>Feature sequence001 701 141 gene locus_tag LOCUS_00010 701 141 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 protein_id gnl|my_center|LOCUS_00010 990 1187 gene locus_tag LOCUS_00020 990 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2989 1193 gene locus_tag LOCUS_00030 2989 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6022 3509 gene locus_tag LOCUS_00040 6022 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7230 6352 gene locus_tag LOCUS_00050 gene galU 7230 6352 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_00050 7467 11288 gene locus_tag LOCUS_00060 gene hrpA 7467 11288 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_00060 11569 11309 gene locus_tag LOCUS_00070 11569 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11921 13234 gene locus_tag LOCUS_00080 11921 13234 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941598.1 transl_except (pos:12488..12490,aa:Sec) note codon on position 190 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00080 13643 13320 gene locus_tag LOCUS_00090 13643 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14455 13784 gene locus_tag LOCUS_00100 14455 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16224 14452 gene locus_tag LOCUS_00110 16224 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16681 17286 gene locus_tag LOCUS_00120 gene fadR 16681 17286 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_00120 17784 17299 gene locus_tag LOCUS_00130 gene greA 17784 17299 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_00130 19313 17970 gene locus_tag LOCUS_00140 19313 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20512 19328 gene locus_tag LOCUS_00150 20512 19328 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_00150 21511 20561 gene locus_tag LOCUS_00160 21511 20561 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_00160 21914 23635 gene locus_tag LOCUS_00170 gene lepA 21914 23635 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334775.1 protein_id gnl|my_center|LOCUS_00170 24232 23957 gene locus_tag LOCUS_00180 24232 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24928 24341 gene locus_tag LOCUS_00190 gene yihA 24928 24341 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_00190 25830 24958 gene locus_tag LOCUS_00200 gene hisG 25830 24958 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_00200 26501 25938 gene locus_tag LOCUS_00210 26501 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26665 27105 gene locus_tag LOCUS_00220 26665 27105 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868968.1 protein_id gnl|my_center|LOCUS_00220 27435 30317 gene locus_tag LOCUS_00230 27435 30317 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_00230 30402 32048 gene locus_tag LOCUS_00240 30402 32048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32098 34254 gene locus_tag LOCUS_00250 32098 34254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34298 34777 gene locus_tag LOCUS_00260 34298 34777 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_00260 35018 36169 gene locus_tag LOCUS_00270 gene cheB 35018 36169 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_00270 36245 37081 gene locus_tag LOCUS_00280 36245 37081 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_00280 37136 37705 gene locus_tag LOCUS_00290 37136 37705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37757 38152 gene locus_tag LOCUS_00300 37757 38152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38306 38716 gene locus_tag LOCUS_00310 38306 38716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38753 38992 gene locus_tag LOCUS_00320 38753 38992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00320 39006 39989 gene locus_tag LOCUS_00330 39006 39989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40252 40713 gene locus_tag LOCUS_00340 gene rplI 40252 40713 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_00340 40893 42284 gene locus_tag LOCUS_00350 gene dnaB 40893 42284 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_00350 42364 44853 gene locus_tag LOCUS_00360 gene leuS 42364 44853 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_00360 44895 45452 gene locus_tag LOCUS_00370 44895 45452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47501 45570 gene locus_tag LOCUS_00380 47501 45570 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_00380 47833 48774 gene locus_tag LOCUS_00390 gene dusB 47833 48774 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_00390 48777 49202 gene locus_tag LOCUS_00400 gene arfB 48777 49202 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212154.1 protein_id gnl|my_center|LOCUS_00400 50947 49199 gene locus_tag LOCUS_00410 50947 49199 CDS product aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792756.1 protein_id gnl|my_center|LOCUS_00410 51372 50944 gene locus_tag LOCUS_00420 51372 50944 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792757.1 protein_id gnl|my_center|LOCUS_00420 51774 52373 gene locus_tag LOCUS_00430 51774 52373 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932180.1 protein_id gnl|my_center|LOCUS_00430 52374 54587 gene locus_tag LOCUS_00440 52374 54587 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_00440 54648 55454 gene locus_tag LOCUS_00450 54648 55454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 55901 55467 gene locus_tag LOCUS_00460 55901 55467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55990 56850 gene locus_tag LOCUS_00470 55990 56850 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_00470 57027 57962 gene locus_tag LOCUS_00480 57027 57962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58237 61749 gene locus_tag LOCUS_00490 gene dnaE 58237 61749 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_00490 62286 62795 gene locus_tag LOCUS_00500 62286 62795 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_00500 63547 63017 gene locus_tag LOCUS_00510 63547 63017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 65037 63595 gene locus_tag LOCUS_00520 gene hslU 65037 63595 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938760.1 protein_id gnl|my_center|LOCUS_00520 65606 65034 gene locus_tag LOCUS_00530 gene hslV 65606 65034 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_00530 66625 65630 gene locus_tag LOCUS_00540 gene xerC 66625 65630 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_00540 66753 66995 gene locus_tag LOCUS_00550 gene xseB 66753 66995 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393512.1 protein_id gnl|my_center|LOCUS_00550 67050 68954 gene locus_tag LOCUS_00560 gene dxs 67050 68954 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_00560 70341 69331 gene locus_tag LOCUS_00570 70341 69331 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_00570 71768 70488 gene locus_tag LOCUS_00580 71768 70488 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_00580 72074 71781 gene locus_tag LOCUS_00590 72074 71781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 72562 72338 gene locus_tag LOCUS_00600 72562 72338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 72775 74142 gene locus_tag LOCUS_00610 72775 74142 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_00610 74166 75866 gene locus_tag LOCUS_00620 74166 75866 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_00620 <76563 75847 gene locus_tag LOCUS_00630 <76563 75847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943723.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence002 1192 2304 gene locus_tag LOCUS_00640 1192 2304 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391456.1 protein_id gnl|my_center|LOCUS_00640 2528 2316 gene locus_tag LOCUS_00650 2528 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 5244 2563 gene locus_tag LOCUS_00660 5244 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 7404 5350 gene locus_tag LOCUS_00670 7404 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 9200 7593 gene locus_tag LOCUS_00680 9200 7593 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021821499.1 protein_id gnl|my_center|LOCUS_00680 11280 9460 gene locus_tag LOCUS_00690 gene uvrC 11280 9460 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_00690 12946 11318 gene locus_tag LOCUS_00700 12946 11318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_00700 13155 14570 gene locus_tag LOCUS_00710 13155 14570 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_00710 14722 15150 gene locus_tag LOCUS_00720 14722 15150 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_00720 16282 15272 gene locus_tag LOCUS_00730 gene hypE 16282 15272 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_00730 17437 16349 gene locus_tag LOCUS_00740 gene hypD 17437 16349 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_00740 17706 17434 gene locus_tag LOCUS_00750 17706 17434 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_00750 20165 17724 gene locus_tag LOCUS_00760 gene hypF 20165 17724 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_00760 20596 21117 gene locus_tag LOCUS_00770 gene frhD 20596 21117 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869751.1 protein_id gnl|my_center|LOCUS_00770 21114 22040 gene locus_tag LOCUS_00780 21114 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00780 22071 22592 gene locus_tag LOCUS_00790 22071 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00790 22606 22788 gene locus_tag LOCUS_00800 22606 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00800 22840 25665 gene locus_tag LOCUS_00810 22840 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00810 25709 25906 gene locus_tag LOCUS_00820 25709 25906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 25949 26134 gene locus_tag LOCUS_00830 25949 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26145 27074 gene locus_tag LOCUS_00840 gene mvhG 26145 27074 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_00840 27089 28438 gene locus_tag LOCUS_00850 27089 28438 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870705.1 protein_id gnl|my_center|LOCUS_00850 28583 28837 gene locus_tag LOCUS_00860 28583 28837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 29081 31315 gene locus_tag LOCUS_00870 29081 31315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 31528 32616 gene locus_tag LOCUS_00880 31528 32616 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941447.1 protein_id gnl|my_center|LOCUS_00880 32644 34344 gene locus_tag LOCUS_00890 32644 34344 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_00890 34393 35034 gene locus_tag LOCUS_00900 gene cybH 34393 35034 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_00900 35086 35592 gene locus_tag LOCUS_00910 35086 35592 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_00910 35585 35830 gene locus_tag LOCUS_00920 35585 35830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 35881 36591 gene locus_tag LOCUS_00930 gene hypB 35881 36591 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_00930 38281 36899 gene locus_tag LOCUS_00940 38281 36899 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_00940 38433 39005 gene locus_tag LOCUS_00950 gene tadA 38433 39005 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_00950 39120 39205 gene locus_tag LOCUS_t00010 39120 39205 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 39521 41374 gene locus_tag LOCUS_00960 gene dnaX 39521 41374 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_00960 41441 41749 gene locus_tag LOCUS_00970 41441 41749 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_00970 41756 42361 gene locus_tag LOCUS_00980 gene recR 41756 42361 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_00980 42634 43080 gene locus_tag LOCUS_00990 gene ndk 42634 43080 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_00990 43858 43211 gene locus_tag LOCUS_01000 43858 43211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 45944 43875 gene locus_tag LOCUS_01010 45944 43875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 46998 47138 gene locus_tag LOCUS_01020 46998 47138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 48290 47529 gene locus_tag LOCUS_01030 48290 47529 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_01030 50176 48287 gene locus_tag LOCUS_01040 50176 48287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 52254 50176 gene locus_tag LOCUS_01050 52254 50176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 <53222 52257 gene locus_tag LOCUS_01060 <53222 52257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787921.1:VWA domain-containing protein >Feature sequence003 2077 692 gene locus_tag LOCUS_01070 2077 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2709 2086 gene locus_tag LOCUS_01080 2709 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3146 2706 gene locus_tag LOCUS_01090 3146 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 4531 3143 gene locus_tag LOCUS_01100 4531 3143 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_01100 5321 4563 gene locus_tag LOCUS_01110 5321 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6312 5308 gene locus_tag LOCUS_01120 gene fliG 6312 5308 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_01120 8022 6382 gene locus_tag LOCUS_01130 gene fliF 8022 6382 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_01130 8448 8152 gene locus_tag LOCUS_01140 8448 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8897 8454 gene locus_tag LOCUS_01150 gene flgC 8897 8454 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_01150 9420 9010 gene locus_tag LOCUS_01160 gene flgB 9420 9010 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_01160 11923 9455 gene locus_tag LOCUS_01170 11923 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 12262 13992 gene locus_tag LOCUS_01180 12262 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 14125 14496 gene locus_tag LOCUS_01190 14125 14496 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_01190 14600 15067 gene locus_tag LOCUS_01200 14600 15067 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_01200 15313 15771 gene locus_tag LOCUS_01210 15313 15771 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_01210 15956 17857 gene locus_tag LOCUS_01220 15956 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 18952 17924 gene locus_tag LOCUS_01230 18952 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 19506 19003 gene locus_tag LOCUS_01240 19506 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 19669 20223 gene locus_tag LOCUS_01250 19669 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 21692 20331 gene locus_tag LOCUS_01260 21692 20331 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_01260 23482 21689 gene locus_tag LOCUS_01270 gene ftsH 23482 21689 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_01270 24689 25882 gene locus_tag LOCUS_01280 gene nrfD 24689 25882 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762020.1 protein_id gnl|my_center|LOCUS_01280 25959 26402 gene locus_tag LOCUS_01290 25959 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 29367 26965 gene locus_tag LOCUS_01300 29367 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 29803 30558 gene locus_tag LOCUS_01310 gene ttrB 29803 30558 CDS product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 protein_id gnl|my_center|LOCUS_01310 30660 31352 gene locus_tag LOCUS_01320 30660 31352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 32236 32466 gene locus_tag LOCUS_01330 32236 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 32525 33709 gene locus_tag LOCUS_01340 gene nrfD 32525 33709 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762020.1 protein_id gnl|my_center|LOCUS_01340 33787 34155 gene locus_tag LOCUS_01350 33787 34155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 34476 35456 gene locus_tag LOCUS_01360 34476 35456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 35574 35846 gene locus_tag LOCUS_01370 gene rpsT 35574 35846 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_01370 35997 37451 gene locus_tag LOCUS_01380 gene trpE 35997 37451 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_01380 37595 38221 gene locus_tag LOCUS_01390 37595 38221 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_01390 38310 39347 gene locus_tag LOCUS_01400 gene trpD 38310 39347 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_01400 39344 40114 gene locus_tag LOCUS_01410 gene trpC 39344 40114 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_01410 40111 40776 gene locus_tag LOCUS_01420 40111 40776 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_01420 41566 40802 gene locus_tag LOCUS_01430 41566 40802 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_01430 43050 41563 gene locus_tag LOCUS_01440 43050 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 43127 43203 gene locus_tag LOCUS_t00020 43127 43203 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43279 43288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44098 43571 gene locus_tag LOCUS_01450 44098 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 <45171 44304 gene locus_tag LOCUS_01460 <45171 44304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015445522.1:three-Cys-motif partner protein TcmP >Feature sequence004 405 779 gene locus_tag LOCUS_01470 gene nuoA 405 779 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_01470 767 1288 gene locus_tag LOCUS_01480 767 1288 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545381.1 protein_id gnl|my_center|LOCUS_01480 1270 1857 gene locus_tag LOCUS_01490 1270 1857 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_01490 1854 3080 gene locus_tag LOCUS_01500 gene nuoD 1854 3080 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545955.1 protein_id gnl|my_center|LOCUS_01500 3218 4186 gene locus_tag LOCUS_01510 gene nuoH 3218 4186 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546488.1 protein_id gnl|my_center|LOCUS_01510 4200 4811 gene locus_tag LOCUS_01520 gene nuoI 4200 4811 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546584.1 protein_id gnl|my_center|LOCUS_01520 4817 5389 gene locus_tag LOCUS_01530 4817 5389 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546215.1 protein_id gnl|my_center|LOCUS_01530 5386 5688 gene locus_tag LOCUS_01540 gene nuoK 5386 5688 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719678.1 protein_id gnl|my_center|LOCUS_01540 5691 7610 gene locus_tag LOCUS_01550 gene nuoL 5691 7610 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_01550 7684 9195 gene locus_tag LOCUS_01560 7684 9195 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_01560 9248 10690 gene locus_tag LOCUS_01570 9248 10690 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_01570 11563 10859 gene locus_tag LOCUS_01580 gene cmk 11563 10859 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 protein_id gnl|my_center|LOCUS_01580 12668 11550 gene locus_tag LOCUS_01590 gene hisC 12668 11550 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_01590 14423 12966 gene locus_tag LOCUS_01600 gene gatA 14423 12966 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_01600 14891 14604 gene locus_tag LOCUS_01610 gene gatC 14891 14604 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_01610 16023 14968 gene locus_tag LOCUS_01620 16023 14968 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_01620 17336 16278 gene locus_tag LOCUS_01630 17336 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17938 17342 gene locus_tag LOCUS_01640 17938 17342 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_01640 19344 18073 gene locus_tag LOCUS_01650 19344 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 19749 20006 gene locus_tag LOCUS_01660 19749 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 20047 20379 gene locus_tag LOCUS_01670 20047 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 20390 20737 gene locus_tag LOCUS_01680 20390 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 20753 20944 gene locus_tag LOCUS_01690 20753 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 21524 21072 gene locus_tag LOCUS_01700 21524 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 21465 21848 gene locus_tag LOCUS_01710 21465 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 22489 23622 gene locus_tag LOCUS_01720 gene dnaN 22489 23622 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_01720 23823 24263 gene locus_tag LOCUS_01730 23823 24263 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_01730 24605 24847 gene locus_tag LOCUS_01740 24605 24847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 24996 27407 gene locus_tag LOCUS_01750 gene gyrB 24996 27407 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_01750 27501 29990 gene locus_tag LOCUS_01760 gene gyrA 27501 29990 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_01760 29971 31002 gene locus_tag LOCUS_01770 29971 31002 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_01770 31720 31058 gene locus_tag LOCUS_01780 31720 31058 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_01780 32456 31905 gene locus_tag LOCUS_01790 32456 31905 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_01790 34027 32456 gene locus_tag LOCUS_01800 34027 32456 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_01800 34092 34177 gene locus_tag LOCUS_t00030 34092 34177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34196 34288 gene locus_tag LOCUS_t00040 34196 34288 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34818 34363 gene locus_tag LOCUS_01810 34818 34363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 35818 34910 gene locus_tag LOCUS_01820 35818 34910 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_01820 35972 35823 gene locus_tag LOCUS_01830 35972 35823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 36280 35969 gene locus_tag LOCUS_01840 36280 35969 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927166.1 protein_id gnl|my_center|LOCUS_01840 36402 36581 gene locus_tag LOCUS_01850 36402 36581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 37411 36533 gene locus_tag LOCUS_01860 37411 36533 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_01860 38191 37415 gene locus_tag LOCUS_01870 38191 37415 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_01870 38322 39947 gene locus_tag LOCUS_01880 gene nadB 38322 39947 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_01880 40449 40372 gene locus_tag LOCUS_t00050 40449 40372 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 40544 40469 gene locus_tag LOCUS_t00060 40544 40469 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 40849 41427 gene locus_tag LOCUS_01890 gene rdgC 40849 41427 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_01890 41603 42142 gene locus_tag LOCUS_01900 41603 42142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_01900 42196 43617 gene locus_tag LOCUS_01910 gene gatB 42196 43617 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_01910 43710 44447 gene locus_tag LOCUS_01920 gene radC 43710 44447 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203904.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence005 387 1430 gene locus_tag LOCUS_01930 gene moaA 387 1430 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_01930 1937 2137 gene locus_tag LOCUS_01940 1937 2137 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_01940 4255 2411 gene locus_tag LOCUS_01950 4255 2411 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_01950 5372 4269 gene locus_tag LOCUS_01960 gene pheA 5372 4269 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_01960 5867 7066 gene locus_tag LOCUS_01970 5867 7066 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_01970 7063 7905 gene locus_tag LOCUS_01980 gene larE 7063 7905 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_01980 8093 8365 gene locus_tag LOCUS_01990 8093 8365 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_01990 8506 8582 gene locus_tag LOCUS_t00070 8506 8582 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8789 10075 gene locus_tag LOCUS_02000 8789 10075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117040.1 protein_id gnl|my_center|LOCUS_02000 10206 11267 gene locus_tag LOCUS_02010 gene msrB 10206 11267 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796156.1 protein_id gnl|my_center|LOCUS_02010 11760 11287 gene locus_tag LOCUS_02020 11760 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12332 11766 gene locus_tag LOCUS_02030 12332 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 12428 13024 gene locus_tag LOCUS_02040 12428 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 13017 13556 gene locus_tag LOCUS_02050 gene cobO 13017 13556 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530100.1 protein_id gnl|my_center|LOCUS_02050 13783 16593 gene locus_tag LOCUS_02060 gene ileS 13783 16593 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_02060 16597 17079 gene locus_tag LOCUS_02070 gene lspA 16597 17079 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_02070 17318 18280 gene locus_tag LOCUS_02080 gene fabD 17318 18280 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_02080 18399 19778 gene locus_tag LOCUS_02090 gene ffh 18399 19778 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_02090 19916 20173 gene locus_tag LOCUS_02100 gene rpsP 19916 20173 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_02100 20173 20403 gene locus_tag LOCUS_02110 20173 20403 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_02110 20425 20952 gene locus_tag LOCUS_02120 gene rimM 20425 20952 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_02120 20958 21728 gene locus_tag LOCUS_02130 gene trmD 20958 21728 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_02130 21721 22275 gene locus_tag LOCUS_02140 21721 22275 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 protein_id gnl|my_center|LOCUS_02140 22454 22801 gene locus_tag LOCUS_02150 gene rplS 22454 22801 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_02150 22849 23598 gene locus_tag LOCUS_02160 gene rnhB 22849 23598 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 protein_id gnl|my_center|LOCUS_02160 23606 23992 gene locus_tag LOCUS_02170 23606 23992 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_02170 23989 25062 gene locus_tag LOCUS_02180 gene pdxA 23989 25062 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_02180 25059 25679 gene locus_tag LOCUS_02190 25059 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 25667 27394 gene locus_tag LOCUS_02200 25667 27394 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_02200 27391 28305 gene locus_tag LOCUS_02210 27391 28305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 29495 28503 gene locus_tag LOCUS_02220 29495 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 29739 32309 gene locus_tag LOCUS_02230 29739 32309 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_02230 32489 33850 gene locus_tag LOCUS_02240 32489 33850 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_02240 33868 35157 gene locus_tag LOCUS_02250 gene dacB 33868 35157 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 protein_id gnl|my_center|LOCUS_02250 35210 35506 gene locus_tag LOCUS_02260 35210 35506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 35647 35898 gene locus_tag LOCUS_02270 35647 35898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 36209 36000 gene locus_tag LOCUS_02280 36209 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 36425 37453 gene locus_tag LOCUS_02290 36425 37453 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_02290 37444 38109 gene locus_tag LOCUS_02300 37444 38109 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392650.1 protein_id gnl|my_center|LOCUS_02300 38106 40223 gene locus_tag LOCUS_02310 38106 40223 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_02310 40233 42113 gene locus_tag LOCUS_02320 40233 42113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 42577 42110 gene locus_tag LOCUS_02330 42577 42110 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_02330 42891 42592 gene locus_tag LOCUS_02340 42891 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence006 420 1292 gene locus_tag LOCUS_02350 420 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1661 1927 gene locus_tag LOCUS_02360 1661 1927 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_02360 2100 3326 gene locus_tag LOCUS_02370 2100 3326 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_02370 3463 3663 gene locus_tag LOCUS_02380 gene cspC 3463 3663 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_02380 4106 5233 gene locus_tag LOCUS_02390 4106 5233 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_02390 5313 5238 gene locus_tag LOCUS_t00080 5313 5238 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5985 5398 gene locus_tag LOCUS_02400 5985 5398 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158843.1 protein_id gnl|my_center|LOCUS_02400 6042 6293 gene locus_tag LOCUS_02410 6042 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6751 6290 gene locus_tag LOCUS_02420 6751 6290 CDS product DUF5662 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116181623.1 protein_id gnl|my_center|LOCUS_02420 7116 6814 gene locus_tag LOCUS_02430 7116 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7520 7113 gene locus_tag LOCUS_02440 7520 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015694.1 protein_id gnl|my_center|LOCUS_02440 7920 7696 gene locus_tag LOCUS_02450 7920 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9187 7946 gene locus_tag LOCUS_02460 gene tnpB 9187 7946 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888231.1 protein_id gnl|my_center|LOCUS_02460 9803 9171 gene locus_tag LOCUS_02470 9803 9171 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_02470 10074 9862 gene locus_tag LOCUS_02480 10074 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10385 10071 gene locus_tag LOCUS_02490 10385 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10897 10382 gene locus_tag LOCUS_02500 10897 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 13458 10894 gene locus_tag LOCUS_02510 13458 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 13730 13458 gene locus_tag LOCUS_02520 13730 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 15511 13718 gene locus_tag LOCUS_02530 15511 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 16307 15504 gene locus_tag LOCUS_02540 16307 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 17097 16297 gene locus_tag LOCUS_02550 17097 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 18108 17104 gene locus_tag LOCUS_02560 18108 17104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 18463 18110 gene locus_tag LOCUS_02570 18463 18110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 21591 18460 gene locus_tag LOCUS_02580 21591 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 21657 21908 gene locus_tag LOCUS_02590 21657 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 22298 21987 gene locus_tag LOCUS_02600 22298 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 23047 22298 gene locus_tag LOCUS_02610 23047 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071003.1 protein_id gnl|my_center|LOCUS_02610 23502 23062 gene locus_tag LOCUS_02620 23502 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 24131 23499 gene locus_tag LOCUS_02630 24131 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 24472 24128 gene locus_tag LOCUS_02640 24472 24128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 25470 24472 gene locus_tag LOCUS_02650 25470 24472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 25908 25522 gene locus_tag LOCUS_02660 25908 25522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 27296 25920 gene locus_tag LOCUS_02670 27296 25920 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190275052.1 protein_id gnl|my_center|LOCUS_02670 28821 27283 gene locus_tag LOCUS_02680 28821 27283 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939448.1 protein_id gnl|my_center|LOCUS_02680 29042 28818 gene locus_tag LOCUS_02690 29042 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29385 29558 gene locus_tag LOCUS_02700 29385 29558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 29530 30096 gene locus_tag LOCUS_02710 29530 30096 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766601.1 protein_id gnl|my_center|LOCUS_02710 30434 30120 gene locus_tag LOCUS_02720 30434 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 30670 30434 gene locus_tag LOCUS_02730 30670 30434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 30869 30639 gene locus_tag LOCUS_02740 30869 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 31657 30866 gene locus_tag LOCUS_02750 31657 30866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 32253 31729 gene locus_tag LOCUS_02760 32253 31729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 32437 32234 gene locus_tag LOCUS_02770 32437 32234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 34491 32440 gene locus_tag LOCUS_02780 34491 32440 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_02780 35153 34491 gene locus_tag LOCUS_02790 35153 34491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 35576 35157 gene locus_tag LOCUS_02800 35576 35157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 35900 35595 gene locus_tag LOCUS_02810 35900 35595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 36180 35902 gene locus_tag LOCUS_02820 36180 35902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 37562 36165 gene locus_tag LOCUS_02830 gene dnaB 37562 36165 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_02830 38818 37559 gene locus_tag LOCUS_02840 38818 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 39126 38833 gene locus_tag LOCUS_02850 39126 38833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 39508 39275 gene locus_tag LOCUS_02860 39508 39275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 39577 40614 gene locus_tag LOCUS_02870 39577 40614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 40774 40586 gene locus_tag LOCUS_02880 40774 40586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 41161 41012 gene locus_tag LOCUS_02890 41161 41012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 41349 41128 gene locus_tag LOCUS_02900 41349 41128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 41710 41501 gene locus_tag LOCUS_02910 41710 41501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 41977 41714 gene locus_tag LOCUS_02920 41977 41714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 42186 41974 gene locus_tag LOCUS_02930 42186 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 42295 42621 gene locus_tag LOCUS_02940 42295 42621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence007 497 288 gene locus_tag LOCUS_02950 497 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1297 560 gene locus_tag LOCUS_02960 gene fabG 1297 560 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_02960 2763 1357 gene locus_tag LOCUS_02970 2763 1357 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_02970 4315 2861 gene locus_tag LOCUS_02980 4315 2861 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_02980 4572 4321 gene locus_tag LOCUS_02990 4572 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5899 4649 gene locus_tag LOCUS_03000 5899 4649 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_03000 8556 5896 gene locus_tag LOCUS_03010 gene alaS 8556 5896 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_03010 9302 8745 gene locus_tag LOCUS_03020 9302 8745 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_03020 11359 9590 gene locus_tag LOCUS_03030 11359 9590 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_03030 11632 11375 gene locus_tag LOCUS_03040 11632 11375 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_03040 12674 11964 gene locus_tag LOCUS_03050 12674 11964 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546015.1 protein_id gnl|my_center|LOCUS_03050 14678 12744 gene locus_tag LOCUS_03060 14678 12744 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_03060 16775 14790 gene locus_tag LOCUS_03070 gene acs 16775 14790 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940228.1 protein_id gnl|my_center|LOCUS_03070 17020 17520 gene locus_tag LOCUS_03080 17020 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 17798 18097 gene locus_tag LOCUS_03090 17798 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 18351 20969 gene locus_tag LOCUS_03100 18351 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 20999 21790 gene locus_tag LOCUS_03110 20999 21790 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_03110 21797 23086 gene locus_tag LOCUS_03120 21797 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_03120 23337 23552 gene locus_tag LOCUS_03130 23337 23552 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_03130 23729 27001 gene locus_tag LOCUS_03140 23729 27001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 30013 27044 gene locus_tag LOCUS_03150 30013 27044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34281 30022 gene locus_tag LOCUS_03160 34281 30022 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_03160 34876 34412 gene locus_tag LOCUS_03170 34876 34412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 35553 34960 gene locus_tag LOCUS_03180 35553 34960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_03180 38581 35696 gene locus_tag LOCUS_03190 38581 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 39683 38790 gene locus_tag LOCUS_03200 39683 38790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 40234 40004 gene locus_tag LOCUS_03210 40234 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 41226 40663 gene locus_tag LOCUS_03220 41226 40663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 41521 41327 gene locus_tag LOCUS_03230 41521 41327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 42151 41723 gene locus_tag LOCUS_03240 42151 41723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 >Feature sequence008 1238 486 gene locus_tag LOCUS_03250 1238 486 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_03250 2346 1342 gene locus_tag LOCUS_03260 gene gap 2346 1342 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 protein_id gnl|my_center|LOCUS_03260 3472 2564 gene locus_tag LOCUS_03270 3472 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5190 3514 gene locus_tag LOCUS_03280 gene glgA 5190 3514 