>Feature sequence001 361 140 gene locus_tag LOCUS_0010 gene infA 361 140 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567521.1 protein_id gnl|my_center|LOCUS_0010 1122 364 gene locus_tag LOCUS_0020 gene map 1122 364 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018129.1 protein_id gnl|my_center|LOCUS_0020 2410 1151 gene locus_tag LOCUS_0030 gene secY 2410 1151 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_0030 2807 2415 gene locus_tag LOCUS_0040 gene rplO 2807 2415 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_0040 3283 2810 gene locus_tag LOCUS_0050 gene rpsE 3283 2810 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001860543.1 protein_id gnl|my_center|LOCUS_0050 3661 3296 gene locus_tag LOCUS_0060 gene rplR 3661 3296 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_0060 4207 3671 gene locus_tag LOCUS_0070 gene rplF 4207 3671 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_0070 4622 4227 gene locus_tag LOCUS_0080 gene rpsH 4622 4227 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_0080 4820 4635 gene locus_tag LOCUS_0090 4820 4635 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_0090 5367 4813 gene locus_tag LOCUS_0100 gene rplE 5367 4813 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_0100 5623 5372 gene locus_tag LOCUS_0110 5623 5372 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834232.1 protein_id gnl|my_center|LOCUS_0110 5991 5623 gene locus_tag LOCUS_0120 gene rplN 5991 5623 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_0120 6239 5994 gene locus_tag LOCUS_0130 gene rpsQ 6239 5994 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_0130 6445 6239 gene locus_tag LOCUS_0140 gene rpmC 6445 6239 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_0140 6857 6432 gene locus_tag LOCUS_0150 gene rplP 6857 6432 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928961.1 protein_id gnl|my_center|LOCUS_0150 7560 6835 gene locus_tag LOCUS_0160 gene rpsC 7560 6835 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_0160 7880 7560 gene locus_tag LOCUS_0170 7880 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 8171 7890 gene locus_tag LOCUS_0180 gene rpsS 8171 7890 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_0180 9005 8181 gene locus_tag LOCUS_0190 gene rplB 9005 8181 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_0190 9297 9016 gene locus_tag LOCUS_0200 9297 9016 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763613.1 protein_id gnl|my_center|LOCUS_0200 9888 9301 gene locus_tag LOCUS_0210 gene rplD 9888 9301 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_0210 10460 9885 gene locus_tag LOCUS_0220 gene rplC 10460 9885 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_0220 10779 10471 gene locus_tag LOCUS_0230 gene rpsJ 10779 10471 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_0230 11566 10898 gene locus_tag LOCUS_0240 11566 10898 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_0240 12671 11592 gene locus_tag LOCUS_0250 12671 11592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545052.1 protein_id gnl|my_center|LOCUS_0250 >Feature sequence002 399 1031 gene locus_tag LOCUS_0260 399 1031 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_0260 1036 1812 gene locus_tag LOCUS_0270 1036 1812 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_0270 1809 2648 gene locus_tag LOCUS_0280 1809 2648 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_0280 2682 3107 gene locus_tag LOCUS_0290 2682 3107 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_0290 3104 3607 gene locus_tag LOCUS_0300 3104 3607 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_0300 3607 4122 gene locus_tag LOCUS_0310 3607 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 4137 5642 gene locus_tag LOCUS_0320 gene atpA 4137 5642 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_0320 5646 6527 gene locus_tag LOCUS_0330 gene atpG 5646 6527 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_0330 6538 7944 gene locus_tag LOCUS_0340 gene atpD 6538 7944 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_0340 7955 8335 gene locus_tag LOCUS_0350 gene atpC 7955 8335 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_0350 8316 8864 gene locus_tag LOCUS_0360 8316 8864 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_0360 8861 9238 gene locus_tag LOCUS_0370 8861 9238 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858790.1 protein_id gnl|my_center|LOCUS_0370 9235 9921 gene locus_tag LOCUS_0380 9235 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 9918 11090 gene locus_tag LOCUS_0390 gene tolB 9918 11090 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_0390 11111 11686 gene locus_tag LOCUS_0400 11111 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 >Feature sequence003 877 1992 gene locus_tag LOCUS_0410 877 1992 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_0410 1967 2824 gene locus_tag LOCUS_0420 1967 2824 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_0420 2802 3977 gene locus_tag LOCUS_0430 gene sat 2802 3977 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029491.1 protein_id gnl|my_center|LOCUS_0430 3987 4481 gene locus_tag LOCUS_0440 3987 4481 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_0440 4587 4859 gene locus_tag LOCUS_0450 4587 4859 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262024.1 protein_id gnl|my_center|LOCUS_0450 4870 5439 gene locus_tag LOCUS_0460 4870 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 6759 5446 gene locus_tag LOCUS_0470 6759 5446 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_0470 7357 6824 gene locus_tag LOCUS_0480 7357 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 8302 7367 gene locus_tag LOCUS_0490 gene accA 8302 7367 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_0490 9533 8313 gene locus_tag LOCUS_0500 9533 8313 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_0500 9866 9633 gene locus_tag LOCUS_0510 gene acpP 9866 9633 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_0510 10739 9996 gene locus_tag LOCUS_0520 gene fabG 10739 9996 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_0520 >Feature sequence004 2 77 gene locus_tag LOCUS_t0010 2 77 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 103 291 gene locus_tag LOCUS_0530 103 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 300 836 gene locus_tag LOCUS_0540 gene nusG 300 836 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_0540 847 1272 gene locus_tag LOCUS_0550 gene rplK 847 1272 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_0550 1314 2015 gene locus_tag LOCUS_0560 gene rplA 1314 2015 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_0560 2100 2579 gene locus_tag LOCUS_0570 gene rplJ 2100 2579 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171739.1 protein_id gnl|my_center|LOCUS_0570 2605 2976 gene locus_tag LOCUS_0580 gene rplL 2605 2976 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_0580 3060 7199 gene locus_tag LOCUS_0590 gene rpoB 3060 7199 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_0590 >Feature sequence005 <1 983 gene locus_tag LOCUS_0600 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000346642.1:aminofutalosine synthase MqnE 1337 969 gene locus_tag LOCUS_0610 1337 969 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_0610 4423 1334 gene locus_tag LOCUS_0620 4423 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 4869 4420 gene locus_tag LOCUS_0630 4869 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 5939 4866 gene locus_tag LOCUS_0640 5939 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 6367 5936 gene locus_tag LOCUS_0650 6367 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 6456 6896 gene locus_tag LOCUS_0660 gene rplI 6456 6896 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_0660 6896 7444 gene locus_tag LOCUS_0670 gene hslV 6896 7444 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_0670 7446 8759 gene locus_tag LOCUS_0680 gene hslU 7446 8759 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_0680 >Feature sequence006 2493 1156 gene locus_tag LOCUS_0690 2493 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 3923 2493 gene locus_tag LOCUS_0700 3923 2493 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_0700 5774 3924 gene locus_tag LOCUS_0710 gene nuoL 5774 3924 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_0710 6075 5767 gene locus_tag LOCUS_0720 6075 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 6542 6078 gene locus_tag LOCUS_0730 6542 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 7093 6539 gene locus_tag LOCUS_0740 7093 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 <7865 7095 gene locus_tag LOCUS_0750 <7865 7095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005159221.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence007 317 232 gene locus_tag LOCUS_t0020 317 232 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 646 371 gene locus_tag LOCUS_0760 646 371 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_0760 749 1195 gene locus_tag LOCUS_0770 749 1195 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 protein_id gnl|my_center|LOCUS_0770 1192 2400 gene locus_tag LOCUS_0780 gene ilvA 1192 2400 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_0780 2424 3851 gene locus_tag LOCUS_0790 gene gatB 2424 3851 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_0790 3848 5482 gene locus_tag LOCUS_0800 3848 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 5479 6165 gene locus_tag LOCUS_0810 5479 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 6176 7060 gene locus_tag LOCUS_0820 6176 7060 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_0820 7197 7057 gene locus_tag LOCUS_0830 7197 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 >Feature sequence008 2276 153 gene locus_tag LOCUS_0840 2276 153 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_0840 2476 2273 gene locus_tag LOCUS_0850 2476 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 3201 2476 gene locus_tag LOCUS_0860 gene pyrH 3201 2476 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148056.1 protein_id gnl|my_center|LOCUS_0860 4446 3289 gene locus_tag LOCUS_0870 4446 3289 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_0870 5225 4443 gene locus_tag LOCUS_0880 5225 4443 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_0880 5877 5212 gene locus_tag LOCUS_0890 5877 5212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_0890 6973 5870 gene locus_tag LOCUS_0900 gene trmB 6973 5870 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_0900 >Feature sequence009 2907 451 gene locus_tag LOCUS_0910 gene leuS 2907 451 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_0910 3302 2958 gene locus_tag LOCUS_0920 3302 2958 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_0920 4310 3339 gene locus_tag LOCUS_0930 gene secF 4310 3339 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_0930 5869 4313 gene locus_tag LOCUS_0940 gene secD 5869 4313 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_0940 6164 5856 gene locus_tag LOCUS_0950 6164 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 >Feature sequence010 <1 540 gene locus_tag LOCUS_0960 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002854681.1:glycerol-3-phosphate 1-O-acyltransferase PlsY 540 866 gene locus_tag LOCUS_0970 540 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 908 1576 gene locus_tag LOCUS_0980 gene hsrA 908 1576 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_0980 1578 1829 gene locus_tag LOCUS_0990 1578 1829 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 protein_id gnl|my_center|LOCUS_0990 1829 3283 gene locus_tag LOCUS_1000 1829 3283 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074267.1 protein_id gnl|my_center|LOCUS_1000 5457 3280 gene locus_tag LOCUS_1010 gene bamA 5457 3280 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_1010 5527 6354 gene locus_tag LOCUS_1020 5527 6354 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611641.1 protein_id gnl|my_center|LOCUS_1020 6690 6370 gene locus_tag LOCUS_1030 6690 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 >Feature sequence011 186 2858 gene locus_tag LOCUS_1040 186 2858 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481418.1 protein_id gnl|my_center|LOCUS_1040 2858 3784 gene locus_tag LOCUS_1050 2858 3784 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462489.1 