB 2608 134 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337156.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence338 9 1478 gene locus_tag LOCUS_16750 9 1478 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338484.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence339 <1 1676 gene locus_tag LOCUS_16760 <1 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538055.1:DNA translocase FtsK 1731 2345 gene locus_tag LOCUS_16770 1731 2345 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538056.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence340 1419 1507 gene locus_tag LOCUS_t00260 1419 1507 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence341 357 1127 gene locus_tag LOCUS_16780 357 1127 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_16780 1704 1138 gene locus_tag LOCUS_16790 1704 1138 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337060.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence342 146 1240 gene locus_tag LOCUS_16800 146 1240 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337241.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence343 463 1452 gene locus_tag LOCUS_16810 gene thiB 463 1452 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669892.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence344 <1 862 gene locus_tag LOCUS_16820 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722319.1:bifunctional sulfate adenylyltransferase/adenylylsulfate kinase 1341 1559 gene locus_tag LOCUS_16830 1341 1559 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 protein_id gnl|my_center|LOCUS_16830 1579 2064 gene locus_tag LOCUS_16840 gene purE 1579 2064 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722311.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence345 >Feature sequence346 1245 97 gene locus_tag LOCUS_16850 1245 97 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384089.1 protein_id gnl|my_center|LOCUS_16850 2132 1314 gene locus_tag LOCUS_16860 2132 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494134.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence347 <1 821 gene locus_tag LOCUS_16870 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085640342.1:SufD family Fe-S cluster assembly protein 821 1408 gene locus_tag LOCUS_16880 821 1408 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720600.1 protein_id gnl|my_center|LOCUS_16880 1482 2096 gene locus_tag LOCUS_16890 1482 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence348 1837 731 gene locus_tag LOCUS_16900 1837 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2582 1824 gene locus_tag LOCUS_16910 2582 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence349 603 409 gene locus_tag LOCUS_16920 603 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1015 707 gene locus_tag LOCUS_16930 1015 707 CDS product ATPase inhibitor subunit zeta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975651.1 protein_id gnl|my_center|LOCUS_16930 1176 1937 gene locus_tag LOCUS_16940 1176 1937 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383888.1 protein_id gnl|my_center|LOCUS_16940 1949 2188 gene locus_tag LOCUS_16950 gene purS 1949 2188 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383889.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence350 1615 500 gene locus_tag LOCUS_16960 1615 500 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_16960 1990 1688 gene locus_tag LOCUS_16970 1990 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence351 1289 201 gene locus_tag LOCUS_16980 1289 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338941.1 protein_id gnl|my_center|LOCUS_16980 1726 1635 gene locus_tag LOCUS_t00270 1726 1635 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <2565 1933 gene locus_tag LOCUS_16990 <2565 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722206.1:tryptophan synthase subunit beta >Feature sequence352 <1 982 gene locus_tag LOCUS_17000 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087420.1:protein-L-isoaspartate(D-aspartate) O-methyltransferase >Feature sequence353 870 1526 gene locus_tag LOCUS_17010 gene ccmA 870 1526 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336993.1 protein_id gnl|my_center|LOCUS_17010 1523 2188 gene locus_tag LOCUS_17020 gene ccmB 1523 2188 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722655.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence354 1155 223 gene locus_tag LOCUS_17030 gene hemC 1155 223 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139943.1 protein_id gnl|my_center|LOCUS_17030 1207 2313 gene locus_tag LOCUS_17040 gene tsaD 1207 2313 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336799.