>Feature sequence0001
1543	212	gene
			locus_tag	LOCUS_00010
			gene	argH
1543	212	CDS
			product	argininosuccinate lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005784384.1
			protein_id	gnl|my_center|LOCUS_00010
2629	1556	gene
			locus_tag	LOCUS_00020
2629	1556	CDS
			product	M20 family metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011201961.1
			protein_id	gnl|my_center|LOCUS_00020
3408	2626	gene
			locus_tag	LOCUS_00030
			gene	argB
3408	2626	CDS
			product	acetylglutamate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783875.1
			protein_id	gnl|my_center|LOCUS_00030
4383	3418	gene
			locus_tag	LOCUS_00040
4383	3418	CDS
			product	acetylornithine carbamoyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762653.1
			protein_id	gnl|my_center|LOCUS_00040
5713	4553	gene
			locus_tag	LOCUS_00050
5713	4553	CDS
			product	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762695.1
			protein_id	gnl|my_center|LOCUS_00050
6753	5725	gene
			locus_tag	LOCUS_00060
			gene	argC
6753	5725	CDS
			product	N-acetyl-gamma-glutamyl-phosphate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762696.1
			protein_id	gnl|my_center|LOCUS_00060
7132	6764	gene
			locus_tag	LOCUS_00070
7132	6764	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00070
<7853	7125	gene
			locus_tag	LOCUS_00080
<7853	7125	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008762697.1:argininosuccinate synthase
>Feature sequence0002
1882	236	gene
			locus_tag	LOCUS_00090
1882	236	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00090
2019	2486	gene
			locus_tag	LOCUS_00100
			gene	bcp
2019	2486	CDS
			product	thioredoxin-dependent thiol peroxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001292536.1
			protein_id	gnl|my_center|LOCUS_00100
2605	3807	gene
			locus_tag	LOCUS_00110
2605	3807	CDS
			product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011268185.1
			protein_id	gnl|my_center|LOCUS_00110
5110	3971	gene
			locus_tag	LOCUS_00120
5110	3971	CDS
			product	esterase-like activity of phytase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013231036.1
			protein_id	gnl|my_center|LOCUS_00120
5247	5678	gene
			locus_tag	LOCUS_00130
5247	5678	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00130
<6822	5731	gene
			locus_tag	LOCUS_00140
<6822	5731	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_164928760.1:transferrin receptor-like dimerization domain-containing protein
>Feature sequence0003
920	1741	gene
			locus_tag	LOCUS_00150
920	1741	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00150
1987	2976	gene
			locus_tag	LOCUS_00160
1987	2976	CDS
			product	aldo/keto reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004083050.1
			protein_id	gnl|my_center|LOCUS_00160
3194	3889	gene
			locus_tag	LOCUS_00170
3194	3889	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783816.1
			protein_id	gnl|my_center|LOCUS_00170
3893	5269	gene
			locus_tag	LOCUS_00180
3893	5269	CDS
			product	HAMP domain-containing sensor histidine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765564.1
			protein_id	gnl|my_center|LOCUS_00180
5669	5421	gene
			locus_tag	LOCUS_00190
5669	5421	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00190
>Feature sequence0004
4	768	gene
			locus_tag	LOCUS_00200
			gene	rfbA
4	768	CDS
			product	glucose-1-phosphate thymidylyltransferase RfbA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002364387.1
			protein_id	gnl|my_center|LOCUS_00200
994	1494	gene
			locus_tag	LOCUS_00210
994	1494	CDS
			product	RNA polymerase sigma factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005784022.1
			protein_id	gnl|my_center|LOCUS_00210
1592	2530	gene
			locus_tag	LOCUS_00220
			gene	pfkB
1592	2530	CDS
			product	6-phosphofructokinase II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013097008.1
			protein_id	gnl|my_center|LOCUS_00220
4081	2567	gene
			locus_tag	LOCUS_00230
4081	2567	CDS
			product	glycoside hydrolase family 10 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_098999755.1
			protein_id	gnl|my_center|LOCUS_00230
4474	5499	gene
			locus_tag	LOCUS_00240
4474	5499	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00240
>Feature sequence0005
<1	3589	gene
			locus_tag	LOCUS_00250
<1	3589	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963312.1:DNA-directed RNA polymerase subunit beta
4648	3668	gene
			locus_tag	LOCUS_00260
4648	3668	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00260
>Feature sequence0006
2490	1633	gene
			locus_tag	LOCUS_00270
2490	1633	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00270
3825	2587	gene
			locus_tag	LOCUS_00280
3825	2587	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00280
5097	3832	gene
			locus_tag	LOCUS_00290
5097	3832	CDS
			product	HAMP domain-containing sensor histidine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107523.1
			protein_id	gnl|my_center|LOCUS_00290
5726	5094	gene
			locus_tag	LOCUS_00300
5726	5094	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107524.1
			protein_id	gnl|my_center|LOCUS_00300
>Feature sequence0007
1363	422	gene
			locus_tag	LOCUS_00310
1363	422	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00310
1474	3540	gene
			locus_tag	LOCUS_00320
1474	3540	CDS
			product	glycoside hydrolase family 65 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010990086.1
			protein_id	gnl|my_center|LOCUS_00320
3601	4119	gene
			locus_tag	LOCUS_00330
3601	4119	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00330
4190	5518	gene
			locus_tag	LOCUS_00340
4190	5518	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00340
>Feature sequence0008
544	1131	gene
			locus_tag	LOCUS_00350
544	1131	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00350
1206	2543	gene
			locus_tag	LOCUS_00360
1206	2543	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00360
2634	3245	gene
			locus_tag	LOCUS_00370
2634	3245	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00370
3661	3248	gene
			locus_tag	LOCUS_00380
3661	3248	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00380
4493	3840	gene
			locus_tag	LOCUS_00390
4493	3840	CDS
			product	DUF3108 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962403.1
			protein_id	gnl|my_center|LOCUS_00390
5361	4777	gene
			locus_tag	LOCUS_00400
5361	4777	CDS
			product	non-canonical purine NTP diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783551.1
			protein_id	gnl|my_center|LOCUS_00400
>Feature sequence0009
4535	1548	gene
			locus_tag	LOCUS_00410
4535	1548	CDS
			product	TonB-dependent receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767240.1
			protein_id	gnl|my_center|LOCUS_00410
4888	4697	gene
			locus_tag	LOCUS_00420
4888	4697	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00420
>Feature sequence0010
620	219	gene
			locus_tag	LOCUS_00430
620	219	CDS
			product	ester cyclase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011970109.1
			protein_id	gnl|my_center|LOCUS_00430
1950	1081	gene
			locus_tag	LOCUS_00440
1950	1081	CDS
			product	AraC family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_194105476.1
			protein_id	gnl|my_center|LOCUS_00440
2253	2852	gene
			locus_tag	LOCUS_00450
2253	2852	CDS
			product	(Fe-S)-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760113.1
			protein_id	gnl|my_center|LOCUS_00450
2923	4326	gene
			locus_tag	LOCUS_00460
2923	4326	CDS
			product	lactate utilization protein B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011121485.1
			protein_id	gnl|my_center|LOCUS_00460
4323	4907	gene
			locus_tag	LOCUS_00470
4323	4907	CDS
			product	LUD domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011071697.1
			protein_id	gnl|my_center|LOCUS_00470
>Feature sequence0011
2843	5287	gene
			locus_tag	LOCUS_00480
			gene	thrA
2843	5287	CDS
			product	bifunctional aspartate kinase/homoserine dehydrogenase I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005784545.1
			protein_id	gnl|my_center|LOCUS_00480
>Feature sequence0012
2676	1777	gene
			locus_tag	LOCUS_00490
2676	1777	CDS
			product	OmpA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767392.1
			protein_id	gnl|my_center|LOCUS_00490
3307	2732	gene
			locus_tag	LOCUS_00500
			gene	nadD
3307	2732	CDS
			product	nicotinate (nicotinamide) nucleotide adenylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_116975564.1
			protein_id	gnl|my_center|LOCUS_00500
3649	3323	gene
			locus_tag	LOCUS_00510
3649	3323	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00510
3698	4069	gene
			locus_tag	LOCUS_00520
			gene	ybeY
3698	4069	CDS
			product	rRNA maturation RNase YbeY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010933051.1
			protein_id	gnl|my_center|LOCUS_00520
<5346	4552	gene
			locus_tag	LOCUS_00530
<5346	4552	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010973130.1:glycosyltransferase family 4 protein
>Feature sequence0013
405	1436	gene
			locus_tag	LOCUS_00540
405	1436	CDS
			product	radical SAM protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010957837.1
			protein_id	gnl|my_center|LOCUS_00540
1737	2195	gene
			locus_tag	LOCUS_00550
1737	2195	CDS
			product	MarR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962680.1
			protein_id	gnl|my_center|LOCUS_00550
2334	3755	gene
			locus_tag	LOCUS_00560
2334	3755	CDS
			product	family 10 glycosylhydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000635999.1
			protein_id	gnl|my_center|LOCUS_00560
4379	3969	gene
			locus_tag	LOCUS_00570
4379	3969	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_00570
<5271	4564	gene
			locus_tag	LOCUS_00580
<5271	4564	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012896094.1:prolyl oligopeptidase family serine peptidase
>Feature sequence0014
1761	1069	gene
			locus_tag	LOCUS_00590
1761	1069	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783816.1
			protein_id	gnl|my_center|LOCUS_00590
1922	3259	gene
			locus_tag	LOCUS_00600
1922	3259	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00600
3305	4498	gene
			locus_tag	LOCUS_00610
3305	4498	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00610
<5257	4531	gene
			locus_tag	LOCUS_00620
<5257	4531	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010941404.1:hydrogenase
>Feature sequence0015
1881	436	gene
			locus_tag	LOCUS_00630
			gene	arcA
1881	436	CDS
			product	arginine deiminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011947930.1
			protein_id	gnl|my_center|LOCUS_00630
2209	3447	gene
			locus_tag	LOCUS_00640
			gene	hutI
2209	3447	CDS
			product	imidazolonepropionase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963888.1
			protein_id	gnl|my_center|LOCUS_00640
3539	4600	gene
			locus_tag	LOCUS_00650
3539	4600	CDS
			product	formimidoylglutamase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963810.1
			protein_id	gnl|my_center|LOCUS_00650
<5186	4608	gene
			locus_tag	LOCUS_00660
<5186	4608	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003643947.1:ABC-F family ATP-binding cassette domain-containing protein
>Feature sequence0016
188	706	gene
			locus_tag	LOCUS_00670
188	706	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00670
938	708	gene
			locus_tag	LOCUS_00680
			gene	yidD
938	708	CDS
			product	membrane protein insertion efficiency factor YidD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002214730.1
			protein_id	gnl|my_center|LOCUS_00680
1266	913	gene
			locus_tag	LOCUS_00690
			gene	rnpA
1266	913	CDS
			product	ribonuclease P protein component
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767458.1
			protein_id	gnl|my_center|LOCUS_00690
1647	1492	gene
			locus_tag	LOCUS_00700
			gene	rpmH
1647	1492	CDS
			product	50S ribosomal protein L34
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004292199.1
			protein_id	gnl|my_center|LOCUS_00700
2702	1842	gene
			locus_tag	LOCUS_00710
			gene	murI
2702	1842	CDS
			product	glutamate racemase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011108947.1
			protein_id	gnl|my_center|LOCUS_00710
3356	2742	gene
			locus_tag	LOCUS_00720
3356	2742	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00720
3869	3387	gene
			locus_tag	LOCUS_00730
3869	3387	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00730
<5138	3931	gene
			locus_tag	LOCUS_00740
<5138	3931	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005784370.1:POTRA domain-containing protein
>Feature sequence0017
560	3925	gene
			locus_tag	LOCUS_00750
560	3925	CDS
			product	TonB-dependent receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011108890.1
			protein_id	gnl|my_center|LOCUS_00750
>Feature sequence0018
3617	2391	gene
			locus_tag	LOCUS_00760
3617	2391	CDS
			product	multiheme c-type cytochrome
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011124143.1
			protein_id	gnl|my_center|LOCUS_00760
4638	3790	gene
			locus_tag	LOCUS_00770
4638	3790	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00770