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707514.1 protein_id gnl|my_center|LOCUS_03280 6292 5213 gene locus_tag LOCUS_03290 gene aroC 6292 5213 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_03290 7033 6398 gene locus_tag LOCUS_03300 gene aroL 7033 6398 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816919.1 protein_id gnl|my_center|LOCUS_03300 7255 8217 gene locus_tag LOCUS_03310 7255 8217 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_03310 8221 8523 gene locus_tag LOCUS_03320 8221 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8535 9884 gene locus_tag LOCUS_03330 8535 9884 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161429162.1 protein_id gnl|my_center|LOCUS_03330 9920 10366 gene locus_tag LOCUS_03340 9920 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 10387 10788 gene locus_tag LOCUS_03350 10387 10788 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_03350 10790 11023 gene locus_tag LOCUS_03360 10790 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 11134 12906 gene locus_tag LOCUS_03370 11134 12906 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695320.1 protein_id gnl|my_center|LOCUS_03370 12962 13708 gene locus_tag LOCUS_03380 12962 13708 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_03380 13917 14204 gene locus_tag LOCUS_03390 13917 14204 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_03390 15563 14223 gene locus_tag LOCUS_03400 gene rimO 15563 14223 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_03400 16356 15586 gene locus_tag LOCUS_03410 16356 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 16725 16465 gene locus_tag LOCUS_03420 16725 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 17542 16820 gene locus_tag LOCUS_03430 17542 16820 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_03430 18010 17546 gene locus_tag LOCUS_03440 18010 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 18240 18007 gene locus_tag LOCUS_03450 18240 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 19697 18405 gene locus_tag LOCUS_03460 gene hemL 19697 18405 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_03460 20082 20411 gene locus_tag LOCUS_03470 gene trxA 20082 20411 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_03470 20705 21637 gene locus_tag LOCUS_03480 gene trxB 20705 21637 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_03480 21692 22543 gene locus_tag LOCUS_03490 21692 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 23071 22634 gene locus_tag LOCUS_03500 23071 22634 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_03500 23709 23149 gene locus_tag LOCUS_03510 23709 23149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 24733 23723 gene locus_tag LOCUS_03520 24733 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03520 24869 25657 gene locus_tag LOCUS_03530 gene larB 24869 25657 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_03530 25938 28502 gene locus_tag LOCUS_03540 25938 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 28506 29234 gene locus_tag LOCUS_03550 28506 29234 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_03550 29235 29906 gene locus_tag LOCUS_03560 29235 29906 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_03560 29984 30634 gene locus_tag LOCUS_03570 29984 30634 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_03570 30943 32469 gene locus_tag LOCUS_03580 30943 32469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 33109 32489 gene locus_tag LOCUS_03590 33109 32489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 33349 35715 gene locus_tag LOCUS_03600 33349 35715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 35957 35709 gene locus_tag LOCUS_03610 35957 35709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 36168 35959 gene locus_tag LOCUS_03620 36168 35959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 37213 36242 gene locus_tag LOCUS_03630 37213 36242 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_03630 38450 37446 gene locus_tag LOCUS_03640 38450 37446 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_03640 39263 38505 gene locus_tag LOCUS_03650 39263 38505 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_03650 39585 39340 gene locus_tag LOCUS_03660 39585 39340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 <40669 39662 gene locus_tag LOCUS_03670 <40669 39662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393106.1:dissimilatory-type sulfite reductase subunit beta >Feature sequence009 1505 537 gene locus_tag LOCUS_03680 1505 537 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_03680 2399 1512 gene locus_tag LOCUS_03690 2399 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_03690 3055 2522 gene locus_tag LOCUS_03700 3055 2522 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_03700 5176 3098 gene locus_tag LOCUS_03710 gene glgX 5176 3098 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_03710 5359 6309 gene locus_tag LOCUS_03720 5359 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6393 6767 gene locus_tag LOCUS_03730 6393 6767 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933714.1 protein_id gnl|my_center|LOCUS_03730 7891 6857 gene locus_tag LOCUS_03740 7891 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8149 9897 gene locus_tag LOCUS_03750 8149 9897 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_03750 9950 11200 gene locus_tag LOCUS_03760 9950 11200 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_03760 11941 11321 gene locus_tag LOCUS_03770 11941 11321 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_03770 14796 12100 gene locus_tag LOCUS_03780 14796 12100 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_03780 15478 14846 gene locus_tag LOCUS_03790 15478 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 16398 15499 gene locus_tag LOCUS_03800 16398 15499 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_03800 16628 16703 gene locus_tag LOCUS_t00090 16628 16703 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16914 17384 gene locus_tag LOCUS_03810 gene rimP 16914 17384 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_03810 17545 19056 gene locus_tag LOCUS_03820 gene nusA 17545 19056 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_03820 19340 22102 gene locus_tag LOCUS_03830 19340 22102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 22336 22737 gene locus_tag LOCUS_03840 gene rbfA 22336 22737 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775329.1 protein_id gnl|my_center|LOCUS_03840 22721 23713 gene locus_tag LOCUS_03850 22721 23713 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_03850 23716 24468 gene locus_tag LOCUS_03860 23716 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 25045 25314 gene locus_tag LOCUS_03870 gene rpsO 25045 25314 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_03870 25559 27643 gene locus_tag LOCUS_03880 gene pnp 25559 27643 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_03880 30167 27762 gene locus_tag LOCUS_03890 30167 27762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 31378 30164 gene locus_tag LOCUS_03900 31378 30164 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_03900 33085 31460 gene locus_tag LOCUS_03910 33085 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 33552 33965 gene locus_tag LOCUS_03920 gene dut 33552 33965 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_03920 33962 34738 gene locus_tag LOCUS_03930 33962 34738 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence010 828 1514 gene locus_tag LOCUS_03940 828 1514 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_03940 1750 5289 gene locus_tag LOCUS_03950 gene nifJ 1750 5289 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_03950 6459 5476 gene locus_tag LOCUS_03960 6459 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6854 7051 gene locus_tag LOCUS_03970 6854 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7197 7976 gene locus_tag LOCUS_03980 7197 7976 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_03980 8226 8606 gene locus_tag LOCUS_03990 8226 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 10314 8683 gene locus_tag LOCUS_04000 10314 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 12125 10389 gene locus_tag LOCUS_04010 12125 10389 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_04010 12576 12226 gene locus_tag LOCUS_04020 12576 12226 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_04020 12972 12580 gene locus_tag LOCUS_04030 gene crcB 12972 12580 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_04030 14615 13065 gene locus_tag LOCUS_04040 14615 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14753 16159 gene locus_tag LOCUS_04050 14753 16159 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_04050 16419 16613 gene locus_tag LOCUS_04060 16419 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 16625 16924 gene locus_tag LOCUS_04070 16625 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 17027 18673 gene locus_tag LOCUS_04080 17027 18673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 18736 19110 gene locus_tag LOCUS_04090 18736 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 21718 19196 gene locus_tag LOCUS_04100 21718 19196 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937846.1 protein_id gnl|my_center|LOCUS_04100 22533 21733 gene locus_tag LOCUS_04110 gene fetB 22533 21733 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_04110 23180 22536 gene locus_tag LOCUS_04120 23180 22536 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_04120 24763 23180 gene locus_tag LOCUS_04130 24763 23180 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_04130 26638 24872 gene locus_tag LOCUS_04140 26638 24872 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_04140 28159 26948 gene locus_tag LOCUS_04150 gene ftsZ 28159 26948 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_04150 29512 28271 gene locus_tag LOCUS_04160 gene ftsA 29512 28271 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_04160 30334 29585 gene locus_tag LOCUS_04170 30334 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 31556 30621 gene locus_tag LOCUS_04180 gene murB 31556 30621 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_04180 32939 31560 gene locus_tag LOCUS_04190 gene murC 32939 31560 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_04190 34045 32948 gene locus_tag LOCUS_04200 gene murG 34045 32948 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_04200 34251 34030 gene locus_tag LOCUS_04210 34251 34030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence011 413 838 gene locus_tag LOCUS_04220 413 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 875 1297 gene locus_tag LOCUS_04230 875 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04230 1299 2342 gene locus_tag LOCUS_04240 1299 2342 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_04240 2349 3533 gene locus_tag LOCUS_04250 2349 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4494 3508 gene locus_tag LOCUS_04260 4494 3508 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_04260 4753 4840 gene locus_tag LOCUS_t00100 4753 4840 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5191 6360 gene locus_tag LOCUS_04270 5191 6360 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 protein_id gnl|my_center|LOCUS_04270 6377 6790 gene locus_tag LOCUS_04280 6377 6790 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496720.1 protein_id gnl|my_center|LOCUS_04280 6951 8426 gene locus_tag LOCUS_04290 6951 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 8405 9307 gene locus_tag LOCUS_04300 gene rsmI 8405 9307 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_04300 9618 11108 gene locus_tag LOCUS_04310 9618 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11140 12525 gene locus_tag LOCUS_04320 11140 12525 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_04320 15582 12544 gene locus_tag LOCUS_04330 15582 12544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 16620 15595 gene locus_tag LOCUS_04340 16620 15595 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_04340 17081 18547 gene locus_tag LOCUS_04350 gene zwf 17081 18547 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 protein_id gnl|my_center|LOCUS_04350 18582 19280 gene locus_tag LOCUS_04360 gene pgl 18582 19280 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_04360 19294 21150 gene locus_tag LOCUS_04370 gene edd 19294 21150 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069450.1 protein_id gnl|my_center|LOCUS_04370 21183 21827 gene locus_tag LOCUS_04380 21183 21827 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366001.1 protein_id gnl|my_center|LOCUS_04380 21865 22608 gene locus_tag LOCUS_04390 21865 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 22984 23403 gene locus_tag LOCUS_04400 22984 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 23400 25358 gene locus_tag LOCUS_04410 23400 25358 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_04410 25355 25825 gene locus_tag LOCUS_04420 25355 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 25822 26343 gene locus_tag LOCUS_04430 25822 26343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 26336 27055 gene locus_tag LOCUS_04440 26336 27055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_04440 27052 27720 gene locus_tag LOCUS_04450 27052 27720 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_04450 27760 28446 gene locus_tag LOCUS_04460 gene ccsA 27760 28446 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_04460 28443 28598 gene locus_tag LOCUS_04470 28443 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 28591 29163 gene locus_tag LOCUS_04480 28591 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 30865 29534 gene locus_tag LOCUS_04490 30865 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 31381 31947 gene locus_tag LOCUS_04500 31381 31947 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_04500 31963 32784 gene locus_tag LOCUS_04510 31963 32784 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_04510 32877 33779 gene locus_tag LOCUS_04520 32877 33779 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_04520 <34369 33776 gene locus_tag LOCUS_04530 <34369 33776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404064.1:M3 family oligoendopeptidase >Feature sequence012 2155 1709 gene locus_tag LOCUS_04540 gene fliW 2155 1709 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_04540 2394 2152 gene locus_tag LOCUS_04550 gene csrA 2394 2152 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_04550 2639 2418 gene locus_tag LOCUS_04560 2639 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3756 2800 gene locus_tag LOCUS_04570 gene flgL 3756 2800 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_04570 5298 3760 gene locus_tag LOCUS_04580 gene flgK 5298 3760 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_04580 5626 6078 gene locus_tag LOCUS_04590 5626 6078 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943742.1 protein_id gnl|my_center|LOCUS_04590 7588 6158 gene locus_tag LOCUS_04600 7588 6158 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356901.1 protein_id gnl|my_center|LOCUS_04600 8289 7585 gene locus_tag LOCUS_04610 8289 7585 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_04610 9179 8826 gene locus_tag LOCUS_04620 9179 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 9474 9184 gene locus_tag LOCUS_04630 9474 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 10127 9807 gene locus_tag LOCUS_04640 10127 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 11275 10139 gene locus_tag LOCUS_04650 11275 10139 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_04650 11992 11309 gene locus_tag LOCUS_04660 11992 11309 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_04660 12948 11995 gene locus_tag LOCUS_04670 12948 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 13740 12955 gene locus_tag LOCUS_04680 gene flgG 13740 12955 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_04680 14532 13801 gene locus_tag LOCUS_04690 gene flgF 14532 13801 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_04690 15135 14710 gene locus_tag LOCUS_04700 15135 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 15889 15155 gene locus_tag LOCUS_04710 15889 15155 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_04710 16831 15935 gene locus_tag LOCUS_04720 16831 15935 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_04720 18098 16824 gene locus_tag LOCUS_04730 gene flhF 18098 16824 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_04730 20187 18088 gene locus_tag LOCUS_04740 gene flhA 20187 18088 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_04740 21179 20187 gene locus_tag LOCUS_04750 gene flhB 21179 20187 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_04750 22243 21464 gene locus_tag LOCUS_04760 gene fliR 22243 21464 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_04760 22518 22249 gene locus_tag LOCUS_04770 gene fliQ 22518 22249 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_04770 24025 22523 gene locus_tag LOCUS_04780 24025 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 24371 24093 gene locus_tag LOCUS_04790 24371 24093 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_04790 25090 24371 gene locus_tag LOCUS_04800 25090 24371 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105585.1 protein_id gnl|my_center|LOCUS_04800 25485 27635 gene locus_tag LOCUS_04810 25485 27635 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269293.1 protein_id gnl|my_center|LOCUS_04810 28393 27650 gene locus_tag LOCUS_04820 gene fliP 28393 27650 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_04820 28752 28390 gene locus_tag LOCUS_04830 28752 28390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 29145 28756 gene locus_tag LOCUS_04840 29145 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 30151 29132 gene locus_tag LOCUS_04850 gene fliM 30151 29132 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941089.1 protein_id gnl|my_center|LOCUS_04850 30673 30155 gene locus_tag LOCUS_04860 30673 30155 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546721.1 protein_id gnl|my_center|LOCUS_04860 31446 30703 gene locus_tag LOCUS_04870 31446 30703 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence013 1150 443 gene locus_tag LOCUS_04880 1150 443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_04880 1970 1143 gene locus_tag LOCUS_04890 1970 1143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_04890 3293 2064 gene locus_tag LOCUS_04900 gene livM 3293 2064 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937855.1 protein_id gnl|my_center|LOCUS_04900 4236 3334 gene locus_tag LOCUS_04910 4236 3334 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_04910 5459 4335 gene locus_tag LOCUS_04920 5459 4335 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_04920 6197 7270 gene locus_tag LOCUS_04930 gene lpxK 6197 7270 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_04930 7534 8532 gene locus_tag LOCUS_04940 gene lpxC 7534 8532 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_04940 8757 9527 gene locus_tag LOCUS_04950 gene proC 8757 9527 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_04950 9524 10399 gene locus_tag LOCUS_04960 9524 10399 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_04960 11819 10425 gene locus_tag LOCUS_04970 11819 10425 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_04970 12768 11917 gene locus_tag LOCUS_04980 12768 11917 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_04980 13048 13488 gene locus_tag LOCUS_04990 gene trxA 13048 13488 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_04990 13760 14341 gene locus_tag LOCUS_05000 13760 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 14369 14989 gene locus_tag LOCUS_05010 14369 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 15000 15308 gene locus_tag LOCUS_05020 15000 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15310 15543 gene locus_tag LOCUS_05030 15310 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 15570 16478 gene locus_tag LOCUS_05040 15570 16478 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_05040 16836 19775 gene locus_tag LOCUS_05050 16836 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 19811 20659 gene locus_tag LOCUS_05060 19811 20659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 21658 21008 gene locus_tag LOCUS_05070 21658 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 22610 21744 gene locus_tag LOCUS_05080 22610 21744 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851174.1 protein_id gnl|my_center|LOCUS_05080 23427 22840 gene locus_tag LOCUS_05090 gene fdh3B 23427 22840 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_05090 26248 23450 gene locus_tag LOCUS_05100 26248 23450 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706856.1 transl_except (pos:complement(25649..25651),aa:Sec) note codon on position 200 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_05100 26458 26261 gene locus_tag LOCUS_05110 26458 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 27308 26664 gene locus_tag LOCUS_05120 27308 26664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 29173 27305 gene locus_tag LOCUS_05130 29173 27305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 30040 29369 gene locus_tag LOCUS_05140 30040 29369 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_05140 <31657 30037 gene locus_tag LOCUS_05150 <31657 30037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188253.1:PAS domain-containing protein >Feature sequence014 2288 2524 gene locus_tag LOCUS_05160 2288 2524 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_05160 2839 5049 gene locus_tag LOCUS_05170 gene recQ 2839 5049 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_05170 7322 5073 gene locus_tag LOCUS_05180 7322 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 8807 7332 gene locus_tag LOCUS_05190 8807 7332 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_05190 10213 9005 gene locus_tag LOCUS_05200 10213 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 10506 10733 gene locus_tag LOCUS_05210 10506 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 11003 13171 gene locus_tag LOCUS_05220 gene feoB 11003 13171 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_05220 13208 13885 gene locus_tag LOCUS_05230 13208 13885 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_05230 14480 13929 gene locus_tag LOCUS_05240 14480 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 14965 14477 gene locus_tag LOCUS_05250 14965 14477 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_05250 15559 16158 gene locus_tag LOCUS_05260 15559 16158 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_05260 16622 16275 gene locus_tag LOCUS_05270 16622 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 16867 16619 gene locus_tag LOCUS_05280 16867 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18167 16806 gene locus_tag LOCUS_05290 18167 16806 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929319.1 protein_id gnl|my_center|LOCUS_05290 18348 19319 gene locus_tag LOCUS_05300 18348 19319 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_05300 20029 22587 gene locus_tag LOCUS_05310 20029 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 22754 22569 gene locus_tag LOCUS_05320 22754 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 23604 24791 gene locus_tag LOCUS_05330 23604 24791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 24821 25807 gene locus_tag LOCUS_05340 24821 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 25810 27417 gene locus_tag LOCUS_05350 25810 27417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 27624 29261 gene locus_tag LOCUS_05360 gene cas1 27624 29261 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_05360 29270 29557 gene locus_tag LOCUS_05370 gene cas2 29270 29557 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence015 253 822 gene locus_tag LOCUS_05380 253 822 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_05380 847 1473 gene locus_tag LOCUS_05390 847 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_05390 1523 2506 gene locus_tag LOCUS_05400 1523 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2517 3143 gene locus_tag LOCUS_05410 2517 3143 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_05410 3100 4233 gene locus_tag LOCUS_05420 3100 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4230 5561 gene locus_tag LOCUS_05430 gene bioA 4230 5561 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_05430 5565 6668 gene locus_tag LOCUS_05440 5565 6668 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927132.1 protein_id gnl|my_center|LOCUS_05440 6892 7986 gene locus_tag LOCUS_05450 6892 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_05450 8655 8164 gene locus_tag LOCUS_05460 8655 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9587 8889 gene locus_tag LOCUS_05470 9587 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 9985 9749 gene locus_tag LOCUS_05480 9985 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10223 10672 gene locus_tag LOCUS_05490 10223 10672 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_05490 11349 10819 gene locus_tag LOCUS_05500 11349 10819 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164013248.1 protein_id gnl|my_center|LOCUS_05500 12807 11464 gene locus_tag LOCUS_05510 12807 11464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 protein_id gnl|my_center|LOCUS_05510 13124 13915 gene locus_tag LOCUS_05520 13124 13915 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812774.1 protein_id gnl|my_center|LOCUS_05520 14351 15181 gene locus_tag LOCUS_05530 14351 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 15406 15735 gene locus_tag LOCUS_05540 15406 15735 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_05540 16124 16861 gene locus_tag LOCUS_05550 gene modA 16124 16861 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943593.1 protein_id gnl|my_center|LOCUS_05550 16858 17541 gene locus_tag LOCUS_05560 gene modB 16858 17541 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943592.1 protein_id gnl|my_center|LOCUS_05560 17546 18601 gene locus_tag LOCUS_05570 gene modC 17546 18601 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943591.1 protein_id gnl|my_center|LOCUS_05570 18921 19955 gene locus_tag LOCUS_05580 18921 19955 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943439.1 protein_id gnl|my_center|LOCUS_05580 20164 20871 gene locus_tag LOCUS_05590 20164 20871 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_05590 21029 22375 gene locus_tag LOCUS_05600 21029 22375 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529019.1 protein_id gnl|my_center|LOCUS_05600 23102 22386 gene locus_tag LOCUS_05610 23102 22386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525180.1 protein_id gnl|my_center|LOCUS_05610 23875 23099 gene locus_tag LOCUS_05620 23875 23099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_05620 24872 23916 gene locus_tag LOCUS_05630 24872 23916 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525178.1 protein_id gnl|my_center|LOCUS_05630 25790 24876 gene locus_tag LOCUS_05640 25790 24876 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525177.1 protein_id gnl|my_center|LOCUS_05640 26976 25876 gene locus_tag LOCUS_05650 26976 25876 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013893969.1 protein_id gnl|my_center|LOCUS_05650 27330 28220 gene locus_tag LOCUS_05660 27330 28220 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence016 1026 769 gene locus_tag LOCUS_05670 1026 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2519 1023 gene locus_tag LOCUS_05680 2519 1023 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_05680 2861 2541 gene locus_tag LOCUS_05690 gene nuoK 2861 2541 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_05690 3415 2864 gene locus_tag LOCUS_05700 3415 2864 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140655.1 protein_id gnl|my_center|LOCUS_05700 3852 3415 gene locus_tag LOCUS_05710 3852 3415 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_05710 4841 3855 gene locus_tag LOCUS_05720 gene nuoH 4841 3855 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_05720 5980 4862 gene locus_tag LOCUS_05730 gene nuoD 5980 4862 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_05730 6660 5977 gene locus_tag LOCUS_05740 6660 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7166 6657 gene locus_tag LOCUS_05750 7166 6657 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_05750 7543 7136 gene locus_tag LOCUS_05760 gene ndhC 7543 7136 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_05760 7723 7568 gene locus_tag LOCUS_05770 7723 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7801 8790 gene locus_tag LOCUS_05780 7801 8790 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_05780 10275 9067 gene locus_tag LOCUS_05790 10275 9067 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_05790 10546 12261 gene locus_tag LOCUS_05800 10546 12261 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205226061.1 protein_id gnl|my_center|LOCUS_05800 12341 13978 gene locus_tag LOCUS_05810 12341 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 14175 13918 gene locus_tag LOCUS_05820 14175 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 14571 16148 gene locus_tag LOCUS_05830 14571 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 16487 16302 gene locus_tag LOCUS_05840 16487 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16808 16653 gene locus_tag LOCUS_05850 16808 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 17210 18247 gene locus_tag LOCUS_05860 17210 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18276 20435 gene locus_tag LOCUS_05870 18276 20435 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_05870 21091 23388 gene locus_tag LOCUS_05880 21091 23388 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_05880 23416 24597 gene locus_tag LOCUS_05890 23416 24597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272186.1 protein_id gnl|my_center|LOCUS_05890 24826 25527 gene locus_tag LOCUS_05900 24826 25527 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171605.1 protein_id gnl|my_center|LOCUS_05900 26286 26849 gene locus_tag LOCUS_05910 26286 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 26999 27268 gene locus_tag LOCUS_05920 26999 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 27330 27590 gene locus_tag LOCUS_05930 27330 27590 CDS product Nif11-like leader peptide family natural product precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814917.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence017 <1 722 gene locus_tag LOCUS_05940 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933201.1:nitrogenase molybdenum-iron protein alpha chain 855 2228 gene locus_tag LOCUS_05950 gene nifK 855 2228 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_05950 2322 3455 gene locus_tag LOCUS_05960 gene nifB 2322 3455 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_05960 3504 3809 gene locus_tag LOCUS_05970 3504 3809 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933206.1 protein_id gnl|my_center|LOCUS_05970 3820 4278 gene locus_tag LOCUS_05980 3820 4278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_05980 4280 4858 gene locus_tag LOCUS_05990 4280 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4839 5060 gene locus_tag LOCUS_06000 4839 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5387 6397 gene locus_tag LOCUS_06010 5387 6397 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_06010 6474 7145 gene locus_tag LOCUS_06020 gene ttrB 6474 7145 CDS product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 protein_id gnl|my_center|LOCUS_06020 7142 10195 gene locus_tag LOCUS_06030 7142 10195 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462223.1 protein_id gnl|my_center|LOCUS_06030 10435 11799 gene locus_tag LOCUS_06040 gene nifE 10435 11799 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787306.1 protein_id gnl|my_center|LOCUS_06040 11820 13184 gene locus_tag LOCUS_06050 11820 13184 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_06050 13257 14534 gene locus_tag LOCUS_06060 gene nifB 13257 14534 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_06060 14867 15082 gene locus_tag LOCUS_06070 14867 15082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 16719 15076 gene locus_tag LOCUS_06080 16719 15076 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_06080 17184 17792 gene locus_tag LOCUS_06090 17184 17792 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_06090 18028 18180 gene locus_tag LOCUS_06100 18028 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 18734 18234 gene locus_tag LOCUS_06110 gene tpx 18734 18234 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_06110 19237 18788 gene locus_tag LOCUS_06120 19237 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 21056 19260 gene locus_tag LOCUS_06130 21056 19260 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_06130 22306 21059 gene locus_tag LOCUS_06140 22306 21059 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_06140 24456 22303 gene locus_tag LOCUS_06150 24456 22303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 24968 24534 gene locus_tag LOCUS_06160 24968 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 25532 25311 gene locus_tag LOCUS_06170 25532 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 25884 26771 gene locus_tag LOCUS_06180 25884 26771 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941034.1 protein_id gnl|my_center|LOCUS_06180 26813 27217 gene locus_tag LOCUS_06190 26813 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence018 1111 470 gene locus_tag LOCUS_06200 1111 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1832 1104 gene locus_tag LOCUS_06210 1832 1104 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_06210 2696 1884 gene locus_tag LOCUS_06220 2696 1884 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_06220 2970 2894 gene locus_tag LOCUS_t00110 2970 2894 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3279 5093 gene locus_tag LOCUS_06230 3279 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5429 7573 gene locus_tag LOCUS_06240 5429 7573 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_06240 7580 8209 gene locus_tag LOCUS_06250 7580 8209 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_06250 8243 8794 gene locus_tag LOCUS_06260 8243 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9041 10696 gene locus_tag LOCUS_06270 9041 10696 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_06270 10974 11885 gene locus_tag LOCUS_06280 10974 11885 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_06280 11909 12889 gene locus_tag LOCUS_06290 11909 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13062 14054 gene locus_tag LOCUS_06300 gene trpX 13062 14054 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836788.1 protein_id gnl|my_center|LOCUS_06300 14069 16804 gene locus_tag LOCUS_06310 14069 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 17174 16926 gene locus_tag LOCUS_06320 17174 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 17463 19277 gene locus_tag LOCUS_06330 17463 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 19582 19809 gene locus_tag LOCUS_06340 19582 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19715 20704 gene locus_tag LOCUS_06350 19715 20704 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932081.1 protein_id gnl|my_center|LOCUS_06350 20705 21736 gene locus_tag LOCUS_06360 20705 21736 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_06360 21733 22527 gene locus_tag LOCUS_06370 21733 22527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969708.1 protein_id gnl|my_center|LOCUS_06370 22524 23435 gene locus_tag LOCUS_06380 22524 23435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_06380 23435 24811 gene locus_tag LOCUS_06390 23435 24811 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_06390 24830 25486 gene locus_tag LOCUS_06400 24830 25486 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence019 644 489 gene locus_tag LOCUS_06410 644 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1496 1421 gene locus_tag LOCUS_t00120 1496 1421 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1726 2763 gene locus_tag LOCUS_06420 1726 2763 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_06420 2835 3695 gene locus_tag LOCUS_06430 2835 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3692 4225 gene locus_tag LOCUS_06440 3692 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4234 6216 gene locus_tag LOCUS_06450 gene mrdA 4234 6216 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06450 6421 7530 gene locus_tag LOCUS_06460 gene rodA 6421 7530 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_06460 8942 8040 gene locus_tag LOCUS_06470 gene hemH 8942 8040 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_06470 9339 9881 gene locus_tag LOCUS_06480 9339 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 10171 10013 gene locus_tag LOCUS_06490 10171 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10288 12981 gene locus_tag LOCUS_06500 gene polA 10288 12981 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_06500 13394 13777 gene locus_tag LOCUS_06510 13394 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 15109 13805 gene locus_tag LOCUS_06520 15109 13805 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_06520 15419 16114 gene locus_tag LOCUS_06530 gene thiE 15419 16114 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_06530 16107 16778 gene locus_tag LOCUS_06540 16107 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 17861 16914 gene locus_tag LOCUS_06550 gene hflC 17861 16914 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_06550 19069 17957 gene locus_tag LOCUS_06560 gene hflK 19069 17957 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_06560 20160 19207 gene locus_tag LOCUS_06570 20160 19207 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_06570 20954 20157 gene locus_tag LOCUS_06580 20954 20157 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_06580 21167 21081 gene locus_tag LOCUS_t00130 21167 21081 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21426 22388 gene locus_tag LOCUS_06590 21426 22388 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_06590 22549 23184 gene locus_tag LOCUS_06600 22549 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 23184 24317 gene locus_tag LOCUS_06610 23184 24317 CDS product PBS lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393103.1 protein_id gnl|my_center|LOCUS_06610 24428 25045 gene locus_tag LOCUS_06620 24428 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence020 572 72 gene locus_tag LOCUS_06630 572 72 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942695.1 protein_id gnl|my_center|LOCUS_06630 2389 569 gene locus_tag LOCUS_06640 2389 569 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_06640 3410 2547 gene locus_tag LOCUS_06650 3410 2547 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_06650 4246 3557 gene locus_tag LOCUS_06660 4246 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5163 4252 gene locus_tag LOCUS_06670 gene prmA 5163 4252 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_06670 6717 5317 gene locus_tag LOCUS_06680 gene nuoN 6717 5317 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443945.1 protein_id gnl|my_center|LOCUS_06680 8341 6791 gene locus_tag LOCUS_06690 8341 6791 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_06690 10139 8358 gene locus_tag LOCUS_06700 10139 8358 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_06700 10400 10140 gene locus_tag LOCUS_06710 10400 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11866 10397 gene locus_tag LOCUS_06720 11866 10397 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_06720 12202 11873 gene locus_tag LOCUS_06730 gene nuoK 12202 11873 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_06730 12714 12205 gene locus_tag LOCUS_06740 12714 12205 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_06740 13247 12792 gene locus_tag LOCUS_06750 gene nuoI 13247 12792 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380115.1 protein_id gnl|my_center|LOCUS_06750 14194 13244 gene locus_tag LOCUS_06760 gene nuoH 14194 13244 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_06760 15324 14191 gene locus_tag LOCUS_06770 gene nuoD 15324 14191 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_06770 15761 15321 gene locus_tag LOCUS_06780 15761 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 16273 15758 gene locus_tag LOCUS_06790 16273 15758 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_06790 16692 16243 gene locus_tag LOCUS_06800 16692 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17089 19023 gene locus_tag LOCUS_06810 17089 19023 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_06810 19330 20235 gene locus_tag LOCUS_06820 19330 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 20672 21565 gene locus_tag LOCUS_06830 20672 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 21562 22770 gene locus_tag LOCUS_06840 21562 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 23297 22839 gene locus_tag LOCUS_06850 23297 22839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 23703 23398 gene locus_tag LOCUS_06860 23703 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 24073 23804 gene locus_tag LOCUS_06870 24073 23804 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272681.