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence355 2091 1330 gene locus_tag LOCUS_17050 2091 1330 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383206.1 protein_id gnl|my_center|LOCUS_17050 2542 2213 gene locus_tag LOCUS_17060 2542 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence356 1157 135 gene locus_tag LOCUS_17070 1157 135 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_17070 2528 1191 gene locus_tag LOCUS_17080 2528 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence357 292 495 gene locus_tag LOCUS_17090 292 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1569 730 gene locus_tag LOCUS_17100 gene prmC 1569 730 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_17100 <2522 1566 gene locus_tag LOCUS_17110 <2522 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337837.1:peptide chain release factor 1 >Feature sequence358 <2521 31 gene locus_tag LOCUS_17120 <2521 31 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041669211.1:ribonuclease E/G >Feature sequence359 <1 1158 gene locus_tag LOCUS_17130 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719238.1:excinuclease ABC subunit UvrB >Feature sequence360 414 1064 gene locus_tag LOCUS_17140 414 1064 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_17140 1064 1483 gene locus_tag LOCUS_17150 gene arfB 1064 1483 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721956.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence361 976 122 gene locus_tag LOCUS_17160 976 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1591 1142 gene locus_tag LOCUS_17170 1591 1142 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_17170 <2509 1594 gene locus_tag LOCUS_17180 <2509 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336966.1:phenylalanine--tRNA ligase subunit beta >Feature sequence362 247 1665 gene locus_tag LOCUS_17190 247 1665 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 protein_id gnl|my_center|LOCUS_17190 2397 1678 gene locus_tag LOCUS_17200 2397 1678 CDS product tRNA (guanine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339440.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence363 866 1741 gene locus_tag LOCUS_17210 866 1741 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_17210 1754 2320 gene locus_tag LOCUS_17220 1754 2320 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence364 3 1520 gene locus_tag LOCUS_17230 gene lepA 3 1520 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670005.1 protein_id gnl|my_center|LOCUS_17230 <2494 1495 gene locus_tag LOCUS_17240 <2494 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103701848.1:acyltransferase family protein >Feature sequence365 2298 238 gene locus_tag LOCUS_17250 2298 238 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence366 243 1202 gene locus_tag LOCUS_17260 243 1202 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972212.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence367 680 117 gene locus_tag LOCUS_17270 gene efp 680 117 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537931.1 protein_id gnl|my_center|LOCUS_17270 815 2065 gene locus_tag LOCUS_17280 815 2065 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 protein_id gnl|my_center|LOCUS_17280 2077 2331 gene locus_tag LOCUS_17290 2077 2331 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112308747.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence368 1085 477 gene locus_tag LOCUS_17300 gene pdxH 1085 477 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337412.1 protein_id gnl|my_center|LOCUS_17300 1171 1989 gene locus_tag LOCUS_17310 gene fabI 1171 1989 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence369 <1 832 gene locus_tag LOCUS_17320 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086305.1:YeeE/YedE family protein 851 1369 gene locus_tag LOCUS_17330 851 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 <2470 1366 gene locus_tag LOCUS_17340 <2470 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383339.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence370 1889 1074 gene locus_tag LOCUS_17350 1889 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <2462 1882 gene locus_tag LOCUS_17360 <2462 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224750.1:ABC transporter ATP-binding protein >Feature sequence371 771 232 gene locus_tag LOCUS_17370 771 232 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence372 202 1101 gene locus_tag LOCUS_17380 202 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1222 1443 gene locus_tag LOCUS_17390 gene rpmE 1222 1443 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721385.1 protein_id gnl|my_center|LOCUS_17390 1519 2328 gene locus_tag LOCUS_17400 1519 2328 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence373 1202 456 gene locus_tag LOCUS_17410 1202 456 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 protein_id gnl|my_center|LOCUS_17410 1310 1531 gene locus_tag LOCUS_17420 1310 1531 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 protein_id gnl|my_center|LOCUS_17420 2442 1702 gene locus_tag LOCUS_17430 2442 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence374 160 1866 gene locus_tag LOCUS_17440 160 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 1839 1848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence375 <1 1546 gene locus_tag LOCUS_17450 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256685.1:peptide ABC transporter substrate-binding protein >Feature sequence376 <1 1337 gene locus_tag LOCUS_17460 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337677.1:RIP metalloprotease RseP >Feature sequence377 1477 350 gene locus_tag LOCUS_17470 1477 350 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_17470 1650 1997 gene locus_tag LOCUS_17480 1650 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence378 1501 911 gene