>Feature sequence0019
100	417	gene
			locus_tag	LOCUS_00780
100	417	CDS
			product	DUF4134 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002560983.1
			protein_id	gnl|my_center|LOCUS_00780
455	769	gene
			locus_tag	LOCUS_00790
455	769	CDS
			product	DUF4133 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008648476.1
			protein_id	gnl|my_center|LOCUS_00790
757	1854	gene
			locus_tag	LOCUS_00800
757	1854	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00800
1970	2404	gene
			locus_tag	LOCUS_00810
1970	2404	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00810
2435	2788	gene
			locus_tag	LOCUS_00820
			gene	ychN
2435	2788	CDS
			product	DsrE/F sulfur relay family protein YchN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001169669.1
			protein_id	gnl|my_center|LOCUS_00820
3836	3051	gene
			locus_tag	LOCUS_00830
3836	3051	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00830
4192	3869	gene
			locus_tag	LOCUS_00840
4192	3869	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00840
4843	5025	gene
			locus_tag	LOCUS_00850
4843	5025	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00850
>Feature sequence0020
<1	779	gene
			locus_tag	LOCUS_00860
<1	779	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011038886.1:N-acetylmuramoyl-L-alanine amidase
952	2106	gene
			locus_tag	LOCUS_00870
952	2106	CDS
			product	acyl-CoA dehydrogenase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964032.1
			protein_id	gnl|my_center|LOCUS_00870
2300	3490	gene
			locus_tag	LOCUS_00880
2300	3490	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00880
3492	4154	gene
			locus_tag	LOCUS_00890
3492	4154	CDS
			product	YggS family pyridoxal phosphate-dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964017.1
			protein_id	gnl|my_center|LOCUS_00890
<5051	4262	gene
			locus_tag	LOCUS_00900
<5051	4262	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011038867.1:M20 family metallopeptidase
>Feature sequence0021
1459	830	gene
			locus_tag	LOCUS_00910
1459	830	CDS
			product	hydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941401.1
			protein_id	gnl|my_center|LOCUS_00910
2390	1485	gene
			locus_tag	LOCUS_00920
2390	1485	CDS
			product	NADH-quinone oxidoreductase subunit H
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941400.1
			protein_id	gnl|my_center|LOCUS_00920
4415	2394	gene
			locus_tag	LOCUS_00930
4415	2394	CDS
			product	proton-conducting transporter membrane subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941395.1
			protein_id	gnl|my_center|LOCUS_00930
>Feature sequence0022
1122	286	gene
			locus_tag	LOCUS_00940
1122	286	CDS
			product	pyridoxal-phosphate dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014205909.1
			protein_id	gnl|my_center|LOCUS_00940
1246	2148	gene
			locus_tag	LOCUS_00950
1246	2148	CDS
			product	nucleotidyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762743.1
			protein_id	gnl|my_center|LOCUS_00950
3399	2290	gene
			locus_tag	LOCUS_00960
3399	2290	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00960
3971	3405	gene
			locus_tag	LOCUS_00970
3971	3405	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00970
4121	4297	gene
			locus_tag	LOCUS_00980
4121	4297	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_00980
>Feature sequence0023
725	2608	gene
			locus_tag	LOCUS_00990
725	2608	CDS
			product	DNA topoisomerase IV subunit B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962807.1
			protein_id	gnl|my_center|LOCUS_00990
2620	3435	gene
			locus_tag	LOCUS_01000
2620	3435	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01000
>Feature sequence0024
1525	2487	gene
			locus_tag	LOCUS_01010
1525	2487	CDS
			product	ribose-phosphate pyrophosphokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962326.1
			protein_id	gnl|my_center|LOCUS_01010
2599	3246	gene
			locus_tag	LOCUS_01020
2599	3246	CDS
			product	50S ribosomal protein L25/general stress protein Ctc
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005785759.1
			protein_id	gnl|my_center|LOCUS_01020
3651	4235	gene
			locus_tag	LOCUS_01030
			gene	pth
3651	4235	CDS
			product	aminoacyl-tRNA hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_034100438.1
			protein_id	gnl|my_center|LOCUS_01030
>Feature sequence0025
617	48	gene
			locus_tag	LOCUS_01040
617	48	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01040
1348	692	gene
			locus_tag	LOCUS_01050
1348	692	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01050
2315	2953	gene
			locus_tag	LOCUS_01060
2315	2953	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01060
3012	3455	gene
			locus_tag	LOCUS_01070
3012	3455	CDS
			product	DUF5675 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963661.1
			protein_id	gnl|my_center|LOCUS_01070
3595	3822	gene
			locus_tag	LOCUS_01080
3595	3822	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964410.1
			protein_id	gnl|my_center|LOCUS_01080
3815	3988	gene
			locus_tag	LOCUS_01090
3815	3988	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01090
>Feature sequence0026
647	33	gene
			locus_tag	LOCUS_01100
647	33	CDS
			product	RNA polymerase sigma-70 factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005796768.1
			protein_id	gnl|my_center|LOCUS_01100
809	3253	gene
			locus_tag	LOCUS_01110
809	3253	CDS
			product	TonB-dependent receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962686.1
			protein_id	gnl|my_center|LOCUS_01110
>Feature sequence0027
<1	2559	gene
			locus_tag	LOCUS_01120
<1	2559	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005798907.1:TonB-dependent receptor
2593	4179	gene
			locus_tag	LOCUS_01130
2593	4179	CDS
			product	RagB/SusD family nutrient uptake outer membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005789572.1
			protein_id	gnl|my_center|LOCUS_01130
>Feature sequence0028
362	2443	gene
			locus_tag	LOCUS_01140
			gene	ftsH
362	2443	CDS
			product	ATP-dependent zinc metalloprotease FtsH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_062695721.1
			protein_id	gnl|my_center|LOCUS_01140
2464	3099	gene
			locus_tag	LOCUS_01150
2464	3099	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01150
>Feature sequence0029
222	1220	gene
			locus_tag	LOCUS_01160
222	1220	CDS
			product	rhodanese-related sulfurtransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013097157.1
			protein_id	gnl|my_center|LOCUS_01160
1648	1223	gene
			locus_tag	LOCUS_01170
1648	1223	CDS
			product	EamA family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868112.1
			protein_id	gnl|my_center|LOCUS_01170
2580	1657	gene
			locus_tag	LOCUS_01180
2580	1657	CDS
			product	phosphoribosylaminoimidazolesuccinocarboxamide synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005785154.1
			protein_id	gnl|my_center|LOCUS_01180
>Feature sequence0030
1550	309	gene
			locus_tag	LOCUS_01190
1550	309	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01190
2034	3071	gene
			locus_tag	LOCUS_01200
2034	3071	CDS
			product	kelch repeat-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011203251.1
			protein_id	gnl|my_center|LOCUS_01200
3064	3399	gene
			locus_tag	LOCUS_01210
3064	3399	CDS
			product	DUF4907 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008769577.1
			protein_id	gnl|my_center|LOCUS_01210
3813	3424	gene
			locus_tag	LOCUS_01220
3813	3424	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01220
<4619	3905	gene
			locus_tag	LOCUS_01230
<4619	3905	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase family protein
>Feature sequence0031
1425	226	gene
			locus_tag	LOCUS_01240
1425	226	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01240
3185	1740	gene
			locus_tag	LOCUS_01250
3185	1740	CDS
			product	circularly permuted type 2 ATP-grasp protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007340179.1
			protein_id	gnl|my_center|LOCUS_01250
3351	3683	gene
			locus_tag	LOCUS_01260
3351	3683	CDS
			product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011461784.1
			protein_id	gnl|my_center|LOCUS_01260
3685	4374	gene
			locus_tag	LOCUS_01270
3685	4374	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01270
>Feature sequence0032
258	581	gene
			locus_tag	LOCUS_01280
258	581	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, internal stop codon
			protein_id	gnl|my_center|LOCUS_01280
624	1265	gene
			locus_tag	LOCUS_01290
624	1265	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, internal stop codon
			protein_id	gnl|my_center|LOCUS_01290
1409	3784	gene
			locus_tag	LOCUS_01300
1409	3784	CDS
			product	glycoside hydrolase family 31 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_162303124.1
			protein_id	gnl|my_center|LOCUS_01300
>Feature sequence0033
>Feature sequence0034
<1	806	gene
			locus_tag	LOCUS_01310
<1	806	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962368.1:NAD-dependent epimerase/dehydratase family protein
1248	838	gene
			locus_tag	LOCUS_01320
1248	838	CDS
			product	Rrf2 family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941998.1
			protein_id	gnl|my_center|LOCUS_01320
2149	1433	gene
			locus_tag	LOCUS_01330
			gene	dapB
2149	1433	CDS
			product	4-hydroxy-tetrahydrodipicolinate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963266.1
			protein_id	gnl|my_center|LOCUS_01330
2880	2218	gene
			locus_tag	LOCUS_01340
2880	2218	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01340
3817	2888	gene
			locus_tag	LOCUS_01350
3817	2888	CDS
			product	ParB/RepB/Spo0J family partition protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760916.1
			protein_id	gnl|my_center|LOCUS_01350
<4505	3897	gene
			locus_tag	LOCUS_01360
<4505	3897	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_016269488.1:AAA family ATPase
>Feature sequence0035
27	659	gene
			locus_tag	LOCUS_01370
			gene	can
27	659	CDS
			product	carbonate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964129.1
			protein_id	gnl|my_center|LOCUS_01370
1626	664	gene
			locus_tag	LOCUS_01380
1626	664	CDS
			product	transketolase C-terminal domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962843.1
			protein_id	gnl|my_center|LOCUS_01380
<4455	1891	gene
			locus_tag	LOCUS_01390
<4455	1891	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000414323.1:glycosyltransferase
>Feature sequence0036
2139	1282	gene
			locus_tag	LOCUS_01400
2139	1282	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_01400
2335	3402	gene
			locus_tag	LOCUS_01410
2335	3402	CDS
			product	endonuclease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767132.1
			protein_id	gnl|my_center|LOCUS_01410
3658	4011	gene
			locus_tag	LOCUS_01420
			gene	rpsF
3658	4011	CDS
			product	30S ribosomal protein S6
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008759739.1
			protein_id	gnl|my_center|LOCUS_01420
4013	4276	gene
			locus_tag	LOCUS_01430
			gene	rpsR
4013	4276	CDS
			product	30S ribosomal protein S18
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008759740.1
			protein_id	gnl|my_center|LOCUS_01430
>Feature sequence0037
1	870	gene
			locus_tag	LOCUS_01440
1	870	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01440
1055	1471	gene
			locus_tag	LOCUS_01450
1055	1471	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01450
1459	2721	gene
			locus_tag	LOCUS_01460
1459	2721	CDS
			product	Y-family DNA polymerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008768413.1
			protein_id	gnl|my_center|LOCUS_01460
2726	3226	gene
			locus_tag	LOCUS_01470
2726	3226	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01470
3229	4014	gene
			locus_tag	LOCUS_01480
3229	4014	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01480
4026	4247	gene
			locus_tag	LOCUS_01490
4026	4247	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01490
>Feature sequence0038
1	423	gene
			locus_tag	LOCUS_01500
1	423	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01500
667	1917	gene
			locus_tag	LOCUS_01510
			gene	gldK
667	1917	CDS
			product	gliding motility lipoprotein GldK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964075.1
			protein_id	gnl|my_center|LOCUS_01510
2019	2783	gene
			locus_tag	LOCUS_01520
2019	2783	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01520
2880	4370	gene
			locus_tag	LOCUS_01530
2880	4370	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01530
>Feature sequence0039
1225	146	gene
			locus_tag	LOCUS_01540
1225	146	CDS
			product	glycoside hydrolase family 43 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011203436.1
			protein_id	gnl|my_center|LOCUS_01540
2481	1279	gene
			locus_tag	LOCUS_01550
2481	1279	CDS
			product	DUF2264 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_116062060.1
			protein_id	gnl|my_center|LOCUS_01550
3603	2485	gene
			locus_tag	LOCUS_01560
3603	2485	CDS
			product	glycoside hydrolase family 88 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767198.1