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence021 1855 794 gene locus_tag LOCUS_06880 1855 794 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_06880 2350 3846 gene locus_tag LOCUS_06890 gene glpK 2350 3846 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_06890 4083 5405 gene locus_tag LOCUS_06900 gene ugpB 4083 5405 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 protein_id gnl|my_center|LOCUS_06900 5472 6353 gene locus_tag LOCUS_06910 gene ugpA 5472 6353 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975291.1 protein_id gnl|my_center|LOCUS_06910 6356 7204 gene locus_tag LOCUS_06920 gene ugpE 6356 7204 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_06920 7206 8285 gene locus_tag LOCUS_06930 7206 8285 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703701.1 protein_id gnl|my_center|LOCUS_06930 9218 8328 gene locus_tag LOCUS_06940 gene pstB 9218 8328 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 protein_id gnl|my_center|LOCUS_06940 10402 9359 gene locus_tag LOCUS_06950 10402 9359 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_06950 11852 10557 gene locus_tag LOCUS_06960 gene pstA 11852 10557 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_06960 13218 11845 gene locus_tag LOCUS_06970 gene pstC 13218 11845 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_06970 13840 13232 gene locus_tag LOCUS_06980 gene phoU 13840 13232 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_06980 14077 14778 gene locus_tag LOCUS_06990 14077 14778 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_06990 14875 16659 gene locus_tag LOCUS_07000 gene phoR 14875 16659 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_07000 16873 19077 gene locus_tag LOCUS_07010 16873 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 19209 19538 gene locus_tag LOCUS_07020 19209 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 19544 20551 gene locus_tag LOCUS_07030 19544 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 21530 20571 gene locus_tag LOCUS_07040 21530 20571 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094452.1 protein_id gnl|my_center|LOCUS_07040 22537 21530 gene locus_tag LOCUS_07050 22537 21530 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_07050 23449 22541 gene locus_tag LOCUS_07060 23449 22541 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378916.1 protein_id gnl|my_center|LOCUS_07060 24462 23452 gene locus_tag LOCUS_07070 24462 23452 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973574.1 protein_id gnl|my_center|LOCUS_07070 25236 24571 gene locus_tag LOCUS_07080 25236 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence022 1437 457 gene locus_tag LOCUS_07090 gene prfB 1437 457 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_07090 3223 1736 gene locus_tag LOCUS_07100 gene lnt 3223 1736 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_07100 4306 3446 gene locus_tag LOCUS_07110 4306 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4682 6085 gene locus_tag LOCUS_07120 4682 6085 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_07120 6182 8449 gene locus_tag LOCUS_07130 6182 8449 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_07130 8553 8628 gene locus_tag LOCUS_t00140 8553 8628 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8883 8692 gene locus_tag LOCUS_07140 8883 8692 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_07140 9974 9024 gene locus_tag LOCUS_07150 9974 9024 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_07150 10110 12482 gene locus_tag LOCUS_07160 10110 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 12559 13917 gene locus_tag LOCUS_07170 12559 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 14013 14330 gene locus_tag LOCUS_07180 gene clpS 14013 14330 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072575.1 protein_id gnl|my_center|LOCUS_07180 14497 16770 gene locus_tag LOCUS_07190 gene clpA 14497 16770 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_07190 17149 18768 gene locus_tag LOCUS_07200 17149 18768 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_07200 18922 19677 gene locus_tag LOCUS_07210 18922 19677 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937672.1 protein_id gnl|my_center|LOCUS_07210 20498 19716 gene locus_tag LOCUS_07220 20498 19716 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_07220 21818 20499 gene locus_tag LOCUS_07230 21818 20499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 23163 22177 gene locus_tag LOCUS_07240 23163 22177 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_07240 23523 24809 gene locus_tag LOCUS_07250 gene hisS 23523 24809 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence023 560 2584 gene locus_tag LOCUS_07260 560 2584 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_07260 3252 2707 gene locus_tag LOCUS_07270 gene rfbC 3252 2707 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_07270 4327 3257 gene locus_tag LOCUS_07280 gene rfbB 4327 3257 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943002.1 protein_id gnl|my_center|LOCUS_07280 5065 4568 gene locus_tag LOCUS_07290 5065 4568 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_07290 5302 5117 gene locus_tag LOCUS_07300 5302 5117 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_07300 5744 5448 gene locus_tag LOCUS_07310 5744 5448 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_07310 6218 5823 gene locus_tag LOCUS_07320 6218 5823 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_07320 7254 6265 gene locus_tag LOCUS_07330 7254 6265 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_07330 7738 7325 gene locus_tag LOCUS_07340 7738 7325 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942060.1 protein_id gnl|my_center|LOCUS_07340 8047 8628 gene locus_tag LOCUS_07350 8047 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8718 10940 gene locus_tag LOCUS_07360 8718 10940 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_07360 11045 12412 gene locus_tag LOCUS_07370 11045 12412 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_07370 12858 13835 gene locus_tag LOCUS_07380 gene hemB 12858 13835 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_07380 14318 13917 gene locus_tag LOCUS_07390 14318 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 14851 14327 gene locus_tag LOCUS_07400 14851 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 17094 14920 gene locus_tag LOCUS_07410 17094 14920 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_07410 17443 17652 gene locus_tag LOCUS_07420 17443 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 17860 17627 gene locus_tag LOCUS_07430 17860 17627 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 protein_id gnl|my_center|LOCUS_07430 18162 18086 gene locus_tag LOCUS_t00150 18162 18086 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 18246 18171 gene locus_tag LOCUS_t00160 18246 18171 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20724 18337 gene locus_tag LOCUS_07440 gene lon 20724 18337 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938632.1 protein_id gnl|my_center|LOCUS_07440 22317 21046 gene locus_tag LOCUS_07450 gene clpX 22317 21046 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_07450 22919 22320 gene locus_tag LOCUS_07460 gene clpP 22919 22320 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_07460 24344 23004 gene locus_tag LOCUS_07470 gene tig 24344 23004 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_07470 24557 24472 gene locus_tag LOCUS_t00170 24557 24472 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 1143 220 gene locus_tag LOCUS_07480 1143 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1514 1161 gene locus_tag LOCUS_07490 1514 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1600 1609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2382 1888 gene locus_tag LOCUS_07500 2382 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3116 2469 gene locus_tag LOCUS_07510 3116 2469 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_07510 5739 3208 gene locus_tag LOCUS_07520 5739 3208 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_07520 6650 5784 gene locus_tag LOCUS_07530 6650 5784 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_07530 8186 6777 gene locus_tag LOCUS_07540 8186 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9726 8341 gene locus_tag LOCUS_07550 9726 8341 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_07550 11143 9704 gene locus_tag LOCUS_07560 11143 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12034 11165 gene locus_tag LOCUS_07570 gene phnD 12034 11165 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_07570 12202 12531 gene locus_tag LOCUS_07580 12202 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12543 13640 gene locus_tag LOCUS_07590 12543 13640 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_07590 13743 13985 gene locus_tag LOCUS_07600 13743 13985 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_07600 14037 14429 gene locus_tag LOCUS_07610 14037 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 14426 15715 gene locus_tag LOCUS_07620 14426 15715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 15788 16861 gene locus_tag LOCUS_07630 15788 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 17127 18764 gene locus_tag LOCUS_07640 17127 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 18733 18742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18893 20365 gene locus_tag LOCUS_07650 18893 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 20639 21736 gene locus_tag LOCUS_07660 20639 21736 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941716.1 protein_id gnl|my_center|LOCUS_07660 21741 21983 gene locus_tag LOCUS_07670 21741 21983 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941715.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence025 246 255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 898 434 gene locus_tag LOCUS_07680 898 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1515 1174 gene locus_tag LOCUS_07690 1515 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2367 1735 gene locus_tag LOCUS_07700 2367 1735 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_07700 3764 2733 gene locus_tag LOCUS_07710 3764 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3867 4208 gene locus_tag LOCUS_07720 3867 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5140 4253 gene locus_tag LOCUS_07730 5140 4253 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_07730 6170 5145 gene locus_tag LOCUS_07740 6170 5145 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_07740 6406 6173 gene locus_tag LOCUS_07750 6406 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7519 6527 gene locus_tag LOCUS_07760 7519 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07760 7950 7516 gene locus_tag LOCUS_07770 7950 7516 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_07770 10984 7970 gene locus_tag LOCUS_07780 10984 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12225 10981 gene locus_tag LOCUS_07790 12225 10981 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 transl_except (pos:complement(11512..11514),aa:Sec) note codon on position 238 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_07790 13797 12349 gene locus_tag LOCUS_07800 13797 12349 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_07800 13979 13794 gene locus_tag LOCUS_07810 13979 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 15017 14415 gene locus_tag LOCUS_07820 15017 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 16511 15204 gene locus_tag LOCUS_07830 16511 15204 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_07830 17252 16575 gene locus_tag LOCUS_07840 17252 16575 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957327.1 protein_id gnl|my_center|LOCUS_07840 17754 18230 gene locus_tag LOCUS_07850 17754 18230 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_07850 18416 19063 gene locus_tag LOCUS_07860 18416 19063 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250917.1 protein_id gnl|my_center|LOCUS_07860 19072 20529 gene locus_tag LOCUS_07870 19072 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 20553 21065 gene locus_tag LOCUS_07880 20553 21065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 21958 21281 gene locus_tag LOCUS_07890 21958 21281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_07890 23301 21955 gene locus_tag LOCUS_07900 gene der 23301 21955 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence026 2707 1676 gene locus_tag LOCUS_07910 2707 1676 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_07910 3078 3272 gene locus_tag LOCUS_07920 3078 3272 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_07920 3284 4408 gene locus_tag LOCUS_07930 3284 4408 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_07930 7752 5302 gene locus_tag LOCUS_07940 gene ppsA 7752 5302 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_07940 8133 9941 gene locus_tag LOCUS_07950 8133 9941 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545176.1 protein_id gnl|my_center|LOCUS_07950 10098 10934 gene locus_tag LOCUS_07960 gene nifU 10098 10934 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_07960 10934 12124 gene locus_tag LOCUS_07970 gene nifS 10934 12124 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_07970 12381 13322 gene locus_tag LOCUS_07980 12381 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13539 15302 gene locus_tag LOCUS_07990 13539 15302 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_07990 15442 17694 gene locus_tag LOCUS_08000 gene pilB 15442 17694 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_08000 18948 17803 gene locus_tag LOCUS_08010 18948 17803 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_08010 19898 18924 gene locus_tag LOCUS_08020 19898 18924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 20982 19909 gene locus_tag LOCUS_08030 20982 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 22220 20979 gene locus_tag LOCUS_08040 22220 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 23052 22294 gene locus_tag LOCUS_08050 23052 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence027 <1 1790 gene locus_tag LOCUS_08060 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein 2313 2092 gene locus_tag LOCUS_08070 2313 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2290 4116 gene locus_tag LOCUS_08080 2290 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4142 5101 gene locus_tag LOCUS_08090 4142 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5140 6171 gene locus_tag LOCUS_08100 5140 6171 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927014.1 protein_id gnl|my_center|LOCUS_08100 6164 6685 gene locus_tag LOCUS_08110 6164 6685 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_08110 6931 7500 gene locus_tag LOCUS_08120 6931 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 7522 9975 gene locus_tag LOCUS_08130 7522 9975 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_08130 10116 10520 gene locus_tag LOCUS_08140 gene rsfS 10116 10520 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 protein_id gnl|my_center|LOCUS_08140 10523 12082 gene locus_tag LOCUS_08150 gene gpmI 10523 12082 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_08150 12191 13582 gene locus_tag LOCUS_08160 gene thrC 12191 13582 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_08160 13598 14452 gene locus_tag LOCUS_08170 13598 14452 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_08170 14510 14950 gene locus_tag LOCUS_08180 14510 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 14947 15474 gene locus_tag LOCUS_08190 14947 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15572 16894 gene locus_tag LOCUS_08200 15572 16894 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_08200 17108 17293 gene locus_tag LOCUS_08210 17108 17293 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_08210 17365 17613 gene locus_tag LOCUS_08220 17365 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 18074 19216 gene locus_tag LOCUS_08230 18074 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_08230 19174 20814 gene locus_tag LOCUS_08240 19174 20814 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_08240 20905 22020 gene locus_tag LOCUS_08250 20905 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 22276 22079 gene locus_tag LOCUS_08260 22276 22079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence028 3810 3034 gene locus_tag LOCUS_08270 3810 3034 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_08270 5909 3894 gene locus_tag LOCUS_08280 5909 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6268 5906 gene locus_tag LOCUS_08290 6268 5906 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_08290 6876 6268 gene locus_tag LOCUS_08300 6876 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 7592 6867 gene locus_tag LOCUS_08310 7592 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 9637 7595 gene locus_tag LOCUS_08320 9637 7595 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926859.1 protein_id gnl|my_center|LOCUS_08320 11288 10086 gene locus_tag LOCUS_08330 11288 10086 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_08330 11899 11426 gene locus_tag LOCUS_08340 11899 11426 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_08340 12842 11919 gene locus_tag LOCUS_08350 12842 11919 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_08350 13183 14214 gene locus_tag LOCUS_08360 gene amrS 13183 14214 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_08360 17625 14233 gene locus_tag LOCUS_08370 17625 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 18947 17763 gene locus_tag LOCUS_08380 18947 17763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938728.1 protein_id gnl|my_center|LOCUS_08380 19345 19091 gene locus_tag LOCUS_08390 19345 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19540 19637 gene locus_tag LOCUS_t00180 19540 19637 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 20579 19677 gene locus_tag LOCUS_08400 gene glyQ 20579 19677 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939184.1 protein_id gnl|my_center|LOCUS_08400 20758 21174 gene locus_tag LOCUS_08410 20758 21174 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence029 <1 1219 gene locus_tag LOCUS_08420 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein 1216 2616 gene locus_tag LOCUS_08430 1216 2616 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_08430 3761 2613 gene locus_tag LOCUS_08440 3761 2613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_08440 4006 3821 gene locus_tag LOCUS_08450 4006 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4177 4758 gene locus_tag LOCUS_08460 4177 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4755 5465 gene locus_tag LOCUS_08470 4755 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5467 5922 gene locus_tag LOCUS_08480 5467 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5919 6401 gene locus_tag LOCUS_08490 5919 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6415 10740 gene locus_tag LOCUS_08500 6415 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 10844 11353 gene locus_tag LOCUS_08510 10844 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 11763 13043 gene locus_tag LOCUS_08520 gene sat 11763 13043 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_08520 13147 14226 gene locus_tag LOCUS_08530 gene aroB 13147 14226 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_08530 14375 14869 gene locus_tag LOCUS_08540 14375 14869 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_08540 16322 14976 gene locus_tag LOCUS_08550 gene gnfM 16322 14976 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_08550 17918 16326 gene locus_tag LOCUS_08560 17918 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 18307 18825 gene locus_tag LOCUS_08570 18307 18825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 19299 19541 gene locus_tag LOCUS_08580 19299 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19587 21974 gene locus_tag LOCUS_08590 19587 21974 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence030 327 118 gene locus_tag LOCUS_08600 327 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 872 3661 gene locus_tag LOCUS_08610 872 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 4350 3700 gene locus_tag LOCUS_08620 4350 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5727 4357 gene locus_tag LOCUS_08630 5727 4357 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_08630 7903 5735 gene locus_tag LOCUS_08640 7903 5735 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_08640 8006 8335 gene locus_tag LOCUS_08650 8006 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 10318 8363 gene locus_tag LOCUS_08660 10318 8363 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 protein_id gnl|my_center|LOCUS_08660 10843 10331 gene locus_tag LOCUS_08670 10843 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12431 11085 gene locus_tag LOCUS_08680 12431 11085 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_08680 12582 13103 gene locus_tag LOCUS_08690 12582 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13258 15636 gene locus_tag LOCUS_08700 13258 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 15741 15817 gene locus_tag LOCUS_t00190 15741 15817 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16341 16000 gene locus_tag LOCUS_08710 16341 16000 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_08710 17164 16514 gene locus_tag LOCUS_08720 17164 16514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 17497 18858 gene locus_tag LOCUS_08730 17497 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 19033 20832 gene locus_tag LOCUS_08740 gene typA 19033 20832 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 protein_id gnl|my_center|LOCUS_08740 21555 21133 gene locus_tag LOCUS_08750 21555 21133 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence031 488 1399 gene locus_tag LOCUS_08760 488 1399 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256041.1 protein_id gnl|my_center|LOCUS_08760 1448 2911 gene locus_tag LOCUS_08770 1448 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144206.1 protein_id gnl|my_center|LOCUS_08770 2929 5298 gene locus_tag LOCUS_08780 2929 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5280 6185 gene locus_tag LOCUS_08790 5280 6185 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928888.1 protein_id gnl|my_center|LOCUS_08790 6196 7104 gene locus_tag LOCUS_08800 6196 7104 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141899.1 protein_id gnl|my_center|LOCUS_08800 7183 7605 gene locus_tag LOCUS_08810 7183 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7666 8613 gene locus_tag LOCUS_08820 7666 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 8619 10106 gene locus_tag LOCUS_08830 8619 10106 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_08830 11278 10355 gene locus_tag LOCUS_08840 11278 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 12239 12943 gene locus_tag LOCUS_08850 12239 12943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_08850 12936 14180 gene locus_tag LOCUS_08860 12936 14180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_08860 14235 14975 gene locus_tag LOCUS_08870 14235 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 15024 16340 gene locus_tag LOCUS_08880 15024 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 18408 16438 gene locus_tag LOCUS_08890 18408 16438 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_08890 19491 18478 gene locus_tag LOCUS_08900 19491 18478 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_08900 20272 19511 gene locus_tag LOCUS_08910 gene rnc 20272 19511 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_08910 20332 20406 gene locus_tag LOCUS_t00200 20332 20406 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20786 21163 gene locus_tag LOCUS_08920 20786 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 21669 21136 gene locus_tag LOCUS_08930 gene thpR 21669 21136 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence032 1299 598 gene locus_tag LOCUS_08940 gene aroD 1299 598 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083186615.1 protein_id gnl|my_center|LOCUS_08940 2243 1299 gene locus_tag LOCUS_08950 2243 1299 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_08950 3013 2231 gene locus_tag LOCUS_08960 3013 2231 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_08960 3162 3953 gene locus_tag LOCUS_08970 3162 3953 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_08970 4637 3957 gene locus_tag LOCUS_08980 4637 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5985 4813 gene locus_tag LOCUS_08990 gene nrfD 5985 4813 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_08990 6856 5993 gene locus_tag LOCUS_09000 6856 5993 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_09000 7254 6880 gene locus_tag LOCUS_09010 gene dsrJ 7254 6880 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_09010 8856 7282 gene locus_tag LOCUS_09020 8856 7282 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_09020 9822 8950 gene locus_tag LOCUS_09030 gene dsrM 9822 8950 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_09030 9854 10021 gene locus_tag LOCUS_09040 9854 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 10623 10090 gene locus_tag LOCUS_09050 10623 10090 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_09050 12912 10723 gene locus_tag LOCUS_09060 12912 10723 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_09060 13559 12939 gene locus_tag LOCUS_09070 gene yedF 13559 12939 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_09070 14655 13732 gene locus_tag LOCUS_09080 14655 13732 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_09080 15526 14669 gene locus_tag LOCUS_09090 15526 14669 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_09090 16052 15849 gene locus_tag LOCUS_09100 16052 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 16824 16042 gene locus_tag LOCUS_09110 16824 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 17592 16900 gene locus_tag LOCUS_09120 17592 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 19808 17721 gene locus_tag LOCUS_09130 gene fusA 19808 17721 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_09130 20090 20015 gene locus_tag LOCUS_t00210 20090 20015 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20928 20149 gene locus_tag LOCUS_09140 20928 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21719 21096 gene locus_tag LOCUS_09150 21719 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence033 <1 601 gene locus_tag LOCUS_09160 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258767.1:deoxyguanosinetriphosphate triphosphohydrolase 586 2367 gene locus_tag LOCUS_09170 586 2367 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_09170 2532 2930 gene locus_tag LOCUS_09180 2532 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3208 3495 gene locus_tag LOCUS_09190 3208 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3893 5590 gene locus_tag LOCUS_09200 3893 5590 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_09200 5606 6400 gene locus_tag LOCUS_09210 5606 6400 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_09210 6569 7828 gene locus_tag LOCUS_09220 6569 7828 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_09220 7864 9588 gene locus_tag LOCUS_09230 7864 9588 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_09230 9631 10038 gene locus_tag LOCUS_09240 9631 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 10046 11221 gene locus_tag LOCUS_09250 10046 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 11214 12191 gene locus_tag LOCUS_09260 11214 12191 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_09260 12245 13813 gene locus_tag LOCUS_09270 12245 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427771.1 protein_id gnl|my_center|LOCUS_09270 13826 14698 gene locus_tag LOCUS_09280 13826 14698 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_09280 15725 14898 gene locus_tag LOCUS_09290 15725 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 16255 15815 gene locus_tag LOCUS_09300 16255 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 16791 16258 gene locus_tag LOCUS_09310 gene coaD 16791 16258 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_09310 17491 16901 gene locus_tag LOCUS_09320 gene rsmD 17491 16901 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_09320 18281 17532 gene locus_tag LOCUS_09330 gene pssA 18281 17532 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_09330 18981 18340 gene locus_tag LOCUS_09340 18981 18340 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_09340 19200 19030 gene locus_tag LOCUS_09350 19200 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 19715 19233 gene locus_tag LOCUS_09360 gene ilvN 19715 19233 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_09360 20681 19779 gene locus_tag LOCUS_09370 20681 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 20682 20691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence034 1058 303 gene locus_tag LOCUS_09380 1058 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2727 1414 gene locus_tag LOCUS_09390 2727 1414 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073868.1 protein_id gnl|my_center|LOCUS_09390 4129 2717 gene locus_tag LOCUS_09400 4129 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5112 4126 gene locus_tag LOCUS_09410 5112 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7033 5078 gene locus_tag LOCUS_09420 7033 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7459 7468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8534 7611 gene locus_tag LOCUS_09430 8534 7611 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_09430 9566 8718 gene locus_tag LOCUS_09440 9566 8718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_09440 10241 9591 gene locus_tag LOCUS_09450 10241 9591 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_09450 10988 10353 gene locus_tag LOCUS_09460 10988 10353 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_09460 11926 10988 gene locus_tag LOCUS_09470 gene rssA 11926 10988 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946687.1 protein_id gnl|my_center|LOCUS_09470 12404 14212 gene locus_tag LOCUS_09480 gene iorA 12404 14212 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_09480 14212 14793 gene locus_tag LOCUS_09490 14212 14793 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_09490 14906 16204 gene locus_tag LOCUS_09500 14906 16204 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_09500 16241 16672 gene locus_tag LOCUS_09510 16241 16672 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_09510 16729 17880 gene locus_tag LOCUS_09520 16729 17880 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_09520 17951 18841 gene locus_tag LOCUS_09530 17951 18841 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_09530 18841 19935 gene locus_tag LOCUS_09540 18841 19935 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_09540 19939 20706 gene locus_tag LOCUS_09550 19939 20706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence035 841 1239 gene locus_tag LOCUS_09560 841 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1405 1632 gene locus_tag LOCUS_09570 1405 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1629 1793 gene locus_tag LOCUS_09580 1629 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2123 3025 gene locus_tag LOCUS_09590 2123 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3022 3252 gene locus_tag LOCUS_09600 3022 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3221 3511 gene locus_tag LOCUS_09610 3221 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3673 3870 gene locus_tag LOCUS_09620 3673 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3911 4246 gene locus_tag LOCUS_09630 3911 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4243 4554 gene locus_tag LOCUS_09640 4243 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4554 5045 gene locus_tag LOCUS_09650 4554 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5071 5280 gene locus_tag LOCUS_09660 5071 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5401 5559 gene locus_tag LOCUS_09670 5401 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5805 6029 gene locus_tag LOCUS_09680 5805 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6029 7603 gene locus_tag LOCUS_09690 6029 7603 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_09690 7575 9659 gene locus_tag LOCUS_09700 7575 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9752 10093 gene locus_tag LOCUS_09710 9752 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 10099 10410 gene locus_tag LOCUS_09720 10099 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 10410 11045 gene locus_tag LOCUS_09730 10410 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 11048 11515 gene locus_tag LOCUS_09740 11048 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11545 12690 gene locus_tag LOCUS_09750 11545 12690 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938786.1 protein_id gnl|my_center|LOCUS_09750 12751 13104 gene locus_tag LOCUS_09760 12751 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13218 13433 gene locus_tag LOCUS_09770 13218 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 13426 17187 gene locus_tag LOCUS_09780 13426 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 17187 18455 gene locus_tag LOCUS_09790 17187 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 18452 19201 gene locus_tag LOCUS_09800 18452 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence036 509 1717 gene locus_tag LOCUS_09810 509 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2538 1807 gene locus_tag LOCUS_09820 gene tatC 2538 1807 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 protein_id gnl|my_center|LOCUS_09820 2951 2535 gene locus_tag LOCUS_09830 2951 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3547 3191 gene locus_tag LOCUS_09840 3547 3191 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760150.1 protein_id gnl|my_center|LOCUS_09840 3938 4486 gene locus_tag LOCUS_09850 3938 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4483 5283 gene locus_tag LOCUS_09860 4483 5283 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_09860 5283 6488 gene locus_tag LOCUS_09870 gene nrfD 5283 6488 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_09870 6641 8227 gene locus_tag LOCUS_09880 6641 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8325 8918 gene locus_tag LOCUS_09890 8325 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 9250 10554 gene locus_tag LOCUS_09900 9250 10554 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_09900 10756 11022 gene locus_tag LOCUS_09910 gene rpoZ 10756 11022 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940500.1 protein_id gnl|my_center|LOCUS_09910 11167 12297 gene locus_tag LOCUS_09920 gene dnaJ 11167 12297 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 protein_id gnl|my_center|LOCUS_09920 12298 12813 gene locus_tag LOCUS_09930 gene moaC 12298 12813 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_09930 12869 13231 gene