locus_tag LOCUS_17490 1501 911 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence379 >Feature sequence380 <1 1000 gene locus_tag LOCUS_17500 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339439.1:3-phosphoshikimate 1-carboxyvinyltransferase 621 533 gene locus_tag LOCUS_t00280 621 533 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 997 1395 gene locus_tag LOCUS_17510 997 1395 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 protein_id gnl|my_center|LOCUS_17510 1392 2021 gene locus_tag LOCUS_17520 1392 2021 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence381 824 102 gene locus_tag LOCUS_17530 824 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1005 2252 gene locus_tag LOCUS_17540 1005 2252 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence382 1577 702 gene locus_tag LOCUS_17550 1577 702 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337386.1 protein_id gnl|my_center|LOCUS_17550 <2388 1607 gene locus_tag LOCUS_17560 <2388 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719460.1:F0F1 ATP synthase subunit alpha >Feature sequence383 983 84 gene locus_tag LOCUS_17570 983 84 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_17570 1108 1971 gene locus_tag LOCUS_17580 1108 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence384 <1 1332 gene locus_tag LOCUS_17590 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338147.1:VWA domain-containing protein 1329 1886 gene locus_tag LOCUS_17600 1329 1886 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_17600 1888 2145 gene locus_tag LOCUS_17610 1888 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence385 <1 637 gene locus_tag LOCUS_17620 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970659.1:dipeptidase 883 1047 gene locus_tag LOCUS_17630 883 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence386 216 140 gene locus_tag LOCUS_t00290 216 140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 750 298 gene locus_tag LOCUS_17640 750 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2047 938 gene locus_tag LOCUS_17650 gene leuB 2047 938 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139959.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence387 1500 523 gene locus_tag LOCUS_17660 1500 523 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 protein_id gnl|my_center|LOCUS_17660 <2346 1746 gene locus_tag LOCUS_17670 <2346 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017869284.1:MDR family oxidoreductase >Feature sequence388 814 1167 gene locus_tag LOCUS_17680 gene rbfA 814 1167 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385562.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence389 1509 841 gene locus_tag LOCUS_17690 1509 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337666.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence390 <1 753 gene locus_tag LOCUS_17700 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338543.1:ornithine cyclodeaminase <2339 750 gene locus_tag LOCUS_17710 <2339 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338040.1:ATP-binding protein >Feature sequence391 55 702 gene locus_tag LOCUS_17720 55 702 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336954.1 protein_id gnl|my_center|LOCUS_17720 920 1288 gene locus_tag LOCUS_17730 gene rpsM 920 1288 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722532.1 protein_id gnl|my_center|LOCUS_17730 1304 1693 gene locus_tag LOCUS_17740 gene rpsK 1304 1693 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722534.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence392 <1 1547 gene locus_tag LOCUS_17750 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722755.1:PEP-utilizing enzyme >Feature sequence393 309 1457 gene locus_tag LOCUS_17760 309 1457 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_17760 1468 1689 gene locus_tag LOCUS_17770 1468 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17770 >Feature sequence394 385 1647 gene locus_tag LOCUS_17780 385 1647 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383580.1 protein_id gnl|my_center|LOCUS_17780 1648 2229 gene locus_tag LOCUS_17790 1648 2229 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383581.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence395 911 672 gene locus_tag LOCUS_17800 911 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_17800 1092 1373 gene locus_tag LOCUS_17810 1092 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence396 224 69 gene locus_tag LOCUS_17820 224 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 274 588 gene locus_tag LOCUS_17830 274 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 585 935 gene locus_tag LOCUS_17840 585 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 991 1941 gene locus_tag LOCUS_17850 gene gshB 991 1941 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence397 88 810 gene locus_tag LOCUS_17860 88 810 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338881.1 protein_id gnl|my_center|LOCUS_17860 822 1607 gene locus_tag LOCUS_17870 gene flgG 822 1607 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338880.1 protein_id gnl|my_center|LOCUS_17870 1604 2032 gene locus_tag LOCUS_17880 gene flgA 1604 2032 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721892.