			protein_id	gnl|my_center|LOCUS_01560
<4359	3725	gene
			locus_tag	LOCUS_01570
<4359	3725	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767016.1:BNR repeat-containing protein
>Feature sequence0040
<1	807	gene
			locus_tag	LOCUS_01580
<1	807	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962644.1:M28 family peptidase
810	1205	gene
			locus_tag	LOCUS_01590
810	1205	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01590
1402	3753	gene
			locus_tag	LOCUS_01600
1402	3753	CDS
			product	TonB-dependent receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962850.1
			protein_id	gnl|my_center|LOCUS_01600
>Feature sequence0041
744	109	gene
			locus_tag	LOCUS_01610
			gene	yihA
744	109	CDS
			product	ribosome biogenesis GTP-binding protein YihA/YsxC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005794469.1
			protein_id	gnl|my_center|LOCUS_01610
1348	836	gene
			locus_tag	LOCUS_01620
1348	836	CDS
			product	heme-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012259362.1
			protein_id	gnl|my_center|LOCUS_01620
2879	1359	gene
			locus_tag	LOCUS_01630
			gene	gpmI
2879	1359	CDS
			product	2,3-bisphosphoglycerate-independent phosphoglycerate mutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964233.1
			protein_id	gnl|my_center|LOCUS_01630
2981	3370	gene
			locus_tag	LOCUS_01640
2981	3370	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01640
>Feature sequence0042
684	427	gene
			locus_tag	LOCUS_01650
684	427	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01650
1070	843	gene
			locus_tag	LOCUS_01660
1070	843	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01660
1992	1051	gene
			locus_tag	LOCUS_01670
1992	1051	CDS
			product	cobalamin-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012258980.1
			protein_id	gnl|my_center|LOCUS_01670
2604	2068	gene
			locus_tag	LOCUS_01680
2604	2068	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000621286.1
			protein_id	gnl|my_center|LOCUS_01680
<4331	2691	gene
			locus_tag	LOCUS_01690
<4331	2691	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000449670.1:TonB-dependent receptor
>Feature sequence0043
922	2556	gene
			locus_tag	LOCUS_01700
			gene	fumB
922	2556	CDS
			product	class I fumarate hydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000066639.1
			protein_id	gnl|my_center|LOCUS_01700
2733	3695	gene
			locus_tag	LOCUS_01710
2733	3695	CDS
			product	2-hydroxyacid dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004186160.1
			protein_id	gnl|my_center|LOCUS_01710
>Feature sequence0044
1234	461	gene
			locus_tag	LOCUS_01720
1234	461	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01720
1608	3575	gene
			locus_tag	LOCUS_01730
1608	3575	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01730
<4265	3757	gene
			locus_tag	LOCUS_01740
<4265	3757	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011082957.1:amidohydrolase/deacetylase family metallohydrolase
>Feature sequence0045
118	1731	gene
			locus_tag	LOCUS_01750
			gene	malL
118	1731	CDS
			product	oligo-1,6-glucosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000415176.1
			protein_id	gnl|my_center|LOCUS_01750
1812	3158	gene
			locus_tag	LOCUS_01760
1812	3158	CDS
			product	sugar porter family MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011122710.1
			protein_id	gnl|my_center|LOCUS_01760
>Feature sequence0046
795	1505	gene
			locus_tag	LOCUS_01770
			gene	ric
795	1505	CDS
			product	iron-sulfur cluster repair di-iron protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005814727.1
			protein_id	gnl|my_center|LOCUS_01770
2096	1710	gene
			locus_tag	LOCUS_01780
2096	1710	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01780
2500	2156	gene
			locus_tag	LOCUS_01790
2500	2156	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01790
3837	2548	gene
			locus_tag	LOCUS_01800
3837	2548	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01800
>Feature sequence0047
1012	41	gene
			locus_tag	LOCUS_01810
1012	41	CDS
			product	dihydrodipicolinate synthase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791099.1
			protein_id	gnl|my_center|LOCUS_01810
2176	1064	gene
			locus_tag	LOCUS_01820
2176	1064	CDS
			product	sialidase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011119313.1
			protein_id	gnl|my_center|LOCUS_01820
3949	2399	gene
			locus_tag	LOCUS_01830
3949	2399	CDS
			product	RagB/SusD family nutrient uptake outer membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202529.1
			protein_id	gnl|my_center|LOCUS_01830
>Feature sequence0048
2131	1499	gene
			locus_tag	LOCUS_01840
			gene	pyrE
2131	1499	CDS
			product	orotate phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005784381.1
			protein_id	gnl|my_center|LOCUS_01840
2197	2610	gene
			locus_tag	LOCUS_01850
2197	2610	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01850
3041	2613	gene
			locus_tag	LOCUS_01860
3041	2613	CDS
			product	hotdog fold thioesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010957885.1
			protein_id	gnl|my_center|LOCUS_01860
3521	3042	gene
			locus_tag	LOCUS_01870
			gene	coaD
3521	3042	CDS
			product	pantetheine-phosphate adenylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962815.1
			protein_id	gnl|my_center|LOCUS_01870
<4151	3605	gene
			locus_tag	LOCUS_01880
<4151	3605	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963902.1:aspartate carbamoyltransferase catalytic subunit
>Feature sequence0049
<1	2047	gene
			locus_tag	LOCUS_01890
<1	2047	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964489.1:efflux RND transporter permease subunit
2154	2951	gene
			locus_tag	LOCUS_01900
2154	2951	CDS
			product	TIGR00266 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001147838.1
			protein_id	gnl|my_center|LOCUS_01900
3013	3576	gene
			locus_tag	LOCUS_01910
3013	3576	CDS
			product	Crp/Fnr family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765993.1
			protein_id	gnl|my_center|LOCUS_01910
>Feature sequence0050
1673	1038	gene
			locus_tag	LOCUS_01920
1673	1038	CDS
			product	cytochrome c
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962547.1
			protein_id	gnl|my_center|LOCUS_01920
2275	1688	gene
			locus_tag	LOCUS_01930
2275	1688	CDS
			product	DUF3341 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011404832.1
			protein_id	gnl|my_center|LOCUS_01930
3799	2321	gene
			locus_tag	LOCUS_01940
			gene	nrfD
3799	2321	CDS
			product	polysulfide reductase NrfD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962545.1
			protein_id	gnl|my_center|LOCUS_01940
>Feature sequence0051
<1	2838	gene
			locus_tag	LOCUS_01950
<1	2838	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203461.1:4-alpha-glucanotransferase
2873	3967	gene
			locus_tag	LOCUS_01960
2873	3967	CDS
			product	dipeptide epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164922169.1
			protein_id	gnl|my_center|LOCUS_01960
>Feature sequence0052
319	1842	gene
			locus_tag	LOCUS_01970
319	1842	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_01970
2782	1856	gene
			locus_tag	LOCUS_01980
2782	1856	CDS
			product	GDP-L-fucose synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941290.1
			protein_id	gnl|my_center|LOCUS_01980
3992	2883	gene
			locus_tag	LOCUS_01990
			gene	gmd
3992	2883	CDS
			product	GDP-mannose 4,6-dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003863514.1
			protein_id	gnl|my_center|LOCUS_01990
>Feature sequence0053
598	2544	gene
			locus_tag	LOCUS_02000
598	2544	CDS
			product	glucosamine-6-phosphate deaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011203149.1
			protein_id	gnl|my_center|LOCUS_02000
2582	3217	gene
			locus_tag	LOCUS_02010
2582	3217	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02010
>Feature sequence0054
727	5	gene
			locus_tag	LOCUS_02020
727	5	CDS
			product	ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962745.1
			protein_id	gnl|my_center|LOCUS_02020
1055	765	gene
			locus_tag	LOCUS_02030
			gene	gatC
1055	765	CDS
			product	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000705423.1
			protein_id	gnl|my_center|LOCUS_02030
1057	1599	gene
			locus_tag	LOCUS_02040
1057	1599	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02040
1610	1963	gene
			locus_tag	LOCUS_02050
1610	1963	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02050
3294	2101	gene
			locus_tag	LOCUS_02060
3294	2101	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02060
>Feature sequence0055
938	1792	gene
			locus_tag	LOCUS_02070
			gene	pabC
938	1792	CDS
			product	aminodeoxychorismate lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005453968.1
			protein_id	gnl|my_center|LOCUS_02070
2621	1782	gene
			locus_tag	LOCUS_02080
2621	1782	CDS
			product	1,4-dihydroxy-6-naphthoate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941121.1
			protein_id	gnl|my_center|LOCUS_02080
3391	2723	gene
			locus_tag	LOCUS_02090
			gene	mqnB
3391	2723	CDS
			product	futalosine hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136796951.1
			protein_id	gnl|my_center|LOCUS_02090
3460	3867	gene
			locus_tag	LOCUS_02100
3460	3867	CDS
			product	6-carboxytetrahydropterin synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405497.1
			protein_id	gnl|my_center|LOCUS_02100
>Feature sequence0056
1234	152	gene
			locus_tag	LOCUS_02110
			gene	lpxK
1234	152	CDS
			product	tetraacyldisaccharide 4'-kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_009292736.1
			protein_id	gnl|my_center|LOCUS_02110
1796	1221	gene
			locus_tag	LOCUS_02120
1796	1221	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02120
2359	1820	gene
			locus_tag	LOCUS_02130
2359	1820	CDS
			product	RsmD family RNA methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760894.1
			protein_id	gnl|my_center|LOCUS_02130
3204	2356	gene
			locus_tag	LOCUS_02140
3204	2356	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02140
>Feature sequence0057
2116	1664	gene
			locus_tag	LOCUS_02150
2116	1664	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02150
2339	2094	gene
			locus_tag	LOCUS_02160
2339	2094	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02160
2530	2339	gene
			locus_tag	LOCUS_02170
2530	2339	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02170
2943	3275	gene
			locus_tag	LOCUS_02180
2943	3275	CDS
			product	metalloregulator ArsR/SmtB family transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405177.1
			protein_id	gnl|my_center|LOCUS_02180
>Feature sequence0058
631	209	gene
			locus_tag	LOCUS_02190
			gene	aroQ
631	209	CDS
			product	type II 3-dehydroquinate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964118.1
			protein_id	gnl|my_center|LOCUS_02190
1990	893	gene
			locus_tag	LOCUS_02200
			gene	carA
1990	893	CDS
			product	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963443.1
			protein_id	gnl|my_center|LOCUS_02200
2595	2080	gene
			locus_tag	LOCUS_02210
			gene	rplQ
2595	2080	CDS
			product	50S ribosomal protein L17
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762052.1
			protein_id	gnl|my_center|LOCUS_02210
3682	2681	gene
			locus_tag	LOCUS_02220
3682	2681	CDS
			product	DNA-directed RNA polymerase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963445.1
			protein_id	gnl|my_center|LOCUS_02220
>Feature sequence0059
<1	1462	gene
			locus_tag	LOCUS_02230
<1	1462	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011392090.1:NAD+ synthase
2373	1534	gene
			locus_tag	LOCUS_02240
2373	1534	CDS
			product	universal stress protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962636.1
			protein_id	gnl|my_center|LOCUS_02240
3670	2495	gene
			locus_tag	LOCUS_02250
3670	2495	CDS
			product	acetyl-CoA C-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963835.1
			protein_id	gnl|my_center|LOCUS_02250
>Feature sequence0060
2300	1809	gene
			locus_tag	LOCUS_02260
2300	1809	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02260
>Feature sequence0061
209	2833	gene
			locus_tag	LOCUS_02270
			gene	mutS
209	2833	CDS
			product	DNA mismatch repair protein MutS
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011108646.1
			protein_id	gnl|my_center|LOCUS_02270
>Feature sequence0062
<1	2908	gene
			locus_tag	LOCUS_02280
<1	2908	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012257943.1:SBBP repeat-containing protein
>Feature sequence0063
932	1813	gene
			locus_tag	LOCUS_02290
932	1813	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02290
1981	2184	gene
			locus_tag	LOCUS_02300
1981	2184	CDS
			product	cold-shock protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003017957.1
			protein_id	gnl|my_center|LOCUS_02300
2968	2324	gene
			locus_tag	LOCUS_02310
2968	2324	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02310
>Feature sequence0064
<1	965	gene
			locus_tag	LOCUS_02320
<1	965	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767090.1:L-fucose:H+ symporter permease
946	1956	gene