locus_tag LOCUS_09940 gene dksA 12869 13231 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_09940 13313 14311 gene locus_tag LOCUS_09950 gene galT 13313 14311 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_09950 14323 14688 gene locus_tag LOCUS_09960 14323 14688 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_09960 14954 15688 gene locus_tag LOCUS_09970 gene folE2 14954 15688 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_09970 15685 17763 gene locus_tag LOCUS_09980 gene glyS 15685 17763 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_09980 18425 18021 gene locus_tag LOCUS_09990 18425 18021 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_09990 19394 18543 gene locus_tag LOCUS_10000 gene ccsB 19394 18543 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_10000 20810 19461 gene locus_tag LOCUS_10010 20810 19461 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence037 186 1868 gene locus_tag LOCUS_10020 gene yidC 186 1868 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_10020 1890 2849 gene locus_tag LOCUS_10030 1890 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2827 4218 gene locus_tag LOCUS_10040 gene mnmE 2827 4218 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_10040 4908 4459 gene locus_tag LOCUS_10050 4908 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5890 4913 gene locus_tag LOCUS_10060 5890 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6708 6160 gene locus_tag LOCUS_10070 6708 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_10070 7764 6796 gene locus_tag LOCUS_10080 gene cmoB 7764 6796 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_10080 8500 7757 gene locus_tag LOCUS_10090 gene cmoA 8500 7757 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_10090 8743 9285 gene locus_tag LOCUS_10100 8743 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9424 10074 gene locus_tag LOCUS_10110 9424 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_10110 10100 11035 gene locus_tag LOCUS_10120 10100 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 12578 11121 gene locus_tag LOCUS_10130 12578 11121 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_10130 13200 12736 gene locus_tag LOCUS_10140 13200 12736 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943436.1 protein_id gnl|my_center|LOCUS_10140 14197 13496 gene locus_tag LOCUS_10150 14197 13496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_10150 14940 14191 gene locus_tag LOCUS_10160 14940 14191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_10160 15902 14937 gene locus_tag LOCUS_10170 15902 14937 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_10170 16863 15952 gene locus_tag LOCUS_10180 16863 15952 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_10180 18042 16870 gene locus_tag LOCUS_10190 18042 16870 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_10190 19273 18107 gene locus_tag LOCUS_10200 19273 18107 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040565.1 protein_id gnl|my_center|LOCUS_10200 19856 19641 gene locus_tag LOCUS_10210 19856 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 <20862 20000 gene locus_tag LOCUS_10220 <20862 20000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244356.1:UDP-glucose 4-epimerase GalE >Feature sequence038 2135 234 gene locus_tag LOCUS_10230 gene htpG 2135 234 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_10230 2362 3771 gene locus_tag LOCUS_10240 gene hemG 2362 3771 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930799.1 protein_id gnl|my_center|LOCUS_10240 4506 3949 gene locus_tag LOCUS_10250 4506 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6274 4955 gene locus_tag LOCUS_10260 gene dnaA 6274 4955 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 protein_id gnl|my_center|LOCUS_10260 7657 6938 gene locus_tag LOCUS_10270 7657 6938 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_10270 8896 7679 gene locus_tag LOCUS_10280 gene icd 8896 7679 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_10280 9102 10307 gene locus_tag LOCUS_10290 9102 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 10323 11075 gene locus_tag LOCUS_10300 10323 11075 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_10300 11325 13997 gene locus_tag LOCUS_10310 gene bamA 11325 13997 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_10310 14277 17789 gene locus_tag LOCUS_10320 gene mfd 14277 17789 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_10320 17941 18636 gene locus_tag LOCUS_10330 gene yrfG 17941 18636 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_10330 20218 19154 gene locus_tag LOCUS_10340 20218 19154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence039 491 1843 gene locus_tag LOCUS_10350 gene trkA 491 1843 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_10350 1902 3395 gene locus_tag LOCUS_10360 1902 3395 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_10360 3444 5339 gene locus_tag LOCUS_10370 gene mnmG 3444 5339 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_10370 5346 6161 gene locus_tag LOCUS_10380 gene lgt 5346 6161 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_10380 6498 6226 gene locus_tag LOCUS_10390 6498 6226 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_10390 7404 6688 gene locus_tag LOCUS_10400 7404 6688 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_10400 8873 7419 gene locus_tag LOCUS_10410 8873 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9584 10174 gene locus_tag LOCUS_10420 9584 10174 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_10420 10412 12574 gene locus_tag LOCUS_10430 10412 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 13520 12657 gene locus_tag LOCUS_10440 gene epsB 13520 12657 CDS product protein tyrosine kinase EpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228249.1 protein_id gnl|my_center|LOCUS_10440 14484 13504 gene locus_tag LOCUS_10450 14484 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 16175 14592 gene locus_tag LOCUS_10460 16175 14592 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_10460 16238 16909 gene locus_tag LOCUS_10470 16238 16909 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_10470 17865 16948 gene locus_tag LOCUS_10480 gene epmA 17865 16948 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_10480 18431 17868 gene locus_tag LOCUS_10490 gene efp 18431 17868 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_10490 18652 19143 gene locus_tag LOCUS_10500 18652 19143 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_10500 19140 19646 gene locus_tag LOCUS_10510 19140 19646 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence040 1194 1694 gene locus_tag LOCUS_10520 1194 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1707 1997 gene locus_tag LOCUS_10530 1707 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1994 2191 gene locus_tag LOCUS_10540 1994 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2193 2366 gene locus_tag LOCUS_10550 2193 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2363 2560 gene locus_tag LOCUS_10560 2363 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2824 3093 gene locus_tag LOCUS_10570 2824 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3095 3403 gene locus_tag LOCUS_10580 3095 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3403 3759 gene locus_tag LOCUS_10590 3403 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5191 4400 gene locus_tag LOCUS_10600 5191 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5124 5405 gene locus_tag LOCUS_10610 5124 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5414 6229 gene locus_tag LOCUS_10620 5414 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6240 6551 gene locus_tag LOCUS_10630 6240 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6902 6642 gene locus_tag LOCUS_10640 6902 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7134 7358 gene locus_tag LOCUS_10650 7134 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7408 7785 gene locus_tag LOCUS_10660 7408 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 7785 8825 gene locus_tag LOCUS_10670 7785 8825 CDS product protein finQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080543.1 protein_id gnl|my_center|LOCUS_10670 8822 9013 gene locus_tag LOCUS_10680 8822 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10359 9211 gene locus_tag LOCUS_10690 10359 9211 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_10690 10645 10364 gene locus_tag LOCUS_10700 10645 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 11235 10747 gene locus_tag LOCUS_10710 11235 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 11308 11514 gene locus_tag LOCUS_10720 11308 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11650 12375 gene locus_tag LOCUS_10730 11650 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12746 14218 gene locus_tag LOCUS_10740 12746 14218 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937499.1 protein_id gnl|my_center|LOCUS_10740 14549 15970 gene locus_tag LOCUS_10750 14549 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 15996 17342 gene locus_tag LOCUS_10760 15996 17342 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940138.1 protein_id gnl|my_center|LOCUS_10760 17335 18090 gene locus_tag LOCUS_10770 17335 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940137.1 protein_id gnl|my_center|LOCUS_10770 18094 18927 gene locus_tag LOCUS_10780 18094 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence041 346 185 gene locus_tag LOCUS_10790 346 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1446 421 gene locus_tag LOCUS_10800 1446 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3116 1467 gene locus_tag LOCUS_10810 gene mshL 3116 1467 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_10810 4929 3151 gene locus_tag LOCUS_10820 4929 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5529 5032 gene locus_tag LOCUS_10830 5529 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6348 5701 gene locus_tag LOCUS_10840 6348 5701 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_10840 6943 6362 gene locus_tag LOCUS_10850 6943 6362 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_10850 8001 6955 gene locus_tag LOCUS_10860 gene pilM 8001 6955 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_10860 8363 9013 gene locus_tag LOCUS_10870 gene lepB 8363 9013 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_10870 9038 9970 gene locus_tag LOCUS_10880 9038 9970 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_10880 10048 11331 gene locus_tag LOCUS_10890 10048 11331 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_10890 12116 11445 gene locus_tag LOCUS_10900 gene sfsA 12116 11445 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_10900 12368 13588 gene locus_tag LOCUS_10910 12368 13588 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_10910 13585 14028 gene locus_tag LOCUS_10920 gene rimI 13585 14028 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_10920 14237 15427 gene locus_tag LOCUS_10930 gene pgk 14237 15427 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_10930 15438 16193 gene locus_tag LOCUS_10940 gene tpiA 15438 16193 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_10940 16190 16597 gene locus_tag LOCUS_10950 16190 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 16623 16708 gene locus_tag LOCUS_t00220 16623 16708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16970 16767 gene locus_tag LOCUS_10960 16970 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16957 18123 gene locus_tag LOCUS_10970 16957 18123 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_10970 18851 18072 gene locus_tag LOCUS_10980 gene ispH 18851 18072 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446429.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence042 2284 593 gene locus_tag LOCUS_10990 2284 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4087 2516 gene locus_tag LOCUS_11000 4087 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4594 4208 gene locus_tag LOCUS_11010 4594 4208 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_11010 6202 4640 gene locus_tag LOCUS_11020 6202 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6648 6199 gene locus_tag LOCUS_11030 6648 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 7473 7087 gene locus_tag LOCUS_11040 7473 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8891 7473 gene locus_tag LOCUS_11050 8891 7473 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_11050 10081 8975 gene locus_tag LOCUS_11060 10081 8975 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_11060 12639 10078 gene locus_tag LOCUS_11070 12639 10078 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791698.1 protein_id gnl|my_center|LOCUS_11070 13684 12686 gene locus_tag LOCUS_11080 gene thiL 13684 12686 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_11080 15477 13684 gene locus_tag LOCUS_11090 gene ptsP 15477 13684 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_11090 15788 15474 gene locus_tag LOCUS_11100 15788 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 16190 15816 gene locus_tag LOCUS_11110 16190 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence043 <1 1271 gene locus_tag LOCUS_11120 <1 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337967.1:flagellin 1353 1706 gene locus_tag LOCUS_11130 1353 1706 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080293.1 protein_id gnl|my_center|LOCUS_11130 1740 3098 gene locus_tag LOCUS_11140 gene fliD 1740 3098 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_11140 3108 3557 gene locus_tag LOCUS_11150 gene fliS 3108 3557 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_11150 3581 3973 gene locus_tag LOCUS_11160 3581 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 5874 3970 gene locus_tag LOCUS_11170 5874 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6260 6269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6435 7127 gene locus_tag LOCUS_11180 6435 7127 CDS product DUF5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943660.1 protein_id gnl|my_center|LOCUS_11180 7326 7952 gene locus_tag LOCUS_11190 7326 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7965 9326 gene locus_tag LOCUS_11200 7965 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 9341 9640 gene locus_tag LOCUS_11210 9341 9640 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 protein_id gnl|my_center|LOCUS_11210 9763 10164 gene locus_tag LOCUS_11220 9763 10164 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548117.1 protein_id gnl|my_center|LOCUS_11220 10234 10839 gene locus_tag LOCUS_11230 10234 10839 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_11230 11059 13596 gene locus_tag LOCUS_11240 11059 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 13705 14277 gene locus_tag LOCUS_11250 13705 14277 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_11250 14374 16020 gene locus_tag LOCUS_11260 gene pilB 14374 16020 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence044 <1 902 gene locus_tag LOCUS_11270 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941139.1:ATP-binding protein 899 2242 gene locus_tag LOCUS_11280 899 2242 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_11280 2748 2401 gene locus_tag LOCUS_11290 2748 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3305 4534 gene locus_tag LOCUS_11300 3305 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4578 6137 gene locus_tag LOCUS_11310 4578 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6191 7120 gene locus_tag LOCUS_11320 6191 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7117 9810 gene locus_tag LOCUS_11330 7117 9810 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_11330 10172 11317 gene locus_tag LOCUS_11340 10172 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 12879 11314 gene locus_tag LOCUS_11350 12879 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 13724 12876 gene locus_tag LOCUS_11360 13724 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 14008 13832 gene locus_tag LOCUS_11370 14008 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15038 15241 gene locus_tag LOCUS_11380 15038 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16731 15571 gene locus_tag LOCUS_11390 16731 15571 CDS product IS4-like element ISGsu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence045 402 61 gene locus_tag LOCUS_11400 402 61 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_11400 1141 470 gene locus_tag LOCUS_11410 1141 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2244 1150 gene locus_tag LOCUS_11420 2244 1150 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927125.1 protein_id gnl|my_center|LOCUS_11420 2637 2365 gene locus_tag LOCUS_11430 2637 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3532 2822 gene locus_tag LOCUS_11440 3532 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5332 4130 gene locus_tag LOCUS_11450 5332 4130 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_11450 8709 5329 gene locus_tag LOCUS_11460 8709 5329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_11460 9280 8696 gene locus_tag LOCUS_11470 9280 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 10019 9567 gene locus_tag LOCUS_11480 10019 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 11425 10019 gene locus_tag LOCUS_11490 11425 10019 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_11490 12999 11560 gene locus_tag LOCUS_11500 12999 11560 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_11500 15958 13076 gene locus_tag LOCUS_11510 15958 13076 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_11510 <16806 15976 gene locus_tag LOCUS_11520 <16806 15976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942261.1:DNA polymerase IV >Feature sequence046 3354 478 gene locus_tag LOCUS_11530 3354 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5213 3351 gene locus_tag LOCUS_11540 5213 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 6439 5594 gene locus_tag LOCUS_11550 6439 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7314 6520 gene locus_tag LOCUS_11560 7314 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7825 7442 gene locus_tag LOCUS_11570 7825 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 10397 7785 gene locus_tag LOCUS_11580 10397 7785 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_11580 11401 10616 gene locus_tag LOCUS_11590 11401 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 12336 11404 gene locus_tag LOCUS_11600 12336 11404 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_11600 14180 12807 gene locus_tag LOCUS_11610 14180 12807 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_11610 15631 14177 gene locus_tag LOCUS_11620 15631 14177 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_11620 16190 16659 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtaatcccctctgatcggggcatttcttcaaac >Feature sequence047 922 308 gene locus_tag LOCUS_11630 gene bcrC 922 308 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_11630 1656 1225 gene locus_tag LOCUS_11640 1656 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3306 1933 gene locus_tag LOCUS_11650 3306 1933 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939857.1 protein_id gnl|my_center|LOCUS_11650 4103 3363 gene locus_tag LOCUS_11660 4103 3363 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311306.1 protein_id gnl|my_center|LOCUS_11660 5037 4144 gene locus_tag LOCUS_11670 5037 4144 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_11670 5298 5759 gene locus_tag LOCUS_11680 5298 5759 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_11680 5870 6271 gene locus_tag LOCUS_11690 5870 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7212 6403 gene locus_tag LOCUS_11700 7212 6403 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_11700 8080 7223 gene locus_tag LOCUS_11710 gene ubiA 8080 7223 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_11710 8740 8183 gene locus_tag LOCUS_11720 8740 8183 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_11720 9483 8779 gene locus_tag LOCUS_11730 9483 8779 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_11730 10339 9515 gene locus_tag LOCUS_11740 10339 9515 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_11740 11485 10343 gene locus_tag LOCUS_11750 11485 10343 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_11750 12720 11662 gene locus_tag LOCUS_11760 gene mqnC 12720 11662 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_11760 13820 12726 gene locus_tag LOCUS_11770 gene mqnE 13820 12726 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_11770 15304 13979 gene locus_tag LOCUS_11780 15304 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence048 <1 1358 gene locus_tag LOCUS_11790 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392714.1:ASKHA domain-containing protein 1407 2597 gene locus_tag LOCUS_11800 1407 2597 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_11800 3135 2530 gene locus_tag LOCUS_11810 3135 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4904 3171 gene locus_tag LOCUS_11820 4904 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6345 4882 gene locus_tag LOCUS_11830 6345 4882 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_11830 8501 6342 gene locus_tag LOCUS_11840 8501 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 9357 8512 gene locus_tag LOCUS_11850 9357 8512 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_11850 9790 9428 gene locus_tag LOCUS_11860 9790 9428 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_11860 11305 9938 gene locus_tag LOCUS_11870 11305 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11499 11984 gene locus_tag LOCUS_11880 11499 11984 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_11880 12162 12494 gene locus_tag LOCUS_11890 12162 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 12510 12794 gene locus_tag LOCUS_11900 12510 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 13482 15047 gene locus_tag LOCUS_11910 gene rny 13482 15047 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_11910 15095 16318 gene locus_tag LOCUS_11920 gene tyrS 15095 16318 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence049 3078 1588 gene locus_tag LOCUS_11930 3078 1588 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_11930 3381 4382 gene locus_tag LOCUS_11940 gene pseB 3381 4382 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_11940 4379 5551 gene locus_tag LOCUS_11950 gene pseC 4379 5551 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_11950 6655 5600 gene locus_tag LOCUS_11960 6655 5600 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460776.1 protein_id gnl|my_center|LOCUS_11960 8722 6683 gene locus_tag LOCUS_11970 8722 6683 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073151.1 protein_id gnl|my_center|LOCUS_11970 9963 8719 gene locus_tag LOCUS_11980 9963 8719 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_11980 10705 9956 gene locus_tag LOCUS_11990 gene fabG 10705 9956 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_11990 12012 10723 gene locus_tag LOCUS_12000 12012 10723 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_12000 12680 12009 gene locus_tag LOCUS_12010 12680 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 13978 12770 gene locus_tag LOCUS_12020 gene csaB 13978 12770 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_12020 15561 14323 gene locus_tag LOCUS_12030 15561 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence050 1916 1011 gene locus_tag LOCUS_12040 1916 1011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_12040 3007 2054 gene locus_tag LOCUS_12050 3007 2054 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_12050 3405 4700 gene locus_tag LOCUS_12060 3405 4700 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_12060 4955 6061 gene locus_tag LOCUS_12070 gene carA 4955 6061 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_12070 6102 9326 gene locus_tag LOCUS_12080 gene carB 6102 9326 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_12080 9611 11560 gene locus_tag LOCUS_12090 gene ftsH 9611 11560 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_12090 11804 12625 gene locus_tag LOCUS_12100 gene folP 11804 12625 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_12100 13100 15073 gene locus_tag LOCUS_12110 13100 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 15436 15744 gene locus_tag LOCUS_12120 15436 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence051 683 605 gene locus_tag LOCUS_t00230 683 605 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1963 4830 gene locus_tag LOCUS_12130 1963 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6276 4918 gene locus_tag LOCUS_12140 gene aggA 6276 4918 CDS product type I protein secretion system protein AggA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 protein_id gnl|my_center|LOCUS_12140 9750 6517 gene locus_tag LOCUS_12150 9750 6517 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_12150 11003 9747 gene locus_tag LOCUS_12160 11003 9747 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096739.1 protein_id gnl|my_center|LOCUS_12160 11551 11003 gene locus_tag LOCUS_12170 11551 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 12392 11769 gene locus_tag LOCUS_12180 12392 11769 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943877.1 protein_id gnl|my_center|LOCUS_12180 12943 12629 gene locus_tag LOCUS_12190 12943 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 13574 12933 gene locus_tag LOCUS_12200 gene plsY 13574 12933 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_12200 13776 13579 gene locus_tag LOCUS_12210 13776 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 14048 14560 gene locus_tag LOCUS_12220 gene def 14048 14560 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_12220 14557 15525 gene locus_tag LOCUS_12230 gene fmt 14557 15525 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence052 578 39 gene locus_tag LOCUS_12240 578 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 910 632 gene locus_tag LOCUS_12250 910 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 807 1469 gene locus_tag LOCUS_12260 807 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1466 3358 gene locus_tag LOCUS_12270 gene ftsH 1466 3358 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081278.1 protein_id gnl|my_center|LOCUS_12270 3364 4692 gene locus_tag LOCUS_12280 3364 4692 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_12280 4732 5379 gene locus_tag LOCUS_12290 4732 5379 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_12290 5437 6183 gene locus_tag LOCUS_12300 5437 6183 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_12300 7142 6123 gene locus_tag LOCUS_12310 7142 6123 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_12310 7453 7932 gene locus_tag LOCUS_12320 gene folA 7453 7932 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_12320 8265 8399 gene locus_tag LOCUS_12330 8265 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8535 10076 gene locus_tag LOCUS_12340 gene sbtM 8535 10076 CDS product thio(seleno)oxazole modification radical SAM maturase SbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045007.1 protein_id gnl|my_center|LOCUS_12340 10310 10086 gene locus_tag LOCUS_12350 10310 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10200 10832 gene locus_tag LOCUS_12360 10200 10832 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_12360 10962 11411 gene locus_tag LOCUS_12370 gene dtd 10962 11411 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_12370 11539 14484 gene locus_tag LOCUS_12380 11539 14484 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_12380 14858 15769 gene locus_tag LOCUS_12390 14858 15769 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence053 2221 1376 gene locus_tag LOCUS_12400 2221 1376 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_12400 2371 3906 gene locus_tag LOCUS_12410 gene rng 2371 3906 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_12410 3994 5379 gene locus_tag LOCUS_12420 3994 5379 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_12420 5480 6907 gene locus_tag LOCUS_12430 5480 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 7573 6938 gene locus_tag LOCUS_12440 7573 6938 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_12440 7941 9530 gene locus_tag LOCUS_12450 7941 9530 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_12450 9582 10031 gene locus_tag LOCUS_12460 9582 10031 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_12460 11402 10065 gene locus_tag LOCUS_12470 11402 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 13161 11470 gene locus_tag LOCUS_12480 13161 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 <16008 13163 gene locus_tag LOCUS_12490 <16008 13163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943878.1:UvrD-helicase domain-containing protein >Feature sequence054 <1 901 gene locus_tag LOCUS_12500 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188687.1:LOG family protein 898 2289 gene locus_tag LOCUS_12510 898 2289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_12510 2410 2886 gene locus_tag LOCUS_12520 2410 2886 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_12520 4075 3017 gene locus_tag LOCUS_12530 gene recA 4075 3017 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_12530 5468 4146 gene locus_tag LOCUS_12540 5468 4146 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_12540 7012 5699 gene locus_tag LOCUS_12550 gene mtaB 7012 5699 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_12550 8074 7034 gene locus_tag LOCUS_12560 gene mnmA 8074 7034 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_12560 8610 8236 gene locus_tag LOCUS_12570 8610 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9655 8873 gene locus_tag LOCUS_12580 9655 8873 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_12580 10006 9710 gene locus_tag LOCUS_12590 10006 9710 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608713.1 protein_id gnl|my_center|LOCUS_12590 10348 10160 gene locus_tag LOCUS_12600 10348 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11106 10345 gene locus_tag LOCUS_12610 11106 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 11201 12466 gene locus_tag LOCUS_12620 11201 12466 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_12620 12514 13584 gene locus_tag LOCUS_12630 12514 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 13839 14420 gene locus_tag LOCUS_12640 13839 14420 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_12640 14365 15399 gene locus_tag LOCUS_12650 14365 15399 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928968.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence055 <1 1006 gene locus_tag LOCUS_12660 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392119.1:radical SAM family heme chaperone HemW 1239 5054 gene locus_tag LOCUS_12670 gene purL 1239 5054 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544968.1 protein_id gnl|my_center|LOCUS_12670 5138 7663 gene locus_tag LOCUS_12680 5138 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7852 8046 gene locus_tag LOCUS_12690 7852 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 8100 8486 gene locus_tag LOCUS_12700 8100 8486 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_12700 8520 8717 gene locus_tag LOCUS_12710 8520 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 9687 8779 gene locus_tag LOCUS_12720 9687 8779 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_12720 9874 10371 gene locus_tag LOCUS_12730 9874 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 11637 10474 gene locus_tag LOCUS_12740 11637 10474 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_12740 13845 11734 gene locus_tag LOCUS_12750 13845 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 14615 13842 gene locus_tag LOCUS_12760 14615 13842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944003.1 protein_id gnl|my_center|LOCUS_12760 15624 14590 gene locus_tag LOCUS_12770 15624 14590 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence056 1167 427 gene locus_tag LOCUS_12780 1167 427 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_12780 2159 1425 gene locus_tag LOCUS_12790 2159 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2851 2159 gene locus_tag LOCUS_12800 2851 2159 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_12800 4554 2923 gene locus_tag LOCUS_12810 gene hcp 4554 2923 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_12810 4689 5360 gene locus_tag LOCUS_12820 4689 5360 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_12820 5716 5378 gene locus_tag LOCUS_12830 5716 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6504 5713 gene locus_tag LOCUS_12840 6504 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7766 6867 gene locus_tag LOCUS_12850 gene nhaR 7766 6867 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_12850 8306 9139 gene locus_tag LOCUS_12860 gene ccsB 8306 9139 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_12860 9368 11392 gene locus_tag LOCUS_12870 9368 11392 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939577.1 protein_id gnl|my_center|LOCUS_12870 11716 14631 gene locus_tag LOCUS_12880 11716 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 14878 14639 gene locus_tag LOCUS_12890 14878 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 >Feature sequence057 474 1694 gene locus_tag LOCUS_12900 474 1694 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_12900 2071 2535 gene locus_tag LOCUS_12910 gene ribH 2071 2535 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_12910 2606 3367 gene locus_tag LOCUS_12920 2606 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3815 5998 gene locus_tag LOCUS_12930 3815 5998 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_12930 6503 6928 gene locus_tag LOCUS_12940 gene aprB 6503 6928 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_12940 6993 9008 gene locus_tag LOCUS_12950 gene aprA 6993 9008 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_12950 9178 10431 gene locus_tag LOCUS_12960 9178 10431 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_12960 10443 12704 gene locus_tag LOCUS_12970 10443 12704 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_12970 12840 14045 gene locus_tag LOCUS_12980 gene qmoC 12840 14045 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_12980 14214 14223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14495 14570 gene locus_tag LOCUS_t00240 14495 14570 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14591 14675 gene locus_tag LOCUS_t00250 14591 14675 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 14740 14815 gene locus_tag LOCUS_t00260 14740 14815 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14869 14943 gene locus_tag LOCUS_t00270 14869 14943 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence058 429 1247 gene locus_tag LOCUS_12990 gene ccsB 429 1247 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_12990 1237 2526 gene locus_tag LOCUS_13000 gene hemA 1237 2526 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_13000 2526 3035 gene locus_tag LOCUS_13010 2526 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3038 4009 gene locus_tag LOCUS_13020 3038 4009 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141858.1 protein_id gnl|my_center|LOCUS_13020 4674 4012 gene locus_tag LOCUS_13030 4674 4012 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_13030 6108 4819 gene locus_tag LOCUS_13040 6108 4819 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_13040 7333 6149 gene locus_tag LOCUS_13050 gene thiH 7333 6149 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_13050 8115 7330 gene locus_tag LOCUS_13060 8115 7330 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_13060 8317 8117 gene locus_tag LOCUS_13070 8317 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9269 8466 gene locus_tag LOCUS_13080 gene thiF 9269 8466 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_13080 10281 9274 gene locus_tag LOCUS_13090 10281 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 11324 10338 gene locus_tag LOCUS_13100 11324 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 11674 12045 gene locus_tag LOCUS_13110 11674 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 12070 13089 gene locus_tag LOCUS_13120 12070 13089 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_13120 14301 13111 gene locus_tag LOCUS_13130 14301 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 14681 14570 gene locus_tag LOCUS_r00010 14681 14570 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence059 517 1101 gene locus_tag LOCUS_13140 517 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1206 2393 gene locus_tag LOCUS_13150 1206 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2410 3696 gene locus_tag LOCUS_13160 2410 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 5232 4180 gene locus_tag LOCUS_13170 5232 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7200 5422 gene locus_tag LOCUS_13180 7200 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9779 7581 gene locus_tag LOCUS_13190 9779 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 10704 9841 gene locus_tag LOCUS_13200 10704 9841 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_13200 11769 10846 gene locus_tag LOCUS_13210 11769 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 12671 11766 gene locus_tag LOCUS_13220 12671 11766 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_13220 13732 12677 gene locus_tag LOCUS_13230 13732 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence060 58 204 gene locus_tag LOCUS_13240 58 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 201 641 gene locus_tag LOCUS_13250 201 641 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_13250 647 1447 gene locus_tag LOCUS_13260 647 1447 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_13260 1457 1690 gene locus_tag LOCUS_13270 1457 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1721 2767 gene locus_tag LOCUS_13280 1721 2767 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_13280 2761 3636 gene locus_tag LOCUS_13290 2761 3636 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_13290 3629 5284 gene locus_tag LOCUS_13300 3629 5284 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_13300 5299 6336 gene locus_tag LOCUS_13310 