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence398 179 913 gene locus_tag LOCUS_17890 179 913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140274.1 protein_id gnl|my_center|LOCUS_17890 1891 1016 gene locus_tag LOCUS_17900 1891 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence399 622 1536 gene locus_tag LOCUS_17910 622 1536 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_17910 2146 1601 gene locus_tag LOCUS_17920 2146 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence400 227 934 gene locus_tag LOCUS_17930 227 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2132 948 gene locus_tag LOCUS_17940 2132 948 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337103.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence401 783 1901 gene locus_tag LOCUS_17950 gene lptF 783 1901 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337830.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence402 669 100 gene locus_tag LOCUS_17960 669 100 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336847.1 protein_id gnl|my_center|LOCUS_17960 1674 775 gene locus_tag LOCUS_17970 gene rpoH 1674 775 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719564.1 protein_id gnl|my_center|LOCUS_17970 <2269 1755 gene locus_tag LOCUS_17980 <2269 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337469.1:RluA family pseudouridine synthase >Feature sequence403 <1 596 gene locus_tag LOCUS_17990 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337521.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase 995 678 gene locus_tag LOCUS_18000 995 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1677 1036 gene locus_tag LOCUS_18010 1677 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence404 1605 166 gene locus_tag LOCUS_18020 1605 166 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_18020 2259 1756 gene locus_tag LOCUS_18030 2259 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence405 968 69 gene locus_tag LOCUS_18040 968 69 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967624.1 protein_id gnl|my_center|LOCUS_18040 2221 965 gene locus_tag LOCUS_18050 2221 965 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence406 <1 1257 gene locus_tag LOCUS_18060 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337371.1:ABC transporter substrate-binding protein 1330 2151 gene locus_tag LOCUS_18070 1330 2151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence407 <1 1375 gene locus_tag LOCUS_18080 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337531.1:vitamin B12-dependent ribonucleotide reductase 1563 2102 gene locus_tag LOCUS_18090 1563 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence408 <2225 118 gene locus_tag LOCUS_18100 <2225 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338533.1:leucine--tRNA ligase >Feature sequence409 <1 1350 gene locus_tag LOCUS_18110 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337238.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 2152 1340 gene locus_tag LOCUS_18120 2152 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence410 1358 603 gene locus_tag LOCUS_18130 gene sufC 1358 603 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384245.1 protein_id gnl|my_center|LOCUS_18130 1718 1398 gene locus_tag LOCUS_18140 1718 1398 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 protein_id gnl|my_center|LOCUS_18140 1903 1715 gene locus_tag LOCUS_18150 1903 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence411 1744 674 gene locus_tag LOCUS_18160 1744 674 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339413.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence412 <1 824 gene locus_tag LOCUS_18170 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720567.1:homoserine dehydrogenase 846 1811 gene locus_tag LOCUS_18180 gene glpX 846 1811 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385196.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence413 1752 634 gene locus_tag LOCUS_18190 gene proB 1752 634 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338952.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence414 388 32 gene locus_tag LOCUS_18200 388 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1460 735 gene locus_tag LOCUS_18210 1460 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence415 274 942 gene locus_tag LOCUS_18220 274 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 939 1922 gene locus_tag LOCUS_18230 939 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence416 1073 603 gene locus_tag LOCUS_18240 gene rlmH 1073 603 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383438.1 protein_id gnl|my_center|LOCUS_18240 1403 1074 gene locus_tag LOCUS_18250 gene rsfS 1403 1074 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365321.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18250 <2161 1585 gene locus_tag LOCUS_18260 <2161 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529592.1:nucleoside hydrolase >Feature sequence417 <1 568 gene locus_tag LOCUS_18270 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338750.1:complex I NDUFA9 subunit family protein 1633 731 gene locus_tag LOCUS_18280 1633 731 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence418 644 847 gene locus_tag LOCUS_18290 644 847 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383592.1 protein_id gnl|my_center|LOCUS_18290 1543 884 gene locus_tag LOCUS_18300 1543 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566974.1 protein_id gnl|my_center|LOCUS_18300 <2153 1566 gene locus_tag LOCUS_18310 <2153 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337367.