			locus_tag	LOCUS_02330
946	1956	CDS
			product	zinc-binding alcohol dehydrogenase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010972587.1
			protein_id	gnl|my_center|LOCUS_02330
1997	3670	gene
			locus_tag	LOCUS_02340
1997	3670	CDS
			product	alpha-L-fucosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767035.1
			protein_id	gnl|my_center|LOCUS_02340
>Feature sequence0065
3537	3073	gene
			locus_tag	LOCUS_02350
3537	3073	CDS
			product	response regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_048061215.1
			protein_id	gnl|my_center|LOCUS_02350
>Feature sequence0066
263	191	gene
			locus_tag	LOCUS_t00010
263	191	tRNA
			product	tRNA-Met
			inference	COORDINATES:profile:Aragorn:1.2.38
1101	313	gene
			locus_tag	LOCUS_02360
1101	313	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02360
>Feature sequence0067
1848	1087	gene
			locus_tag	LOCUS_02370
1848	1087	CDS
			product	GLPGLI family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_109413831.1
			protein_id	gnl|my_center|LOCUS_02370
<3798	1838	gene
			locus_tag	LOCUS_02380
<3798	1838	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202738.1:outer membrane beta-barrel protein
>Feature sequence0068
>Feature sequence0069
<1	1198	gene
			locus_tag	LOCUS_02390
<1	1198	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011201893.1:beta-ketoacyl-ACP synthase II
1203	1910	gene
			locus_tag	LOCUS_02400
1203	1910	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02400
2574	1921	gene
			locus_tag	LOCUS_02410
2574	1921	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02410
2993	2589	gene
			locus_tag	LOCUS_02420
			gene	mce
2993	2589	CDS
			product	methylmalonyl-CoA epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962412.1
			protein_id	gnl|my_center|LOCUS_02420
>Feature sequence0070
87	1154	gene
			locus_tag	LOCUS_02430
			gene	arsB
87	1154	CDS
			product	ACR3 family arsenite efflux transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000826560.1
			protein_id	gnl|my_center|LOCUS_02430
1283	1711	gene
			locus_tag	LOCUS_02440
1283	1711	CDS
			product	arsenate reductase ArsC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013222673.1
			protein_id	gnl|my_center|LOCUS_02440
1758	2246	gene
			locus_tag	LOCUS_02450
			gene	ssb
1758	2246	CDS
			product	single-stranded DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_137264126.1
			protein_id	gnl|my_center|LOCUS_02450
2346	3686	gene
			locus_tag	LOCUS_02460
2346	3686	CDS
			product	gliding motility-associated protein GldE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005795192.1
			protein_id	gnl|my_center|LOCUS_02460
>Feature sequence0071
944	69	gene
			locus_tag	LOCUS_02470
944	69	CDS
			product	ABC transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013229773.1
			protein_id	gnl|my_center|LOCUS_02470
1860	922	gene
			locus_tag	LOCUS_02480
1860	922	CDS
			product	ATP-binding cassette domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011460543.1
			protein_id	gnl|my_center|LOCUS_02480
<3686	2005	gene
			locus_tag	LOCUS_02490
<3686	2005	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963173.1:dehydrogenase E1 component subunit alpha/beta
>Feature sequence0072
1376	3235	gene
			locus_tag	LOCUS_02500
1376	3235	CDS
			product	phosphoenolpyruvate carboxykinase (GTP)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010933885.1
			protein_id	gnl|my_center|LOCUS_02500
>Feature sequence0073
645	154	gene
			locus_tag	LOCUS_02510
645	154	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963109.1
			protein_id	gnl|my_center|LOCUS_02510
1457	657	gene
			locus_tag	LOCUS_02520
1457	657	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02520
2922	1555	gene
			locus_tag	LOCUS_02530
2922	1555	CDS
			product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011392987.1
			protein_id	gnl|my_center|LOCUS_02530
3596	2922	gene
			locus_tag	LOCUS_02540
3596	2922	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_200855686.1
			protein_id	gnl|my_center|LOCUS_02540
>Feature sequence0074
727	359	gene
			locus_tag	LOCUS_02550
727	359	CDS
			product	four helix bundle protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964356.1
			protein_id	gnl|my_center|LOCUS_02550
1809	769	gene
			locus_tag	LOCUS_02560
			gene	hemE
1809	769	CDS
			product	uroporphyrinogen decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962222.1
			protein_id	gnl|my_center|LOCUS_02560
2522	1806	gene
			locus_tag	LOCUS_02570
2522	1806	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02570
3432	2509	gene
			locus_tag	LOCUS_02580
			gene	hemC
3432	2509	CDS
			product	hydroxymethylbilane synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962224.1
			protein_id	gnl|my_center|LOCUS_02580
>Feature sequence0075
2304	1372	gene
			locus_tag	LOCUS_02590
2304	1372	CDS
			product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005479611.1
			protein_id	gnl|my_center|LOCUS_02590
<3650	2526	gene
			locus_tag	LOCUS_02600
<3650	2526	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010920956.1:efflux RND transporter permease subunit
>Feature sequence0076
761	303	gene
			locus_tag	LOCUS_02610
761	303	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962201.1
			protein_id	gnl|my_center|LOCUS_02610
951	2429	gene
			locus_tag	LOCUS_02620
951	2429	CDS
			product	NAD(P)/FAD-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_024265670.1
			protein_id	gnl|my_center|LOCUS_02620
<3638	2453	gene
			locus_tag	LOCUS_02630
<3638	2453	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964466.1:acetyl-CoA carboxylase biotin carboxylase subunit
>Feature sequence0077
1	390	gene
			locus_tag	LOCUS_02640
1	390	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02640
488	2188	gene
			locus_tag	LOCUS_02650
488	2188	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02650
<3635	2431	gene
			locus_tag	LOCUS_02660
<3635	2431	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011071149.1:PAS domain S-box protein
>Feature sequence0078
1110	61	gene
			locus_tag	LOCUS_02670
1110	61	CDS
			product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_072879556.1
			protein_id	gnl|my_center|LOCUS_02670
1864	1187	gene
			locus_tag	LOCUS_02680
1864	1187	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962529.1
			protein_id	gnl|my_center|LOCUS_02680
>Feature sequence0079
2	415	gene
			locus_tag	LOCUS_02690
2	415	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02690
579	3005	gene
			locus_tag	LOCUS_02700
			gene	pbpC
579	3005	CDS
			product	penicillin-binding protein 1C
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964324.1
			protein_id	gnl|my_center|LOCUS_02700
>Feature sequence0080
374	2791	gene
			locus_tag	LOCUS_02710
374	2791	CDS
			product	zinc-dependent metalloprotease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_118839793.1
			protein_id	gnl|my_center|LOCUS_02710
>Feature sequence0081
<3562	2063	gene
			locus_tag	LOCUS_02720
<3562	2063	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_118838626.1:amidohydrolase
>Feature sequence0082
2879	888	gene
			locus_tag	LOCUS_02730
			gene	nosZ
2879	888	CDS
			product	Sec-dependent nitrous-oxide reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_118838072.1
			protein_id	gnl|my_center|LOCUS_02730
3369	2929	gene
			locus_tag	LOCUS_02740
3369	2929	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02740
>Feature sequence0083
1284	4	gene
			locus_tag	LOCUS_02750
1284	4	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02750
1900	3153	gene
			locus_tag	LOCUS_02760
1900	3153	CDS
			product	peptidase U32 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008761719.1
			protein_id	gnl|my_center|LOCUS_02760
3153	3374	gene
			locus_tag	LOCUS_02770
3153	3374	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_02770
>Feature sequence0084
1255	2388	gene
			locus_tag	LOCUS_02780
1255	2388	CDS
			product	formimidoylglutamase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_103912749.1
			protein_id	gnl|my_center|LOCUS_02780
<3528	2465	gene
			locus_tag	LOCUS_02790
<3528	2465	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011038708.1:arabinogalactan endo-1,4-beta-galactosidase
>Feature sequence0085
165	1406	gene
			locus_tag	LOCUS_02800
			gene	aroA
165	1406	CDS
			product	3-phosphoshikimate 1-carboxyvinyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_064496517.1
			protein_id	gnl|my_center|LOCUS_02800
1467	2480	gene
			locus_tag	LOCUS_02810
			gene	aroC
1467	2480	CDS
			product	chorismate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010878173.1
			protein_id	gnl|my_center|LOCUS_02810
2491	2790	gene
			locus_tag	LOCUS_02820
2491	2790	CDS
			product	DUF952 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011142756.1
			protein_id	gnl|my_center|LOCUS_02820
2884	3360	gene
			locus_tag	LOCUS_02830
			gene	rnhA
2884	3360	CDS
			product	ribonuclease HI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962375.1
			protein_id	gnl|my_center|LOCUS_02830
>Feature sequence0086
<1	1124	gene
			locus_tag	LOCUS_02840
<1	1124	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005785419.1:FecR family protein
>Feature sequence0087
215	481	gene
			locus_tag	LOCUS_02850
			gene	rpsQ
215	481	CDS
			product	30S ribosomal protein S17
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762040.1
			protein_id	gnl|my_center|LOCUS_02850
582	950	gene
			locus_tag	LOCUS_02860
			gene	rplN
582	950	CDS
			product	50S ribosomal protein L14
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004558867.1
			protein_id	gnl|my_center|LOCUS_02860
1015	1353	gene
			locus_tag	LOCUS_02870
			gene	rplX
1015	1353	CDS
			product	50S ribosomal protein L24
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791554.1
			protein_id	gnl|my_center|LOCUS_02870
1353	1928	gene
			locus_tag	LOCUS_02880
			gene	rplE
1353	1928	CDS
			product	50S ribosomal protein L5
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963458.1
			protein_id	gnl|my_center|LOCUS_02880
1941	2210	gene
			locus_tag	LOCUS_02890
			gene	rpsN
1941	2210	CDS
			product	30S ribosomal protein S14
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963457.1
			protein_id	gnl|my_center|LOCUS_02890
2284	2682	gene
			locus_tag	LOCUS_02900
			gene	rpsH
2284	2682	CDS
			product	30S ribosomal protein S8
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963456.1
			protein_id	gnl|my_center|LOCUS_02900
2802	3356	gene
			locus_tag	LOCUS_02910
			gene	rplF
2802	3356	CDS
			product	50S ribosomal protein L6
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765429.1
			protein_id	gnl|my_center|LOCUS_02910
>Feature sequence0088
3236	2496	gene
			locus_tag	LOCUS_02920
3236	2496	CDS
			product	TIGR00730 family Rossman fold protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013222950.1
			protein_id	gnl|my_center|LOCUS_02920
>Feature sequence0089
<1	1184	gene
			locus_tag	LOCUS_02930
<1	1184	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963824.1:endopeptidase La
1508	2662	gene
			locus_tag	LOCUS_02940
1508	2662	CDS
			product	DUF4105 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405075.1
			protein_id	gnl|my_center|LOCUS_02940
>Feature sequence0090
1018	290	gene
			locus_tag	LOCUS_02950
1018	290	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011103245.1
			protein_id	gnl|my_center|LOCUS_02950
1402	1079	gene
			locus_tag	LOCUS_02960
1402	1079	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004407887.1
			protein_id	gnl|my_center|LOCUS_02960
2139	1399	gene
			locus_tag	LOCUS_02970
2139	1399	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007245498.1
			protein_id	gnl|my_center|LOCUS_02970
2758	2132	gene
			locus_tag	LOCUS_02980
2758	2132	CDS
			product	HAD family phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011266514.1
			protein_id	gnl|my_center|LOCUS_02980
3390	2764	gene
			locus_tag	LOCUS_02990
3390	2764	CDS
			product	phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005769042.1
			protein_id	gnl|my_center|LOCUS_02990
>Feature sequence0091
816	247	gene
			locus_tag	LOCUS_03000
816	247	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000621286.1
			protein_id	gnl|my_center|LOCUS_03000
2120	897	gene
			locus_tag	LOCUS_03010
			gene	manA
2120	897	CDS
			product	mannose-6-phosphate isomerase, class I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005480231.1
			protein_id	gnl|my_center|LOCUS_03010
2156	2512	gene
			locus_tag	LOCUS_03020
2156	2512	CDS
			product	YraN family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005081582.1
			protein_id	gnl|my_center|LOCUS_03020
>Feature sequence0092
2830	113	gene
			locus_tag	LOCUS_03030
			gene	alaS
2830	113	CDS
			product	alanine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011109057.1
			protein_id	gnl|my_center|LOCUS_03030
>Feature sequence0093
107	2542	gene
			locus_tag	LOCUS_03040
			gene	galB
107	2542	CDS