5299 6336 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_13310 6490 6921 gene locus_tag LOCUS_13320 6490 6921 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_13320 6918 7658 gene locus_tag LOCUS_13330 6918 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7703 8200 gene locus_tag LOCUS_13340 7703 8200 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083275.1 protein_id gnl|my_center|LOCUS_13340 8205 9728 gene locus_tag LOCUS_13350 gene atpA 8205 9728 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_13350 9750 10628 gene locus_tag LOCUS_13360 9750 10628 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_13360 10675 12096 gene locus_tag LOCUS_13370 gene atpD 10675 12096 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_13370 12127 12543 gene locus_tag LOCUS_13380 12127 12543 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_13380 12700 14112 gene locus_tag LOCUS_13390 gene gltA 12700 14112 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence061 1644 313 gene locus_tag LOCUS_13400 gene glnA 1644 313 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_13400 4378 1787 gene locus_tag LOCUS_13410 gene glnD 4378 1787 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_13410 4865 4527 gene locus_tag LOCUS_13420 gene glnB 4865 4527 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_13420 6435 5218 gene locus_tag LOCUS_13430 6435 5218 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_13430 7839 6625 gene locus_tag LOCUS_13440 7839 6625 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_13440 8315 8683 gene locus_tag LOCUS_13450 8315 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10116 8677 gene locus_tag LOCUS_13460 10116 8677 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_13460 11732 10359 gene locus_tag LOCUS_13470 11732 10359 CDS product phosphohexose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506571.1 protein_id gnl|my_center|LOCUS_13470 11887 12780 gene locus_tag LOCUS_13480 gene rfbA 11887 12780 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938224.1 protein_id gnl|my_center|LOCUS_13480 12777 13655 gene locus_tag LOCUS_13490 gene rfbD 12777 13655 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_13490 <14241 13657 gene locus_tag LOCUS_13500 <14241 13657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583102.1:UPF0280 family protein >Feature sequence062 190 1560 gene locus_tag LOCUS_13510 190 1560 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_13510 1541 2305 gene locus_tag LOCUS_13520 1541 2305 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_13520 2309 3841 gene locus_tag LOCUS_13530 2309 3841 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_13530 4317 4550 gene locus_tag LOCUS_13540 4317 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4574 6892 gene locus_tag LOCUS_13550 gene napA 4574 6892 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784576.1 protein_id gnl|my_center|LOCUS_13550 6892 7536 gene locus_tag LOCUS_13560 6892 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7553 8179 gene locus_tag LOCUS_13570 7553 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8194 9156 gene locus_tag LOCUS_13580 8194 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 9189 10424 gene locus_tag LOCUS_13590 gene nrfD 9189 10424 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_13590 11343 11104 gene locus_tag LOCUS_13600 11343 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11239 13788 gene locus_tag LOCUS_13610 11239 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence063 458 177 gene locus_tag LOCUS_13620 gene ihfB 458 177 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_13620 2321 582 gene locus_tag LOCUS_13630 2321 582 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_13630 3430 2747 gene locus_tag LOCUS_13640 3430 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4645 3470 gene locus_tag LOCUS_13650 4645 3470 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_13650 4784 6613 gene locus_tag LOCUS_13660 gene ilvD 4784 6613 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_13660 6617 7339 gene locus_tag LOCUS_13670 6617 7339 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_13670 7360 7974 gene locus_tag LOCUS_13680 7360 7974 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807327.1 protein_id gnl|my_center|LOCUS_13680 8418 8170 gene locus_tag LOCUS_13690 8418 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8338 13398 gene locus_tag LOCUS_13700 8338 13398 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence064 <1 761 gene locus_tag LOCUS_13710 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256327.1:replication-associated recombination protein A 745 897 gene locus_tag LOCUS_13720 745 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1084 2367 gene locus_tag LOCUS_13730 1084 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3360 2437 gene locus_tag LOCUS_13740 3360 2437 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938927.1 protein_id gnl|my_center|LOCUS_13740 3790 4773 gene locus_tag LOCUS_13750 3790 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5835 5116 gene locus_tag LOCUS_13760 5835 5116 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_13760 5947 6723 gene locus_tag LOCUS_13770 5947 6723 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_13770 7518 6772 gene locus_tag LOCUS_13780 7518 6772 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814165.1 protein_id gnl|my_center|LOCUS_13780 8985 7636 gene locus_tag LOCUS_13790 gene gdhA 8985 7636 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_13790 11977 8978 gene locus_tag LOCUS_13800 11977 8978 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_13800 12715 13626 gene locus_tag LOCUS_13810 12715 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 13642 13935 gene locus_tag LOCUS_13820 13642 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence065 1738 3855 gene locus_tag LOCUS_13830 1738 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4683 3907 gene locus_tag LOCUS_13840 gene trpA 4683 3907 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_13840 6022 4787 gene locus_tag LOCUS_13850 gene trpB 6022 4787 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_13850 7727 6123 gene locus_tag LOCUS_13860 7727 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8698 7880 gene locus_tag LOCUS_13870 8698 7880 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_13870 9089 9700 gene locus_tag LOCUS_13880 9089 9700 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_13880 9773 11701 gene locus_tag LOCUS_13890 9773 11701 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_13890 11720 12484 gene locus_tag LOCUS_13900 11720 12484 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_13900 12785 12630 gene locus_tag LOCUS_13910 12785 12630 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092374840.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence066 969 814 gene locus_tag LOCUS_13920 969 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1700 987 gene locus_tag LOCUS_13930 1700 987 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091600.1 protein_id gnl|my_center|LOCUS_13930 2296 1844 gene locus_tag LOCUS_13940 2296 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4603 2384 gene locus_tag LOCUS_13950 4603 2384 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_13950 6360 4639 gene locus_tag LOCUS_13960 6360 4639 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_13960 7516 6428 gene locus_tag LOCUS_13970 gene ispG 7516 6428 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_13970 8334 7582 gene locus_tag LOCUS_13980 gene tsaB 8334 7582 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_13980 9404 8319 gene locus_tag LOCUS_13990 gene rseP 9404 8319 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_13990 10658 9486 gene locus_tag LOCUS_14000 10658 9486 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_14000 11452 10655 gene locus_tag LOCUS_14010 11452 10655 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_14010 12203 11457 gene locus_tag LOCUS_14020 12203 11457 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_14020 12769 12218 gene locus_tag LOCUS_14030 gene frr 12769 12218 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_14030 <13590 12890 gene locus_tag LOCUS_14040 <13590 12890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919787.1:UMP kinase >Feature sequence067 578 1258 gene locus_tag LOCUS_14050 578 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1260 2189 gene locus_tag LOCUS_14060 1260 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2267 3448 gene locus_tag LOCUS_14070 gene nrfD 2267 3448 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_14070 3630 5975 gene locus_tag LOCUS_14080 gene extM 3630 5975 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_14080 7011 6367 gene locus_tag LOCUS_14090 7011 6367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_14090 9332 7008 gene locus_tag LOCUS_14100 9332 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 10039 10233 gene locus_tag LOCUS_14110 gene rpmB 10039 10233 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_14110 10418 10675 gene locus_tag LOCUS_14120 10418 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 11841 10705 gene locus_tag LOCUS_14130 gene dinB 11841 10705 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860981.1 protein_id gnl|my_center|LOCUS_14130 12100 11831 gene locus_tag LOCUS_14140 12100 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938093.1 protein_id gnl|my_center|LOCUS_14140 13222 12395 gene locus_tag LOCUS_14150 13222 12395 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227246.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence068 31 384 gene locus_tag LOCUS_14160 31 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 847 1281 gene locus_tag LOCUS_14170 847 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1241 1594 gene locus_tag LOCUS_14180 1241 1594 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_14180 1683 2096 gene locus_tag LOCUS_14190 1683 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3585 2281 gene locus_tag LOCUS_14200 gene nhaA 3585 2281 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_14200 4252 3860 gene locus_tag LOCUS_14210 4252 3860 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_14210 4841 4996 gene locus_tag LOCUS_14220 4841 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5130 5450 gene locus_tag LOCUS_14230 5130 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5490 5843 gene locus_tag LOCUS_14240 5490 5843 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_14240 5909 6787 gene locus_tag LOCUS_14250 5909 6787 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_14250 6780 7649 gene locus_tag LOCUS_14260 6780 7649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_14260 7736 8056 gene locus_tag LOCUS_14270 7736 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8295 8564 gene locus_tag LOCUS_14280 8295 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8650 8964 gene locus_tag LOCUS_14290 8650 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 10099 9074 gene locus_tag LOCUS_14300 10099 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10791 10096 gene locus_tag LOCUS_14310 10791 10096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792728.1 protein_id gnl|my_center|LOCUS_14310 11742 10921 gene locus_tag LOCUS_14320 11742 10921 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_14320 12748 11822 gene locus_tag LOCUS_14330 12748 11822 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791454.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence069 1316 207 gene locus_tag LOCUS_14340 1316 207 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 protein_id gnl|my_center|LOCUS_14340 1678 1313 gene locus_tag LOCUS_14350 1678 1313 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_14350 3225 1780 gene locus_tag LOCUS_14360 gene htrA 3225 1780 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_14360 3852 3433 gene locus_tag LOCUS_14370 3852 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4557 3862 gene locus_tag LOCUS_14380 4557 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14380 5663 4635 gene locus_tag LOCUS_14390 gene glk 5663 4635 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812576.1 protein_id gnl|my_center|LOCUS_14390 7293 5854 gene locus_tag LOCUS_14400 7293 5854 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974857.1 protein_id gnl|my_center|LOCUS_14400 7669 7277 gene locus_tag LOCUS_14410 7669 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 8595 7675 gene locus_tag LOCUS_14420 8595 7675 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_14420 9361 8726 gene locus_tag LOCUS_14430 9361 8726 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 protein_id gnl|my_center|LOCUS_14430 9638 9453 gene locus_tag LOCUS_14440 9638 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10446 9670 gene locus_tag LOCUS_14450 10446 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 12083 10533 gene locus_tag LOCUS_14460 gene guaA 12083 10533 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_14460 <12872 12144 gene locus_tag LOCUS_14470 <12872 12144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938343.1:IMP dehydrogenase >Feature sequence070 <1 1787 gene locus_tag LOCUS_14480 <1 1787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211627.1:exodeoxyribonuclease V subunit gamma 1774 5526 gene locus_tag LOCUS_14490 gene recB 1774 5526 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 protein_id gnl|my_center|LOCUS_14490 5523 7424 gene locus_tag LOCUS_14500 gene recD 5523 7424 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775983.1 protein_id gnl|my_center|LOCUS_14500 7982 10690 gene locus_tag LOCUS_14510 7982 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10917 11852 gene locus_tag LOCUS_14520 10917 11852 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_14520 11929 12621 gene locus_tag LOCUS_14530 11929 12621 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence071 <1 1010 gene locus_tag LOCUS_14540 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680885.1:TraB/GumN family protein 1154 1495 gene locus_tag LOCUS_14550 gene yhbY 1154 1495 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 protein_id gnl|my_center|LOCUS_14550 1579 5370 gene locus_tag LOCUS_14560 1579 5370 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_14560 6620 5469 gene locus_tag LOCUS_14570 6620 5469 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_14570 7497 6703 gene locus_tag LOCUS_14580 7497 6703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_14580 8381 7494 gene locus_tag LOCUS_14590 8381 7494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067273.1 protein_id gnl|my_center|LOCUS_14590 9393 8434 gene locus_tag LOCUS_14600 9393 8434 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389859.1 protein_id gnl|my_center|LOCUS_14600 11943 9595 gene locus_tag LOCUS_14610 11943 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 12368 11940 gene locus_tag LOCUS_14620 12368 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence072 273 551 gene locus_tag LOCUS_14630 273 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 688 2316 gene locus_tag LOCUS_14640 688 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2404 2601 gene locus_tag LOCUS_14650 2404 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2711 3208 gene locus_tag LOCUS_14660 2711 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3210 3788 gene locus_tag LOCUS_14670 3210 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4025 5953 gene locus_tag LOCUS_14680 4025 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5953 6696 gene locus_tag LOCUS_14690 5953 6696 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_14690 6769 8442 gene locus_tag LOCUS_14700 6769 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8903 8550 gene locus_tag LOCUS_14710 8903 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9669 8863 gene locus_tag LOCUS_14720 9669 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 9919 10098 gene locus_tag LOCUS_14730 9919 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10328 11875 gene locus_tag LOCUS_14740 10328 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence073 492 1127 gene locus_tag LOCUS_14750 492 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1262 1014 gene locus_tag LOCUS_14760 1262 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2158 1286 gene locus_tag LOCUS_14770 2158 1286 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_14770 2447 3703 gene locus_tag LOCUS_14780 2447 3703 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_14780 3766 4158 gene locus_tag LOCUS_14790 3766 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4403 5533 gene locus_tag LOCUS_14800 4403 5533 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197328.1 protein_id gnl|my_center|LOCUS_14800 5555 6670 gene locus_tag LOCUS_14810 5555 6670 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_14810 6670 8214 gene locus_tag LOCUS_14820 6670 8214 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_14820 8211 9260 gene locus_tag LOCUS_14830 8211 9260 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_14830 9264 10298 gene locus_tag LOCUS_14840 9264 10298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_14840 11317 10403 gene locus_tag LOCUS_14850 11317 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 11595 11320 gene locus_tag LOCUS_14860 11595 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence074 328 1467 gene locus_tag LOCUS_14870 328 1467 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943140.1 protein_id gnl|my_center|LOCUS_14870 1744 3807 gene locus_tag LOCUS_14880 1744 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3807 4448 gene locus_tag LOCUS_14890 3807 4448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_14890 4450 5034 gene locus_tag LOCUS_14900 4450 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5689 5048 gene locus_tag LOCUS_14910 5689 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 8413 5756 gene locus_tag LOCUS_14920 8413 5756 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015774797.1 protein_id gnl|my_center|LOCUS_14920 9507 8410 gene locus_tag LOCUS_14930 9507 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_14930 9851 9660 gene locus_tag LOCUS_14940 9851 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 11500 10070 gene locus_tag LOCUS_14950 gene purF 11500 10070 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence075 1140 304 gene locus_tag LOCUS_14960 gene htpX 1140 304 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_14960 2258 1230 gene locus_tag LOCUS_14970 2258 1230 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_14970 3138 2491 gene locus_tag LOCUS_14980 3138 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4202 3462 gene locus_tag LOCUS_14990 4202 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4301 6106 gene locus_tag LOCUS_15000 4301 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6313 7959 gene locus_tag LOCUS_15010 gene rpoD 6313 7959 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_15010 8075 9226 gene locus_tag LOCUS_15020 gene dprA 8075 9226 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_15020 9492 10142 gene locus_tag LOCUS_15030 gene rpe 9492 10142 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_15030 10154 11749 gene locus_tag LOCUS_15040 10154 11749 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871730.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence076 745 233 gene locus_tag LOCUS_15050 745 233 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199982.1 protein_id gnl|my_center|LOCUS_15050 863 952 gene locus_tag LOCUS_t00280 863 952 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2002 1109 gene locus_tag LOCUS_15060 2002 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2221 3870 gene locus_tag LOCUS_15070 2221 3870 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_15070 3904 4752 gene locus_tag LOCUS_15080 gene kdsA 3904 4752 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_15080 4745 5380 gene locus_tag LOCUS_15090 4745 5380 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_15090 5377 5949 gene locus_tag LOCUS_15100 5377 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6021 7244 gene locus_tag LOCUS_15110 6021 7244 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_15110 8831 7365 gene locus_tag LOCUS_15120 8831 7365 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_15120 9114 10484 gene locus_tag LOCUS_15130 9114 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11287 10493 gene locus_tag LOCUS_15140 11287 10493 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_15140 11819 11361 gene locus_tag LOCUS_15150 11819 11361 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_15150 <12476 11825 gene locus_tag LOCUS_15160 <12476 11825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393989.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence077 433 227 gene locus_tag LOCUS_15170 433 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1077 724 gene locus_tag LOCUS_15180 1077 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1323 1120 gene locus_tag LOCUS_15190 1323 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15190 4358 1323 gene locus_tag LOCUS_15200 4358 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(4206..4208),aa:Sec) note codon on position 51 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_15200 8789 4545 gene locus_tag LOCUS_15210 gene fdhF 8789 4545 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482725.1 transl_except (pos:complement(6255..6257),aa:Sec) note codon on position 845 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_15210 10293 8938 gene locus_tag LOCUS_15220 gene acsC 10293 8938 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_15220 <12451 10458 gene locus_tag LOCUS_15230 <12451 10458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392716.1:acetyl-CoA decarbonylase/synthase complex subunit alpha/beta >Feature sequence078 208 423 gene locus_tag LOCUS_15240 208 423 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545791.1 protein_id gnl|my_center|LOCUS_15240 859 524 gene locus_tag LOCUS_15250 859 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 876 1289 gene locus_tag LOCUS_15260 876 1289 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635494.1 protein_id gnl|my_center|LOCUS_15260 2092 1304 gene locus_tag LOCUS_15270 gene tatC 2092 1304 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_15270 2797 4068 gene locus_tag LOCUS_15280 gene serS 2797 4068 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_15280 5303 4383 gene locus_tag LOCUS_15290 5303 4383 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937641.1 protein_id gnl|my_center|LOCUS_15290 5507 7951 gene locus_tag LOCUS_15300 5507 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8113 7919 gene locus_tag LOCUS_15310 8113 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8178 9575 gene locus_tag LOCUS_15320 8178 9575 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_15320 9578 10222 gene locus_tag LOCUS_15330 gene queE 9578 10222 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_15330 10232 10927 gene locus_tag LOCUS_15340 gene queC 10232 10927 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_15340 11093 11287 gene locus_tag LOCUS_15350 gene rpsU 11093 11287 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313768.1 protein_id gnl|my_center|LOCUS_15350 11543 11376 gene locus_tag LOCUS_15360 11543 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 11667 12248 gene locus_tag LOCUS_15370 11667 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence079 <1 695 gene locus_tag LOCUS_15380 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073027.1:TRAP transporter substrate-binding protein 881 1426 gene locus_tag LOCUS_15390 881 1426 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_15390 1423 2820 gene locus_tag LOCUS_15400 1423 2820 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_15400 2994 3485 gene locus_tag LOCUS_15410 2994 3485 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103929.1 protein_id gnl|my_center|LOCUS_15410 4088 4465 gene locus_tag LOCUS_15420 4088 4465 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_15420 4472 5722 gene locus_tag LOCUS_15430 4472 5722 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_15430 6135 5764 gene locus_tag LOCUS_15440 6135 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 7086 6274 gene locus_tag LOCUS_15450 7086 6274 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_15450 7531 8499 gene locus_tag LOCUS_15460 7531 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8838 9419 gene locus_tag LOCUS_15470 gene rpoE 8838 9419 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_15470 9388 10509 gene locus_tag LOCUS_15480 9388 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 10506 11447 gene locus_tag LOCUS_15490 10506 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 <12316 11554 gene locus_tag LOCUS_15500 <12316 11554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161937917.1:GlxA family transcriptional regulator >Feature sequence080 1045 2568 gene locus_tag LOCUS_15510 1045 2568 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_15510 3509 2586 gene locus_tag LOCUS_15520 3509 2586 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140474.1 protein_id gnl|my_center|LOCUS_15520 3929 5506 gene locus_tag LOCUS_15530 3929 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 6651 5527 gene locus_tag LOCUS_15540 6651 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7071 10718 gene locus_tag LOCUS_15550 7071 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11128 10880 gene locus_tag LOCUS_15560 11128 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11012 11848 gene locus_tag LOCUS_15570 11012 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence081 136 606 gene locus_tag LOCUS_15580 136 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 606 1976 gene locus_tag LOCUS_15590 606 1976 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_15590 2049 3173 gene locus_tag LOCUS_15600 2049 3173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_15600 3173 3979 gene locus_tag LOCUS_15610 3173 3979 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_15610 3976 4986 gene locus_tag LOCUS_15620 3976 4986 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_15620 4983 5591 gene locus_tag LOCUS_15630 4983 5591 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113920.1 protein_id gnl|my_center|LOCUS_15630 7449 5623 gene locus_tag LOCUS_15640 7449 5623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_15640 9249 7450 gene locus_tag LOCUS_15650 9249 7450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_15650 10303 9302 gene locus_tag LOCUS_15660 10303 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 <12215 10339 gene locus_tag LOCUS_15670 <12215 10339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence082 513 758 gene locus_tag LOCUS_15680 513 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3204 742 gene locus_tag LOCUS_15690 3204 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4996 3209 gene locus_tag LOCUS_15700 4996 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4931 5197 gene locus_tag LOCUS_15710 4931 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5647 6015 gene locus_tag LOCUS_15720 5647 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 6277 8871 gene locus_tag LOCUS_15730 6277 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 9494 8919 gene locus_tag LOCUS_15740 9494 8919 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_15740 10411 9623 gene locus_tag LOCUS_15750 10411 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 11190 10417 gene locus_tag LOCUS_15760 11190 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 11632 11165 gene locus_tag LOCUS_15770 gene rlmH 11632 11165 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_15770 11946 11635 gene locus_tag LOCUS_15780 11946 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence083 2369 600 gene locus_tag LOCUS_15790 2369 600 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706852.1 protein_id gnl|my_center|LOCUS_15790 2607 3539 gene locus_tag LOCUS_15800 2607 3539 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_15800 3653 5203 gene locus_tag LOCUS_15810 3653 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 5358 6275 gene locus_tag LOCUS_15820 gene rarD 5358 6275 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_15820 7431 6487 gene locus_tag LOCUS_15830 7431 6487 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545320.1 protein_id gnl|my_center|LOCUS_15830 9243 7450 gene locus_tag LOCUS_15840 9243 7450 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_15840 11298 9319 gene locus_tag LOCUS_15850 11298 9319 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839181.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence084 996 31 gene locus_tag LOCUS_15860 996 31 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_15860 1308 1748 gene locus_tag LOCUS_15870 1308 1748 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_15870 1753 4128 gene locus_tag LOCUS_15880 gene lon 1753 4128 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_15880 4128 5372 gene locus_tag LOCUS_15890 gene ftsY 4128 5372 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_15890 5551 6390 gene locus_tag LOCUS_15900 gene djlA 5551 6390 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459635.1 protein_id gnl|my_center|LOCUS_15900 6635 7816 gene locus_tag LOCUS_15910 6635 7816 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_15910 9232 7880 gene locus_tag LOCUS_15920 gene glmM 9232 7880 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_15920 10329 9313 gene locus_tag LOCUS_15930 10329 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 11232 10426 gene locus_tag LOCUS_15940 gene cdaA 11232 10426 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence085 2730 709 gene locus_tag LOCUS_15950 2730 709 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_15950 4565 2727 gene locus_tag LOCUS_15960 4565 2727 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_15960 4833 5645 gene locus_tag LOCUS_15970 gene thiD 4833 5645 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242048.1 protein_id gnl|my_center|LOCUS_15970 5661 7370 gene locus_tag LOCUS_15980 5661 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 8010 7660 gene locus_tag LOCUS_15990 8010 7660 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_15990 8178 8966 gene locus_tag LOCUS_16000 8178 8966 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_16000 8968 9924 gene locus_tag LOCUS_16010 8968 9924 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_16010 9929 10585 gene locus_tag LOCUS_16020 9929 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 <12037 10687 gene locus_tag LOCUS_16030 <12037 10687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939485.1:YcaO-like family protein >Feature sequence086 582 1103 gene locus_tag LOCUS_16040 582 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1687 1151 gene locus_tag LOCUS_16050 1687 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3277 1991 gene locus_tag LOCUS_16060 gene ahcY 3277 1991 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_16060 4718 3549 gene locus_tag LOCUS_16070 gene metK 4718 3549 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_16070 6661 4748 gene locus_tag LOCUS_16080 6661 4748 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_16080 8301 6826 gene locus_tag LOCUS_16090 8301 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 9255 8503 gene locus_tag LOCUS_16100 gene fabL 9255 8503 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_16100 10334 9402 gene locus_tag LOCUS_16110 10334 9402 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_16110 <11892 10688 gene locus_tag LOCUS_16120 <11892 10688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943084.1:aconitate hydratase >Feature sequence087 263 541 gene locus_tag LOCUS_16130 gene rpsS 263 541 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_16130 658 990 gene locus_tag LOCUS_16140 gene rplV 658 990 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_16140 1048 1701 gene locus_tag LOCUS_16150 gene rpsC 1048 1701 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_16150 1766 2182 gene locus_tag LOCUS_16160 gene rplP 1766 2182 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950835.1 protein_id gnl|my_center|LOCUS_16160 2179 2370 gene locus_tag LOCUS_16170 gene rpmC 2179 2370 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_16170 2411 2671 gene locus_tag LOCUS_16180 gene rpsQ 2411 2671 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 protein_id gnl|my_center|LOCUS_16180 2729 3097 gene locus_tag LOCUS_16190 gene rplN 2729 3097 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_16190 3153 3491 gene locus_tag LOCUS_16200 gene rplX 3153 3491 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_16200 3518 4060 gene locus_tag LOCUS_16210 gene rplE 3518 4060 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_16210 4076 4300 gene locus_tag LOCUS_16220 4076 4300 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_16220 4464 4856 gene locus_tag LOCUS_16230 gene rpsH 4464 4856 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567538.1 protein_id gnl|my_center|LOCUS_16230 4887 5429 gene locus_tag LOCUS_16240 gene rplF 4887 5429 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722518.1 protein_id gnl|my_center|LOCUS_16240 5447 5812 gene locus_tag LOCUS_16250 gene rplR 5447 5812 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_16250 5867 6379 gene locus_tag LOCUS_16260 gene rpsE 5867 6379 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_16260 6487 6666 gene locus_tag LOCUS_16270 gene rpmD 6487 6666 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943468.1 protein_id gnl|my_center|LOCUS_16270 6670 7113 gene locus_tag LOCUS_16280 gene rplO 6670 7113 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_16280 7114 8418 gene locus_tag LOCUS_16290 gene secY 7114 8418 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_16290 8425 9213 gene locus_tag LOCUS_16300 gene map 8425 9213 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_16300 9325 9561 gene locus_tag LOCUS_16310 gene infA 9325 9561 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_16310 9742 10110 gene locus_tag LOCUS_16320 gene rpsM 9742 10110 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_16320 10160 10558 gene locus_tag LOCUS_16330 gene rpsK 10160 10558 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_16330 10681 11280 gene locus_tag LOCUS_16340 gene rpsD 10681 11280 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence088 994 62 gene locus_tag LOCUS_16350 994 62 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_16350 3045 1147 gene locus_tag LOCUS_16360 3045 1147 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_16360 3657 3220 gene locus_tag LOCUS_16370 3657 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3915 5765 gene locus_tag LOCUS_16380 3915 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 7208 5784 gene locus_tag LOCUS_16390 7208 5784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_16390 8736 7468 gene locus_tag LOCUS_16400 8736 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 9106 9339 gene locus_tag LOCUS_16410 9106 9339 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_16410 9336 9749 gene locus_tag LOCUS_16420 9336 9749 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_16420 11478 9817 gene locus_tag LOCUS_16430 11478 9817 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_16430 11828 11661 gene locus_tag LOCUS_16440 11828 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence089 <1 398 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtaatcccctctgatcggggcatttcttcaaac 1954 818 gene locus_tag LOCUS_16450 1954 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3564 1951 gene locus_tag LOCUS_16460 3564 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4588 3569 gene locus_tag LOCUS_16470 4588 3569 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_16470 5297 4602 gene locus_tag LOCUS_16480 gene csm3 5297 4602 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_16480 5723 5334 gene locus_tag LOCUS_16490 gene csm2 5723 5334 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_16490 8330 5754 gene locus_tag LOCUS_16500 gene cas10 8330 5754 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_16500 9081 8431 gene locus_tag LOCUS_16510 9081 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 11054 9081 gene locus_tag LOCUS_16520 11054 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 <11657 11071 gene locus_tag LOCUS_16530 <11657 11071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545643.1:CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 >Feature sequence090 806 1225 gene locus_tag LOCUS_16540 806 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1225 1953 gene locus_tag LOCUS_16550 gene lptB 1225 1953 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869978.1 protein_id gnl|my_center|LOCUS_16550 1989 3452 gene locus_tag LOCUS_16560 gene rpoN 1989 3452 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_16560 3464 3916 gene locus_tag LOCUS_16570 3464 3916 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_16570 6339 3934 gene locus_tag LOCUS_16580 6339 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7931 6585 gene locus_tag LOCUS_16590 7931 6585 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_16590 8681 8106 gene locus_tag LOCUS_16600 8681 8106 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937707.1 protein_id gnl|my_center|LOCUS_16600 9671 8775 gene locus_tag LOCUS_16610 9671 8775 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_16610 9932 11308 gene locus_tag LOCUS_16620 9932 11308 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence091 128 205 gene locus_tag LOCUS_t00290 128 205 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 997 449 gene locus_tag LOCUS_16630 997 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2159 1023 gene locus_tag LOCUS_16640 2159 1023 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 