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence419 <1 515 gene locus_tag LOCUS_18320 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722432.1:sensor histidine kinase 512 928 gene locus_tag LOCUS_18330 512 928 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 protein_id gnl|my_center|LOCUS_18330 921 1802 gene locus_tag LOCUS_18340 gene rapZ 921 1802 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561581.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence420 405 935 gene locus_tag LOCUS_18350 405 935 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18350 880 889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1041 1922 gene locus_tag LOCUS_18360 1041 1922 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337518.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence421 2 187 gene locus_tag LOCUS_18370 2 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 251 1645 gene locus_tag LOCUS_18380 251 1645 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338105.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence422 <1 727 gene locus_tag LOCUS_18390 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976003.1:FAD-binding oxidoreductase 724 1116 gene locus_tag LOCUS_18400 724 1116 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503070.1 protein_id gnl|my_center|LOCUS_18400 1174 1608 gene locus_tag LOCUS_18410 gene trxC 1174 1608 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence423 <2095 271 gene locus_tag LOCUS_18420 <2095 271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707876.1:heavy metal translocating P-type ATPase >Feature sequence424 1639 878 gene locus_tag LOCUS_18430 1639 878 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence425 1880 762 gene locus_tag LOCUS_18440 gene hflK 1880 762 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338174.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence426 2 403 gene locus_tag LOCUS_18450 2 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1274 534 gene locus_tag LOCUS_18460 1274 534 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972010.1 protein_id gnl|my_center|LOCUS_18460 1771 1271 gene locus_tag LOCUS_18470 1771 1271 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971658.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence427 496 1266 gene locus_tag LOCUS_18480 496 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1279 1839 gene locus_tag LOCUS_18490 gene ilvN 1279 1839 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence428 498 175 gene locus_tag LOCUS_18500 498 175 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719839.1 protein_id gnl|my_center|LOCUS_18500 973 509 gene locus_tag LOCUS_18510 973 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1093 1308 gene locus_tag LOCUS_18520 1093 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 <2076 1323 gene locus_tag LOCUS_18530 <2076 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719837.1:sarcosine oxidase subunit beta family protein >Feature sequence429 501 1148 gene locus_tag LOCUS_18540 501 1148 CDS product cytochrome c oxidase assembly factor Coa1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173707.1 protein_id gnl|my_center|LOCUS_18540 <2068 1210 gene locus_tag LOCUS_18550 <2068 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719649.1:phosphopyruvate hydratase >Feature sequence430 1115 1675 gene locus_tag LOCUS_18560 1115 1675 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337663.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence431 1300 452 gene locus_tag LOCUS_18570 1300 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383548.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence432 448 1560 gene locus_tag LOCUS_18580 gene dprA 448 1560 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337288.1 protein_id gnl|my_center|LOCUS_18580 1985 1557 gene locus_tag LOCUS_18590 1985 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence433 <2014 706 gene locus_tag LOCUS_18600 <2014 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337139.1:valine--tRNA ligase >Feature sequence434 687 1259 gene locus_tag LOCUS_18610 687 1259 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562233.1 protein_id gnl|my_center|LOCUS_18610 1974 1306 gene locus_tag LOCUS_18620 1974 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence435 335 1048 gene locus_tag LOCUS_18630 gene uppS 335 1048 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384345.1 protein_id gnl|my_center|LOCUS_18630 1279 1288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence436 1194 667 gene locus_tag LOCUS_18640 1194 667 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_18640 <2006 1191 gene locus_tag LOCUS_18650 <2006 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003695633.1:ABC transporter permease >Feature sequence437 453 1400 gene locus_tag LOCUS_18660 453 1400 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337406.1 protein_id gnl|my_center|LOCUS_18660 1720 1508 gene locus_tag LOCUS_18670 1720 1508 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337232.