			product	beta-galactosidase GalB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202546.1
			protein_id	gnl|my_center|LOCUS_03040
>Feature sequence0094
1249	671	gene
			locus_tag	LOCUS_03050
1249	671	CDS
			product	MarC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962629.1
			protein_id	gnl|my_center|LOCUS_03050
1646	1431	gene
			locus_tag	LOCUS_03060
1646	1431	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03060
<3395	1684	gene
			locus_tag	LOCUS_03070
<3395	1684	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010919618.1:TonB-dependent receptor
>Feature sequence0095
416	1846	gene
			locus_tag	LOCUS_03080
416	1846	CDS
			product	decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963818.1
			protein_id	gnl|my_center|LOCUS_03080
2099	2308	gene
			locus_tag	LOCUS_03090
2099	2308	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03090
2960	2325	gene
			locus_tag	LOCUS_03100
2960	2325	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03100
3388	2972	gene
			locus_tag	LOCUS_03110
3388	2972	CDS
			product	sigma-70 family RNA polymerase sigma factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964036.1
			protein_id	gnl|my_center|LOCUS_03110
>Feature sequence0096
526	927	gene
			locus_tag	LOCUS_03120
526	927	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03120
949	2229	gene
			locus_tag	LOCUS_03130
949	2229	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03130
2512	2285	gene
			locus_tag	LOCUS_03140
2512	2285	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03140
>Feature sequence0097
1057	266	gene
			locus_tag	LOCUS_03150
1057	266	CDS
			product	helical backbone metal receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011403682.1
			protein_id	gnl|my_center|LOCUS_03150
2434	1076	gene
			locus_tag	LOCUS_03160
2434	1076	CDS
			product	pyridoxal-phosphate dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963328.1
			protein_id	gnl|my_center|LOCUS_03160
>Feature sequence0098
728	1588	gene
			locus_tag	LOCUS_03170
728	1588	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03170
1625	1999	gene
			locus_tag	LOCUS_03180
1625	1999	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03180
<3353	2002	gene
			locus_tag	LOCUS_03190
<3353	2002	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962270.1:ferrous iron transport protein B
>Feature sequence0099
1823	813	gene
			locus_tag	LOCUS_03200
1823	813	CDS
			product	inorganic phosphate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008766890.1
			protein_id	gnl|my_center|LOCUS_03200
2533	1886	gene
			locus_tag	LOCUS_03210
2533	1886	CDS
			product	DUF47 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963146.1
			protein_id	gnl|my_center|LOCUS_03210
>Feature sequence0100
>Feature sequence0101
<3344	2802	gene
			locus_tag	LOCUS_03220
<3344	2802	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_146602274.1:alpha/beta hydrolase-fold protein
>Feature sequence0102
<1	1053	gene
			locus_tag	LOCUS_03230
<1	1053	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein
1082	2116	gene
			locus_tag	LOCUS_03240
1082	2116	CDS
			product	type IX secretion system membrane protein PorP/SprF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962491.1
			protein_id	gnl|my_center|LOCUS_03240
>Feature sequence0103
310	1425	gene
			locus_tag	LOCUS_03250
			gene	dnaN
310	1425	CDS
			product	DNA polymerase III subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963230.1
			protein_id	gnl|my_center|LOCUS_03250
1519	2328	gene
			locus_tag	LOCUS_03260
1519	2328	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03260
2377	3078	gene
			locus_tag	LOCUS_03270
			gene	kdsB
2377	3078	CDS
			product	3-deoxy-manno-octulosonate cytidylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963128.1
			protein_id	gnl|my_center|LOCUS_03270
>Feature sequence0104
750	166	gene
			locus_tag	LOCUS_03280
750	166	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03280
2038	761	gene
			locus_tag	LOCUS_03290
2038	761	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03290
>Feature sequence0105
<1	1624	gene
			locus_tag	LOCUS_03300
<1	1624	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005804126.1:DNA-directed RNA polymerase subunit beta'
2570	2013	gene
			locus_tag	LOCUS_03310
2570	2013	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03310
2811	2689	gene
			locus_tag	LOCUS_03320
2811	2689	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03320
>Feature sequence0106
1192	2436	gene
			locus_tag	LOCUS_03330
1192	2436	CDS
			product	pitrilysin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005792023.1
			protein_id	gnl|my_center|LOCUS_03330
>Feature sequence0107
499	573	gene
			locus_tag	LOCUS_t00020
499	573	tRNA
			product	tRNA-Met
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0108
<1	770	gene
			locus_tag	LOCUS_03340
<1	770	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962384.1:radical SAM family heme chaperone HemW
995	2539	gene
			locus_tag	LOCUS_03350
995	2539	CDS
			product	magnesium chelatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405041.1
			protein_id	gnl|my_center|LOCUS_03350
<3257	2614	gene
			locus_tag	LOCUS_03360
<3257	2614	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008764912.1:aspartate kinase
>Feature sequence0109
83	637	gene
			locus_tag	LOCUS_03370
83	637	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_03370
571	1695	gene
			locus_tag	LOCUS_03380
571	1695	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03380
1771	2559	gene
			locus_tag	LOCUS_03390
1771	2559	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03390
>Feature sequence0110
>Feature sequence0111
<1	905	gene
			locus_tag	LOCUS_03400
<1	905	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_062542960.1:AAA family ATPase
892	1899	gene
			locus_tag	LOCUS_03410
892	1899	CDS
			product	DUF3871 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011203302.1
			protein_id	gnl|my_center|LOCUS_03410
2033	2716	gene
			locus_tag	LOCUS_03420
2033	2716	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03420
>Feature sequence0112
326	1315	gene
			locus_tag	LOCUS_03430
			gene	mgrA
326	1315	CDS
			product	L-glyceraldehyde 3-phosphate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098184.1
			protein_id	gnl|my_center|LOCUS_03430
<3225	1545	gene
			locus_tag	LOCUS_03440
<3225	1545	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963005.1:excinuclease ABC subunit UvrA
>Feature sequence0113
237	677	gene
			locus_tag	LOCUS_03450
237	677	CDS
			product	Hsp20/alpha crystallin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004295281.1
			protein_id	gnl|my_center|LOCUS_03450
1805	756	gene
			locus_tag	LOCUS_03460
1805	756	CDS
			product	NAD(P)-dependent alcohol dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005056643.1
			protein_id	gnl|my_center|LOCUS_03460
2996	1902	gene
			locus_tag	LOCUS_03470
2996	1902	CDS
			product	saccharopine dehydrogenase NADP-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014206885.1
			protein_id	gnl|my_center|LOCUS_03470
>Feature sequence0114
>Feature sequence0115
2115	2534	gene
			locus_tag	LOCUS_03480
2115	2534	CDS
			product	thioesterase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963339.1
			protein_id	gnl|my_center|LOCUS_03480
2950	2522	gene
			locus_tag	LOCUS_03490
2950	2522	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03490
>Feature sequence0116
>Feature sequence0117
897	355	gene
			locus_tag	LOCUS_03500
897	355	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03500
1620	1183	gene
			locus_tag	LOCUS_03510
1620	1183	CDS
			product	universal stress protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010932479.1
			protein_id	gnl|my_center|LOCUS_03510
<3187	1642	gene
			locus_tag	LOCUS_03520
<3187	1642	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962666.1:MDR family MFS transporter
>Feature sequence0118
811	407	gene
			locus_tag	LOCUS_03530
811	407	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03530
1103	1753	gene
			locus_tag	LOCUS_03540
1103	1753	CDS
			product	WbqC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783764.1
			protein_id	gnl|my_center|LOCUS_03540
>Feature sequence0119
556	1179	gene
			locus_tag	LOCUS_03550
556	1179	CDS
			product	MIP family channel protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013530368.1
			protein_id	gnl|my_center|LOCUS_03550
2124	1225	gene
			locus_tag	LOCUS_03560
2124	1225	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03560
3037	2162	gene
			locus_tag	LOCUS_03570
			gene	rfbD
3037	2162	CDS
			product	dTDP-4-dehydrorhamnose reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005786018.1
			protein_id	gnl|my_center|LOCUS_03570
>Feature sequence0120
<1	677	gene
			locus_tag	LOCUS_03580
<1	677	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011090750.1:DNA polymerase/3'-5' exonuclease PolX
<3175	881	gene
			locus_tag	LOCUS_03590
<3175	881	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_062542257.1:HAMP domain-containing sensor histidine kinase
>Feature sequence0121
2064	1072	gene
			locus_tag	LOCUS_03600
2064	1072	CDS
			product	cation diffusion facilitator family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011793101.1
			protein_id	gnl|my_center|LOCUS_03600
2504	2094	gene
			locus_tag	LOCUS_03610
2504	2094	CDS
			product	OsmC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005811690.1
			protein_id	gnl|my_center|LOCUS_03610
3171	2683	gene
			locus_tag	LOCUS_03620
3171	2683	CDS
			product	superoxide dismutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005478593.1
			protein_id	gnl|my_center|LOCUS_03620
>Feature sequence0122
455	1027	gene
			locus_tag	LOCUS_03630
455	1027	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03630
1037	1795	gene
			locus_tag	LOCUS_03640
			gene	rlmB
1037	1795	CDS
			product	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005788741.1
			protein_id	gnl|my_center|LOCUS_03640
1799	2662	gene
			locus_tag	LOCUS_03650
1799	2662	CDS
			product	hydroxymethylglutaryl-CoA lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963928.1
			protein_id	gnl|my_center|LOCUS_03650
>Feature sequence0123
288	1124	gene
			locus_tag	LOCUS_03660
			gene	tsf
288	1124	CDS
			product	translation elongation factor Ts
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962622.1
			protein_id	gnl|my_center|LOCUS_03660
1235	1951	gene
			locus_tag	LOCUS_03670
			gene	pyrH
1235	1951	CDS
			product	UMP kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962604.1
			protein_id	gnl|my_center|LOCUS_03670
>Feature sequence0124
726	319	gene
			locus_tag	LOCUS_03680
726	319	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03680
1920	1105	gene
			locus_tag	LOCUS_03690
			gene	pyrF
1920	1105	CDS
			product	orotidine-5'-phosphate decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202194.1
			protein_id	gnl|my_center|LOCUS_03690
<3145	2085	gene
			locus_tag	LOCUS_03700
<3145	2085	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_038503865.1:alpha-amylase family glycosyl hydrolase
>Feature sequence0125
1050	2504	gene
			locus_tag	LOCUS_03710
1050	2504	CDS
			product	RNase adapter RapZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107905.1
			protein_id	gnl|my_center|LOCUS_03710
2673	3056	gene
			locus_tag	LOCUS_03720
2673	3056	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03720
>Feature sequence0126
<3142	1003	gene
			locus_tag	LOCUS_03730
<3142	1003	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108195.1:SusC/RagA family TonB-linked outer membrane protein
>Feature sequence0127
<1	978	gene
			locus_tag	LOCUS_03740
<1	978	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011404813.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA
2187	991	gene
			locus_tag	LOCUS_03750
2187	991	CDS
			product	aspartate aminotransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963881.1
			protein_id	gnl|my_center|LOCUS_03750
2244	2780	gene
			locus_tag	LOCUS_03760
2244	2780	CDS
			product	gamma carbonic anhydrase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964199.1
			protein_id	gnl|my_center|LOCUS_03760
2808	3059	gene
			locus_tag	LOCUS_03770
2808	3059	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03770
>Feature sequence0128
>Feature sequence0129
1704	2297	gene
			locus_tag	LOCUS_03780
1704	2297	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03780
2887	2399	gene
			locus_tag	LOCUS_03790
			gene	cdd
2887	2399	CDS
			product	cytidine deaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762228.1
			protein_id	gnl|my_center|LOCUS_03790
>Feature sequence0130
1832	378	gene
			locus_tag	LOCUS_03800
1832	378	CDS
			product	M20 family peptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011404493.1
			protein_id	gnl|my_center|LOCUS_03800
>Feature sequence0131
479	1135	gene
			locus_tag	LOCUS_03810
			gene	mnmD
479	1135	CDS