protein_id gnl|my_center|LOCUS_16640 2267 3352 gene locus_tag LOCUS_16650 2267 3352 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_16650 3595 3885 gene locus_tag LOCUS_16660 gene groES 3595 3885 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_16660 3923 5572 gene locus_tag LOCUS_16670 gene groL 3923 5572 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_16670 5737 5813 gene locus_tag LOCUS_t00300 5737 5813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6534 6205 gene locus_tag LOCUS_16680 6534 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 6830 8692 gene locus_tag LOCUS_16690 6830 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 8778 9965 gene locus_tag LOCUS_16700 8778 9965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257605.1 protein_id gnl|my_center|LOCUS_16700 9990 10571 gene locus_tag LOCUS_16710 9990 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 10564 11004 gene locus_tag LOCUS_16720 10564 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence092 1098 691 gene locus_tag LOCUS_16730 1098 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2795 1209 gene locus_tag LOCUS_16740 gene cimA 2795 1209 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_16740 4089 2824 gene locus_tag LOCUS_16750 4089 2824 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_16750 4315 4818 gene locus_tag LOCUS_16760 4315 4818 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_16760 4869 5951 gene locus_tag LOCUS_16770 gene serC 4869 5951 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_16770 6052 6921 gene locus_tag LOCUS_16780 6052 6921 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_16780 7191 8243 gene locus_tag LOCUS_16790 gene rlmN 7191 8243 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_16790 9255 8266 gene locus_tag LOCUS_16800 9255 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10696 9617 gene locus_tag LOCUS_16810 10696 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence093 165 2171 gene locus_tag LOCUS_16820 165 2171 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927081.1 protein_id gnl|my_center|LOCUS_16820 2295 3122 gene locus_tag LOCUS_16830 2295 3122 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 protein_id gnl|my_center|LOCUS_16830 3119 3568 gene locus_tag LOCUS_16840 3119 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3562 4455 gene locus_tag LOCUS_16850 3562 4455 CDS product nicotianamine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023911.1 protein_id gnl|my_center|LOCUS_16850 4455 5264 gene locus_tag LOCUS_16860 4455 5264 CDS product nicotianamine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023912.1 protein_id gnl|my_center|LOCUS_16860 5497 6111 gene locus_tag LOCUS_16870 5497 6111 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_16870 6108 6539 gene locus_tag LOCUS_16880 6108 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6536 7324 gene locus_tag LOCUS_16890 6536 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7327 8601 gene locus_tag LOCUS_16900 7327 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 9134 8670 gene locus_tag LOCUS_16910 9134 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 <11051 9577 gene locus_tag LOCUS_16920 <11051 9577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044997.1:ATP-binding protein >Feature sequence094 1956 775 gene locus_tag LOCUS_16930 1956 775 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 protein_id gnl|my_center|LOCUS_16930 2228 5374 gene locus_tag LOCUS_16940 2228 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6250 5657 gene locus_tag LOCUS_16950 6250 5657 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 protein_id gnl|my_center|LOCUS_16950 6694 7107 gene locus_tag LOCUS_16960 6694 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 7125 7301 gene locus_tag LOCUS_16970 7125 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 7314 7577 gene locus_tag LOCUS_16980 7314 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7672 7992 gene locus_tag LOCUS_16990 7672 7992 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_16990 8046 9236 gene locus_tag LOCUS_17000 8046 9236 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_17000 10791 9337 gene locus_tag LOCUS_17010 10791 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence095 1128 247 gene locus_tag LOCUS_17020 1128 247 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_17020 2292 1447 gene locus_tag LOCUS_17030 2292 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2846 2307 gene locus_tag LOCUS_17040 2846 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3376 3457 gene locus_tag LOCUS_t00310 3376 3457 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3923 6118 gene locus_tag LOCUS_17050 gene glgP 3923 6118 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143866.1 protein_id gnl|my_center|LOCUS_17050 6189 6614 gene locus_tag LOCUS_17060 6189 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 6653 7942 gene locus_tag LOCUS_17070 6653 7942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_17070 8954 7923 gene locus_tag LOCUS_17080 8954 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 9108 9515 gene locus_tag LOCUS_17090 9108 9515 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence096 1518 931 gene locus_tag LOCUS_17100 1518 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1805 1533 gene locus_tag LOCUS_17110 1805 1533 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_17110 2096 2020 gene locus_tag LOCUS_t00320 2096 2020 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3465 2176 gene locus_tag LOCUS_17120 3465 2176 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_17120 4721 3462 gene locus_tag LOCUS_17130 4721 3462 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_17130 6075 5047 gene locus_tag LOCUS_17140 6075 5047 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_17140 7942 6341 gene locus_tag LOCUS_17150 7942 6341 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_17150 8097 9179 gene locus_tag LOCUS_17160 gene lptG 8097 9179 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_17160 9179 9931 gene locus_tag LOCUS_17170 9179 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 9937 10602 gene locus_tag LOCUS_17180 9937 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence097 17 466 gene locus_tag LOCUS_17190 17 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 463 1179 gene locus_tag LOCUS_17200 463 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1176 2138 gene locus_tag LOCUS_17210 gene gspK 1176 2138 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_17210 2406 3965 gene locus_tag LOCUS_17220 2406 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3965 4501 gene locus_tag LOCUS_17230 3965 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4507 5436 gene locus_tag LOCUS_17240 4507 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 5439 6182 gene locus_tag LOCUS_17250 5439 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 6401 8584 gene locus_tag LOCUS_17260 gene gspD 6401 8584 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_17260 8755 9060 gene locus_tag LOCUS_17270 8755 9060 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_17270 9057 9386 gene locus_tag LOCUS_17280 9057 9386 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence098 335 1432 gene locus_tag LOCUS_17290 gene mtnA 335 1432 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532924.1 protein_id gnl|my_center|LOCUS_17290 1464 2111 gene locus_tag LOCUS_17300 1464 2111 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969269.1 protein_id gnl|my_center|LOCUS_17300 2792 3865 gene locus_tag LOCUS_17310 2792 3865 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_17310 3892 5673 gene locus_tag LOCUS_17320 3892 5673 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097482.1 protein_id gnl|my_center|LOCUS_17320 5670 6818 gene locus_tag LOCUS_17330 5670 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6831 7940 gene locus_tag LOCUS_17340 6831 7940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_17340 8052 7891 gene locus_tag LOCUS_17350 8052 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 8503 9318 gene locus_tag LOCUS_17360 8503 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9588 9512 gene locus_tag LOCUS_t00330 9588 9512 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10057 9677 gene locus_tag LOCUS_17370 10057 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 10355 10059 gene locus_tag LOCUS_17380 gene ihfA 10355 10059 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384166.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence099 448 1398 gene locus_tag LOCUS_17390 448 1398 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_17390 1427 2527 gene locus_tag LOCUS_17400 gene ada 1427 2527 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_17400 2524 2835 gene locus_tag LOCUS_17410 2524 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2580 2589 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3919 3104 gene locus_tag LOCUS_17420 3919 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4116 3928 gene locus_tag LOCUS_17430 4116 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4812 5297 gene locus_tag LOCUS_17440 4812 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8174 5688 gene locus_tag LOCUS_17450 8174 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9564 9277 gene locus_tag LOCUS_17460 9564 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence100 371 1810 gene locus_tag LOCUS_17470 gene selA 371 1810 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_17470 1813 3906 gene locus_tag LOCUS_17480 1813 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3915 4598 gene locus_tag LOCUS_17490 3915 4598 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_17490 5039 4848 gene locus_tag LOCUS_17500 5039 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5197 6279 gene locus_tag LOCUS_17510 5197 6279 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_17510 6827 6294 gene locus_tag LOCUS_17520 6827 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 9419 6954 gene locus_tag LOCUS_17530 9419 6954 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_17530 <10522 9481 gene locus_tag LOCUS_17540 <10522 9481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942899.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence101 <1 2543 gene locus_tag LOCUS_17550 <1 2543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta 2676 6749 gene locus_tag LOCUS_17560 gene rpoC 2676 6749 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_17560 3337 3427 gene locus_tag LOCUS_t00340 3337 3427 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6936 7307 gene locus_tag LOCUS_17570 gene rpsL 6936 7307 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_17570 7350 7823 gene locus_tag LOCUS_17580 gene rpsG 7350 7823 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_17580 7960 10038 gene locus_tag LOCUS_17590 gene fusA 7960 10038 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence102 1551 19 gene locus_tag LOCUS_17600 1551 19 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_17600 1958 1551 gene locus_tag LOCUS_17610 gene mce 1958 1551 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_17610 3689 2022 gene locus_tag LOCUS_17620 3689 2022 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_17620 4594 3686 gene locus_tag LOCUS_17630 gene meaB 4594 3686 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_17630 5013 4591 gene locus_tag LOCUS_17640 5013 4591 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_17640 5348 5010 gene locus_tag LOCUS_17650 5348 5010 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_17650 6214 5345 gene locus_tag LOCUS_17660 gene sucD 6214 5345 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_17660 7402 6230 gene locus_tag LOCUS_17670 gene sucC 7402 6230 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403880.1 protein_id gnl|my_center|LOCUS_17670 9474 7582 gene locus_tag LOCUS_17680 9474 7582 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence103 <1 535 gene locus_tag LOCUS_17690 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941842.1:4-alpha-glucanotransferase 528 1142 gene locus_tag LOCUS_17700 528 1142 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_17700 1182 1257 gene locus_tag LOCUS_t00350 1182 1257 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1600 1361 gene locus_tag LOCUS_17710 1600 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2074 1610 gene locus_tag LOCUS_17720 2074 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2777 2445 gene locus_tag LOCUS_17730 2777 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4090 2774 gene locus_tag LOCUS_17740 4090 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5940 4396 gene locus_tag LOCUS_17750 gene gspD 5940 4396 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209864.1 protein_id gnl|my_center|LOCUS_17750 6916 6017 gene locus_tag LOCUS_17760 6916 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 7247 6918 gene locus_tag LOCUS_17770 7247 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 8005 7256 gene locus_tag LOCUS_17780 8005 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 9430 9125 gene locus_tag LOCUS_17790 9430 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 9609 9475 gene locus_tag LOCUS_17800 9609 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 9786 9649 gene locus_tag LOCUS_17810 9786 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence104 81 671 gene locus_tag LOCUS_17820 81 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 675 1784 gene locus_tag LOCUS_17830 675 1784 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_17830 1853 2185 gene locus_tag LOCUS_17840 1853 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938753.1 protein_id gnl|my_center|LOCUS_17840 2210 2944 gene locus_tag LOCUS_17850 gene pyrF 2210 2944 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_17850 4103 2970 gene locus_tag LOCUS_17860 4103 2970 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_17860 4619 4398 gene locus_tag LOCUS_17870 4619 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7329 4987 gene locus_tag LOCUS_17880 gene feoB 7329 4987 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_17880 7565 7332 gene locus_tag LOCUS_17890 7565 7332 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_17890 7839 7540 gene locus_tag LOCUS_17900 7839 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 8692 8189 gene locus_tag LOCUS_17910 8692 8189 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_17910 <9934 8804 gene locus_tag LOCUS_17920 <9934 8804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002673563.1:DUF5714 domain-containing protein >Feature sequence105 <1 803 gene locus_tag LOCUS_17930 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940826.1:acetylglutamate kinase 800 1996 gene locus_tag LOCUS_17940 800 1996 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_17940 1990 2559 gene locus_tag LOCUS_17950 1990 2559 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_17950 2880 3791 gene locus_tag LOCUS_17960 gene argF 2880 3791 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_17960 3934 5151 gene locus_tag LOCUS_17970 3934 5151 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_17970 5246 6670 gene locus_tag LOCUS_17980 gene argH 5246 6670 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_17980 6694 7728 gene locus_tag LOCUS_17990 6694 7728 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546291.1 protein_id gnl|my_center|LOCUS_17990 7732 9000 gene locus_tag LOCUS_18000 gene lysA 7732 9000 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938936.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence106 1195 59 gene locus_tag LOCUS_18010 1195 59 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_18010 2701 1439 gene locus_tag LOCUS_18020 2701 1439 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_18020 3390 2764 gene locus_tag LOCUS_18030 gene upp 3390 2764 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 protein_id gnl|my_center|LOCUS_18030 3735 6224 gene locus_tag LOCUS_18040 3735 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6202 6753 gene locus_tag LOCUS_18050 6202 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 6779 7375 gene locus_tag LOCUS_18060 6779 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7375 8271 gene locus_tag LOCUS_18070 7375 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 8261 8659 gene locus_tag LOCUS_18080 8261 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 9484 8681 gene locus_tag LOCUS_18090 9484 8681 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence107 1196 711 gene locus_tag LOCUS_18100 1196 711 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_18100 1608 1321 gene locus_tag LOCUS_18110 1608 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 3285 1630 gene locus_tag LOCUS_18120 gene argS 3285 1630 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_18120 4457 3327 gene locus_tag LOCUS_18130 gene alr 4457 3327 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_18130 4896 4450 gene locus_tag LOCUS_18140 4896 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 5156 4971 gene locus_tag LOCUS_18150 5156 4971 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_18150 5464 5820 gene locus_tag LOCUS_18160 5464 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 5925 7652 gene locus_tag LOCUS_18170 5925 7652 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_18170 7655 7882 gene locus_tag LOCUS_18180 7655 7882 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_18180 7965 8945 gene locus_tag LOCUS_18190 7965 8945 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937322.1 protein_id gnl|my_center|LOCUS_18190 8962 9501 gene locus_tag LOCUS_18200 8962 9501 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937321.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence108 373 2691 gene locus_tag LOCUS_18210 gene rnr 373 2691 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_18210 2723 3505 gene locus_tag LOCUS_18220 2723 3505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_18220 3490 4356 gene locus_tag LOCUS_18230 3490 4356 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_18230 4538 5059 gene locus_tag LOCUS_18240 4538 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 5098 5856 gene locus_tag LOCUS_18250 5098 5856 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_18250 6571 5927 gene locus_tag LOCUS_18260 6571 5927 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_18260 7685 6600 gene locus_tag LOCUS_18270 7685 6600 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence109 534 1163 gene locus_tag LOCUS_18280 534 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1344 1994 gene locus_tag LOCUS_18290 1344 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2008 2583 gene locus_tag LOCUS_18300 2008 2583 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_18300 2833 3426 gene locus_tag LOCUS_18310 2833 3426 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_18310 3552 3926 gene locus_tag LOCUS_18320 3552 3926 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_18320 3994 4152 gene locus_tag LOCUS_18330 3994 4152 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_18330 4292 4642 gene locus_tag LOCUS_18340 4292 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4666 5886 gene locus_tag LOCUS_18350 4666 5886 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_18350 5975 6298 gene locus_tag LOCUS_18360 5975 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6891 8996 gene locus_tag LOCUS_18370 6891 8996 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence110 968 360 gene locus_tag LOCUS_18380 968 360 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_18380 1807 965 gene locus_tag LOCUS_18390 1807 965 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_18390 2965 1829 gene locus_tag LOCUS_18400 2965 1829 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_18400 3251 2958 gene locus_tag LOCUS_18410 3251 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3502 4473 gene locus_tag LOCUS_18420 3502 4473 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261092.1 protein_id gnl|my_center|LOCUS_18420 4780 6864 gene locus_tag LOCUS_18430 4780 6864 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_18430 6984 7493 gene locus_tag LOCUS_18440 6984 7493 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_18440 8680 7511 gene locus_tag LOCUS_18450 8680 7511 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 protein_id gnl|my_center|LOCUS_18450 <9214 8677 gene locus_tag LOCUS_18460 <9214 8677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000902136.1:lysine 2,3-aminomutase >Feature sequence111 1170 121 gene locus_tag LOCUS_18470 gene mltB 1170 121 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444402.1 protein_id gnl|my_center|LOCUS_18470 2240 1215 gene locus_tag LOCUS_18480 2240 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_18480 4558 2258 gene locus_tag LOCUS_18490 gene lptD 4558 2258 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_18490 4737 4883 gene locus_tag LOCUS_18500 4737 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5044 6033 gene locus_tag LOCUS_18510 5044 6033 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_18510 6250 8436 gene locus_tag LOCUS_18520 6250 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 8529 8605 gene locus_tag LOCUS_t00360 8529 8605 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 109 960 gene locus_tag LOCUS_18530 109 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1242 2783 gene locus_tag LOCUS_18540 1242 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4416 2767 gene locus_tag LOCUS_18550 4416 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 7064 4476 gene locus_tag LOCUS_18560 7064 4476 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939350.1 protein_id gnl|my_center|LOCUS_18560 7560 7186 gene locus_tag LOCUS_18570 7560 7186 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_18570 8417 7566 gene locus_tag LOCUS_18580 8417 7566 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_18580 <9075 8470 gene locus_tag LOCUS_18590 <9075 8470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044233342.1:HEAT repeat domain-containing protein >Feature sequence113 933 3161 gene locus_tag LOCUS_18600 gene rlmKL 933 3161 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_18600 3179 3709 gene locus_tag LOCUS_18610 3179 3709 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399749.1 protein_id gnl|my_center|LOCUS_18610 3711 4061 gene locus_tag LOCUS_18620 3711 4061 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877543.1 protein_id gnl|my_center|LOCUS_18620 4065 4817 gene locus_tag LOCUS_18630 4065 4817 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_18630 5936 5232 gene locus_tag LOCUS_18640 gene rph 5936 5232 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039967.1 protein_id gnl|my_center|LOCUS_18640 7355 6600 gene locus_tag LOCUS_18650 7355 6600 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939255.1 protein_id gnl|my_center|LOCUS_18650 8596 7367 gene locus_tag LOCUS_18660 8596 7367 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939254.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence114 369 554 gene locus_tag LOCUS_18670 369 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 956 723 gene locus_tag LOCUS_18680 956 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3105 1171 gene locus_tag LOCUS_18690 3105 1171 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_18690 4502 3264 gene locus_tag LOCUS_18700 4502 3264 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_18700 5889 4516 gene locus_tag LOCUS_18710 5889 4516 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_18710 6610 6038 gene locus_tag LOCUS_18720 6610 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 7356 6667 gene locus_tag LOCUS_18730 7356 6667 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870318.1 protein_id gnl|my_center|LOCUS_18730 7645 8364 gene locus_tag LOCUS_18740 7645 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:7894..7896,aa:Sec) note codon on position 84 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_18740 <8954 8455 gene locus_tag LOCUS_18750 <8954 8455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937320.1:TRAP transporter large permease >Feature sequence115 363 671 gene locus_tag LOCUS_18760 363 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 668 1264 gene locus_tag LOCUS_18770 668 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1264 2088 gene locus_tag LOCUS_18780 1264 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2394 2212 gene locus_tag LOCUS_18790 2394 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2587 4407 gene locus_tag LOCUS_18800 gene ftsH 2587 4407 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_18800 5937 4738 gene locus_tag LOCUS_18810 gene nrfD 5937 4738 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817192.1 protein_id gnl|my_center|LOCUS_18810 6935 6093 gene locus_tag LOCUS_18820 6935 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 7380 7159 gene locus_tag LOCUS_18830 7380 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7674 7453 gene locus_tag LOCUS_18840 7674 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 <8832 7951 gene locus_tag LOCUS_18850 <8832 7951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943144.1:sigma-54 dependent transcriptional regulator >Feature sequence116 3198 4931 gene locus_tag LOCUS_18860 3198 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 5316 5969 gene locus_tag LOCUS_18870 5316 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 6028 6104 gene locus_tag LOCUS_t00370 6028 6104 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7673 6231 gene locus_tag LOCUS_18880 7673 6231 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_18880 <8798 7773 gene locus_tag LOCUS_18890 <8798 7773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546582.1:ATP-binding protein >Feature sequence117 135 59 gene locus_tag LOCUS_t00380 135 59 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 641 189 gene locus_tag LOCUS_18900 641 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1873 641 gene locus_tag LOCUS_18910 1873 641 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_18910 3185 1878 gene locus_tag LOCUS_18920 3185 1878 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_18920 3612 4286 gene locus_tag LOCUS_18930 3612 4286 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_18930 4838 5776 gene locus_tag LOCUS_18940 gene hemC 4838 5776 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_18940 5809 7374 gene locus_tag LOCUS_18950 gene cobA 5809 7374 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_18950 7390 7845 gene locus_tag LOCUS_18960 7390 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 <8725 7826 gene locus_tag LOCUS_18970 <8725 7826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310733.1:glycosyltransferase family protein >Feature sequence118 775 1440 gene locus_tag LOCUS_18980 775 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18980 1476 1751 gene locus_tag LOCUS_18990 1476 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18990 1765 2481 gene locus_tag LOCUS_19000 1765 2481 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_19000 2489 3139 gene locus_tag LOCUS_19010 2489 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3161 3916 gene locus_tag LOCUS_19020 3161 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4383 3943 gene locus_tag LOCUS_19030 4383 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4679 5494 gene locus_tag LOCUS_19040 4679 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5440 6381 gene locus_tag LOCUS_19050 gene mptA 5440 6381 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496622.1 protein_id gnl|my_center|LOCUS_19050 6564 7565 gene locus_tag LOCUS_19060 6564 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7600 8532 gene locus_tag LOCUS_19070 gene ppk2 7600 8532 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence119 249 1232 gene locus_tag LOCUS_19080 249 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1229 1666 gene locus_tag LOCUS_19090 1229 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1744 1893 gene locus_tag LOCUS_19100 1744 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1871 3919 gene locus_tag LOCUS_19110 1871 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3919 4281 gene locus_tag LOCUS_19120 3919 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4297 4446 gene locus_tag LOCUS_19130 4297 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4443 8228 gene locus_tag LOCUS_19140 4443 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence120 1384 416 gene locus_tag LOCUS_19150 1384 416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_19150 3384 1525 gene locus_tag LOCUS_19160 gene sppA 3384 1525 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262204.1 protein_id gnl|my_center|LOCUS_19160 5541 3637 gene locus_tag LOCUS_19170 5541 3637 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_19170 7849 5765 gene locus_tag LOCUS_19180 7849 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence121 2587 1925 gene locus_tag LOCUS_19190 gene elbB 2587 1925 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_19190 3124 2606 gene locus_tag LOCUS_19200 gene hpt 3124 2606 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_19200 5620 3314 gene locus_tag LOCUS_19210 gene prsT 5620 3314 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_19210 5793 6545 gene locus_tag LOCUS_19220 5793 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6566 8047 gene locus_tag LOCUS_19230 6566 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence122 590 180 gene locus_tag LOCUS_19240 590 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1702 626 gene locus_tag LOCUS_19250 1702 626 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083251.1 protein_id gnl|my_center|LOCUS_19250 2666 1722 gene locus_tag LOCUS_19260 2666 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4618 2693 gene locus_tag LOCUS_19270 4618 2693 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390075.1 protein_id gnl|my_center|LOCUS_19270 6574 4640 gene locus_tag LOCUS_19280 6574 4640 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390074.1 protein_id gnl|my_center|LOCUS_19280 7006 6614 gene locus_tag LOCUS_19290 7006 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence123 2565 313 gene locus_tag LOCUS_19300 2565 313 CDS product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513617.1 protein_id gnl|my_center|LOCUS_19300 3783 3019 gene locus_tag LOCUS_19310 3783 3019 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 protein_id gnl|my_center|LOCUS_19310 4456 3830 gene locus_tag LOCUS_19320 4456 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4707 6023 gene locus_tag LOCUS_19330 gene hisD 4707 6023 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_19330 6027 6695 gene locus_tag LOCUS_19340 gene rsmG 6027 6695 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944072.1 protein_id gnl|my_center|LOCUS_19340 6872 7957 gene locus_tag LOCUS_19350 gene leuB 6872 7957 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence124 45 1883 gene locus_tag LOCUS_19360 gene glmS 45 1883 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_19360 2032 3201 gene locus_tag LOCUS_19370 2032 3201 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_19370 3266 4324 gene locus_tag LOCUS_19380 gene lpxD 3266 4324 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_19380 4469 4927 gene locus_tag LOCUS_19390 gene fabZ 4469 4927 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_19390 5000 5797 gene locus_tag LOCUS_19400 gene lpxA 5000 5797 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_19400 5808 6647 gene locus_tag LOCUS_19410 gene lpxI 5808 6647 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_19410 7819 6671 gene locus_tag LOCUS_19420 7819 6671 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence125 <1 623 gene locus_tag LOCUS_19430 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768338.1:selenide, water dikinase SelD 830 2839 gene locus_tag LOCUS_19440 830 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2854 5574 gene locus_tag LOCUS_19450 2854 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6703 5561 gene locus_tag LOCUS_19460 6703 5561 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609803.1 protein_id gnl|my_center|LOCUS_19460 7956 6709 gene locus_tag LOCUS_19470 7956 6709 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence126 <1 715 gene locus_tag LOCUS_19480 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546330.1:electron transfer flavoprotein subunit beta/FixA family protein 765 1958 gene locus_tag LOCUS_19490 765 1958 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_19490 1955 2704 gene locus_tag LOCUS_19500 gene fabG 1955 2704 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_19500 2817 3047 gene locus_tag LOCUS_19510 gene acpP 2817 3047 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 protein_id gnl|my_center|LOCUS_19510 3065 4306 gene locus_tag LOCUS_19520 gene fabF 3065 4306 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_19520 4324 4749 gene locus_tag LOCUS_19530 gene rpiB 4324 4749 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_19530 5135 6388 gene locus_tag LOCUS_19540 5135 6388 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986909.1 protein_id gnl|my_center|LOCUS_19540 6457 6945 gene locus_tag LOCUS_19550 gene nrdR 6457 6945 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_19550 6948 8048 gene locus_tag LOCUS_19560 gene ribD 6948 8048 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence127 527 1063 gene locus_tag LOCUS_19570 527 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1089 1520 gene locus_tag LOCUS_19580 1089 1520 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021674.1 protein_id gnl|my_center|LOCUS_19580 3766 1859 gene locus_tag LOCUS_19590 3766 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5449 4007 gene locus_tag LOCUS_19600 5449 4007 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_19600 6880 5966 gene locus_tag LOCUS_19610 gene trxB 6880 5966 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence128 606 1262 gene locus_tag LOCUS_19620 606 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2284 1361 gene locus_tag LOCUS_19630 2284 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2322 2501 gene locus_tag LOCUS_19640 2322 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2661 3008 gene locus_tag LOCUS_19650 2661 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 4271 2997 gene locus_tag LOCUS_19660 4271 2997 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_19660 6902 4416 gene locus_tag LOCUS_19670 6902 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 7638 7563 gene locus_tag LOCUS_t00390 7638 7563 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 2779 611 gene locus_tag LOCUS_19680 2779 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 6504 3091 gene locus_tag LOCUS_19690 6504 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 7599 6571 gene locus_tag LOCUS_19700 7599 6571 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_19700 7175 7267 gene locus_tag LOCUS_t00400 7175 7267 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 866 1273 gene locus_tag LOCUS_19710 866 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_19710 2423 1422 gene locus_tag LOCUS_19720 2423 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2739 4052 gene locus_tag LOCUS_19730 2739 4052 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545901.1 protein_id gnl|my_center|LOCUS_19730 4046 5113 gene locus_tag LOCUS_19740 4046 5113 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_19740 5088 5498 gene locus_tag LOCUS_19750 5088 5498 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 protein_id gnl|my_center|LOCUS_19750 6411 5500 gene locus_tag LOCUS_19760 6411 5500 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_19760 6618 6893 gene locus_tag LOCUS_19770 6618 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 6890 7423 gene locus_tag LOCUS_19780 6890 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 <7863 7359 gene locus_tag LOCUS_19790 <7863 7359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660626.1:endonuclease MutS2 >Feature sequence131 1361 138 gene locus_tag LOCUS_19800 1361 138 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_19800 2860 1370 gene locus_tag LOCUS_19810 gene lysS 2860 1370 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_19810 4041 2935 gene locus_tag LOCUS_19820 4041 2935 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814543.1 protein_id gnl|my_center|LOCUS_19820 5565 4264 gene locus_tag LOCUS_19830 gene rlmD 5565 4264 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_19830 5658 7019 gene locus_tag LOCUS_19840 5658 7019 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence132 1503 796 gene locus_tag LOCUS_19850 gene nadD 1503 796 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_19850 2863 1598 gene locus_tag LOCUS_19860 2863 1598 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_19860 4079 2886 gene locus_tag LOCUS_19870 gene proB 4079 2886 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_19870 5080 4076 gene locus_tag LOCUS_19880 5080 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5712 5455 gene locus_tag LOCUS_19890 gene rpmA 5712 5455 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_19890 6047 5736 gene locus_tag LOCUS_19900 gene rplU 6047 5736 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_19900 6322 6480 gene locus_tag LOCUS_19910 6322 6480 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_19910 6954 7688 gene locus_tag LOCUS_19920 6954 7688 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869292.