protein_id gnl|my_center|LOCUS_1050 3768 5036 gene locus_tag LOCUS_1060 3768 5036 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_1060 5037 5960 gene locus_tag LOCUS_1070 5037 5960 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_1070 5957 6547 gene locus_tag LOCUS_1080 5957 6547 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167942160.1 protein_id gnl|my_center|LOCUS_1080 >Feature sequence012 2144 288 gene locus_tag LOCUS_1090 2144 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 2246 3568 gene locus_tag LOCUS_1100 gene murJ 2246 3568 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_1100 3570 4964 gene locus_tag LOCUS_1110 gene cysS 3570 4964 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_1110 4966 6051 gene locus_tag LOCUS_1120 4966 6051 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_1120 >Feature sequence013 1583 444 gene locus_tag LOCUS_1130 1583 444 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_1130 1880 1584 gene locus_tag LOCUS_1140 1880 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 2941 2063 gene locus_tag LOCUS_1150 gene sucD 2941 2063 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872006.1 protein_id gnl|my_center|LOCUS_1150 4113 2941 gene locus_tag LOCUS_1160 gene sucC 4113 2941 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858590.1 protein_id gnl|my_center|LOCUS_1160 4682 4128 gene locus_tag LOCUS_1170 4682 4128 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_1170 5553 4693 gene locus_tag LOCUS_1180 5553 4693 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_1180 6501 5557 gene locus_tag LOCUS_1190 gene mdh 6501 5557 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545039.1 protein_id gnl|my_center|LOCUS_1190 >Feature sequence014 315 1088 gene locus_tag LOCUS_1200 315 1088 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_1200 1063 1449 gene locus_tag LOCUS_1210 1063 1449 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_1210 1442 3067 gene locus_tag LOCUS_1220 1442 3067 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_1220 3090 4253 gene locus_tag LOCUS_1230 3090 4253 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_1230 4341 4526 gene locus_tag LOCUS_1240 gene rpmB 4341 4526 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_1240 4549 5688 gene locus_tag LOCUS_1250 4549 5688 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_1250 >Feature sequence015 116 505 gene locus_tag LOCUS_1260 116 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 1071 502 gene locus_tag LOCUS_1270 1071 502 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_1270 1410 1132 gene locus_tag LOCUS_1280 1410 1132 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044050.1 protein_id gnl|my_center|LOCUS_1280 1852 1388 gene locus_tag LOCUS_1290 gene thpR 1852 1388 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871092.1 protein_id gnl|my_center|LOCUS_1290 2058 1849 gene locus_tag LOCUS_1300 2058 1849 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_1300 2118 3395 gene locus_tag LOCUS_1310 gene leuC 2118 3395 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_1310 3989 3390 gene locus_tag LOCUS_1320 3989 3390 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857885.1 protein_id gnl|my_center|LOCUS_1320 4029 4250 gene locus_tag LOCUS_1330 4029 4250 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_1330 4252 4692 gene locus_tag LOCUS_1340 4252 4692 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_1340 4695 5891 gene locus_tag LOCUS_1350 4695 5891 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_1350 >Feature sequence016 1475 387 gene locus_tag LOCUS_1360 1475 387 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_1360 3105 1450 gene locus_tag LOCUS_1370 3105 1450 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_1370 3452 3159 gene locus_tag LOCUS_1380 gene fliE 3452 3159 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851122.1 protein_id gnl|my_center|LOCUS_1380 3959 3462 gene locus_tag LOCUS_1390 gene flgC 3959 3462 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_1390 4397 3969 gene locus_tag LOCUS_1400 gene flgB 4397 3969 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_1400 4503 5639 gene locus_tag LOCUS_1410 gene ftsW 4503 5639 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 protein_id gnl|my_center|LOCUS_1410 >Feature sequence017 186 1301 gene locus_tag LOCUS_1420 gene cfa 186 1301 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_1420 1349 1582 gene locus_tag LOCUS_1430 1349 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 1579 2586 gene locus_tag LOCUS_1440 1579 2586 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_1440 2597 3937 gene locus_tag LOCUS_1450 gene fslC 2597 3937 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_1450 >Feature sequence018 1783 215 gene locus_tag LOCUS_1460 gene serA 1783 215 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_1460 2224 1784 gene locus_tag LOCUS_1470 2224 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 3384 2221 gene locus_tag LOCUS_1480 3384 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 4211 3381 gene locus_tag LOCUS_1490 4211 3381 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_1490 <5324 4201 gene locus_tag LOCUS_1500 <5324 4201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852577.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence019 197 994 gene locus_tag LOCUS_1510 197 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 1006 1170 gene locus_tag LOCUS_1520 1006 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 1173 4250 gene locus_tag LOCUS_1530 1173 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 4255 4545 gene locus_tag LOCUS_1540 4255 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 4526 5215 gene locus_tag LOCUS_1550 4526 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 >Feature sequence020 516 259 gene locus_tag LOCUS_1560 516 259 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_1560 623 1063 gene locus_tag LOCUS_1570 623 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 4483 1064 gene locus_tag LOCUS_1580 gene dnaE 4483 1064 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662171.1 protein_id gnl|my_center|LOCUS_1580 4554 5132 gene locus_tag LOCUS_1590 4554 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 >Feature sequence021 837 280 gene locus_tag LOCUS_1600 837 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 1502 837 gene locus_tag LOCUS_1610 gene hisIE 1502 837 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_1610 2556 1489 gene locus_tag LOCUS_1620 2556 1489 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121076.1 protein_id gnl|my_center|LOCUS_1620 3480 2566 gene locus_tag LOCUS_1630 gene ilvE 3480 2566 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_1630 3623 5038 gene locus_tag LOCUS_1640 3623 5038 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_1640 >Feature sequence022 1487 738 gene locus_tag LOCUS_1650 1487 738 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469349.1 protein_id gnl|my_center|LOCUS_1650 1623 2936 gene locus_tag LOCUS_1660 1623 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 2974 3492 gene locus_tag LOCUS_1670 gene mog 2974 3492 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002842823.1 protein_id gnl|my_center|LOCUS_1670 3819 3484 gene locus_tag LOCUS_1680 3819 3484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853247.1 protein_id gnl|my_center|LOCUS_1680 4237 3806 gene locus_tag LOCUS_1690 gene rpiB 4237 3806 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_1690 4313 5092 gene locus_tag LOCUS_1700 4313 5092 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_1700 >Feature sequence023 2262 607 gene locus_tag LOCUS_1710 2262 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 2645 2265 gene locus_tag LOCUS_1720 2645 2265 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_1720 3899 2712 gene locus_tag LOCUS_1730 3899 2712 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_1730 3936 4121 gene locus_tag LOCUS_1740 3936 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 4131 5006 gene locus_tag LOCUS_1750 gene cmoB 4131 5006 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_1750 >Feature sequence024 965 105 gene locus_tag LOCUS_1760 965 105 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_1760 1204 962 gene locus_tag LOCUS_1770 1204 962 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356779.1 protein_id gnl|my_center|LOCUS_1770 1669 1205 gene locus_tag LOCUS_1780 1669 1205 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_1780 2166 1669 gene locus_tag LOCUS_1790 gene purE 2166 1669 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_1790 3464 2184 gene locus_tag LOCUS_1800 3464 2184 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 protein_id gnl|my_center|LOCUS_1800 4196 3465 gene locus_tag LOCUS_1810 gene cheZ 4196 3465 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191026.1 protein_id gnl|my_center|LOCUS_1810 >Feature sequence025 <1 1394 gene locus_tag LOCUS_1820 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858508.1:DNA-directed RNA polymerase subunit beta' 1492 1875 gene locus_tag LOCUS_1830 gene rpsL 1492 1875 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142321.1 protein_id gnl|my_center|LOCUS_1830 2001 2468 gene locus_tag LOCUS_1840 gene rpsG 2001 2468 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254357.1 protein_id gnl|my_center|LOCUS_1840 2579 4663 gene locus_tag LOCUS_1850 gene fusA 2579 4663 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101814.1 protein_id gnl|my_center|LOCUS_1850 >Feature sequence026 <1 660 gene locus_tag LOCUS_1860 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001862438.1:GTPase Era 644 2200 gene locus_tag LOCUS_1870 644 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 2197 2838 gene locus_tag LOCUS_1880 2197 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 2835 3269 gene locus_tag LOCUS_1890 2835 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 3269 4648 gene locus_tag LOCUS_1900 gene mshL 3269 4648 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_1900 >Feature sequence027 1508 375 gene locus_tag LOCUS_1910 1508 375 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_1910 1645 3108 gene locus_tag LOCUS_1920 1645 3108 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_1920 4318 3098 gene locus_tag LOCUS_1930 4318 3098 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622860.1 protein_id gnl|my_center|LOCUS_1930 >Feature sequence028 <1 1817 gene locus_tag LOCUS_1940 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852796.1:ATP-dependent zinc metalloprotease FtsH 1795 2436 gene locus_tag LOCUS_1950 1795 2436 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598533.1 protein_id gnl|my_center|LOCUS_1950 2423 3136 gene locus_tag LOCUS_1960 gene pssA 2423 3136 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_1960 >Feature sequence029 1500 298 gene locus_tag LOCUS_1970 1500 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 2847 1510 gene locus_tag LOCUS_1980 gene purF 2847 1510 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_1980 3640 2879 gene locus_tag LOCUS_1990 gene dapB 3640 2879 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_1990 4540 3641 gene locus_tag LOCUS_2000 gene trxB 4540 3641 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_2000 >Feature sequence030 <1 581 gene locus_tag LOCUS_2010 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853397.