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence438 1746 754 gene locus_tag LOCUS_18680 1746 754 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338674.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence439 <1985 446 gene locus_tag LOCUS_18690 <1985 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337294.1:choline dehydrogenase >Feature sequence440 1646 234 gene locus_tag LOCUS_18700 1646 234 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038211423.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence441 >Feature sequence442 71 1450 gene locus_tag LOCUS_18710 gene mgtE 71 1450 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722827.1 protein_id gnl|my_center|LOCUS_18710 1969 1655 gene locus_tag LOCUS_18720 1969 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence443 >Feature sequence444 >Feature sequence445 1234 1881 gene locus_tag LOCUS_18730 1234 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence446 1424 93 gene locus_tag LOCUS_18740 1424 93 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_18740 <1944 1425 gene locus_tag LOCUS_18750 <1944 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061554.1:LysR family transcriptional regulator >Feature sequence447 <1939 756 gene locus_tag LOCUS_18760 <1939 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003587.1:terminase family protein >Feature sequence448 <1 790 gene locus_tag LOCUS_18770 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140040.1:propionyl-CoA synthetase 1153 1566 gene locus_tag LOCUS_18780 1153 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence449 <1 1129 gene locus_tag LOCUS_18790 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336810.1:ATP-dependent protease ATPase subunit HslU 1378 1169 gene locus_tag LOCUS_18800 1378 1169 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327668.1 protein_id gnl|my_center|LOCUS_18800 <1935 1394 gene locus_tag LOCUS_18810 <1935 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563182.1:response regulator >Feature sequence450 182 943 gene locus_tag LOCUS_18820 182 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1064 1306 gene locus_tag LOCUS_18830 1064 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388150.1 protein_id gnl|my_center|LOCUS_18830 1323 1682 gene locus_tag LOCUS_18840 1323 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719345.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence451 732 1469 gene locus_tag LOCUS_18850 732 1469 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383401.1 protein_id gnl|my_center|LOCUS_18850 1732 1472 gene locus_tag LOCUS_18860 1732 1472 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383054.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence452 <1 1093 gene locus_tag LOCUS_18870 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528581.1:malonyl-CoA synthase <1926 1224 gene locus_tag LOCUS_18880 <1926 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337323.1:lysophospholipid acyltransferase family protein >Feature sequence453 1008 361 gene locus_tag LOCUS_18890 1008 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence454 >Feature sequence455 <1 929 gene locus_tag LOCUS_18900 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174516.1:MBL fold metallo-hydrolase 1888 1139 gene locus_tag LOCUS_18910 1888 1139 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338100.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence456 831 544 gene locus_tag LOCUS_18920 gene gatC 831 544 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence457 >Feature sequence458 1326 58 gene locus_tag LOCUS_18930 1326 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence459 693 118 gene locus_tag LOCUS_18940 693 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1291 695 gene locus_tag LOCUS_18950 1291 695 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_18950 <1899 1302 gene locus_tag LOCUS_18960 <1899 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385535.1:DNA polymerase III subunit delta >Feature sequence460 402 572 gene locus_tag LOCUS_18970 402 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 582 1541 gene locus_tag LOCUS_18980 582 1541 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence461 742 206 gene locus_tag LOCUS_18990 742 206 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 protein_id gnl|my_center|LOCUS_18990 901 1485 gene locus_tag LOCUS_19000 901 1485 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563235.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence462 3 1454 gene locus_tag LOCUS_19010 gene typA 3 1454 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720611.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence463 >Feature sequence464 565 215 gene locus_tag LOCUS_19020 565 215 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337105.1 protein_id gnl|my_center|LOCUS_19020 931 566 gene locus_tag LOCUS_19030 931 566 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384190.