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence133 <1 557 gene locus_tag LOCUS_19930 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065644.1:shikimate kinase 1703 579 gene locus_tag LOCUS_19940 1703 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3075 1684 gene locus_tag LOCUS_19950 3075 1684 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_19950 3535 3233 gene locus_tag LOCUS_19960 3535 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4477 3797 gene locus_tag LOCUS_19970 4477 3797 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294610.1 protein_id gnl|my_center|LOCUS_19970 4902 4474 gene locus_tag LOCUS_19980 4902 4474 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454437.1 protein_id gnl|my_center|LOCUS_19980 5880 4969 gene locus_tag LOCUS_19990 gene cysK 5880 4969 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_19990 6857 5880 gene locus_tag LOCUS_20000 6857 5880 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_20000 7530 6928 gene locus_tag LOCUS_20010 gene metW 7530 6928 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence134 532 1746 gene locus_tag LOCUS_20020 532 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1908 4601 gene locus_tag LOCUS_20030 1908 4601 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_20030 6685 4760 gene locus_tag LOCUS_20040 gene selB 6685 4760 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_20040 7473 6847 gene locus_tag LOCUS_20050 7473 6847 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence135 <1 590 gene locus_tag LOCUS_20060 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405312.1:lytic transglycosylase domain-containing protein 719 793 gene locus_tag LOCUS_t00410 719 793 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 947 2875 gene locus_tag LOCUS_20070 gene thrS 947 2875 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_20070 2829 3473 gene locus_tag LOCUS_20080 gene infC 2829 3473 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216580.1 protein_id gnl|my_center|LOCUS_20080 3614 3811 gene locus_tag LOCUS_20090 gene rpmI 3614 3811 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_20090 3986 4279 gene locus_tag LOCUS_20100 gene rplT 3986 4279 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939805.1 protein_id gnl|my_center|LOCUS_20100 4380 5390 gene locus_tag LOCUS_20110 gene pheS 4380 5390 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence136 1509 358 gene locus_tag LOCUS_20120 1509 358 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_20120 2494 1523 gene locus_tag LOCUS_20130 2494 1523 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_20130 3522 2518 gene locus_tag LOCUS_20140 gene plsX 3522 2518 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_20140 3717 3529 gene locus_tag LOCUS_20150 gene rpmF 3717 3529 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_20150 4273 3761 gene locus_tag LOCUS_20160 4273 3761 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_20160 4919 4488 gene locus_tag LOCUS_20170 4919 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5587 4916 gene locus_tag LOCUS_20180 5587 4916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_20180 6380 5601 gene locus_tag LOCUS_20190 6380 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 6809 6384 gene locus_tag LOCUS_20200 gene mlaD 6809 6384 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_20200 <7623 7057 gene locus_tag LOCUS_20210 <7623 7057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546205.1:ABC transporter ATP-binding protein >Feature sequence137 368 1417 gene locus_tag LOCUS_20220 gene nadA 368 1417 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 protein_id gnl|my_center|LOCUS_20220 2499 1438 gene locus_tag LOCUS_20230 2499 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2551 2922 gene locus_tag LOCUS_20240 2551 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3664 2855 gene locus_tag LOCUS_20250 3664 2855 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_20250 3935 6379 gene locus_tag LOCUS_20260 gene lon 3935 6379 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence138 <1 1041 gene locus_tag LOCUS_20270 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404573.1:phosphoenolpyruvate carboxykinase (ATP) 3796 1121 gene locus_tag LOCUS_20280 gene pepN 3796 1121 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_20280 3971 5002 gene locus_tag LOCUS_20290 3971 5002 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_20290 5300 5563 gene locus_tag LOCUS_20300 5300 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 5720 6544 gene locus_tag LOCUS_20310 5720 6544 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119749.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence139 <1 1647 gene locus_tag LOCUS_20320 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038860.1:conjugative transfer ATPase 4830 1759 gene locus_tag LOCUS_20330 4830 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5546 5920 gene locus_tag LOCUS_20340 5546 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 5917 6936 gene locus_tag LOCUS_20350 5917 6936 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038228.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence140 1041 349 gene locus_tag LOCUS_20360 1041 349 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940883.1 protein_id gnl|my_center|LOCUS_20360 2323 1250 gene locus_tag LOCUS_20370 2323 1250 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_20370 3690 2311 gene locus_tag LOCUS_20380 3690 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5463 4069 gene locus_tag LOCUS_20390 gene cobB 5463 4069 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_20390 6383 5733 gene locus_tag LOCUS_20400 6383 5733 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937719.1 protein_id gnl|my_center|LOCUS_20400 <7255 6530 gene locus_tag LOCUS_20410 <7255 6530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937720.1:potassium transporter TrkG >Feature sequence141 1995 955 gene locus_tag LOCUS_20420 1995 955 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_20420 3458 1992 gene locus_tag LOCUS_20430 3458 1992 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_20430 5870 3483 gene locus_tag LOCUS_20440 5870 3483 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_20440 6075 5863 gene locus_tag LOCUS_20450 6075 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 6245 6421 gene locus_tag LOCUS_20460 6245 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6896 6535 gene locus_tag LOCUS_tm00010 6896 6535 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence142 2947 1571 gene locus_tag LOCUS_20470 2947 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3244 5082 gene locus_tag LOCUS_20480 3244 5082 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_20480 5732 5115 gene locus_tag LOCUS_20490 5732 5115 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence143 32 490 gene locus_tag LOCUS_20500 32 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 492 950 gene locus_tag LOCUS_20510 492 950 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_20510 3872 1206 gene locus_tag LOCUS_20520 3872 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 5649 3865 gene locus_tag LOCUS_20530 5649 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6995 5649 gene locus_tag LOCUS_20540 6995 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence144 381 2183 gene locus_tag LOCUS_20550 381 2183 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550684.1 protein_id gnl|my_center|LOCUS_20550 2286 5375 gene locus_tag LOCUS_20560 2286 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5607 6017 gene locus_tag LOCUS_20570 gene nikR 5607 6017 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_20570 6092 6691 gene locus_tag LOCUS_20580 gene cbiM 6092 6691 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence145 2361 103 gene locus_tag LOCUS_20590 2361 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3757 2627 gene locus_tag LOCUS_20600 gene cydB 3757 2627 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_20600 5294 3759 gene locus_tag LOCUS_20610 5294 3759 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_20610 5564 5301 gene locus_tag LOCUS_20620 5564 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 6023 5574 gene locus_tag LOCUS_20630 6023 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 <7064 6249 gene locus_tag LOCUS_20640 <7064 6249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851984.1:cytochrome d ubiquinol oxidase subunit II >Feature sequence146 1091 720 gene locus_tag LOCUS_20650 1091 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2397 1054 gene locus_tag LOCUS_20660 gene thiC 2397 1054 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_20660 3147 3485 gene locus_tag LOCUS_20670 3147 3485 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_20670 3540 4877 gene locus_tag LOCUS_20680 3540 4877 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_20680 5007 5750 gene locus_tag LOCUS_20690 5007 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence147 440 994 gene locus_tag LOCUS_20700 gene pyrE 440 994 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_20700 999 1169 gene locus_tag LOCUS_20710 999 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1174 1641 gene locus_tag LOCUS_20720 1174 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3284 1665 gene locus_tag LOCUS_20730 gene hflX 3284 1665 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_20730 4885 3509 gene locus_tag LOCUS_20740 gene asnS 4885 3509 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_20740 5868 4981 gene locus_tag LOCUS_20750 5868 4981 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_20750 6684 5929 gene locus_tag LOCUS_20760 6684 5929 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence148 496 1389 gene locus_tag LOCUS_20770 496 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2029 1478 gene locus_tag LOCUS_20780 2029 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3885 2029 gene locus_tag LOCUS_20790 3885 2029 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_20790 4111 5979 gene locus_tag LOCUS_20800 gene mutL 4111 5979 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_20800 6139 6885 gene locus_tag LOCUS_20810 6139 6885 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence149 <1 2022 gene locus_tag LOCUS_20820 <1 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810772.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 3009 2317 gene locus_tag LOCUS_20830 gene aat 3009 2317 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_20830 3544 3182 gene locus_tag LOCUS_20840 3544 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 5331 3691 gene locus_tag LOCUS_20850 5331 3691 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940550.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence150 245 838 gene locus_tag LOCUS_20860 gene pth 245 838 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_20860 1059 1520 gene locus_tag LOCUS_20870 1059 1520 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_20870 2111 1812 gene locus_tag LOCUS_20880 2111 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2031 2531 gene locus_tag LOCUS_20890 2031 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2515 3132 gene locus_tag LOCUS_20900 gene coaE 2515 3132 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 protein_id gnl|my_center|LOCUS_20900 3752 4999 gene locus_tag LOCUS_20910 gene rho 3752 4999 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_20910 5111 5332 gene locus_tag LOCUS_20920 gene rpmE 5111 5332 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_20920 5545 6612 gene locus_tag LOCUS_20930 gene prfA 5545 6612 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence151 1013 597 gene locus_tag LOCUS_20940 1013 597 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_20940 1967 1080 gene locus_tag LOCUS_20950 1967 1080 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_20950 3043 1964 gene locus_tag LOCUS_20960 3043 1964 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_20960 5091 3043 gene locus_tag LOCUS_20970 5091 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(4690..4692),aa:Sec) note codon on position 134 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_20970 >Feature sequence152 2103 328 gene locus_tag LOCUS_20980 2103 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_20980 2609 2103 gene locus_tag LOCUS_20990 2609 2103 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_20990 3382 2708 gene locus_tag LOCUS_21000 3382 2708 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_21000 5399 3375 gene locus_tag LOCUS_21010 gene uvrB 5399 3375 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence153 337 1221 gene locus_tag LOCUS_21020 gene dapA 337 1221 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_21020 1318 2130 gene locus_tag LOCUS_21030 gene dapB 1318 2130 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_21030 2274 2795 gene locus_tag LOCUS_21040 gene folK 2274 2795 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_21040 2997 3287 gene locus_tag LOCUS_21050 2997 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3392 4036 gene locus_tag LOCUS_21060 gene fsa 3392 4036 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_21060 4039 4737 gene locus_tag LOCUS_21070 4039 4737 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_21070 4742 5305 gene locus_tag LOCUS_21080 gene pgsA 4742 5305 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_21080 6111 5356 gene locus_tag LOCUS_21090 6111 5356 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_21090 6233 6319 gene locus_tag LOCUS_t00420 6233 6319 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence154 <1 698 gene locus_tag LOCUS_21100 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870021.1:iron-containing alcohol dehydrogenase 2047 827 gene locus_tag LOCUS_21110 gene coaBC 2047 827 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_21110 2607 2110 gene locus_tag LOCUS_21120 2607 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3125 2604 gene locus_tag LOCUS_21130 3125 2604 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_21130 3279 4112 gene locus_tag LOCUS_21140 3279 4112 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_21140 4109 4795 gene locus_tag LOCUS_21150 4109 4795 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_21150 5082 6392 gene locus_tag LOCUS_21160 5082 6392 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence155 1497 298 gene locus_tag LOCUS_21170 1497 298 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_21170 1868 1506 gene locus_tag LOCUS_21180 1868 1506 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818672.1 protein_id gnl|my_center|LOCUS_21180 2736 1885 gene locus_tag LOCUS_21190 gene panC 2736 1885 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_21190 3466 2771 gene locus_tag LOCUS_21200 3466 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3623 4981 gene locus_tag LOCUS_21210 gene xseA 3623 4981 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_21210 5430 4978 gene locus_tag LOCUS_21220 5430 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 6267 5959 gene locus_tag LOCUS_21230 6267 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 6401 6189 gene locus_tag LOCUS_21240 6401 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence156 2276 1152 gene locus_tag LOCUS_21250 gene mutY 2276 1152 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_21250 2450 2635 gene locus_tag LOCUS_21260 2450 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2933 3466 gene locus_tag LOCUS_21270 2933 3466 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_21270 4024 3623 gene locus_tag LOCUS_21280 4024 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4866 4021 gene locus_tag LOCUS_21290 4866 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence157 <1 626 gene locus_tag LOCUS_21300 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:OmpA family protein 1036 3585 gene locus_tag LOCUS_21310 1036 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5221 3611 gene locus_tag LOCUS_21320 5221 3611 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_21320 6119 5319 gene locus_tag LOCUS_21330 6119 5319 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence158 1177 2 gene locus_tag LOCUS_21340 1177 2 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643456.1 protein_id gnl|my_center|LOCUS_21340 3177 1174 gene locus_tag LOCUS_21350 3177 1174 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_21350 4795 3167 gene locus_tag LOCUS_21360 4795 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5376 4786 gene locus_tag LOCUS_21370 5376 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence159 <1 678 gene locus_tag LOCUS_21380 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041913993.1:type II secretion system ATPase GspE 800 1474 gene locus_tag LOCUS_21390 800 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1635 1955 gene locus_tag LOCUS_21400 1635 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2652 3422 gene locus_tag LOCUS_21410 2652 3422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_21410 3422 4168 gene locus_tag LOCUS_21420 3422 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence160 391 741 gene locus_tag LOCUS_21430 391 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21430 707 716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2503 2078 gene locus_tag LOCUS_21440 2503 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2642 3214 gene locus_tag LOCUS_21450 2642 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4794 5282 gene locus_tag LOCUS_21460 4794 5282 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387932.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence161 <1 539 gene locus_tag LOCUS_21470 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792490.1:amino acid ABC transporter permease 526 1266 gene locus_tag LOCUS_21480 526 1266 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938532.1 protein_id gnl|my_center|LOCUS_21480 1807 1553 gene locus_tag LOCUS_21490 1807 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2627 2184 gene locus_tag LOCUS_21500 2627 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2877 3551 gene locus_tag LOCUS_21510 gene bluB 2877 3551 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_21510 4254 3565 gene locus_tag LOCUS_21520 gene bioD 4254 3565 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225454.1 protein_id gnl|my_center|LOCUS_21520 4413 5729 gene locus_tag LOCUS_21530 4413 5729 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_21530 <6265 5665 gene locus_tag LOCUS_21540 <6265 5665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205939.1:malonyl-ACP O-methyltransferase BioC >Feature sequence162 419 670 gene locus_tag LOCUS_21550 419 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 672 2177 gene locus_tag LOCUS_21560 672 2177 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_21560 2189 3442 gene locus_tag LOCUS_21570 2189 3442 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123216.1 protein_id gnl|my_center|LOCUS_21570 2823 2832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3487 4143 gene locus_tag LOCUS_21580 3487 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4192 5220 gene locus_tag LOCUS_21590 4192 5220 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_21590 5231 5548 gene locus_tag LOCUS_21600 5231 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 5548 6168 gene locus_tag LOCUS_21610 5548 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence163 1901 363 gene locus_tag LOCUS_21620 1901 363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_21620 2143 2475 gene locus_tag LOCUS_21630 2143 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3169 2672 gene locus_tag LOCUS_21640 3169 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4116 3292 gene locus_tag LOCUS_21650 4116 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_21650 4961 4146 gene locus_tag LOCUS_21660 4961 4146 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_21660 5728 4958 gene locus_tag LOCUS_21670 5728 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence164 <1 1602 gene locus_tag LOCUS_21680 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722319.1:bifunctional sulfate adenylyltransferase/adenylylsulfate kinase 1607 2539 gene locus_tag LOCUS_21690 1607 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2546 3985 gene locus_tag LOCUS_21700 2546 3985 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049561091.1 protein_id gnl|my_center|LOCUS_21700 3998 4591 gene locus_tag LOCUS_21710 3998 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4584 5930 gene locus_tag LOCUS_21720 gene glrR 4584 5930 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence165 3161 462 gene locus_tag LOCUS_21730 3161 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 5264 3276 gene locus_tag LOCUS_21740 gene cooS 5264 3276 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_21740 <6021 5390 gene locus_tag LOCUS_21750 <6021 5390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230259.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence166 366 3572 gene locus_tag LOCUS_21760 gene murF 366 3572 CDS product bifunctional UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase MurE/UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase MurF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039092.1 protein_id gnl|my_center|LOCUS_21760 3669 4748 gene locus_tag LOCUS_21770 gene mraY 3669 4748 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence167 <1 1126 gene locus_tag LOCUS_21780 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938369.1:ABC transporter ATP-binding protein 1361 1158 gene locus_tag LOCUS_21790 1361 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3650 1596 gene locus_tag LOCUS_21800 3650 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21800 3764 4159 gene locus_tag LOCUS_21810 3764 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5699 4674 gene locus_tag LOCUS_21820 gene vmeA 5699 4674 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477962.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence168 228 377 gene locus_tag LOCUS_21830 gene rpmG 228 377 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_21830 487 563 gene locus_tag LOCUS_t00430 487 563 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 611 880 gene locus_tag LOCUS_21840 611 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 907 1437 gene locus_tag LOCUS_21850 gene nusG 907 1437 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_21850 1470 1895 gene locus_tag LOCUS_21860 gene rplK 1470 1895 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_21860 1969 2679 gene locus_tag LOCUS_21870 gene rplA 1969 2679 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_21870 2924 3442 gene locus_tag LOCUS_21880 gene rplJ 2924 3442 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940186.1 protein_id gnl|my_center|LOCUS_21880 3477 3866 gene locus_tag LOCUS_21890 gene rplL 3477 3866 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence169 1122 2645 gene locus_tag LOCUS_21900 gene murJ 1122 2645 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_21900 3421 2627 gene locus_tag LOCUS_21910 3421 2627 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 protein_id gnl|my_center|LOCUS_21910 3570 5501 gene locus_tag LOCUS_21920 gene glgB 3570 5501 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence170 2445 760 gene locus_tag LOCUS_21930 2445 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 5359 2519 gene locus_tag LOCUS_21940 5359 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5743 5432 gene locus_tag LOCUS_21950 5743 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence171 501 1586 gene locus_tag LOCUS_21960 gene arsB 501 1586 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_21960 1678 2124 gene locus_tag LOCUS_21970 1678 2124 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_21970 4020 3016 gene locus_tag LOCUS_21980 4020 3016 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_21980 5579 4233 gene locus_tag LOCUS_21990 5579 4233 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence172 1330 548 gene locus_tag LOCUS_22000 1330 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1814 1521 gene locus_tag LOCUS_22010 gene yggU 1814 1521 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 protein_id gnl|my_center|LOCUS_22010 2128 1832 gene locus_tag LOCUS_22020 2128 1832 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_22020 4236 2287 gene locus_tag LOCUS_22030 gene metG 4236 2287 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_22030 5355 4360 gene locus_tag LOCUS_22040 5355 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence173 1 444 gene locus_tag LOCUS_22050 1 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 548 1807 gene locus_tag LOCUS_22060 548 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2029 3525 gene locus_tag LOCUS_22070 2029 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3522 3989 gene locus_tag LOCUS_22080 3522 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3986 4456 gene locus_tag LOCUS_22090 3986 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence174 <1 1433 gene locus_tag LOCUS_22100 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938056.1:HAMP domain-containing sensor histidine kinase 1466 3688 gene locus_tag LOCUS_22110 1466 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3731 5458 gene locus_tag LOCUS_22120 gene msbA 3731 5458 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence175 3 1049 gene locus_tag LOCUS_22130 3 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2365 1064 gene locus_tag LOCUS_22140 2365 1064 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_22140 2461 2910 gene locus_tag LOCUS_22150 2461 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3233 4330 gene locus_tag LOCUS_22160 gene ychF 3233 4330 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_22160 4354 5415 gene locus_tag LOCUS_22170 4354 5415 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence176 1525 206 gene locus_tag LOCUS_22180 1525 206 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_22180 2490 1705 gene locus_tag LOCUS_22190 2490 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3498 2497 gene locus_tag LOCUS_22200 3498 2497 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_22200 3603 4745 gene locus_tag LOCUS_22210 3603 4745 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence177 815 639 gene locus_tag LOCUS_22220 815 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1021 815 gene locus_tag LOCUS_22230 1021 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1943 1155 gene locus_tag LOCUS_22240 1943 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2242 1943 gene locus_tag LOCUS_22250 2242 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3458 2244 gene locus_tag LOCUS_22260 3458 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3652 3518 gene locus_tag LOCUS_22270 3652 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4145 3897 gene locus_tag LOCUS_22280 4145 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4423 4154 gene locus_tag LOCUS_22290 4423 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4661 4837 gene locus_tag LOCUS_22300 4661 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 5215 5469 gene locus_tag LOCUS_22310 5215 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence178 111 857 gene locus_tag LOCUS_22320 111 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 870 1937 gene locus_tag LOCUS_22330 870 1937 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943138.1 protein_id gnl|my_center|LOCUS_22330 1943 3304 gene locus_tag LOCUS_22340 1943 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 3311 4744 gene locus_tag LOCUS_22350 3311 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943137.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence179 2977 1703 gene locus_tag LOCUS_22360 2977 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 <5296 3604 gene locus_tag LOCUS_22370 <5296 3604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit 4856 4865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence180 1 588 gene locus_tag LOCUS_22380 1 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1843 629 gene locus_tag LOCUS_22390 gene fabB 1843 629 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_22390 2614 1850 gene locus_tag LOCUS_22400 2614 1850 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939072.1 protein_id gnl|my_center|LOCUS_22400 3209 3721 gene locus_tag LOCUS_22410 3209 3721 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_22410 3747 4454 gene locus_tag LOCUS_22420 3747 4454 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937605.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence181 1333 2616 gene locus_tag LOCUS_22430 1333 2616 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_22430 2705 3232 gene locus_tag LOCUS_22440 2705 3232 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_22440 4307 3354 gene locus_tag LOCUS_22450 4307 3354 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_22450 4972 4544 gene locus_tag LOCUS_22460 gene ssb 4972 4544 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence182 <1 1086 gene locus_tag LOCUS_22470 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965385.1:flippase 1094 1975 gene locus_tag LOCUS_22480 1094 1975 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_22480 2031 2807 gene locus_tag LOCUS_22490 2031 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2807 3949 gene locus_tag LOCUS_22500 2807 3949 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808452.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence183 1303 620 gene locus_tag LOCUS_22510 1303 620 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_22510 1736 1284 gene locus_tag LOCUS_22520 gene ureE 1736 1284 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 protein_id gnl|my_center|LOCUS_22520 3442 1739 gene locus_tag LOCUS_22530 gene ureC 3442 1739 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099392.1 protein_id gnl|my_center|LOCUS_22530 3759 3439 gene locus_tag LOCUS_22540 3759 3439 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 protein_id gnl|my_center|LOCUS_22540 4076 3774 gene locus_tag LOCUS_22550 gene ureA 4076 3774 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_22550 5159 4323 gene locus_tag LOCUS_22560 5159 4323 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence184 589 200 gene locus_tag LOCUS_22570 589 200 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_22570 2247 586 gene locus_tag LOCUS_22580 2247 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4799 2439 gene locus_tag LOCUS_22590 4799 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence185 2299 3987 gene locus_tag LOCUS_22600 2299 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4014 5051 gene locus_tag LOCUS_22610 4014 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence186 970 182 gene locus_tag LOCUS_22620 970 182 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310727.1 protein_id gnl|my_center|LOCUS_22620 2142 967 gene locus_tag LOCUS_22630 2142 967 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 protein_id gnl|my_center|LOCUS_22630 2768 2139 gene locus_tag LOCUS_22640 gene gpmB 2768 2139 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 protein_id gnl|my_center|LOCUS_22640 4012 2765 gene locus_tag LOCUS_22650 4012 2765 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_22650 5011 4055 gene locus_tag LOCUS_22660 5011 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence187 1392 610 gene locus_tag LOCUS_22670 gene truA 1392 610 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_22670 2429 1389 gene locus_tag LOCUS_22680 gene argC 2429 1389 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_22680 3032 2640 gene locus_tag LOCUS_22690 gene rpsI 3032 2640 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_22690 3482 3054 gene locus_tag LOCUS_22700 gene rplM 3482 3054 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_22700 3630 3556 gene locus_tag LOCUS_t00440 3630 3556 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3828 4427 gene locus_tag LOCUS_22710 gene hisB 3828 4427 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence188 154 1551 gene locus_tag LOCUS_22720 gene nlpM 154 1551 CDS product nif11-like peptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814916.1 protein_id gnl|my_center|LOCUS_22720 1819 2013 gene locus_tag LOCUS_22730 1819 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22730 2032 2301 gene locus_tag LOCUS_22740 2032 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22740 4076 2343 gene locus_tag LOCUS_22750 gene extM 4076 2343 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_22750 <4981 4190 gene locus_tag LOCUS_22760 <4981 4190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase >Feature sequence189 <1 1004 gene locus_tag LOCUS_22770 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939127.1:class 1 fructose-bisphosphatase 1125 2201 gene locus_tag LOCUS_22780 1125 2201 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123234.1 protein_id gnl|my_center|LOCUS_22780 2316 2819 gene locus_tag LOCUS_22790 2316 2819 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_22790 2816 4147 gene locus_tag LOCUS_22800 2816 4147 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence190 580 44 gene locus_tag LOCUS_22810 580 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1506 577 gene locus_tag LOCUS_22820 1506 577 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_22820 2724 1657 gene locus_tag LOCUS_22830 2724 1657 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_22830 4258 2915 gene locus_tag LOCUS_22840 4258 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4586 4915 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccggggcgggaataccccggaaaac >Feature sequence191 945 58 gene locus_tag LOCUS_22850 gene rhuM 945 58 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_22850 1909 1019 gene locus_tag LOCUS_22860 gene cas7c 1909 1019 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_22860 3690 1912 gene locus_tag LOCUS_22870 gene cas8c 3690 1912 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_22870 4349 3687 gene locus_tag LOCUS_22880 gene cas5c 4349 3687 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448696.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence192 80 373 gene locus_tag LOCUS_22890 80 373 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_22890 370 1731 gene locus_tag LOCUS_22900 370 1731 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_22900 3715 1838 gene locus_tag LOCUS_22910 gene cooS 3715 1838 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939375.1 protein_id gnl|my_center|LOCUS_22910 4595 3939 gene locus_tag LOCUS_22920 4595 3939 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939374.