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 600 992 gene locus_tag LOCUS_2020 600 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 1426 1022 gene locus_tag LOCUS_2030 1426 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 2558 1767 gene locus_tag LOCUS_2040 gene amrB 2558 1767 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880539.1 protein_id gnl|my_center|LOCUS_2040 3604 2603 gene locus_tag LOCUS_2050 gene amrS 3604 2603 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583380.1 protein_id gnl|my_center|LOCUS_2050 <4450 3687 gene locus_tag LOCUS_2060 <4450 3687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864549.1:metal-dependent hydrolase >Feature sequence031 1050 85 gene locus_tag LOCUS_2070 1050 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 2150 1047 gene locus_tag LOCUS_2080 2150 1047 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_2080 2815 2147 gene locus_tag LOCUS_2090 gene purQ 2815 2147 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_2090 3054 2812 gene locus_tag LOCUS_2100 gene purS 3054 2812 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_2100 3758 3051 gene locus_tag LOCUS_2110 3758 3051 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_2110 <4404 3769 gene locus_tag LOCUS_2120 <4404 3769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002856815.1:S41 family peptidase >Feature sequence032 1918 1217 gene locus_tag LOCUS_2130 1918 1217 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_2130 1960 2688 gene locus_tag LOCUS_2140 1960 2688 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_2140 3546 2671 gene locus_tag LOCUS_2150 3546 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 <4369 3543 gene locus_tag LOCUS_2160 <4369 3543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852451.1:threonine synthase >Feature sequence033 2173 1751 gene locus_tag LOCUS_2170 2173 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 2642 2175 gene locus_tag LOCUS_2180 2642 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 2911 2714 gene locus_tag LOCUS_2190 2911 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 3129 2908 gene locus_tag LOCUS_2200 3129 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 >Feature sequence034 153 1178 gene locus_tag LOCUS_2210 153 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2210 1175 2074 gene locus_tag LOCUS_2220 1175 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2220 2084 3679 gene locus_tag LOCUS_2230 2084 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 >Feature sequence035 1440 289 gene locus_tag LOCUS_2240 1440 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2240 1931 1482 gene locus_tag LOCUS_2250 1931 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 2356 1940 gene locus_tag LOCUS_2260 2356 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 4161 2467 gene locus_tag LOCUS_2270 4161 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 >Feature sequence036 150 1040 gene locus_tag LOCUS_2280 150 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_2280 1037 2074 gene locus_tag LOCUS_2290 1037 2074 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418344.1 protein_id gnl|my_center|LOCUS_2290 2071 3117 gene locus_tag LOCUS_2300 2071 3117 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_2300 >Feature sequence037 <1 693 gene locus_tag LOCUS_2310 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858494.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 704 1591 gene locus_tag LOCUS_2320 704 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 1588 2754 gene locus_tag LOCUS_2330 gene murD 1588 2754 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_2330 2736 3659 gene locus_tag LOCUS_2340 2736 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 >Feature sequence038 <1 1152 gene locus_tag LOCUS_2350 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853329.1:ABC transporter permease 1192 2058 gene locus_tag LOCUS_2360 gene dapA 1192 2058 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_2360 2068 2844 gene locus_tag LOCUS_2370 2068 2844 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014495.1 protein_id gnl|my_center|LOCUS_2370 2847 3437 gene locus_tag LOCUS_2380 gene pgsA 2847 3437 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_2380 3430 3681 gene locus_tag LOCUS_2390 3430 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 >Feature sequence039 920 66 gene locus_tag LOCUS_2400 920 66 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_2400 1426 917 gene locus_tag LOCUS_2410 1426 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 2143 1436 gene locus_tag LOCUS_2420 2143 1436 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880390.1 protein_id gnl|my_center|LOCUS_2420 3091 2264 gene locus_tag LOCUS_2430 3091 2264 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_2430 <4030 3091 gene locus_tag LOCUS_2440 <4030 3091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933696.1:succinate dehydrogenase/fumarate reductase iron-sulfur subunit >Feature sequence040 6 1490 gene locus_tag LOCUS_2450 6 1490 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_2450 1626 1964 gene locus_tag LOCUS_2460 1626 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 1948 2421 gene locus_tag LOCUS_2470 1948 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 >Feature sequence041 1375 860 gene locus_tag LOCUS_2480 1375 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 2114 1356 gene locus_tag LOCUS_2490 2114 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 3225 2224 gene locus_tag LOCUS_2500 3225 2224 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_2500 <3846 3259 gene locus_tag LOCUS_2510 <3846 3259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000664449.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence042 1584 754 gene locus_tag LOCUS_2520 1584 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 1610 2395 gene locus_tag LOCUS_2530 1610 2395 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583165.1 protein_id gnl|my_center|LOCUS_2530 2385 3008 gene locus_tag LOCUS_2540 2385 3008 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887243.1 protein_id gnl|my_center|LOCUS_2540 3005 3550 gene locus_tag LOCUS_2550 3005 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 >Feature sequence043 488 240 gene locus_tag LOCUS_2560 488 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 1508 498 gene locus_tag LOCUS_2570 gene queA 1508 498 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_2570 2565 1498 gene locus_tag LOCUS_2580 2565 1498 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_2580 2855 2574 gene locus_tag LOCUS_2590 gene gatC 2855 2574 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165207.1 protein_id gnl|my_center|LOCUS_2590 >Feature sequence044 3 791 gene locus_tag LOCUS_2600 3 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 874 2916 gene locus_tag LOCUS_2610 gene ligA 874 2916 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_2610 2906 3199 gene locus_tag LOCUS_2620 gene clpS 2906 3199 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_2620 >Feature sequence045 1311 1769 gene locus_tag LOCUS_2630 1311 1769 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_2630 1771 3531 gene locus_tag LOCUS_2640 1771 3531 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_2640 >Feature sequence046 <1 536 gene locus_tag LOCUS_2650 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852885.1:N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase 533 1798 gene locus_tag LOCUS_2660 533 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 1791 2528 gene locus_tag LOCUS_2670 1791 2528 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143766.1 protein_id gnl|my_center|LOCUS_2670 2528 3397 gene locus_tag LOCUS_2680 2528 3397 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 protein_id gnl|my_center|LOCUS_2680 >Feature sequence047 <1 725 gene locus_tag LOCUS_2690 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002244146.1:fatty acid--CoA ligase 1090 740 gene locus_tag LOCUS_2700 gene rplT 1090 740 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_2700 1378 1184 gene locus_tag LOCUS_2710 gene rpmI 1378 1184 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125542.1 protein_id gnl|my_center|LOCUS_2710 1459 2265 gene locus_tag LOCUS_2720 1459 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 3213 2248 gene locus_tag LOCUS_2730 3213 2248 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_2730 >Feature sequence048 <1 1499 gene locus_tag LOCUS_2740 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853339.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 1508 1933 gene locus_tag LOCUS_2750 1508 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 2054 2320 gene locus_tag LOCUS_2760 2054 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 2313 2702 gene locus_tag LOCUS_2770 2313 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 2699 3556 gene locus_tag LOCUS_2780 2699 3556 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_2780 >Feature sequence049 57 1472 gene locus_tag LOCUS_2790 57 1472 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_2790 3435 1486 gene locus_tag LOCUS_2800 3435 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 3649 3458 gene locus_tag LOCUS_2810 3649 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 >Feature sequence050 650 279 gene locus_tag LOCUS_2820 650 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 1999 731 gene locus_tag LOCUS_2830 gene miaB 1999 731 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_2830 2239 2009 gene locus_tag LOCUS_2840 2239 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 2315 3388 gene locus_tag LOCUS_2850 gene nusA 2315 3388 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_2850 >Feature sequence051 2466 1702 gene locus_tag LOCUS_2860 gene fliH 2466 1702 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056222.1 protein_id gnl|my_center|LOCUS_2860 3484 2459 gene locus_tag LOCUS_2870 gene fliG 3484 2459 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_2870 >Feature sequence052 <1 635 gene locus_tag LOCUS_2880 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851542.1:HAD family hydrolase 2077 632 gene locus_tag LOCUS_2890 2077 632 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_2890 3330 2059 gene locus_tag LOCUS_2900 gene trkA 3330 2059 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220338.1 protein_id gnl|my_center|LOCUS_2900 >Feature sequence053 1608 583 gene locus_tag LOCUS_2910 1608 583 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_2910 2812 1601 gene locus_tag LOCUS_2920 gene clpX 2812 1601 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_2920 <3530 2796 gene locus_tag LOCUS_2930 <3530 2796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851756.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase >Feature sequence054 2107 1226 gene locus_tag LOCUS_2940 gene exoX 2107 1226 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816504.1 protein_id gnl|my_center|LOCUS_2940 2750 2088 gene locus_tag LOCUS_2950 2750 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 3411 2743 gene locus_tag LOCUS_2960 3411 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 >Feature sequence055 1331 1909 gene locus_tag LOCUS_2970 gene folE 1331 1909 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_2970 1909 3207 gene locus_tag LOCUS_2980 gene fliI 1909 3207 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_2980 >Feature sequence056 <3366 967 gene locus_tag LOCUS_2990 <3366 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001266636.1:flagellar hook-associated protein FlgL >Feature sequence057 454 32 gene locus_tag LOCUS_3000 gene rplM 454 32 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_3000 1015 539 gene locus_tag LOCUS_3010 1015 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 1512 1012 gene locus_tag LOCUS_3020 1512 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 2353 1514 gene locus_tag LOCUS_3030 gene mqnP 2353 1514 CDS product menaquinone biosynthesis prenyltransferase MqnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913938.1 protein_id gnl|my_center|LOCUS_3030 2404 3255 gene locus_tag LOCUS_3040 gene miaA 2404 3255 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080343057.1 protein_id gnl|my_center|LOCUS_3040 >Feature sequence058 <1 540 gene locus_tag LOCUS_3050 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964937.1:DJ-1/PfpI family protein 551 853 gene locus_tag LOCUS_3060 551 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 1201 857 gene locus_tag LOCUS_3070 gene hypA 1201 857 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_3070 1252 1833 gene locus_tag LOCUS_3080 1252 1833 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_3080 1817 2665 gene locus_tag LOCUS_3090 1817 2665 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880486.1 protein_id gnl|my_center|LOCUS_3090 >Feature sequence059 1919 150 gene locus_tag LOCUS_3100 gene asnB 1919 150 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_3100 <3339 1919 gene locus_tag LOCUS_3110 <3339 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852780.1:undecaprenyl-diphosphooligosaccharide--protein glycotransferase >Feature sequence060 3 2078 gene locus_tag LOCUS_3120 gene topA 