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence465 <1 1834 gene locus_tag LOCUS_19040 <1 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336808.1:double-strand break repair helicase AddA >Feature sequence466 105 485 gene locus_tag LOCUS_19050 105 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 570 908 gene locus_tag LOCUS_19060 570 908 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719579.1 protein_id gnl|my_center|LOCUS_19060 1118 1636 gene locus_tag LOCUS_19070 1118 1636 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence467 295 1074 gene locus_tag LOCUS_19080 295 1074 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338955.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence468 846 40 gene locus_tag LOCUS_19090 846 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1035 1448 gene locus_tag LOCUS_19100 1035 1448 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence469 1308 673 gene locus_tag LOCUS_19110 1308 673 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence470 418 83 gene locus_tag LOCUS_19120 418 83 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_19120 <1827 553 gene locus_tag LOCUS_19130 <1827 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035359.1:aldehyde dehydrogenase family protein >Feature sequence471 >Feature sequence472 440 754 gene locus_tag LOCUS_19140 440 754 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383290.1 protein_id gnl|my_center|LOCUS_19140 767 1546 gene locus_tag LOCUS_19150 767 1546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence473 <1 727 gene locus_tag LOCUS_19160 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721701.1:argininosuccinate synthase 820 1143 gene locus_tag LOCUS_19170 820 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1169 1735 gene locus_tag LOCUS_19180 1169 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence474 >Feature sequence475 <1 1075 gene locus_tag LOCUS_19190 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337410.1:aminotransferase >Feature sequence476 <1 1754 gene locus_tag LOCUS_19200 <1 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336807.1:double-strand break repair protein AddB >Feature sequence477 777 199 gene locus_tag LOCUS_19210 777 199 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence478 1162 1485 gene locus_tag LOCUS_19220 1162 1485 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence479 1513 1034 gene locus_tag LOCUS_19230 1513 1034 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338374.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence480 961 314 gene locus_tag LOCUS_19240 961 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 <1779 1015 gene locus_tag LOCUS_19250 <1779 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338926.1:DMT family transporter >Feature sequence481 >Feature sequence482 208 432 gene locus_tag LOCUS_19260 208 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence483 784 131 gene locus_tag LOCUS_19270 784 131 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338812.1 protein_id gnl|my_center|LOCUS_19270 902 1387 gene locus_tag LOCUS_19280 gene fxsA 902 1387 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence484 255 671 gene locus_tag LOCUS_19290 255 671 CDS product FlgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 protein_id gnl|my_center|LOCUS_19290 686 1078 gene locus_tag LOCUS_19300 gene flgC 686 1078 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003754.1 protein_id gnl|my_center|LOCUS_19300 1092 1382 gene locus_tag LOCUS_19310 gene fliE 1092 1382 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338883.1 protein_id gnl|my_center|LOCUS_19310 1382 1651 gene locus_tag LOCUS_19320 1382 1651 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385143.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence485 1385 789 gene locus_tag LOCUS_19330 gene fdh3B 1385 789 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence486 <1 1449 gene locus_tag LOCUS_19340 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565602.1:DegQ family serine endoprotease >Feature sequence487 <1756 276 gene locus_tag LOCUS_19350 <1756 276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003709.1:carbamoyl-phosphate synthase large subunit >Feature sequence488 <1 736 gene locus_tag LOCUS_19360 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140029.1:amidase family protein >Feature sequence489 <1 643 gene locus_tag LOCUS_19370 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337352.1:acyl-CoA synthetase 814 740 gene locus_tag LOCUS_t00300 814 740 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 898 1068 gene locus_tag LOCUS_19380 898 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence490 <1747 876 gene locus_tag LOCUS_19390 <1747 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338028.1:enoyl-CoA hydratase/isomerase family protein >Feature sequence491 >Feature sequence492 685 224 gene locus_tag LOCUS_19400 gene nrdR 685 224 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720557.1 protein_id gnl|my_center|LOCUS_19400 1459 800 gene locus_tag LOCUS_19410 1459 800 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence493 >Feature sequence494 <1 775 gene locus_tag LOCUS_19420 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721079.1:DMT family transporter <1704 772 gene locus_tag LOCUS_19430 <1704 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338564.1:transglycosylase SLT domain-containing protein >Feature sequence495 1445 324 gene locus_tag LOCUS_19440 gene ispG 1445 324 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337892.