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence193 1163 204 gene locus_tag LOCUS_22930 1163 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1545 1258 gene locus_tag LOCUS_22940 1545 1258 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942767.1 protein_id gnl|my_center|LOCUS_22940 2925 1630 gene locus_tag LOCUS_22950 gene eno 2925 1630 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_22950 4270 3062 gene locus_tag LOCUS_22960 4270 3062 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_22960 4463 4708 gene locus_tag LOCUS_22970 4463 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence194 <1 1874 gene locus_tag LOCUS_22980 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143274454.1:type III-B CRISPR-associated protein Cas10/Cmr2 2148 1831 gene locus_tag LOCUS_22990 2148 1831 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_22990 2436 2158 gene locus_tag LOCUS_23000 2436 2158 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_23000 2476 3507 gene locus_tag LOCUS_23010 2476 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3524 4441 gene locus_tag LOCUS_23020 gene cmr4 3524 4441 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_23020 4438 4809 gene locus_tag LOCUS_23030 4438 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence195 <1 1733 gene locus_tag LOCUS_23040 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404295.1:thioredoxin domain-containing protein 1749 2600 gene locus_tag LOCUS_23050 1749 2600 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_23050 3895 2618 gene locus_tag LOCUS_23060 gene tviB 3895 2618 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_23060 4362 3979 gene locus_tag LOCUS_23070 gene queD 4362 3979 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence196 928 1383 gene locus_tag LOCUS_23080 928 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1505 2731 gene locus_tag LOCUS_23090 1505 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2741 4486 gene locus_tag LOCUS_23100 2741 4486 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence197 <1 2483 gene locus_tag LOCUS_23110 <1 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS 2694 4586 gene locus_tag LOCUS_23120 2694 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence198 3092 1773 gene locus_tag LOCUS_23130 3092 1773 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_23130 4495 3314 gene locus_tag LOCUS_23140 4495 3314 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_23140 4692 4492 gene locus_tag LOCUS_23150 4692 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence199 432 617 gene locus_tag LOCUS_23160 432 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 628 2643 gene locus_tag LOCUS_23170 gene ligA 628 2643 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_23170 2643 2924 gene locus_tag LOCUS_23180 2643 2924 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_23180 2942 3193 gene locus_tag LOCUS_23190 2942 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3193 3960 gene locus_tag LOCUS_23200 3193 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4383 4063 gene locus_tag LOCUS_23210 4383 4063 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence200 961 617 gene locus_tag LOCUS_23220 gene yajC 961 617 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_23220 2220 1084 gene locus_tag LOCUS_23230 gene tgt 2220 1084 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_23230 2531 4429 gene locus_tag LOCUS_23240 2531 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence201 1160 45 gene locus_tag LOCUS_23250 1160 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2279 1194 gene locus_tag LOCUS_23260 2279 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2608 2276 gene locus_tag LOCUS_23270 2608 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2900 4240 gene locus_tag LOCUS_23280 gene radA 2900 4240 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence202 1989 760 gene locus_tag LOCUS_23290 1989 760 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_23290 2477 1986 gene locus_tag LOCUS_23300 2477 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3693 2491 gene locus_tag LOCUS_23310 3693 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 <4527 3706 gene locus_tag LOCUS_23320 <4527 3706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770766.1:extracellular solute-binding protein >Feature sequence203 875 384 gene locus_tag LOCUS_23330 875 384 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_23330 1759 878 gene locus_tag LOCUS_23340 1759 878 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_23340 3557 1923 gene locus_tag LOCUS_23350 3557 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3905 3684 gene locus_tag LOCUS_23360 3905 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence204 <1 1281 gene locus_tag LOCUS_23370 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122252.1:DEAD/DEAH box helicase 2128 1346 gene locus_tag LOCUS_23380 2128 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3073 2147 gene locus_tag LOCUS_23390 3073 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4063 3080 gene locus_tag LOCUS_23400 4063 3080 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence205 8 1756 gene locus_tag LOCUS_23410 gene recJ 8 1756 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_23410 2037 3479 gene locus_tag LOCUS_23420 gene purB 2037 3479 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_23420 3481 3714 gene locus_tag LOCUS_23430 3481 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence206 1731 1207 gene locus_tag LOCUS_23440 1731 1207 CDS product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_23440 3557 1746 gene locus_tag LOCUS_23450 3557 1746 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_23450 4255 3563 gene locus_tag LOCUS_23460 4255 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence207 <1 2383 gene locus_tag LOCUS_23470 <1 2383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein 2793 2398 gene locus_tag LOCUS_23480 2793 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 <4415 2851 gene locus_tag LOCUS_23490 <4415 2851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit >Feature sequence208 230 979 gene locus_tag LOCUS_23500 230 979 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_23500 1127 1633 gene locus_tag LOCUS_23510 1127 1633 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_23510 1636 3729 gene locus_tag LOCUS_23520 1636 3729 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_23520 3726 3920 gene locus_tag LOCUS_23530 3726 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence209 722 213 gene locus_tag LOCUS_23540 722 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1365 901 gene locus_tag LOCUS_23550 1365 901 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_23550 2618 1512 gene locus_tag LOCUS_23560 2618 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3693 2749 gene locus_tag LOCUS_23570 3693 2749 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence210 382 852 gene locus_tag LOCUS_23580 gene mraZ 382 852 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_23580 865 1776 gene locus_tag LOCUS_23590 gene rsmH 865 1776 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_23590 1795 2160 gene locus_tag LOCUS_23600 1795 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence211 126 1409 gene locus_tag LOCUS_23610 gene tolB 126 1409 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_23610 1481 2521 gene locus_tag LOCUS_23620 gene ybgF 1481 2521 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939216.1 protein_id gnl|my_center|LOCUS_23620 2553 3344 gene locus_tag LOCUS_23630 2553 3344 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_23630 3656 4114 gene locus_tag LOCUS_23640 3656 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence212 1731 568 gene locus_tag LOCUS_23650 1731 568 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_23650 2692 1745 gene locus_tag LOCUS_23660 gene rsmA 2692 1745 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_23660 3235 2732 gene locus_tag LOCUS_23670 3235 2732 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 protein_id gnl|my_center|LOCUS_23670 4242 3238 gene locus_tag LOCUS_23680 gene tsaD 4242 3238 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence213 944 744 gene locus_tag LOCUS_23690 944 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1121 2188 gene locus_tag LOCUS_23700 gene purM 1121 2188 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_23700 2844 2323 gene locus_tag LOCUS_23710 2844 2323 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_23710 <4311 2850 gene locus_tag LOCUS_23720 <4311 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G >Feature sequence214 278 1336 gene locus_tag LOCUS_23730 278 1336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 protein_id gnl|my_center|LOCUS_23730 1423 2496 gene locus_tag LOCUS_23740 1423 2496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_23740 2503 3360 gene locus_tag LOCUS_23750 2503 3360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969483.1 protein_id gnl|my_center|LOCUS_23750 3357 4211 gene locus_tag LOCUS_23760 3357 4211 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037481.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence215 <4294 1253 gene locus_tag LOCUS_23770 <4294 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:class I SAM-dependent DNA methyltransferase >Feature sequence216 <1 778 gene locus_tag LOCUS_23780 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881416.1:CCA tRNA nucleotidyltransferase 771 1406 gene locus_tag LOCUS_23790 771 1406 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_23790 1795 2544 gene locus_tag LOCUS_23800 1795 2544 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_23800 2616 3113 gene locus_tag LOCUS_23810 gene ruvC 2616 3113 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_23810 3581 4204 gene locus_tag LOCUS_23820 gene ruvA 3581 4204 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence217 902 153 gene locus_tag LOCUS_23830 gene cobM 902 153 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_23830 1645 899 gene locus_tag LOCUS_23840 gene cobI 1645 899 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_23840 2985 1708 gene locus_tag LOCUS_23850 2985 1708 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258427.1 protein_id gnl|my_center|LOCUS_23850 4177 3005 gene locus_tag LOCUS_23860 4177 3005 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence218 2866 1829 gene locus_tag LOCUS_23870 2866 1829 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_23870 <4212 2889 gene locus_tag LOCUS_23880 <4212 2889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044950.1:TolC family protein >Feature sequence219 397 603 gene locus_tag LOCUS_23890 397 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2680 983 gene locus_tag LOCUS_23900 2680 983 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_23900 4167 2677 gene locus_tag LOCUS_23910 gene gltX 4167 2677 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence220 <1 1871 gene locus_tag LOCUS_23920 <1 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941319.1:ATP-dependent chaperone ClpB 1902 1911 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2157 2648 gene locus_tag LOCUS_23930 2157 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4106 2694 gene locus_tag LOCUS_23940 4106 2694 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937940.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence221 <1 602 gene locus_tag LOCUS_23950 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792164.1:TIGR04282 family arsenosugar biosynthesis glycosyltransferase 562 1242 gene locus_tag LOCUS_23960 562 1242 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_23960 1799 1230 gene locus_tag LOCUS_23970 1799 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1932 2684 gene locus_tag LOCUS_23980 1932 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2688 3530 gene locus_tag LOCUS_23990 gene mutM 2688 3530 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence222 <1 1025 gene locus_tag LOCUS_24000 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048172.1:glycyl radical protein 1025 1504 gene locus_tag LOCUS_24010 1025 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1570 2400 gene locus_tag LOCUS_24020 1570 2400 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_24020 2406 3125 gene locus_tag LOCUS_24030 2406 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3155 4126 gene locus_tag LOCUS_24040 3155 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence223 2570 1053 gene locus_tag LOCUS_24050 2570 1053 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_24050 <4128 2586 gene locus_tag LOCUS_24060 <4128 2586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967805.1:Na(+)/H(+) antiporter subunit D >Feature sequence224 <1 1168 gene locus_tag LOCUS_24070 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005419738.1:amino acid ABC transporter permease 1171 2274 gene locus_tag LOCUS_24080 1171 2274 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_24080 2362 3129 gene locus_tag LOCUS_24090 2362 3129 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence225 95 1216 gene locus_tag LOCUS_24100 95 1216 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_24100 2433 1402 gene locus_tag LOCUS_24110 2433 1402 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence226 38 364 gene locus_tag LOCUS_24120 38 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 477 1550 gene locus_tag LOCUS_24130 477 1550 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence227 3758 888 gene locus_tag LOCUS_24140 3758 888 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence228 3339 1336 gene locus_tag LOCUS_24150 3339 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence229 <1 941 gene locus_tag LOCUS_24160 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705996.1:glycosyl transferase 938 1867 gene locus_tag LOCUS_24170 938 1867 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_24170 1860 2735 gene locus_tag LOCUS_24180 1860 2735 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence230 1036 293 gene locus_tag LOCUS_24190 gene folE2 1036 293 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_24190 1221 1619 gene locus_tag LOCUS_24200 gene hslR 1221 1619 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660720.1 protein_id gnl|my_center|LOCUS_24200 1641 2261 gene locus_tag LOCUS_24210 1641 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2549 3163 gene locus_tag LOCUS_24220 gene purN 2549 3163 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_24220 3160 3696 gene locus_tag LOCUS_24230 gene pyrR 3160 3696 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546581.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence231 2002 248 gene locus_tag LOCUS_24240 2002 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2509 2018 gene locus_tag LOCUS_24250 2509 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 <3871 2912 gene locus_tag LOCUS_24260 <3871 2912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173514554.1:copper-translocating P-type ATPase >Feature sequence232 577 2613 gene locus_tag LOCUS_24270 577 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 3496 2630 gene locus_tag LOCUS_24280 3496 2630 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence233 2010 973 gene locus_tag LOCUS_24290 2010 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2183 2007 gene locus_tag LOCUS_24300 2183 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3284 2352 gene locus_tag LOCUS_24310 gene cas6 3284 2352 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence234 219 3479 gene locus_tag LOCUS_24320 219 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence235 626 1186 gene locus_tag LOCUS_24330 626 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1205 1615 gene locus_tag LOCUS_24340 1205 1615 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_24340 1855 2523 gene locus_tag LOCUS_24350 1855 2523 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence236 284 1570 gene locus_tag LOCUS_24360 gene urtA 284 1570 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_24360 1661 3295 gene locus_tag LOCUS_24370 gene urtB 1661 3295 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence237 <1 1462 gene locus_tag LOCUS_24380 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020247.1:DEAD/DEAH box helicase 1539 2456 gene locus_tag LOCUS_24390 1539 2456 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_24390 <3787 2907 gene locus_tag LOCUS_24400 <3787 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986854.1:Fic family protein >Feature sequence238 477 1712 gene locus_tag LOCUS_24410 477 1712 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence239 553 269 gene locus_tag LOCUS_24420 553 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1938 763 gene locus_tag LOCUS_24430 1938 763 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_24430 2521 2123 gene locus_tag LOCUS_24440 2521 2123 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_24440 3291 2623 gene locus_tag LOCUS_24450 3291 2623 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence240 589 2052 gene locus_tag LOCUS_24460 gene cysS 589 2052 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_24460 2343 3143 gene locus_tag LOCUS_24470 gene amrB 2343 3143 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_24470 3268 3341 gene locus_tag LOCUS_t00450 3268 3341 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 2188 236 gene locus_tag LOCUS_24480 gene dnaK 2188 236 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_24480 2996 2394 gene locus_tag LOCUS_24490 gene grpE 2996 2394 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence242 2584 1517 gene locus_tag LOCUS_24500 2584 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3579 2581 gene locus_tag LOCUS_24510 3579 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence243 553 1056 gene locus_tag LOCUS_24520 553 1056 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943891.1 protein_id gnl|my_center|LOCUS_24520 1194 1394 gene locus_tag LOCUS_24530 1194 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1485 2294 gene locus_tag LOCUS_24540 1485 2294 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403116.1 protein_id gnl|my_center|LOCUS_24540 2432 3130 gene locus_tag LOCUS_24550 2432 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence244 1409 2611 gene locus_tag LOCUS_24560 1409 2611 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence245 339 49 gene locus_tag LOCUS_24570 339 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1024 452 gene locus_tag LOCUS_24580 1024 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3148 1028 gene locus_tag LOCUS_24590 3148 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence246 247 2853 gene locus_tag LOCUS_24600 247 2853 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence247 982 83 gene locus_tag LOCUS_24610 982 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24610 1602 1090 gene locus_tag LOCUS_24620 1602 1090 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_24620 <3478 1651 gene locus_tag LOCUS_24630 <3478 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958113.1:LssY C-terminal domain-containing protein >Feature sequence248 77 1510 gene locus_tag LOCUS_24640 77 1510 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_24640 1609 2247 gene locus_tag LOCUS_24650 gene lexA 1609 2247 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_24650 2442 2729 gene locus_tag LOCUS_24660 2442 2729 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_24660 2726 2947 gene locus_tag LOCUS_24670 2726 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence249 1510 656 gene locus_tag LOCUS_24680 1510 656 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689582.1 protein_id gnl|my_center|LOCUS_24680 3387 1507 gene locus_tag LOCUS_24690 3387 1507 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence250 1778 342 gene locus_tag LOCUS_24700 1778 342 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989732.1 protein_id gnl|my_center|LOCUS_24700 2979 1756 gene locus_tag LOCUS_24710 2979 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence251 2154 1042 gene locus_tag LOCUS_24720 2154 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2645 2295 gene locus_tag LOCUS_24730 2645 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence252 2767 734 gene locus_tag LOCUS_24740 2767 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence253 1320 736 gene locus_tag LOCUS_24750 1320 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1963 1511 gene locus_tag LOCUS_24760 1963 1511 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_24760 <3338 1960 gene locus_tag LOCUS_24770 <3338 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937484.1:thiosulfate reductase >Feature sequence254 3 455 gene locus_tag LOCUS_24780 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 456 2219 gene locus_tag LOCUS_24790 gene dnaK 456 2219 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_24790 2223 2546 gene locus_tag LOCUS_24800 2223 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence255 1935 1612 gene locus_tag LOCUS_24810 1935 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2241 2014 gene locus_tag LOCUS_24820 2241 2014 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049786599.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence256 2101 728 gene locus_tag LOCUS_24830 2101 728 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490599.1 protein_id gnl|my_center|LOCUS_24830 <3288 2094 gene locus_tag LOCUS_24840 <3288 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391770.1:sensor histidine kinase >Feature sequence257 <1 1443 gene locus_tag LOCUS_24850 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942109.1:aspartate--tRNA ligase 2589 1492 gene locus_tag LOCUS_24860 2589 1492 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_24860 2942 2595 gene locus_tag LOCUS_24870 2942 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence258 978 205 gene locus_tag LOCUS_24880 978 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1737 2579 gene locus_tag LOCUS_24890 1737 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence259 162 1403 gene locus_tag LOCUS_24900 162 1403 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530014.1 protein_id gnl|my_center|LOCUS_24900 1400 2068 gene locus_tag LOCUS_24910 1400 2068 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410049.1 protein_id gnl|my_center|LOCUS_24910 2170 2973 gene locus_tag LOCUS_24920 2170 2973 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence260 52 1800 gene locus_tag LOCUS_24930 gene ade 52 1800 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967905.1 protein_id gnl|my_center|LOCUS_24930 2910 1780 gene locus_tag LOCUS_24940 gene nifV 2910 1780 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418528.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence261 1358 2479 gene locus_tag LOCUS_24950 1358 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 <3206 2575 gene locus_tag LOCUS_24960 <3206 2575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941176.1:endolytic transglycosylase MltG >Feature sequence262 2407 2129 gene locus_tag LOCUS_24970 2407 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence263 241 1632 gene locus_tag LOCUS_24980 241 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2642 1995 gene locus_tag LOCUS_24990 2642 1995 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence264 1878 949 gene locus_tag LOCUS_25000 1878 949 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence265 1431 331 gene locus_tag LOCUS_25010 gene wecB 1431 331 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_25010 2327 1428 gene locus_tag LOCUS_25020 2327 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 <3099 2337 gene locus_tag LOCUS_25030 <3099 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965644.1:glycosyltransferase family 2 protein >Feature sequence266 406 1230 gene locus_tag LOCUS_25040 gene nifH 406 1230 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176593.1 protein_id gnl|my_center|LOCUS_25040 1303 1659 gene locus_tag LOCUS_25050 1303 1659 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933199.1 protein_id gnl|my_center|LOCUS_25050 1656 2030 gene locus_tag LOCUS_25060 1656 2030 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933200.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence267 1199 951 gene locus_tag LOCUS_25070 1199 951 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525356.1 protein_id gnl|my_center|LOCUS_25070 <3059 1225 gene locus_tag LOCUS_25080 <3059 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976178.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence268 320 1099 gene locus_tag LOCUS_25090 320 1099 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940035.1 protein_id gnl|my_center|LOCUS_25090 1096 1845 gene locus_tag LOCUS_25100 gene cbiQ 1096 1845 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_25100 2142 2867 gene locus_tag LOCUS_25110 2142 2867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence269 88 675 gene locus_tag LOCUS_25120 88 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence270 593 871 gene locus_tag LOCUS_25130 593 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 <3034 980 gene locus_tag LOCUS_25140 <3034 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938126.1:preprotein translocase subunit SecA >Feature sequence271 <1 806 gene locus_tag LOCUS_25150 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229228.1:cobalamin biosynthesis protein 1005 1163 gene locus_tag LOCUS_25160 1005 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1250 2206 gene locus_tag LOCUS_25170 1250 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence272 1497 421 gene locus_tag LOCUS_25180 1497 421 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_25180 1935 1576 gene locus_tag LOCUS_25190 1935 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2756 2286 gene locus_tag LOCUS_25200 2756 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence273 140 790 gene locus_tag LOCUS_25210 140 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 816 1541 gene locus_tag LOCUS_25220 816 1541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence274 >Feature sequence275 1940 621 gene locus_tag LOCUS_25230 gene trmFO 1940 621 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_25230 2288 2494 gene locus_tag LOCUS_25240 2288 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2700 2924 gene locus_tag LOCUS_25250 2700 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence276 688 131 gene locus_tag LOCUS_25260 gene tadA 688 131 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872231.1 protein_id gnl|my_center|LOCUS_25260 2856 685 gene locus_tag LOCUS_25270 2856 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence277 1211 594 gene locus_tag LOCUS_25280 1211 594 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 protein_id gnl|my_center|LOCUS_25280 2576 1275 gene locus_tag LOCUS_25290 gene aroA 2576 1275 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence278 >Feature sequence279 2 307 gene locus_tag LOCUS_25300 2 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2038 371 gene locus_tag LOCUS_25310 2038 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 <2921 2220 gene locus_tag LOCUS_25320 <2921 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942909.1:ABC transporter ATP-binding protein >Feature sequence280 94 999 gene locus_tag LOCUS_25330 94 999 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_25330 2742 1039 gene locus_tag LOCUS_25340 2742 1039 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence281 1675 2088 gene locus_tag LOCUS_25350 1675 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 <2918 2103 gene locus_tag LOCUS_25360 <2918 2103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583579.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence282 746 264 gene locus_tag LOCUS_25370 746 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393800.1 protein_id gnl|my_center|LOCUS_25370 1086 721 gene locus_tag LOCUS_25380 1086 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2090 1083 gene locus_tag LOCUS_25390 2090 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023621.1 protein_id gnl|my_center|LOCUS_25390 2886 2101 gene locus_tag LOCUS_25400 2886 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence283 67 1428 gene locus_tag LOCUS_25410 67 1428 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence284 >Feature sequence285 <1 610 gene locus_tag LOCUS_25420 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937875.1:alanine dehydrogenase 898 1320 gene locus_tag LOCUS_25430 898 1320 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 protein_id gnl|my_center|LOCUS_25430 2501 1389 gene locus_tag LOCUS_25440 2501 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence286 1171 980 gene locus_tag LOCUS_25450 1171 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 2211 1168 gene locus_tag LOCUS_25460 2211 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2645 2208 gene locus_tag LOCUS_25470 2645 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence287 967 374 gene locus_tag LOCUS_25480 gene tsf 967 374 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_25480 1887 1099 gene locus_tag LOCUS_25490 gene rpsB 1887 1099 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence288 >Feature sequence289 562 1134 gene locus_tag LOCUS_25500 562 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2308 1097 gene locus_tag LOCUS_25510 2308 1097 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence290 478 218 gene locus_tag LOCUS_25520 478 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 692 1525 gene locus_tag LOCUS_25530 692 1525 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546502.1 protein_id gnl|my_center|LOCUS_25530 1527 1904 gene locus_tag LOCUS_25540 1527 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence291 559 1641 gene locus_tag LOCUS_25550 559 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1641 2507 gene locus_tag LOCUS_25560 1641 2507 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence292 327 623 gene locus_tag LOCUS_25570 327 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25570 605 1849 gene locus_tag LOCUS_25580 605 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2271 1864 gene locus_tag LOCUS_25590 2271 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence293 <1 1233 gene locus_tag LOCUS_25600 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942687.1:EAL domain-containing protein >Feature sequence294 >Feature sequence295 1284 205 gene locus_tag LOCUS_25610 gene mobAB 1284 205 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927249.1 protein_id gnl|my_center|LOCUS_25610 2126 1281 gene locus_tag LOCUS_25620 2126 1281 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence296 487 20 gene locus_tag LOCUS_25630 gene secB 487 20 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_25630 <2638 705 gene locus_tag LOCUS_25640 <2638 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061214.1:excinuclease ABC subunit UvrA >Feature sequence297 3 554 gene locus_tag LOCUS_25650 3 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 715 1272 gene locus_tag LOCUS_25660 715 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence298 1175 690 gene locus_tag LOCUS_25670 gene gpt 1175 690 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_25670 2167 1247 gene locus_tag LOCUS_25680 2167 1247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence299 1379 768 gene locus_tag LOCUS_25690 1379 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1535 2116 gene locus_tag LOCUS_25700 1535 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence300 1720 956 gene locus_tag LOCUS_25710 gene kdsB 1720 956 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence301 2 640 gene locus_tag LOCUS_25720 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence302 <1 631 gene locus_tag LOCUS_25730 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140106.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase 655 729 gene locus_tag LOCUS_t00460 655 729 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 752 1690 gene locus_tag LOCUS_25740 752 1690 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938866.1 protein_id gnl|my_center|LOCUS_25740 1795 2352 gene locus_tag LOCUS_25750 1795 2352 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence303 1 2301 gene locus_tag LOCUS_25760 1 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence304 1 243 gene locus_tag LOCUS_25770 1 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 541 254 gene locus_tag LOCUS_25780 541 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2373 607 gene locus_tag LOCUS_25790 2373 607 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence305 896 210 gene locus_tag LOCUS_25800 896 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1330 1016 gene locus_tag LOCUS_25810 1330 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1522 1355 gene locus_tag LOCUS_25820 1522 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1863 1519 gene locus_tag LOCUS_25830 1863 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence306 446 727 gene locus_tag LOCUS_25840 446 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 755 1927 gene locus_tag LOCUS_25850 755 1927 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202494.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence307 587 2185 gene locus_tag LOCUS_25860 gene serA 587 2185 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence308 405 1121 gene locus_tag LOCUS_25870 405 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 <2393 1273 gene locus_tag LOCUS_25880 <2393 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704592.1:peptidylprolyl isomerase >Feature sequence309 850 155 gene locus_tag LOCUS_25890 gene urtE 850 155 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938472.1 protein_id gnl|my_center|LOCUS_25890 1683 853 gene locus_tag LOCUS_25900 gene urtD 1683 853 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_25900 <2390 1680 gene locus_tag LOCUS_25910 <2390 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084267.1:urea ABC transporter permease subunit UrtC >Feature sequence310 1306 1010 gene locus_tag LOCUS_25920 1306 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1521 1303 gene locus_tag LOCUS_25930 1521 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 <2366 1797 gene locus_tag LOCUS_25940 <2366 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020677315.1:DEAD/DEAH box helicase family protein >Feature sequence311 <1 1894 gene locus_tag LOCUS_25950 <1 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205226061.1:methyl-accepting chemotaxis protein >Feature sequence312 242 2065 gene locus_tag LOCUS_25960 242 2065 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence313 1677 136 gene locus_tag LOCUS_25970 1677 136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence314 368 2059 gene locus_tag LOCUS_25980 368 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence315 <1 2170 gene locus_tag LOCUS_25990 <1 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144210.1:type I polyketide synthase >Feature sequence316 <1 542 gene locus_tag LOCUS_26000 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941857.1:30S ribosomal protein S1 1337 552 gene locus_tag LOCUS_26010 gene rlmB 1337 552 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_26010 1972 1364 gene locus_tag LOCUS_26020 gene gmk 1972 1364 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_26020 2267 1965 gene locus_tag LOCUS_26030 2267 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence317 >Feature sequence318 1308 82 gene locus_tag LOCUS_26040 1308 82 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_26040 1570 1725 gene locus_tag LOCUS_26050 1570 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence319 1585 398 gene locus_tag LOCUS_26060 1585 398 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_26060 <2140 1582 gene locus_tag LOCUS_26070 <2140 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038389.1:bifunctional DedA family/phosphatase PAP2 family protein >Feature sequence320 1021 140 gene locus_tag LOCUS_26080 1021 140 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_26080 <2053 1058 gene locus_tag LOCUS_26090 <2053 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094228360.1:cobaltochelatase subunit CobN >Feature sequence321 <1 1490 gene locus_tag LOCUS_26100 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942706.1:DNA repair protein RecN >Feature sequence322 <1 505 gene locus_tag LOCUS_26110 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942375.1:ABC transporter ATP-binding protein 579 1850 gene locus_tag LOCUS_26120 579 1850 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence323 150 467 gene locus_tag LOCUS_26130 150 467 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_26130 1301 633 gene locus_tag LOCUS_26140 1301 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence324 1157 1774 gene locus_tag LOCUS_26150 1157 1774 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence325 511 924 gene locus_tag LOCUS_26160 511 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence326 <1 683 gene locus_tag LOCUS_26170 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870190.1:AAA family ATPase 724 1431 gene locus_tag LOCUS_26180 gene ftsE 724 1431 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence327 <1930 865 gene locus_tag LOCUS_26190 <1930 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941191.1:aminodeoxychorismate synthase component I >Feature sequence328 <1914 1201 gene locus_tag LOCUS_26200 <1914 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942903.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence329 497 228 gene locus_tag LOCUS_26210 497 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 757 503 gene locus_tag LOCUS_26220 757 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 996 859 gene locus_tag LOCUS_26230 gene rpmH 996 859 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816025.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence330 <1 800 gene locus_tag LOCUS_26240 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021191.1:ribose-phosphate diphosphokinase >Feature sequence331 580 1683 gene locus_tag LOCUS_26250 gene queA 580 1683 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940607.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence332 <1 752 gene locus_tag LOCUS_26260 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259308.1:homocysteine synthase >Feature sequence333 1277 888 gene locus_tag LOCUS_26270 1277 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence334 1182 298 gene locus_tag LOCUS_26280 1182 298 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_26280 1487 1200 gene locus_tag LOCUS_26290 1487 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence335 <1775 39 gene locus_tag LOCUS_26300 <1775 39 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:DEAD/DEAH box helicase family protein >Feature sequence336 <1 1205 gene locus_tag LOCUS_26310 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392070.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence337 681 478 gene locus_tag LOCUS_26320 681 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 806 681 gene locus_tag LOCUS_26330 806 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 986 1159 gene locus_tag LOCUS_26340 986 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1664 1182 gene locus_tag LOCUS_26350 gene creA 1664 1182 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence338 >Feature sequence339 >Feature sequence340 >Feature sequence341 >Feature sequence342 >Feature sequence343 <1 855 gene locus_tag LOCUS_26360 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943389.1:glycerol-3-phosphate dehydrogenase/oxidase 1622 840 gene locus_tag LOCUS_26370 1622 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence344 <1 1370 gene locus_tag LOCUS_26380 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:PAS domain S-box protein >Feature sequence345 648 115 gene locus_tag LOCUS_26390 648 115 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940993.1 protein_id gnl|my_center|LOCUS_26390 1177 716 gene locus_tag LOCUS_26400 gene gspG 1177 716 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence346 903 559 gene locus_tag LOCUS_26410 gene rplQ 903 559 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393907.1 protein_id gnl|my_center|LOCUS_26410 <1625 1009 gene locus_tag LOCUS_26420 <1625 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943459.1:DNA-directed RNA polymerase subunit alpha >Feature sequence347 1599 718 gene locus_tag LOCUS_26430 gene prmC 1599 718 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence348 <1592 882 gene locus_tag LOCUS_26440 <1592 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545614.1:flagellar hook protein FlgE >Feature sequence349 363 1331 gene locus_tag LOCUS_26450 gene trpS 363 1331 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence350 115 462 gene locus_tag LOCUS_26460 115 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 465 1244 gene locus_tag LOCUS_26470 465 1244 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence351 110 772 gene locus_tag LOCUS_26480 110 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 769 1215 gene locus_tag LOCUS_26490 769 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence352 138 452 gene locus_tag LOCUS_26500 gene rpsJ 138 452 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_26500 520 1152 gene locus_tag LOCUS_26510 gene rplC 520 1152 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence353 >Feature sequence354 711 58 gene locus_tag LOCUS_26520 711 58 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_26520 1082 708 gene locus_tag LOCUS_26530 1082 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530