3 2078 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681408.1 protein_id gnl|my_center|LOCUS_3120 2080 2595 gene locus_tag LOCUS_3130 2080 2595 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_3130 >Feature sequence061 <1 799 gene locus_tag LOCUS_3140 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001158562.1:arginine decarboxylase 1311 796 gene locus_tag LOCUS_3150 1311 796 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826355.1 protein_id gnl|my_center|LOCUS_3150 <3287 1321 gene locus_tag LOCUS_3160 <3287 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891851.1:response regulator >Feature sequence062 372 10 gene locus_tag LOCUS_3170 372 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 643 347 gene locus_tag LOCUS_3180 643 347 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_3180 1020 652 gene locus_tag LOCUS_3190 gene rplQ 1020 652 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_3190 2018 1017 gene locus_tag LOCUS_3200 2018 1017 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864547.1 protein_id gnl|my_center|LOCUS_3200 2657 2031 gene locus_tag LOCUS_3210 gene rpsD 2657 2031 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_3210 3052 2660 gene locus_tag LOCUS_3220 gene rpsK 3052 2660 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129287.1 protein_id gnl|my_center|LOCUS_3220 >Feature sequence063 988 119 gene locus_tag LOCUS_3230 988 119 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_3230 1086 3074 gene locus_tag LOCUS_3240 1086 3074 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_3240 >Feature sequence064 600 319 gene locus_tag LOCUS_3250 600 319 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_3250 1901 600 gene locus_tag LOCUS_3260 gene gltX 1901 600 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_3260 3170 1914 gene locus_tag LOCUS_3270 gene cetA 3170 1914 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_3270 >Feature sequence065 <1 1229 gene locus_tag LOCUS_3280 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891871.1:ribonuclease R 1222 2133 gene locus_tag LOCUS_3290 1222 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 2473 2120 gene locus_tag LOCUS_3300 2473 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 2989 2522 gene locus_tag LOCUS_3310 2989 2522 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_3310 3104 2982 gene locus_tag LOCUS_3320 3104 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 >Feature sequence066 389 757 gene locus_tag LOCUS_3330 389 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 852 1601 gene locus_tag LOCUS_3340 852 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 1666 2055 gene locus_tag LOCUS_3350 gene perR 1666 2055 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_3350 <3203 2056 gene locus_tag LOCUS_3360 <3203 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262831.1:type II secretion system inner membrane protein GspF >Feature sequence067 2475 1264 gene locus_tag LOCUS_3370 gene mtaB 2475 1264 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_3370 2875 2477 gene locus_tag LOCUS_3380 2875 2477 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926036.1 protein_id gnl|my_center|LOCUS_3380 3135 2866 gene locus_tag LOCUS_3390 3135 2866 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930609.1 protein_id gnl|my_center|LOCUS_3390 >Feature sequence068 1 693 gene locus_tag LOCUS_3400 1 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 2267 720 gene locus_tag LOCUS_3410 gene sdhA 2267 720 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_3410 2309 2947 gene locus_tag LOCUS_3420 2309 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 >Feature sequence069 <1 1074 gene locus_tag LOCUS_3430 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880661.1:MFS transporter 1058 1594 gene locus_tag LOCUS_3440 1058 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 1591 2910 gene locus_tag LOCUS_3450 1591 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 >Feature sequence070 387 1886 gene locus_tag LOCUS_3460 gene lysS 387 1886 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492582.1 protein_id gnl|my_center|LOCUS_3460 1907 3157 gene locus_tag LOCUS_3470 1907 3157 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_3470 >Feature sequence071 50 664 gene locus_tag LOCUS_3480 50 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 1688 666 gene locus_tag LOCUS_3490 gene pseI 1688 666 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_3490 2188 1685 gene locus_tag LOCUS_3500 gene pseH 2188 1685 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858467.1 protein_id gnl|my_center|LOCUS_3500 2891 2127 gene locus_tag LOCUS_3510 2891 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 >Feature sequence072 <1 1493 gene locus_tag LOCUS_3520 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001204347.1:menaquinone biosynthesis decarboxylase 1857 1486 gene locus_tag LOCUS_3530 1857 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 1952 2587 gene locus_tag LOCUS_3540 1952 2587 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_3540 <3127 2619 gene locus_tag LOCUS_3550 <3127 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110272.1:hydroxylamine reductase >Feature sequence073 1303 23 gene locus_tag LOCUS_3560 1303 23 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_3560 3004 1316 gene locus_tag LOCUS_3570 gene ilvD 3004 1316 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_3570 >Feature sequence074 >Feature sequence075 1645 845 gene locus_tag LOCUS_3580 gene cheP 1645 845 CDS product cheVAW transcriptional regulator CheP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851703.1 protein_id gnl|my_center|LOCUS_3580 2384 1638 gene locus_tag LOCUS_3590 2384 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 <3086 2377 gene locus_tag LOCUS_3600 <3086 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851464.1:ATP-binding protein >Feature sequence076 186 725 gene locus_tag LOCUS_3610 186 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 722 937 gene locus_tag LOCUS_3620 722 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 1101 1475 gene locus_tag LOCUS_3630 1101 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 >Feature sequence077 219 1367 gene locus_tag LOCUS_3640 219 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 1505 1870 gene locus_tag LOCUS_3650 1505 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 2501 1863 gene locus_tag LOCUS_3660 2501 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 <3057 2501 gene locus_tag LOCUS_3670 <3057 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000746824.1:homoserine dehydrogenase >Feature sequence078 2624 2031 gene locus_tag LOCUS_3680 2624 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 >Feature sequence079 413 982 gene locus_tag LOCUS_3690 gene coaE 413 982 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_3690 1003 1233 gene locus_tag LOCUS_3700 1003 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 1465 1241 gene locus_tag LOCUS_3710 1465 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3710 1815 1576 gene locus_tag LOCUS_3720 1815 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3720 >Feature sequence080 1910 969 gene locus_tag LOCUS_3730 1910 969 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_3730 <3033 2015 gene locus_tag LOCUS_3740 <3033 2015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852953.1:ABC transporter substrate-binding protein >Feature sequence081 2220 2459 gene locus_tag LOCUS_3750 2220 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_3750 2456 2713 gene locus_tag LOCUS_3760 2456 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 >Feature sequence082 1627 1403 gene locus_tag LOCUS_3770 1627 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 1705 2874 gene locus_tag LOCUS_3780 gene purT 1705 2874 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_3780 >Feature sequence083 <1 1281 gene locus_tag LOCUS_3790 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583120.1:L-aspartate oxidase 1283 2587 gene locus_tag LOCUS_3800 gene nhaD 1283 2587 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_3800 >Feature sequence084 1793 753 gene locus_tag LOCUS_3810 1793 753 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_3810 2911 1796 gene locus_tag LOCUS_3820 gene pglJ 2911 1796 CDS product N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852870.1 protein_id gnl|my_center|LOCUS_3820 >Feature sequence085 1283 486 gene locus_tag LOCUS_3830 1283 486 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_3830 <2916 1249 gene locus_tag LOCUS_3840 <2916 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964202.1:thioredoxin domain-containing protein >Feature sequence086 2196 1234 gene locus_tag LOCUS_3850 2196 1234 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_3850 <2908 2259 gene locus_tag LOCUS_3860 <2908 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858726.1:flagellar biosynthesis protein FlhB >Feature sequence087 1307 576 gene locus_tag LOCUS_3870 gene fliP 1307 576 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_3870 2077 1304 gene locus_tag LOCUS_3880 2077 1304 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_3880 2854 2087 gene locus_tag LOCUS_3890 gene pomA 2854 2087 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707085.1 protein_id gnl|my_center|LOCUS_3890 >Feature sequence088 2205 565 gene locus_tag LOCUS_3900 2205 565 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946396.1 protein_id gnl|my_center|LOCUS_3900 <2906 2206 gene locus_tag LOCUS_3910 <2906 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545543.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence089 <1 905 gene locus_tag LOCUS_3920 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258604.1:dihydroorotase 905 1600 gene locus_tag LOCUS_3930 905 1600 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_3930 1610 1759 gene locus_tag LOCUS_3940 1610 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 2536 1760 gene locus_tag LOCUS_3950 2536 1760 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891838.1 protein_id gnl|my_center|LOCUS_3950 >Feature sequence090 <1 1128 gene locus_tag LOCUS_3960 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858822.1:chromosomal replication initiator protein DnaA 1255 2307 gene locus_tag LOCUS_3970 gene dnaN 1255 2307 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_3970 >Feature sequence091 333 1412 gene locus_tag LOCUS_3980 333 1412 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 protein_id gnl|my_center|LOCUS_3980 >Feature sequence092 <1 554 gene locus_tag LOCUS_3990 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002868636.1:endopeptidase La 725 1162 gene locus_tag LOCUS_4000 725 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 1155 1682 gene locus_tag LOCUS_4010 1155 1682 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780126.1 protein_id gnl|my_center|LOCUS_4010 1675 2154 gene locus_tag LOCUS_4020 gene coaD 1675 2154 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 protein_id gnl|my_center|LOCUS_4020 2138 2710 gene locus_tag LOCUS_4030 gene tmk 2138 2710 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_4030 >Feature sequence093 566 333 gene locus_tag LOCUS_4040 gene minE 566 333 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051415.1 protein_id gnl|my_center|LOCUS_4040 1372 563 gene locus_tag LOCUS_4050 gene minD 1372 563 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019069.1 protein_id gnl|my_center|LOCUS_4050 2445 1426 gene locus_tag LOCUS_4060 gene ilvC 2445 1426 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_4060 >Feature sequence094 >Feature sequence095 3 1058 gene locus_tag LOCUS_4070 gene gatA 3 1058 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 protein_id gnl|my_center|LOCUS_4070 1055 2503 gene locus_tag LOCUS_4080 gene guaB 1055 2503 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_4080 >Feature sequence096 2083 932 gene locus_tag LOCUS_4090 2083 932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_4090 2643 2080 gene locus_tag LOCUS_4100 2643 2080 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_4100 >Feature sequence097 2335 95 gene locus_tag LOCUS_4110 gene metE 2335 95 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_4110 >Feature sequence098 1524 2075 gene locus_tag LOCUS_4120 gene ruvA 1524 2075 