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence496 >Feature sequence497 721 23 gene locus_tag LOCUS_19450 721 23 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 protein_id gnl|my_center|LOCUS_19450 1265 819 gene locus_tag LOCUS_19460 1265 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence498 >Feature sequence499 167 1051 gene locus_tag LOCUS_19470 167 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384915.1 protein_id gnl|my_center|LOCUS_19470 <1657 1052 gene locus_tag LOCUS_19480 <1657 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969966.1:D-glycerate dehydrogenase >Feature sequence500 996 1080 gene locus_tag LOCUS_t00310 996 1080 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence501 29 1012 gene locus_tag LOCUS_19490 gene lpxK 29 1012 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336758.1 protein_id gnl|my_center|LOCUS_19490 <1643 1004 gene locus_tag LOCUS_19500 <1643 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003713.1:PBP1A family penicillin-binding protein >Feature sequence502 1495 506 gene locus_tag LOCUS_19510 1495 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence503 922 467 gene locus_tag LOCUS_19520 922 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 <1638 969 gene locus_tag LOCUS_19530 <1638 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530942.1:hydantoinase B/oxoprolinase family protein >Feature sequence504 1150 203 gene locus_tag LOCUS_19540 1150 203 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence505 <1633 953 gene locus_tag LOCUS_19550 <1633 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061434.1:glycerol kinase GlpK >Feature sequence506 <1 863 gene locus_tag LOCUS_19560 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_182574366.1:DUF4147 domain-containing protein 917 1486 gene locus_tag LOCUS_19570 917 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence507 450 1301 gene locus_tag LOCUS_19580 450 1301 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140016.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence508 <1607 113 gene locus_tag LOCUS_19590 <1607 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140063.1:aconitate hydratase AcnA >Feature sequence509 1359 664 gene locus_tag LOCUS_19600 gene narI 1359 664 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence510 <1598 86 gene locus_tag LOCUS_19610 <1598 86 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337536.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence511 3 986 gene locus_tag LOCUS_19620 3 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 993 1274 gene locus_tag LOCUS_19630 993 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence512 >Feature sequence513 146 793 gene locus_tag LOCUS_19640 gene eda 146 793 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719793.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence514 >Feature sequence515 <1589 433 gene locus_tag LOCUS_19650 <1589 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721917.1:chromosomal replication initiator protein DnaA >Feature sequence516 >Feature sequence517 <1 986 gene locus_tag LOCUS_19660 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720117.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence518 1351 380 gene locus_tag LOCUS_19670 gene zntB 1351 380 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366313.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence519 >Feature sequence520 <1 880 gene locus_tag LOCUS_19680 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338892.1:DNA polymerase III subunit beta >Feature sequence521 <1 552 gene locus_tag LOCUS_19690 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339449.1:tRNA 2-selenouridine(34) synthase MnmH <1555 697 gene locus_tag LOCUS_19700 <1555 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551284.1:selenide, water dikinase SelD >Feature sequence522 <1 644 gene locus_tag LOCUS_19710 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720078.1:GlxA family transcriptional regulator >Feature sequence523 <1 540 gene locus_tag LOCUS_19720 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083176.1:MBL fold metallo-hydrolase >Feature sequence524 459 977 gene locus_tag LOCUS_19730 gene mobB 459 977 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531704.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence525 <1 965 gene locus_tag LOCUS_19740 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385507.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence526 1156 242 gene locus_tag LOCUS_19750 1156 242 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140202.1 protein_id gnl|my_center|LOCUS_19750 1476 1171 gene locus_tag LOCUS_19760 1476 1171 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence527 1349 573 gene locus_tag LOCUS_19770 gene paaG 1349 573 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence528 <1501 106 gene locus_tag LOCUS_19780 <1501 106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337230.1:UvrD-helicase domain-containing protein