			product	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963850.1
			protein_id	gnl|my_center|LOCUS_03810
1216	1641	gene
			locus_tag	LOCUS_03820
1216	1641	CDS
			product	nuclear transport factor 2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011070531.1
			protein_id	gnl|my_center|LOCUS_03820
1711	2619	gene
			locus_tag	LOCUS_03830
1711	2619	CDS
			product	prohibitin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962731.1
			protein_id	gnl|my_center|LOCUS_03830
>Feature sequence0132
<1	1022	gene
			locus_tag	LOCUS_03840
<1	1022	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_002287925.1:amino acid permease
2308	1349	gene
			locus_tag	LOCUS_03850
2308	1349	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03850
2883	2305	gene
			locus_tag	LOCUS_03860
			gene	def
2883	2305	CDS
			product	peptide deformylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963863.1
			protein_id	gnl|my_center|LOCUS_03860
>Feature sequence0133
102	755	gene
			locus_tag	LOCUS_03870
102	755	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03870
796	1575	gene
			locus_tag	LOCUS_03880
796	1575	CDS
			product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000167663.1
			protein_id	gnl|my_center|LOCUS_03880
2736	1699	gene
			locus_tag	LOCUS_03890
			gene	dusB
2736	1699	CDS
			product	tRNA dihydrouridine synthase DusB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964342.1
			protein_id	gnl|my_center|LOCUS_03890
>Feature sequence0134
<1	1075	gene
			locus_tag	LOCUS_03900
<1	1075	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962463.1:metallophosphoesterase
1208	1783	gene
			locus_tag	LOCUS_03910
1208	1783	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03910
1966	2706	gene
			locus_tag	LOCUS_03920
1966	2706	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, internal stop codon
			protein_id	gnl|my_center|LOCUS_03920
>Feature sequence0135
1484	765	gene
			locus_tag	LOCUS_03930
1484	765	CDS
			product	pirin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005789136.1
			protein_id	gnl|my_center|LOCUS_03930
2055	1531	gene
			locus_tag	LOCUS_03940
2055	1531	CDS
			product	MarR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962680.1
			protein_id	gnl|my_center|LOCUS_03940
<3097	2091	gene
			locus_tag	LOCUS_03950
<3097	2091	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008760775.1:peptidylprolyl isomerase
>Feature sequence0136
460	125	gene
			locus_tag	LOCUS_03960
460	125	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_03960
846	1706	gene
			locus_tag	LOCUS_03970
846	1706	CDS
			product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011268499.1
			protein_id	gnl|my_center|LOCUS_03970
>Feature sequence0137
<1	1083	gene
			locus_tag	LOCUS_03980
<1	1083	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108758.1:TonB-dependent receptor
1108	2634	gene
			locus_tag	LOCUS_03990
1108	2634	CDS
			product	RagB/SusD family nutrient uptake outer membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767524.1
			protein_id	gnl|my_center|LOCUS_03990
>Feature sequence0138
<1	1412	gene
			locus_tag	LOCUS_04000
<1	1412	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011109107.1:RagB/SusD family nutrient uptake outer membrane protein
1569	2240	gene
			locus_tag	LOCUS_04010
			gene	rhgT
1569	2240	CDS
			product	rhamnogalacturonan acetylesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003233825.1
			protein_id	gnl|my_center|LOCUS_04010
>Feature sequence0139
848	501	gene
			locus_tag	LOCUS_04020
848	501	CDS
			product	4Fe-4S dicluster domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962803.1
			protein_id	gnl|my_center|LOCUS_04020
960	1910	gene
			locus_tag	LOCUS_04030
960	1910	CDS
			product	acyl-CoA reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962802.1
			protein_id	gnl|my_center|LOCUS_04030
>Feature sequence0140
<1	2258	gene
			locus_tag	LOCUS_04040
<1	2258	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962686.1:TonB-dependent receptor
2499	2888	gene
			locus_tag	LOCUS_04050
2499	2888	CDS
			product	DUF2721 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762404.1
			protein_id	gnl|my_center|LOCUS_04050
3073	2885	gene
			locus_tag	LOCUS_04060
3073	2885	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04060
>Feature sequence0141
82	522	gene
			locus_tag	LOCUS_04070
82	522	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04070
<3069	868	gene
			locus_tag	LOCUS_04080
<3069	868	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_164926886.1:vitamin B12-dependent ribonucleotide reductase
>Feature sequence0142
137	1336	gene
			locus_tag	LOCUS_04090
137	1336	CDS
			product	glycosyltransferase family 4 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405119.1
			protein_id	gnl|my_center|LOCUS_04090
1484	2863	gene
			locus_tag	LOCUS_04100
1484	2863	CDS
			product	LutB/LldF family L-lactate oxidation iron-sulfur protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011228625.1
			protein_id	gnl|my_center|LOCUS_04100
>Feature sequence0143
>Feature sequence0144
318	1394	gene
			locus_tag	LOCUS_04110
318	1394	CDS
			product	PA0069 family radical SAM protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010958153.1
			protein_id	gnl|my_center|LOCUS_04110
1433	2347	gene
			locus_tag	LOCUS_04120
1433	2347	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04120
>Feature sequence0145
<1	764	gene
			locus_tag	LOCUS_04130
<1	764	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011391957.1:sugar kinase
819	1268	gene
			locus_tag	LOCUS_04140
819	1268	CDS
			product	YhcH/YjgK/YiaL family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008761472.1
			protein_id	gnl|my_center|LOCUS_04140
1273	1935	gene
			locus_tag	LOCUS_04150
1273	1935	CDS
			product	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005788379.1
			protein_id	gnl|my_center|LOCUS_04150
>Feature sequence0146
2739	835	gene
			locus_tag	LOCUS_04160
			gene	nuoL
2739	835	CDS
			product	NADH-quinone oxidoreductase subunit L
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964310.1
			protein_id	gnl|my_center|LOCUS_04160
>Feature sequence0147
408	1544	gene
			locus_tag	LOCUS_04170
408	1544	CDS
			product	tyrosine-type recombinase/integrase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002286587.1
			protein_id	gnl|my_center|LOCUS_04170
>Feature sequence0148
1291	2463	gene
			locus_tag	LOCUS_04180
1291	2463	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04180
>Feature sequence0149
1	417	gene
			locus_tag	LOCUS_04190
1	417	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04190
510	1058	gene
			locus_tag	LOCUS_04200
510	1058	CDS
			product	DUF1572 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963698.1
			protein_id	gnl|my_center|LOCUS_04200
1067	1732	gene
			locus_tag	LOCUS_04210
1067	1732	CDS
			product	beta-phosphoglucomutase family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164927183.1
			protein_id	gnl|my_center|LOCUS_04210
>Feature sequence0150
912	1520	gene
			locus_tag	LOCUS_04220
912	1520	CDS
			product	polysaccharide deacetylase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783668.1
			protein_id	gnl|my_center|LOCUS_04220
1693	2460	gene
			locus_tag	LOCUS_04230
1693	2460	CDS
			product	TatD family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011260929.1
			protein_id	gnl|my_center|LOCUS_04230
2543	2631	gene
			locus_tag	LOCUS_t00030
2543	2631	tRNA
			product	tRNA-Ser
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0151
406	1347	gene
			locus_tag	LOCUS_04240
406	1347	CDS
			product	DUF1080 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164921772.1
			protein_id	gnl|my_center|LOCUS_04240
2008	1505	gene
			locus_tag	LOCUS_04250
2008	1505	CDS
			product	cytidine/deoxycytidylate deaminase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032889952.1
			protein_id	gnl|my_center|LOCUS_04250
2180	2716	gene
			locus_tag	LOCUS_04260
2180	2716	CDS
			product	ORF6N domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010958442.1
			protein_id	gnl|my_center|LOCUS_04260
>Feature sequence0152
<1	584	gene
			locus_tag	LOCUS_04270
<1	584	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_014878023.1:phosphonatase-like hydrolase
723	1910	gene
			locus_tag	LOCUS_04280
723	1910	CDS
			product	DUF5690 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010918537.1
			protein_id	gnl|my_center|LOCUS_04280
>Feature sequence0153
561	1067	gene
			locus_tag	LOCUS_04290
561	1067	CDS
			product	DUF2480 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405390.1
			protein_id	gnl|my_center|LOCUS_04290
1542	1072	gene
			locus_tag	LOCUS_04300
1542	1072	CDS
			product	nuclear transport factor 2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011266812.1
			protein_id	gnl|my_center|LOCUS_04300
2979	1552	gene
			locus_tag	LOCUS_04310
2979	1552	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04310
>Feature sequence0154
<1	1903	gene
			locus_tag	LOCUS_04320
<1	1903	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005791861.1:DNA helicase RecQ
2102	2356	gene
			locus_tag	LOCUS_04330
2102	2356	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04330
<2973	2407	gene
			locus_tag	LOCUS_04340
<2973	2407	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010918560.1:DUF3089 domain-containing protein
>Feature sequence0155
720	232	gene
			locus_tag	LOCUS_04350
720	232	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04350
808	2238	gene
			locus_tag	LOCUS_04360
808	2238	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04360
<2969	2334	gene
			locus_tag	LOCUS_04370
<2969	2334	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000347004.1:DMT family transporter
>Feature sequence0156
2418	1	gene
			locus_tag	LOCUS_04380
2418	1	CDS
			product	Plug domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008658068.1
			protein_id	gnl|my_center|LOCUS_04380
>Feature sequence0157
383	69	gene
			locus_tag	LOCUS_04390
			gene	nuoK
383	69	CDS
			product	NADH-quinone oxidoreductase subunit NuoK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011140654.1
			protein_id	gnl|my_center|LOCUS_04390
767	504	gene
			locus_tag	LOCUS_04400
767	504	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_04400
1141	911	gene
			locus_tag	LOCUS_04410
1141	911	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_04410
1434	1135	gene
			locus_tag	LOCUS_04420
1434	1135	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_04420
1910	1434	gene
			locus_tag	LOCUS_04430
1910	1434	CDS
			product	4Fe-4S dicluster domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005785046.1
			protein_id	gnl|my_center|LOCUS_04430
<2958	2017	gene
			locus_tag	LOCUS_04440
<2958	2017	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005785048.1:NADH-quinone oxidoreductase subunit NuoH
>Feature sequence0158
<1	794	gene
			locus_tag	LOCUS_04450
<1	794	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963032.1:single-stranded-DNA-specific exonuclease RecJ
2762	867	gene
			locus_tag	LOCUS_04460
			gene	htpG
2762	867	CDS
			product	molecular chaperone HtpG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202859.1
			protein_id	gnl|my_center|LOCUS_04460
>Feature sequence0159
<1	1793	gene
			locus_tag	LOCUS_04470
<1	1793	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein
2629	1814	gene
			locus_tag	LOCUS_04480
2629	1814	CDS
			product	glycosyltransferase family A protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010942157.1
			protein_id	gnl|my_center|LOCUS_04480
>Feature sequence0160
1121	2146	gene
			locus_tag	LOCUS_04490
			gene	hemH
1121	2146	CDS
			product	ferrochelatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962227.1
			protein_id	gnl|my_center|LOCUS_04490
2209	2757	gene
			locus_tag	LOCUS_04500
2209	2757	CDS
			product	CopD family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962228.1
			protein_id	gnl|my_center|LOCUS_04500
>Feature sequence0161
781	1770	gene
			locus_tag	LOCUS_04510
			gene	pfkA
781	1770	CDS
			product	6-phosphofructokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963726.1
			protein_id	gnl|my_center|LOCUS_04510
>Feature sequence0162
261	1433	gene
			locus_tag	LOCUS_04520
261	1433	CDS
			product	c-type cytochrome
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962543.1
			protein_id	gnl|my_center|LOCUS_04520
>Feature sequence0163
2306	1011	gene
			locus_tag	LOCUS_04530
2306	1011	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04530
<2931	2381	gene
			locus_tag	LOCUS_04540
<2931	2381	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_164926800.1:peptide-methionine (R)-S-oxide reductase MsrB
>Feature sequence0164
2839	386	gene
			locus_tag	LOCUS_04550
2839	386	CDS
			product	DUF5686 and carboxypeptidase regulatory-like domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964117.1
			protein_id	gnl|my_center|LOCUS_04550
>Feature sequence0165
82	2457	gene
			locus_tag	LOCUS_04560