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 protein_id gnl|my_center|LOCUS_4120 >Feature sequence099 1253 300 gene locus_tag LOCUS_4130 1253 300 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_4130 2114 1263 gene locus_tag LOCUS_4140 2114 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_4140 <2850 2111 gene locus_tag LOCUS_4150 <2850 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963670.1:AAA family ATPase >Feature sequence100 405 1049 gene locus_tag LOCUS_4160 405 1049 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_4160 1039 2415 gene locus_tag LOCUS_4170 1039 2415 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455312.1 protein_id gnl|my_center|LOCUS_4170 >Feature sequence101 1839 907 gene locus_tag LOCUS_4180 1839 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 2195 1836 gene locus_tag LOCUS_4190 gene dksA 2195 1836 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_4190 2634 2206 gene locus_tag LOCUS_4200 gene rlmH 2634 2206 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203892.1 protein_id gnl|my_center|LOCUS_4200 >Feature sequence102 757 512 gene locus_tag LOCUS_4210 757 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 2032 767 gene locus_tag LOCUS_4220 gene eno 2032 767 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_4220 <2785 2034 gene locus_tag LOCUS_4230 <2785 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851424.1:recombinase RecA >Feature sequence103 <1 752 gene locus_tag LOCUS_4240 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869681.1:bifunctional ornithine acetyltransferase/N-acetylglutamate synthase 869 943 gene locus_tag LOCUS_t0030 869 943 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1148 1456 gene locus_tag LOCUS_4250 1148 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 1453 1776 gene locus_tag LOCUS_4260 1453 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 1769 2026 gene locus_tag LOCUS_4270 1769 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 >Feature sequence104 340 921 gene locus_tag LOCUS_4280 340 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 1168 929 gene locus_tag LOCUS_4290 1168 929 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855201.1 protein_id gnl|my_center|LOCUS_4290 1484 1194 gene locus_tag LOCUS_4300 1484 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 2526 1486 gene locus_tag LOCUS_4310 2526 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 >Feature sequence105 51 1205 gene locus_tag LOCUS_4320 51 1205 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858609.1 protein_id gnl|my_center|LOCUS_4320 >Feature sequence106 >Feature sequence107 379 1431 gene locus_tag LOCUS_4330 379 1431 CDS product nitrogen fixation protein FixF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193080251.1 protein_id gnl|my_center|LOCUS_4330 1419 2258 gene locus_tag LOCUS_4340 1419 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 >Feature sequence108 2029 2343 gene locus_tag LOCUS_4350 2029 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 2686 2324 gene locus_tag LOCUS_4360 2686 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 >Feature sequence109 1075 1299 gene locus_tag LOCUS_4370 1075 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 1301 1903 gene locus_tag LOCUS_4380 1301 1903 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090667.1 protein_id gnl|my_center|LOCUS_4380 >Feature sequence110 1177 902 gene locus_tag LOCUS_4390 gene rpsT 1177 902 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_4390 1258 2577 gene locus_tag LOCUS_4400 gene glmM 1258 2577 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_4400 >Feature sequence111 562 221 gene locus_tag LOCUS_4410 562 221 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_4410 927 559 gene locus_tag LOCUS_4420 927 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 >Feature sequence112 1629 439 gene locus_tag LOCUS_4430 1629 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 <2654 1654 gene locus_tag LOCUS_4440 <2654 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879939.1:aspartate aminotransferase family protein >Feature sequence113 1590 448 gene locus_tag LOCUS_4450 gene coaBC 1590 448 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852470.1 protein_id gnl|my_center|LOCUS_4450 <2642 1590 gene locus_tag LOCUS_4460 <2642 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852530.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence114 <1 850 gene locus_tag LOCUS_4470 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858151.1:molybdopterin molybdotransferase MoeA 860 1969 gene locus_tag LOCUS_4480 gene nspC 860 1969 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_4480 >Feature sequence115 >Feature sequence116 205 1569 gene locus_tag LOCUS_4490 205 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 1572 2345 gene locus_tag LOCUS_4500 1572 2345 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_4500 >Feature sequence117 <1 691 gene locus_tag LOCUS_4510 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein 733 1908 gene locus_tag LOCUS_4520 733 1908 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891906.1 protein_id gnl|my_center|LOCUS_4520 >Feature sequence118 2291 123 gene locus_tag LOCUS_4530 2291 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 >Feature sequence119 496 14 gene locus_tag LOCUS_4540 gene aroQ 496 14 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_4540 572 1777 gene locus_tag LOCUS_4550 572 1777 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_4550 2402 1794 gene locus_tag LOCUS_4560 2402 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 >Feature sequence120 1533 640 gene locus_tag LOCUS_4570 1533 640 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_4570 2080 1523 gene locus_tag LOCUS_4580 2080 1523 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461585.1 protein_id gnl|my_center|LOCUS_4580 2541 2095 gene locus_tag LOCUS_4590 2541 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 >Feature sequence121 1179 2465 gene locus_tag LOCUS_4600 1179 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 >Feature sequence122 1 1380 gene locus_tag LOCUS_4610 gene der 1 1380 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_4610 1367 2158 gene locus_tag LOCUS_4620 1367 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 >Feature sequence123 293 661 gene locus_tag LOCUS_4630 293 661 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_4630 645 977 gene locus_tag LOCUS_4640 645 977 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211699.1 protein_id gnl|my_center|LOCUS_4640 <2522 1140 gene locus_tag LOCUS_4650 <2522 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055064929.1:type I restriction endonuclease subunit R >Feature sequence124 >Feature sequence125 171 1157 gene locus_tag LOCUS_4660 gene cas1b 171 1157 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582992.1 protein_id gnl|my_center|LOCUS_4660 1154 1450 gene locus_tag LOCUS_4670 gene cas2 1154 1450 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_4670 1602 2410 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaccgaaacaatagttgtattgaaac >Feature sequence126 <2505 1685 gene locus_tag LOCUS_4680 <2505 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942839.1:DUF3373 domain-containing protein >Feature sequence127 2002 944 gene locus_tag LOCUS_4690 2002 944 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 protein_id gnl|my_center|LOCUS_4690 >Feature sequence128 2373 1918 gene locus_tag LOCUS_4700 2373 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 >Feature sequence129 368 1084 gene locus_tag LOCUS_4710 368 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 1085 1483 gene locus_tag LOCUS_4720 1085 1483 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250603.1 protein_id gnl|my_center|LOCUS_4720 <2485 1484 gene locus_tag LOCUS_4730 <2485 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108558166.1:DEAD/DEAH box helicase >Feature sequence130 879 43 gene locus_tag LOCUS_4740 gene rpsB 879 43 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_4740 1033 1566 gene locus_tag LOCUS_4750 gene luxS 1033 1566 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_4750 >Feature sequence131 371 502 gene locus_tag LOCUS_4760 371 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 1469 786 gene locus_tag LOCUS_4770 1469 786 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401225.1 protein_id gnl|my_center|LOCUS_4770 2270 1554 gene locus_tag LOCUS_4780 2270 1554 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_4780 >Feature sequence132 291 1634 gene locus_tag LOCUS_4790 291 1634 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_4790 2289 1618 gene locus_tag LOCUS_4800 2289 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 >Feature sequence133 1884 871 gene locus_tag LOCUS_4810 1884 871 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601458.1 protein_id gnl|my_center|LOCUS_4810 <2459 1884 gene locus_tag LOCUS_4820 <2459 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000853811.1:nicotinamide-nucleotide amidase >Feature sequence134 255 494 gene locus_tag LOCUS_4830 255 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 496 1242 gene locus_tag LOCUS_4840 496 1242 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869557.1 protein_id gnl|my_center|LOCUS_4840 1242 2333 gene locus_tag LOCUS_4850 gene dxr 1242 2333 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260724.1 protein_id gnl|my_center|LOCUS_4850 >Feature sequence135 <1 1329 gene locus_tag LOCUS_4860 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000971620.1:methyl-accepting chemotaxis protein TlpB 1907 1353 gene locus_tag LOCUS_4870 1907 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 >Feature sequence136 309 22 gene locus_tag LOCUS_4880 309 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 817 461 gene locus_tag LOCUS_4890 gene rplS 817 461 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_4890 1562 906 gene locus_tag LOCUS_4900 gene trmD 1562 906 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_4900 2080 1559 gene locus_tag LOCUS_4910 gene rimM 2080 1559 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832559.1 protein_id gnl|my_center|LOCUS_4910 2315 2070 gene locus_tag LOCUS_4920 2315 2070 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290277.1 protein_id gnl|my_center|LOCUS_4920 >Feature sequence137 536 288 gene locus_tag LOCUS_4930 536 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 775 527 gene locus_tag LOCUS_4940 775 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 1826 762 gene locus_tag LOCUS_4950 gene leuB 1826 762 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_4950 2322 1819 gene locus_tag LOCUS_4960 gene leuD 2322 1819 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_4960 >Feature sequence138 <1 671 gene locus_tag LOCUS_4970 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932230.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 1486 668 gene locus_tag LOCUS_4980 1486 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 <2417 1801 gene locus_tag LOCUS_4990 <2417 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947940.1:DUF445 family protein >Feature sequence139 51 127 gene locus_tag LOCUS_t0040 51 127 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 219 1334 gene locus_tag LOCUS_5000 219 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 <2416 1331 gene locus_tag LOCUS_5010 <2416 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002837927.1:translation elongation factor 4 >Feature sequence140 <1 684 gene locus_tag LOCUS_5020 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858532.1:replicative DNA helicase 685 1881 gene locus_tag LOCUS_5030 685 1881 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611625.1 protein_id gnl|my_center|LOCUS_5030 >Feature sequence141 2162 312 gene locus_tag LOCUS_5040 2162 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 >Feature sequence142 1798 1723 gene locus_tag LOCUS_t0050 1798 1723 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence143 <1 1790 gene locus_tag LOCUS_5050 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546336.