82	2457	CDS
			product	NADP-dependent malic enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964222.1
			protein_id	gnl|my_center|LOCUS_04560
>Feature sequence0166
2178	157	gene
			locus_tag	LOCUS_04570
2178	157	CDS
			product	M13 family metallopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005814533.1
			protein_id	gnl|my_center|LOCUS_04570
>Feature sequence0167
118	2115	gene
			locus_tag	LOCUS_04580
118	2115	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04580
<2909	2121	gene
			locus_tag	LOCUS_04590
<2909	2121	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962994.1:histidine ammonia-lyase
>Feature sequence0168
>Feature sequence0169
1412	756	gene
			locus_tag	LOCUS_04600
1412	756	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04600
1649	2572	gene
			locus_tag	LOCUS_04610
1649	2572	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04610
>Feature sequence0170
1536	31	gene
			locus_tag	LOCUS_04620
1536	31	CDS
			product	GH3 auxin-responsive promoter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767560.1
			protein_id	gnl|my_center|LOCUS_04620
2386	1580	gene
			locus_tag	LOCUS_04630
			gene	lptB
2386	1580	CDS
			product	LPS export ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963369.1
			protein_id	gnl|my_center|LOCUS_04630
>Feature sequence0171
<1	2369	gene
			locus_tag	LOCUS_04640
<1	2369	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203176.1:SusC/RagA family TonB-linked outer membrane protein
>Feature sequence0172
2595	1486	gene
			locus_tag	LOCUS_04650
2595	1486	CDS
			product	efflux RND transporter periplasmic adaptor subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963917.1
			protein_id	gnl|my_center|LOCUS_04650
>Feature sequence0173
2	376	gene
			locus_tag	LOCUS_04660
2	376	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04660
467	2335	gene
			locus_tag	LOCUS_04670
467	2335	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04670
>Feature sequence0174
865	212	gene
			locus_tag	LOCUS_04680
			gene	fsa
865	212	CDS
			product	fructose-6-phosphate aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107927.1
			protein_id	gnl|my_center|LOCUS_04680
1398	2243	gene
			locus_tag	LOCUS_04690
			gene	panC
1398	2243	CDS
			product	pantoate--beta-alanine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011336964.1
			protein_id	gnl|my_center|LOCUS_04690
>Feature sequence0175
2420	867	gene
			locus_tag	LOCUS_04700
2420	867	CDS
			product	cellulase family glycosylhydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010920215.1
			protein_id	gnl|my_center|LOCUS_04700
>Feature sequence0176
1158	187	gene
			locus_tag	LOCUS_04710
1158	187	CDS
			product	ribonucleotide-diphosphate reductase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962627.1
			protein_id	gnl|my_center|LOCUS_04710
2043	1609	gene
			locus_tag	LOCUS_04720
			gene	ribH
2043	1609	CDS
			product	6,7-dimethyl-8-ribityllumazine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010957715.1
			protein_id	gnl|my_center|LOCUS_04720
<2847	2040	gene
			locus_tag	LOCUS_04730
<2847	2040	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010880177.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
>Feature sequence0177
486	1535	gene
			locus_tag	LOCUS_04740
486	1535	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04740
1729	2244	gene
			locus_tag	LOCUS_04750
1729	2244	CDS
			product	DUF421 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962904.1
			protein_id	gnl|my_center|LOCUS_04750
2841	2317	gene
			locus_tag	LOCUS_04760
2841	2317	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04760
>Feature sequence0178
158	391	gene
			locus_tag	LOCUS_04770
158	391	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04770
393	1313	gene
			locus_tag	LOCUS_04780
393	1313	CDS
			product	PstS family phosphate ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005803239.1
			protein_id	gnl|my_center|LOCUS_04780
>Feature sequence0179
2540	348	gene
			locus_tag	LOCUS_04790
2540	348	CDS
			product	glutamine synthetase III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962708.1
			protein_id	gnl|my_center|LOCUS_04790
>Feature sequence0180
982	539	gene
			locus_tag	LOCUS_04800
982	539	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04800
2092	992	gene
			locus_tag	LOCUS_04810
2092	992	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04810
>Feature sequence0181
677	2374	gene
			locus_tag	LOCUS_04820
			gene	kdpA
677	2374	CDS
			product	potassium-transporting ATPase subunit KdpA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963802.1
			protein_id	gnl|my_center|LOCUS_04820
>Feature sequence0182
39	365	gene
			locus_tag	LOCUS_04830
39	365	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04830
1835	447	gene
			locus_tag	LOCUS_04840
1835	447	CDS
			product	tyrosine phenol-lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012256475.1
			protein_id	gnl|my_center|LOCUS_04840
>Feature sequence0183
1163	96	gene
			locus_tag	LOCUS_04850
1163	96	CDS
			product	DUF4974 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765463.1
			protein_id	gnl|my_center|LOCUS_04850
1826	1338	gene
			locus_tag	LOCUS_04860
1826	1338	CDS
			product	RNA polymerase sigma-70 factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011108164.1
			protein_id	gnl|my_center|LOCUS_04860
2113	2039	gene
			locus_tag	LOCUS_t00040
2113	2039	tRNA
			product	tRNA-Ala
			inference	COORDINATES:profile:Aragorn:1.2.38
2611	2261	gene
			locus_tag	LOCUS_04870
2611	2261	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04870
>Feature sequence0184
1091	1384	gene
			locus_tag	LOCUS_04880
1091	1384	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04880
1368	1805	gene
			locus_tag	LOCUS_04890
1368	1805	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04890
1885	2463	gene
			locus_tag	LOCUS_04900
1885	2463	CDS
			product	alkylphosphonate utilization protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962319.1
			protein_id	gnl|my_center|LOCUS_04900
>Feature sequence0185
431	1207	gene
			locus_tag	LOCUS_04910
431	1207	CDS
			product	LytTR family DNA-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963635.1
			protein_id	gnl|my_center|LOCUS_04910
>Feature sequence0186
541	1425	gene
			locus_tag	LOCUS_04920
541	1425	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04920
1521	1994	gene
			locus_tag	LOCUS_04930
1521	1994	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04930
2591	2163	gene
			locus_tag	LOCUS_04940
2591	2163	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007331629.1
			protein_id	gnl|my_center|LOCUS_04940
>Feature sequence0187
531	1304	gene
			locus_tag	LOCUS_04950
531	1304	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04950
2127	1672	gene
			locus_tag	LOCUS_04960
2127	1672	CDS
			product	DUF3368 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010878102.1
			protein_id	gnl|my_center|LOCUS_04960
2347	2120	gene
			locus_tag	LOCUS_04970
2347	2120	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_04970
>Feature sequence0188
533	1372	gene
			locus_tag	LOCUS_04980
533	1372	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202688.1
			protein_id	gnl|my_center|LOCUS_04980
<2797	1373	gene
			locus_tag	LOCUS_04990
<2797	1373	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_007334319.1:ATP-binding protein
>Feature sequence0189
144	1142	gene
			locus_tag	LOCUS_05000
			gene	mutY
144	1142	CDS
			product	A/G-specific adenine glycosylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_009291960.1
			protein_id	gnl|my_center|LOCUS_05000
2560	1208	gene
			locus_tag	LOCUS_05010
			gene	gdhA
2560	1208	CDS
			product	NADP-specific glutamate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962445.1
			protein_id	gnl|my_center|LOCUS_05010
>Feature sequence0190
<1	1199	gene
			locus_tag	LOCUS_05020
<1	1199	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008763738.1:potassium-transporting ATPase subunit KdpB
1229	1792	gene
			locus_tag	LOCUS_05030
1229	1792	CDS
			product	K(+)-transporting ATPase subunit C
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963800.1
			protein_id	gnl|my_center|LOCUS_05030
>Feature sequence0191
1913	660	gene
			locus_tag	LOCUS_05040
1913	660	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05040
<2761	1918	gene
			locus_tag	LOCUS_05050
<2761	1918	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963036.1:CusA/CzcA family heavy metal efflux RND transporter
>Feature sequence0192
832	2016	gene
			locus_tag	LOCUS_05060
832	2016	CDS
			product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_024118841.1
			protein_id	gnl|my_center|LOCUS_05060
>Feature sequence0193
683	54	gene
			locus_tag	LOCUS_05070
683	54	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05070
1306	680	gene
			locus_tag	LOCUS_05080
1306	680	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05080
2022	1354	gene
			locus_tag	LOCUS_05090
2022	1354	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05090
2303	2019	gene
			locus_tag	LOCUS_05100
2303	2019	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05100
>Feature sequence0194
1883	696	gene
			locus_tag	LOCUS_05110
			gene	kbl
1883	696	CDS
			product	glycine C-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962334.1
			protein_id	gnl|my_center|LOCUS_05110
<2749	1990	gene
			locus_tag	LOCUS_05120
<2749	1990	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_164921709.1:cyclic dehypoxanthinyl futalosine synthase
>Feature sequence0195
>Feature sequence0196
136	723	gene
			locus_tag	LOCUS_05130
136	723	CDS
			product	carboxymuconolactone decarboxylase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164921658.1
			protein_id	gnl|my_center|LOCUS_05130
1226	765	gene
			locus_tag	LOCUS_05140
1226	765	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05140
2394	1300	gene
			locus_tag	LOCUS_05150
2394	1300	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05150
>Feature sequence0197
1483	122	gene
			locus_tag	LOCUS_05160
1483	122	CDS
			product	Gfo/Idh/MocA family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763947.1
			protein_id	gnl|my_center|LOCUS_05160
1881	2132	gene
			locus_tag	LOCUS_05170
1881	2132	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05170
>Feature sequence0198
431	817	gene
			locus_tag	LOCUS_05180
431	817	CDS
			product	RidA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962909.1
			protein_id	gnl|my_center|LOCUS_05180
1999	857	gene
			locus_tag	LOCUS_05190
			gene	galK
1999	857	CDS
			product	galactokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005800633.1
			protein_id	gnl|my_center|LOCUS_05190
<2728	2121	gene
			locus_tag	LOCUS_05200
<2728	2121	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_015909272.1:UDP-glucose--hexose-1-phosphate uridylyltransferase
>Feature sequence0199
1271	1615	gene
			locus_tag	LOCUS_05210
1271	1615	CDS
			product	aspartate 1-decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008759980.1
			protein_id	gnl|my_center|LOCUS_05210
<2727	1902	gene
			locus_tag	LOCUS_05220
<2727	1902	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003100622.1:Fe-S protein assembly chaperone HscA
>Feature sequence0200
2283	748	gene
			locus_tag	LOCUS_05230
2283	748	CDS
			product	alpha-L-arabinofuranosidase C-terminal domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107210.1
			protein_id	gnl|my_center|LOCUS_05230
>Feature sequence0201
1257	439	gene
			locus_tag	LOCUS_05240
1257	439	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05240
1339	1779	gene
			locus_tag	LOCUS_05250
1339	1779	CDS
			product	MarR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005790948.1
			protein_id	gnl|my_center|LOCUS_05250
>Feature sequence0202
1689	241	gene
			locus_tag	LOCUS_05260
1689	241	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05260
<2718	1731	gene
			locus_tag	LOCUS_05270
<2718	1731	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005791295.1:glucoamylase family protein
>Feature sequence0203
345	2579	gene
			locus_tag	LOCUS_05280
345	2579	CDS
			product	penicillin acylase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010919006.1
			protein_id	gnl|my_center|LOCUS_05280
>Feature sequence0204
525	824	gene
			locus_tag	LOCUS_05290
			gene	rplW
525	824	CDS
			product	50S ribosomal protein L23
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007747932.1
			protein_id	gnl|my_center|LOCUS_05290
868	1707	gene
			locus_tag	LOCUS_05300
			gene	rplB
868	1707	CDS
			product	50S ribosomal protein L2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791545.1
			protein_id	gnl|my_center|LOCUS_05300
1811	2080	gene
			locus_tag	LOCUS_05310
			gene	rpsS
1811	2080	CDS
			product	30S ribosomal protein S19
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005782197.1
			protein_id	gnl|my_center|LOCUS_05310
2144	2497	gene
			locus_tag	LOCUS_05320
			gene	rplV