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence144 484 990 gene locus_tag LOCUS_5060 484 990 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329720.1 protein_id gnl|my_center|LOCUS_5060 >Feature sequence145 <2396 331 gene locus_tag LOCUS_5070 <2396 331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858721.1:excinuclease ABC subunit UvrA >Feature sequence146 <1 890 gene locus_tag LOCUS_5080 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852180.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence147 559 437 gene locus_tag LOCUS_5090 559 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 <2378 560 gene locus_tag LOCUS_5100 <2378 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000380097.1:RecB-like helicase >Feature sequence148 1384 698 gene locus_tag LOCUS_5110 gene pyrF 1384 698 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_5110 1941 1381 gene locus_tag LOCUS_5120 gene dcd 1941 1381 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_5120 >Feature sequence149 713 1879 gene locus_tag LOCUS_5130 713 1879 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 protein_id gnl|my_center|LOCUS_5130 1876 2157 gene locus_tag LOCUS_5140 1876 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 >Feature sequence150 869 372 gene locus_tag LOCUS_5150 869 372 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_5150 1435 866 gene locus_tag LOCUS_5160 gene hisB 1435 866 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546516.1 protein_id gnl|my_center|LOCUS_5160 2122 1436 gene locus_tag LOCUS_5170 2122 1436 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_5170 >Feature sequence151 <1 1004 gene locus_tag LOCUS_5180 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit >Feature sequence152 <1 556 gene locus_tag LOCUS_5190 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852877.1:UDP-N-acetylbacillosamine transaminase 537 2261 gene locus_tag LOCUS_5200 gene pglF 537 2261 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (configuration-retaining) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858054.1 protein_id gnl|my_center|LOCUS_5200 >Feature sequence153 153 2267 gene locus_tag LOCUS_5210 153 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 >Feature sequence154 1330 305 gene locus_tag LOCUS_5220 gene aroB 1330 305 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_5220 >Feature sequence155 <1 1440 gene locus_tag LOCUS_5230 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000601638.1:DNA primase >Feature sequence156 1604 792 gene locus_tag LOCUS_5240 gene galU 1604 792 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851421.1 protein_id gnl|my_center|LOCUS_5240 2100 1597 gene locus_tag LOCUS_5250 2100 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 >Feature sequence157 69 719 gene locus_tag LOCUS_5260 gene crdR 69 719 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_5260 >Feature sequence158 1902 1087 gene locus_tag LOCUS_5270 gene fliY 1902 1087 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150629.1 protein_id gnl|my_center|LOCUS_5270 >Feature sequence159 1141 158 gene locus_tag LOCUS_5280 gene hypE 1141 158 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 protein_id gnl|my_center|LOCUS_5280 2263 1145 gene locus_tag LOCUS_5290 gene hypD 2263 1145 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_5290 >Feature sequence160 <2281 132 gene locus_tag LOCUS_5300 <2281 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858833.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence161 <1 2240 gene locus_tag LOCUS_5310 <1 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864150.1:valine--tRNA ligase >Feature sequence162 724 152 gene locus_tag LOCUS_5320 724 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 817 2259 gene locus_tag LOCUS_5330 gene glnA 817 2259 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091770.1 protein_id gnl|my_center|LOCUS_5330 >Feature sequence163 <1 922 gene locus_tag LOCUS_5340 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461405.1:carboxynorspermidine decarboxylase 1646 942 gene locus_tag LOCUS_5350 1646 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 >Feature sequence164 116 1243 gene locus_tag LOCUS_5360 116 1243 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880660.1 protein_id gnl|my_center|LOCUS_5360 1253 1597 gene locus_tag LOCUS_5370 1253 1597 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_5370 >Feature sequence165 837 52 gene locus_tag LOCUS_5380 gene rsmI 837 52 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_5380 1038 838 gene locus_tag LOCUS_5390 gene rpmE 1038 838 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_5390 1511 1254 gene locus_tag LOCUS_5400 1511 1254 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_5400 1648 2079 gene locus_tag LOCUS_5410 1648 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 >Feature sequence166 2227 386 gene locus_tag LOCUS_5420 gene thrS 2227 386 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_5420 >Feature sequence167 345 115 gene locus_tag LOCUS_5430 345 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 1705 440 gene locus_tag LOCUS_5440 1705 440 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129562.1 protein_id gnl|my_center|LOCUS_5440 2032 1946 gene locus_tag LOCUS_t0060 2032 1946 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2113 2204 gene locus_tag LOCUS_t0070 2113 2204 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence168 312 938 gene locus_tag LOCUS_5450 312 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 935 2227 gene locus_tag LOCUS_5460 935 2227 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_5460 >Feature sequence169 <1 1076 gene locus_tag LOCUS_5470 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857904.1:DNA topoisomerase (ATP-hydrolyzing) subunit A 1104 1553 gene locus_tag LOCUS_5480 1104 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 1516 1887 gene locus_tag LOCUS_5490 1516 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 >Feature sequence170 >Feature sequence171 1170 226 gene locus_tag LOCUS_5500 1170 226 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_5500 1281 1661 gene locus_tag LOCUS_5510 1281 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 <2210 1651 gene locus_tag LOCUS_5520 <2210 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546404.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence172 927 211 gene locus_tag LOCUS_5530 927 211 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907234.1 protein_id gnl|my_center|LOCUS_5530 988 1632 gene locus_tag LOCUS_5540 gene nth 988 1632 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612264.1 protein_id gnl|my_center|LOCUS_5540 <2208 1670 gene locus_tag LOCUS_5550 <2208 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948617.1:Fic family protein >Feature sequence173 1862 1212 gene locus_tag LOCUS_5560 gene dccR 1862 1212 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_5560 >Feature sequence174 1711 161 gene locus_tag LOCUS_5570 1711 161 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_5570 >Feature sequence175 50 892 gene locus_tag LOCUS_5580 50 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 2099 873 gene locus_tag LOCUS_5590 2099 873 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_5590 >Feature sequence176 762 502 gene locus_tag LOCUS_5600 gene rpmA 762 502 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_5600 1087 776 gene locus_tag LOCUS_5610 gene rplU 1087 776 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778820.1 protein_id gnl|my_center|LOCUS_5610 1536 1165 gene locus_tag LOCUS_5620 1536 1165 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869808.1 protein_id gnl|my_center|LOCUS_5620 <2186 1557 gene locus_tag LOCUS_5630 <2186 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064705.1:patatin-like phospholipase family protein >Feature sequence177 646 86 gene locus_tag LOCUS_5640 646 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 692 1606 gene locus_tag LOCUS_5650 gene rsmH 692 1606 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_5650 1608 1883 gene locus_tag LOCUS_5660 1608 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 >Feature sequence178 462 830 gene locus_tag LOCUS_5670 gene hspR 462 830 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_5670 <2172 827 gene locus_tag LOCUS_5680 <2172 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001042337.1:AsmA-like C-terminal domain-containing protein >Feature sequence179 >Feature sequence180 <2165 159 gene locus_tag LOCUS_5690 <2165 159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000033406.1:type III restriction-modification system endonuclease >Feature sequence181 363 1469 gene locus_tag LOCUS_5700 363 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 <2145 1453 gene locus_tag LOCUS_5710 <2145 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853029.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence182 220 1146 gene locus_tag LOCUS_5720 220 1146 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_5720 >Feature sequence183 574 20 gene locus_tag LOCUS_5730 574 20 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_5730 1445 585 gene locus_tag LOCUS_5740 1445 585 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_5740 <2129 1449 gene locus_tag LOCUS_5750 <2129 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545039.1:malate dehydrogenase >Feature sequence184 1296 1913 gene locus_tag LOCUS_5760 1296 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5760 >Feature sequence185 256 873 gene locus_tag LOCUS_5770 256 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5770 845 854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 981 1223 gene locus_tag LOCUS_5780 981 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5780 1220 2050 gene locus_tag LOCUS_5790 gene nadC 1220 2050 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_5790 >Feature sequence186 1561 770 gene locus_tag LOCUS_5800 1561 770 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_5800 <2111 1570 gene locus_tag LOCUS_5810 <2111 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852997.1:RNA polymerase sigma factor RpoD >Feature sequence187 2080 518 gene locus_tag LOCUS_5820 gene rny 2080 518 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_5820 >Feature sequence188 <2101 894 gene locus_tag LOCUS_5830 <2101 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789589.1:TolC family protein >Feature sequence189 1372 524 gene locus_tag LOCUS_5840 gene accD 1372 524 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505053.1 protein_id gnl|my_center|LOCUS_5840 2073 1375 gene locus_tag LOCUS_5850 2073 1375 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851687.1 protein_id gnl|my_center|LOCUS_5850 >Feature sequence190 362 93 gene locus_tag LOCUS_5860 362 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 609 463 gene locus_tag LOCUS_5870 609 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 651 1382 gene locus_tag LOCUS_5880 651 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_5880 >Feature sequence191 <2086 891 gene locus_tag LOCUS_5890 <2086 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858315.1:tyrosine--tRNA ligase >Feature sequence192 1942 1067 gene locus_tag LOCUS_5900 gene hemC 1942 1067 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_5900 >Feature sequence193 994 278 gene locus_tag LOCUS_5910 994 278 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_5910 <2075 1008 gene locus_tag LOCUS_5920 <2075 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851396.1:flagellar hook-associated protein FlgK >Feature sequence194 307 819 gene locus_tag LOCUS_5930 307 819 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_5930 792 1187 gene locus_tag LOCUS_5940 gene ruvX 792 1187 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_5940 1953 1138 gene locus_tag LOCUS_5950 1953 1138 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245639.1 protein_id gnl|my_center|LOCUS_5950 >Feature sequence195 142 684 gene locus_tag LOCUS_5960 142 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 >Feature sequence196 1016 468 gene locus_tag LOCUS_5970 1016 468 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880571.1 protein_id gnl|my_center|LOCUS_5970 <2069 1026 gene locus_tag LOCUS_5980 <2069 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851758.1:ribonucleotide-diphosphate reductase subunit beta >Feature sequence197 132 326 gene locus_tag LOCUS_5990 132 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 1139 342 gene locus_tag LOCUS_6000 1139 342 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_6000 1518 1132 gene locus_tag LOCUS_6010 gene crcB 1518 1132 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871047.1 protein_id gnl|my_center|LOCUS_6010 <2069 1519 gene locus_tag LOCUS_6020 <2069 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858620.1:lysophospholipid acyltransferase family protein >Feature sequence198 721 323 gene locus_tag LOCUS_6030 gene rpsI 721 323 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227269.1 protein_id gnl|my_center|LOCUS_6030 1143 721 gene locus_tag LOCUS_6040 gene rplM 1143 721 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_6040 1703 1227 gene locus_tag LOCUS_6050 1703 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 >Feature sequence199 <1 624 gene locus_tag LOCUS_6060 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444597.1:phosphoribosyltransferase 937 614 gene locus_tag LOCUS_6070 937 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 1299 1712 gene locus_tag LOCUS_6080 1299 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 >Feature sequence200 <1 1058 gene locus_tag LOCUS_6090 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457973.1:intermembrane transport protein PqiB 1060 1557 gene locus_tag LOCUS_6100 1060 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 1554 1985 gene locus_tag LOCUS_6110 1554 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021820.1 protein_id gnl|my_center|LOCUS_6110 >Feature sequence201 1458 496 gene locus_tag LOCUS_6120 1458 496 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_6120 <2020 1439 gene locus_tag LOCUS_6130 <2020 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858657.1:UDP-2,3-diacylglucosamine diphosphatase >Feature sequence202 758 381 gene locus_tag LOCUS_6140 758 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 940 767 gene locus_tag LOCUS_6150 940 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 <2019 1000 gene locus_tag LOCUS_6160 <2019 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001048043.1:AAA family ATPase >Feature sequence203 <2017 318 gene locus_tag LOCUS_6170 <2017 318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047792.1:phage tail tape measure protein >Feature sequence204 271 1245 gene locus_tag LOCUS_6180 271 1245 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_6180 1245 1985 gene locus_tag LOCUS_6190 1245 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 >Feature sequence205 161 1411 gene locus_tag LOCUS_6200 161 1411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_6200 >Feature sequence206 12 1310 gene locus_tag LOCUS_6210 gene hisD 12 1310 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_6210 1303 1746 gene locus_tag LOCUS_6220 1303 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 >Feature sequence207 78 659 gene locus_tag LOCUS_6230 78 659 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072160.1 protein_id gnl|my_center|LOCUS_6230 >Feature sequence208 1919 432 gene locus_tag LOCUS_6240 1919 432 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_6240 >Feature sequence209 >Feature sequence210 99 737 gene locus_tag LOCUS_6250 gene rpe 99 737 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858571.1 protein_id gnl|my_center|LOCUS_6250 734 1333 gene locus_tag LOCUS_6260 734 1333 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_6260 >Feature sequence211 261 1610 gene locus_tag LOCUS_6270 gene ffh 261 1610 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484750.1 protein_id gnl|my_center|LOCUS_6270 1693 1944 gene locus_tag LOCUS_6280 gene rpsP 1693 1944 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216125.1 protein_id gnl|my_center|LOCUS_6280 >Feature sequence212 814 188 gene locus_tag LOCUS_6290 gene thiF 814 188 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954515.1 protein_id gnl|my_center|LOCUS_6290 <1937 807 gene locus_tag LOCUS_6300 <1937 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858587.1:dihydropteroate synthase >Feature sequence213 890 114 gene locus_tag LOCUS_6310 890 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482941.1 protein_id gnl|my_center|LOCUS_6310 1726 908 gene locus_tag LOCUS_6320 gene salC 1726 908 CDS product peptidylprolyl isomerase SalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864102.1 protein_id gnl|my_center|LOCUS_6320 >Feature sequence214 1 468 gene locus_tag LOCUS_6330 1 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 461 1867 gene locus_tag LOCUS_6340 461 1867 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_6340 >Feature sequence215 <1 1282 gene locus_tag LOCUS_6350 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853190.1:nickel-dependent hydrogenase large subunit >Feature sequence216 <1 684 gene locus_tag LOCUS_6360 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002854730.1:D-2-hydroxyacid dehydrogenase 1487 681 gene locus_tag LOCUS_6370 gene mscS 1487 681 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_6370 >Feature sequence217 1178 486 gene locus_tag LOCUS_6380 1178 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 1920 1156 gene locus_tag LOCUS_6390 1920 1156 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858388.1 protein_id gnl|my_center|LOCUS_6390 >Feature sequence218 1182 286 gene locus_tag LOCUS_6400 1182 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 1301 1377 gene locus_tag LOCUS_t0080 1301 1377 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1403 1488 gene locus_tag LOCUS_t0090 1403 1488 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1495 1571 gene locus_tag LOCUS_t0100 1495 1571 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1675 1749 gene locus_tag LOCUS_t0110 1675 1749 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence219 56 985 gene locus_tag LOCUS_6410 56 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 985 1671 gene locus_tag LOCUS_6420 gene prpE 985 1671 CDS product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244765.1 protein_id gnl|my_center|LOCUS_6420 1729 1805 gene locus_tag LOCUS_t0120 1729 1805 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1816 1891 gene locus_tag LOCUS_t0130 1816 1891 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence220 <1 1277 gene locus_tag LOCUS_6430 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852810.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence221 1273 68 gene locus_tag LOCUS_6440 1273 68 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_6440 1326 1574 gene locus_tag LOCUS_6450 1326 1574 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_6450 >Feature sequence222 401 201 gene locus_tag LOCUS_6460 401 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 622 488 gene locus_tag LOCUS_6470 622 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 1171 668 gene locus_tag LOCUS_6480 gene raiA 1171 668 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_6480 1573 1205 gene locus_tag LOCUS_6490 1573 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 >Feature sequence223 >Feature sequence224 1130 249 gene locus_tag LOCUS_6500 gene thrB 1130 249 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888538.1 protein_id gnl|my_center|LOCUS_6500 1595 1140 gene locus_tag LOCUS_6510 1595 1140 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_6510 1857 1576 gene locus_tag LOCUS_6520 1857 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 >Feature sequence225 57 962 gene locus_tag LOCUS_6530 gene fabD 57 962 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_6530 959 1702 gene locus_tag LOCUS_6540 959 1702 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence226 816 64 gene locus_tag LOCUS_6550 816 64 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_6550 1518 856 gene locus_tag LOCUS_6560 1518 856 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_6560 >Feature sequence227 1288 731 gene locus_tag LOCUS_6570 1288 731 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_6570 <1854 1341 gene locus_tag LOCUS_6580 <1854 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851265.1:MotE family protein >Feature sequence228 <1 545 gene locus_tag LOCUS_6590 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020772.1:DNA polymerase/3'-5' exonuclease PolX <1850 520 gene locus_tag LOCUS_6600 <1850 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116307.1:motility associated factor glycosyltransferase family protein >Feature sequence229 >Feature sequence230 3 413 gene locus_tag LOCUS_6610 3 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 403 915 gene locus_tag LOCUS_6620 403 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 >Feature sequence231 1798 953 gene locus_tag LOCUS_6630 gene nfo 1798 953 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 protein_id gnl|my_center|LOCUS_6630 >Feature sequence232 >Feature sequence233 154 669 gene locus_tag LOCUS_6640 154 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 1785 670 gene locus_tag LOCUS_6650 1785 670 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_6650 >Feature sequence234 684 205 gene locus_tag LOCUS_6660 684 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 1534 671 gene locus_tag LOCUS_6670 1534 671 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857964.1 protein_id gnl|my_center|LOCUS_6670 >Feature sequence235 >Feature sequence236 1765 1055 gene locus_tag LOCUS_6680 1765 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 >Feature sequence237 1649 267 gene locus_tag LOCUS_6690 gene pyk 1649 267 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_6690 >Feature sequence238 136 1110 gene locus_tag LOCUS_6700 136 1110 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_6700 1104 1634 gene locus_tag LOCUS_6710 1104 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 >Feature sequence239 344 1717 gene locus_tag LOCUS_6720 344 1717 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_6720 >Feature sequence240 <1 1165 gene locus_tag LOCUS_6730 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880933.1:EAL domain-containing protein >Feature sequence241 784 635 gene locus_tag LOCUS_6740 gene rpmF 784 635 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290472.1 protein_id gnl|my_center|LOCUS_6740 1123 794 gene locus_tag LOCUS_6750 1123 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 1537 1124 gene locus_tag LOCUS_6760 gene ndk 1537 1124 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_6760 >Feature sequence242 <1 656 gene locus_tag LOCUS_6770 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852250.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 653 952 gene locus_tag LOCUS_6780 653 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 >Feature sequence243 99 530 gene locus_tag LOCUS_6790 99 530 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 protein_id gnl|my_center|LOCUS_6790 833 516 gene locus_tag LOCUS_6800 gene rsfS 833 516 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076151.1 protein_id gnl|my_center|LOCUS_6800 1347 820 gene locus_tag LOCUS_6810 gene nadD 1347 820 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_6810 >Feature sequence244 1410 163 gene locus_tag LOCUS_6820 1410 163 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599072.1 protein_id gnl|my_center|LOCUS_6820 >Feature sequence245 <1 743 gene locus_tag LOCUS_6830 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891825.1:RluA family pseudouridine synthase 833 759 gene locus_tag LOCUS_t0140 833 759 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 891 1310 gene locus_tag LOCUS_6840 891 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 1347 1727 gene locus_tag LOCUS_6850 1347 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 >Feature sequence246 <1 1215 gene locus_tag LOCUS_6860 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000382848.1:exodeoxyribonuclease VII large subunit >Feature sequence247 1281 292 gene locus_tag LOCUS_6870 gene ruvB 1281 292 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_6870 >Feature sequence248 32 748 gene locus_tag LOCUS_6880 32 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 751 1035 gene locus_tag LOCUS_6890 751 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 1072 1374 gene locus_tag LOCUS_6900 1072 1374 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_6900 >Feature sequence249 854 513 gene locus_tag LOCUS_6910 854 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 1730 864 gene locus_tag LOCUS_6920 gene flhG 1730 864 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_6920 >Feature sequence250 404 1765 gene locus_tag LOCUS_6930 404 1765 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912892.1 protein_id gnl|my_center|LOCUS_6930 >Feature sequence251 <1766 418 gene locus_tag LOCUS_6940 <1766 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249133.1:IGHMBP2 family helicase >Feature sequence252 274 53 gene locus_tag LOCUS_6950 274 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6950 >Feature sequence253 1265 246 gene locus_tag LOCUS_6960 gene gap 1265 246 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_6960 >Feature sequence254 66 1403 gene locus_tag LOCUS_6970 gene ftsA 66 1403 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_6970 >Feature sequence255 <1721 143 gene locus_tag LOCUS_6980 <1721 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891903.1:endonuclease MutS2 >Feature sequence256 260 1099 gene locus_tag LOCUS_6990 260 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 >Feature sequence257 1176 103 gene locus_tag LOCUS_7000 1176 103 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_7000 1424 1206 gene locus_tag LOCUS_7010 1424 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 >Feature sequence258 1701 277 gene locus_tag LOCUS_7020 1701 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 >Feature sequence259 607 1620 gene locus_tag LOCUS_7030 607 1620 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853490.1 protein_id gnl|my_center|LOCUS_7030 >Feature sequence260 <1 1361 gene locus_tag LOCUS_7040 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858644.1:DNA polymerase I 1674 1354 gene locus_tag LOCUS_7050 1674 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 >Feature sequence261 361 80 gene locus_tag LOCUS_7060 361 80 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_7060 1662 361 gene locus_tag LOCUS_7070 gene gltX 1662 361 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_7070 >Feature sequence262 53 940 gene locus_tag LOCUS_7080 53 940 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_7080 >Feature sequence263 <1 1568 gene locus_tag LOCUS_7090 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858406.1:phosphoribosylformylglycinamidine synthase subunit PurL 1647 1572 gene locus_tag LOCUS_t0150 1647 1572 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence264 546 346 gene locus_tag LOCUS_7100 gene thiS 546 346 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 protein_id gnl|my_center|LOCUS_7100 <1664 556 gene locus_tag LOCUS_7110 <1664 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858294.1:glycine--tRNA ligase subunit beta >Feature sequence265 1330 938 gene locus_tag LOCUS_7120 1330 938 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225008.1 protein_id gnl|my_center|LOCUS_7120 >Feature sequence266 720 166 gene locus_tag LOCUS_7130 gene frr 720 166 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_7130 <1660 720 gene locus_tag LOCUS_7140 <1660 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074212.1:polysaccharide deacetylase family protein >Feature sequence267 >Feature sequence268 <1 1461 gene locus_tag LOCUS_7150 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853186.1:LPS-assembly protein LptD >Feature sequence269 <1 778 gene locus_tag LOCUS_7160 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383316.1:ammonium transporter <1649 775 gene locus_tag LOCUS_7170 <1649 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858322.1:invasion protein CiaB >Feature sequence270 382 110 gene locus_tag LOCUS_7180 382 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 <1645 386 gene locus_tag LOCUS_7190 <1645 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864546.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence271 <1 639 gene locus_tag LOCUS_7200 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478977.1:EAL domain-containing protein 661 1251 gene locus_tag LOCUS_7210 gene rdgB 661 1251 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence272 1433 429 gene locus_tag LOCUS_7220 gene pstS 1433 429 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_7220 >Feature sequence273 >Feature sequence274 <1633 892 gene locus_tag LOCUS_7230 <1633 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130232873.1:thiamine-phosphate kinase >Feature sequence275 <1627 135 gene locus_tag LOCUS_7240 <1627 135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858661.1:carbamoyl-phosphate synthase large subunit >Feature sequence276 375 1436 gene locus_tag LOCUS_7250 gene aroF 375 1436 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_7250 >Feature sequence277 418 494 gene locus_tag LOCUS_t0160 418 494 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 498 572 gene locus_tag LOCUS_t0170 498 572 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 623 710 gene locus_tag LOCUS_t0180 623 710 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 750 839 gene locus_tag LOCUS_t0190 750 839 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1594 863 gene locus_tag LOCUS_7260 1594 863 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_7260 >Feature sequence278 216 1061 gene locus_tag LOCUS_7270 216 1061 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_7270 >Feature sequence279 <1 956 gene locus_tag LOCUS_7280 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853182.1:polyribonucleotide nucleotidyltransferase >Feature sequence280 140 634 gene locus_tag LOCUS_7290 gene lptE 140 634 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852685.1 protein_id gnl|my_center|LOCUS_7290 >Feature sequence281 <1 914 gene locus_tag LOCUS_7300 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB >Feature sequence282 <1 620 gene locus_tag LOCUS_7310 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858051.1:lipid A biosynthesis lauroyl acyltransferase HtrB >Feature sequence283 >Feature sequence284 1193 309 gene locus_tag LOCUS_7320 1193 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852449.1 protein_id gnl|my_center|LOCUS_7320 >Feature sequence285 <1 1307 gene locus_tag LOCUS_7330 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002915726.1:phenylalanine--tRNA ligase subunit beta >Feature sequence286 302 1033 gene locus_tag LOCUS_7340 gene dapF 302 1033 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_7340 >Feature sequence287 1103 405 gene locus_tag LOCUS_7350 gene rsmA 1103 405 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_7350 >Feature sequence288 965 222 gene locus_tag LOCUS_7360 965 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 1422 958 gene locus_tag LOCUS_7370 1422 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 >Feature sequence289 155 1480 gene locus_tag LOCUS_7380 155 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 >Feature sequence290 1155 229 gene locus_tag LOCUS_7390 1155 229 CDS product COG2958 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851346.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence291 699 154 gene locus_tag LOCUS_7400 699 154 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_7400 1226 696 gene locus_tag LOCUS_7410 1226 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 >Feature sequence292 356 814 gene locus_tag LOCUS_7420 356 814 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_7420 >Feature sequence293 1455 190 gene locus_tag LOCUS_7430 1455 190 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250773.1 protein_id gnl|my_center|LOCUS_7430 >Feature sequence294 696 172 gene locus_tag LOCUS_7440 696 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 >Feature sequence295 >Feature sequence296 1080 955 gene locus_tag LOCUS_7450 1080 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 >Feature sequence297 <1 712 gene locus_tag LOCUS_7460 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000971620.1:methyl-accepting chemotaxis protein TlpB <1573 700 gene locus_tag LOCUS_7470 <1573 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852262.1:radical SAM family heme chaperone HemW >Feature sequence298 <1 911 gene locus_tag LOCUS_7480 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387846.1:diguanylate cyclase <1573 908 gene locus_tag LOCUS_7490 <1573 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694271.1:aminodeoxychorismate synthase component I >Feature sequence299 <1 668 gene locus_tag LOCUS_7500 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000832067.1:flagellar basal body P-ring protein FlgI 679 945 gene locus_tag LOCUS_7510 679 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609401.1 protein_id gnl|my_center|LOCUS_7510 999 1181 gene locus_tag LOCUS_7520 999 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 >Feature sequence300 <1 677 gene locus_tag LOCUS_7530 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244356.1:UDP-glucose 4-epimerase GalE 670 996 gene locus_tag LOCUS_7540 670 996 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930609.1 protein_id gnl|my_center|LOCUS_7540 989 1372 gene locus_tag LOCUS_7550 989 1372 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810333.1 protein_id gnl|my_center|LOCUS_7550 >Feature sequence301 <1 657 gene locus_tag LOCUS_7560 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021450949.1:1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase >Feature sequence302 673 218 gene locus_tag LOCUS_7570 gene smpB 673 218 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_7570 1437 670 gene locus_tag LOCUS_7580 gene proB 1437 670 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_7580 >Feature sequence303 1226 987 gene locus_tag LOCUS_7590 1226 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 >Feature sequence304 <1549 614 gene locus_tag LOCUS_7600 <1549 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853233.1:uroporphyrinogen decarboxylase >Feature sequence305 624 157 gene locus_tag LOCUS_7610 gene folK 624 157 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612148.1 protein_id gnl|my_center|LOCUS_7610 831 667 gene locus_tag LOCUS_7620 831 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 <1539 828 gene locus_tag LOCUS_7630 <1539 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000677174.1:aminopeptidase P family protein >Feature sequence306 1127 84 gene locus_tag LOCUS_7640 1127 84 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_7640 >Feature sequence307 847 62 gene locus_tag LOCUS_7650 847 62 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393565.1 protein_id gnl|my_center|LOCUS_7650 1329 844 gene locus_tag LOCUS_7660 gene greA 1329 844 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_7660 >Feature sequence308 1452 304 gene locus_tag LOCUS_7670 gene metK 1452 304 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655178.1 protein_id gnl|my_center|LOCUS_7670 >Feature sequence309 <1526 189 gene locus_tag LOCUS_7680 <1526 189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545143.1:DegQ family serine endoprotease >Feature sequence310 447 893 gene locus_tag LOCUS_7690 447 893 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853161.1 protein_id gnl|my_center|LOCUS_7690 >Feature sequence311 966 496 gene locus_tag LOCUS_7700 966 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 <1525 963 gene locus_tag LOCUS_7710 <1525 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000142409.1:succinyldiaminopimelate transaminase >Feature sequence312 >Feature sequence313 515 87 gene locus_tag LOCUS_7720 515 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 1030 719 gene locus_tag LOCUS_7730 1030 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 1477 1040 gene locus_tag LOCUS_7740 gene cas4 1477 1040 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180703501.1 protein_id gnl|my_center|LOCUS_7740 >Feature sequence314 1510 350 gene locus_tag LOCUS_7750 gene sndC 1510 350 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_7750 >Feature sequence315 <1508 637 gene locus_tag LOCUS_7760 <1508 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972133.1:calcium:proton antiporter >Feature sequence316 <1508 406 gene locus_tag LOCUS_7770 <1508 406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068364.1:ATP-binding protein >Feature sequence317 >Feature sequence318 601 92 gene locus_tag LOCUS_7780 601 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 <1503 636 gene locus_tag LOCUS_7790 <1503 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853222.1:radical SAM protein