2144	2497	CDS
			product	50S ribosomal protein L22
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002558069.1
			protein_id	gnl|my_center|LOCUS_05320
>Feature sequence0205
457	1290	gene
			locus_tag	LOCUS_05330
457	1290	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05330
1884	1279	gene
			locus_tag	LOCUS_05340
1884	1279	CDS
			product	ribonuclease HII
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763678.1
			protein_id	gnl|my_center|LOCUS_05340
>Feature sequence0206
<1	752	gene
			locus_tag	LOCUS_05350
<1	752	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962426.1:prephenate dehydratase
859	2013	gene
			locus_tag	LOCUS_05360
859	2013	CDS
			product	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962425.1
			protein_id	gnl|my_center|LOCUS_05360
>Feature sequence0207
589	1071	gene
			locus_tag	LOCUS_05370
589	1071	CDS
			product	hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003978113.1
			note	possible pseudo, internal stop codon
			protein_id	gnl|my_center|LOCUS_05370
2255	1344	gene
			locus_tag	LOCUS_05380
2255	1344	CDS
			product	IS3 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765456.1
			protein_id	gnl|my_center|LOCUS_05380
2620	2252	gene
			locus_tag	LOCUS_05390
2620	2252	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05390
>Feature sequence0208
884	204	gene
			locus_tag	LOCUS_05400
884	204	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05400
990	2477	gene
			locus_tag	LOCUS_05410
990	2477	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05410
2517	2588	gene
			locus_tag	LOCUS_t00050
2517	2588	tRNA
			product	tRNA-Cys
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0209
433	1608	gene
			locus_tag	LOCUS_05420
433	1608	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05420
>Feature sequence0210
<1	1790	gene
			locus_tag	LOCUS_05430
<1	1790	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963765.1:TonB-dependent receptor
>Feature sequence0211
>Feature sequence0212
<2649	1927	gene
			locus_tag	LOCUS_05440
<2649	1927	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_067544393.1:VCBS repeat-containing protein
>Feature sequence0213
132	428	gene
			locus_tag	LOCUS_05450
132	428	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05450
522	1031	gene
			locus_tag	LOCUS_05460
522	1031	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05460
1128	2057	gene
			locus_tag	LOCUS_05470
			gene	mdh
1128	2057	CDS
			product	malate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760830.1
			protein_id	gnl|my_center|LOCUS_05470
>Feature sequence0214
2427	1051	gene
			locus_tag	LOCUS_05480
2427	1051	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05480
>Feature sequence0215
899	234	gene
			locus_tag	LOCUS_05490
899	234	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05490
2018	1062	gene
			locus_tag	LOCUS_05500
2018	1062	CDS
			product	potassium channel protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012546063.1
			protein_id	gnl|my_center|LOCUS_05500
2181	2615	gene
			locus_tag	LOCUS_05510
2181	2615	CDS
			product	FKBP-type peptidyl-prolyl cis-trans isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011071597.1
			protein_id	gnl|my_center|LOCUS_05510
>Feature sequence0216
1573	2337	gene
			locus_tag	LOCUS_05520
			gene	cobA
1573	2337	CDS
			product	uroporphyrinogen-III C-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_064496681.1
			protein_id	gnl|my_center|LOCUS_05520
>Feature sequence0217
62	595	gene
			locus_tag	LOCUS_05530
62	595	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05530
1190	1792	gene
			locus_tag	LOCUS_05540
1190	1792	CDS
			product	Crp/Fnr family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010966608.1
			protein_id	gnl|my_center|LOCUS_05540
1896	2366	gene
			locus_tag	LOCUS_05550
1896	2366	CDS
			product	cupin domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_167278068.1
			protein_id	gnl|my_center|LOCUS_05550
>Feature sequence0218
314	108	gene
			locus_tag	LOCUS_05560
314	108	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05560
999	295	gene
			locus_tag	LOCUS_05570
			gene	trmB
999	295	CDS
			product	tRNA (guanosine(46)-N7)-methyltransferase TrmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962539.1
			protein_id	gnl|my_center|LOCUS_05570
1397	1870	gene
			locus_tag	LOCUS_05580
1397	1870	CDS
			product	Lrp/AsnC ligand binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003359806.1
			protein_id	gnl|my_center|LOCUS_05580
>Feature sequence0219
<1	648	gene
			locus_tag	LOCUS_05590
<1	648	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_023175504.1:amidohydrolase family protein
2333	720	gene
			locus_tag	LOCUS_05600
			gene	rho
2333	720	CDS
			product	transcription termination factor Rho
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962876.1
			protein_id	gnl|my_center|LOCUS_05600
>Feature sequence0220
>Feature sequence0221
862	11	gene
			locus_tag	LOCUS_05610
862	11	CDS
			product	aldo/keto reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001174466.1
			protein_id	gnl|my_center|LOCUS_05610
1018	1914	gene
			locus_tag	LOCUS_05620
1018	1914	CDS
			product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765597.1
			protein_id	gnl|my_center|LOCUS_05620
>Feature sequence0222
320	1573	gene
			locus_tag	LOCUS_05630
320	1573	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05630
>Feature sequence0223
965	432	gene
			locus_tag	LOCUS_05640
965	432	CDS
			product	CAP domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012546171.1
			protein_id	gnl|my_center|LOCUS_05640
2604	1102	gene
			locus_tag	LOCUS_05650
2604	1102	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05650
>Feature sequence0224
109	180	gene
			locus_tag	LOCUS_t00060
109	180	tRNA
			product	tRNA-Gln
			inference	COORDINATES:profile:Aragorn:1.2.38
570	803	gene
			locus_tag	LOCUS_05660
570	803	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05660
811	2130	gene
			locus_tag	LOCUS_05670
811	2130	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05670
>Feature sequence0225
>Feature sequence0226
<1	502	gene
			locus_tag	LOCUS_05680
<1	502	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962841.1:serine hydroxymethyltransferase
532	954	gene
			locus_tag	LOCUS_05690
532	954	CDS
			product	DUF4293 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005788196.1
			protein_id	gnl|my_center|LOCUS_05690
2398	1049	gene
			locus_tag	LOCUS_05700
2398	1049	CDS
			product	M20/M25/M40 family metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013222156.1
			protein_id	gnl|my_center|LOCUS_05700
>Feature sequence0227
<1	1196	gene
			locus_tag	LOCUS_05710
<1	1196	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_062695564.1:family 20 glycosylhydrolase
2339	1314	gene
			locus_tag	LOCUS_05720
			gene	lpxD
2339	1314	CDS
			product	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963125.1
			protein_id	gnl|my_center|LOCUS_05720
2573	2427	gene
			locus_tag	LOCUS_05730
2573	2427	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05730
>Feature sequence0228
509	1036	gene
			locus_tag	LOCUS_05740
509	1036	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05740
1040	1207	gene
			locus_tag	LOCUS_05750
1040	1207	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05750
2251	1211	gene
			locus_tag	LOCUS_05760
			gene	murB
2251	1211	CDS
			product	UDP-N-acetylmuramate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964097.1
			protein_id	gnl|my_center|LOCUS_05760
>Feature sequence0229
3	1181	gene
			locus_tag	LOCUS_05770
3	1181	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05770
1394	2425	gene
			locus_tag	LOCUS_05780
1394	2425	CDS
			product	2-oxoacid:ferredoxin oxidoreductase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010931856.1
			protein_id	gnl|my_center|LOCUS_05780
>Feature sequence0230
1759	413	gene
			locus_tag	LOCUS_05790
1759	413	CDS
			product	MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005814920.1
			protein_id	gnl|my_center|LOCUS_05790
<2558	1846	gene
			locus_tag	LOCUS_05800
<2558	1846	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011144244.1:glucose-1-phosphate adenylyltransferase
>Feature sequence0231
287	826	gene
			locus_tag	LOCUS_05810
287	826	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05810
1112	1723	gene
			locus_tag	LOCUS_05820
1112	1723	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05820
1909	2382	gene
			locus_tag	LOCUS_05830
1909	2382	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05830
>Feature sequence0232
<1	2187	gene
			locus_tag	LOCUS_05840
<1	2187	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000955702.1:alpha-L-rhamnosidase
>Feature sequence0233
823	206	gene
			locus_tag	LOCUS_05850
823	206	CDS
			product	IMPACT family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002255036.1
			protein_id	gnl|my_center|LOCUS_05850
881	1738	gene
			locus_tag	LOCUS_05860
			gene	prmC
881	1738	CDS
			product	peptide chain release factor N(5)-glutamine methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964123.1
			protein_id	gnl|my_center|LOCUS_05860
>Feature sequence0234
<2534	1643	gene
			locus_tag	LOCUS_05870
<2534	1643	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_014208048.1:glycosyltransferase
>Feature sequence0235
20	1003	gene
			locus_tag	LOCUS_05880
20	1003	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05880
1055	1714	gene
			locus_tag	LOCUS_05890
			gene	purQ
1055	1714	CDS
			product	phosphoribosylformylglycinamidine synthase subunit PurQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011393545.1
			protein_id	gnl|my_center|LOCUS_05890
1808	2257	gene
			locus_tag	LOCUS_05900
1808	2257	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05900
>Feature sequence0236
393	662	gene
			locus_tag	LOCUS_05910
393	662	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05910
877	2100	gene
			locus_tag	LOCUS_05920
877	2100	CDS
			product	acetyl-CoA C-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962929.1
			protein_id	gnl|my_center|LOCUS_05920
>Feature sequence0237
614	1843	gene
			locus_tag	LOCUS_05930
614	1843	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_05930
2317	1928	gene
			locus_tag	LOCUS_05940
2317	1928	CDS
			product	SET domain-containing protein-lysine N-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011021683.1
			protein_id	gnl|my_center|LOCUS_05940
>Feature sequence0238
564	848	gene
			locus_tag	LOCUS_05950
564	848	CDS
			product	type II toxin-antitoxin system RelE/ParE family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000605676.1
			protein_id	gnl|my_center|LOCUS_05950
874	1170	gene
			locus_tag	LOCUS_05960
874	1170	CDS
			product	HigA family addiction module antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_103019402.1
			protein_id	gnl|my_center|LOCUS_05960
>Feature sequence0239
<1	2006	gene
			locus_tag	LOCUS_05970
<1	2006	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202161.1:glycoside hydrolase family 3 C-terminal domain-containing protein
>Feature sequence0240
>Feature sequence0241
299	1096	gene
			locus_tag	LOCUS_05980
299	1096	CDS
			product	uroporphyrinogen-III synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962359.1
			protein_id	gnl|my_center|LOCUS_05980
>Feature sequence0242
818	114	gene
			locus_tag	LOCUS_05990
818	114	CDS
			product	L-ribulose-5-phosphate 4-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002287284.1
			protein_id	gnl|my_center|LOCUS_05990
<2505	863	gene
			locus_tag	LOCUS_06000
<2505	863	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005460432.1:ribulokinase
>Feature sequence0243
<1	2033	gene
			locus_tag	LOCUS_06010
<1	2033	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963875.1:ATP-dependent chaperone ClpB
>Feature sequence0244
1376	810	gene
			locus_tag	LOCUS_06020
1376	810	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06020
2310	1561	gene
			locus_tag	LOCUS_06030
2310	1561	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06030
>Feature sequence0245
2326	827	gene
			locus_tag	LOCUS_06040
2326	827	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06040
>Feature sequence0246
>Feature sequence0247
1863	850	gene
			locus_tag	LOCUS_06050
1863	850	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06050
>Feature sequence0248
>Feature sequence0249
>Feature sequence0250
<1	735	gene
			locus_tag	LOCUS_06060
<1	735	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_027480088.1:PfkB family carbohydrate kinase
904	1815	gene
			locus_tag	LOCUS_06070
904	1815	CDS
			product	pseudouridine-5'-phosphate glycosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011948816.1
			protein_id	gnl|my_center|LOCUS_06070
>Feature sequence0251
<1	791	gene
			locus_tag	LOCUS_06080
<1	791	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963331.1:SusC/RagA family TonB-linked outer membrane protein
825	2393	gene
			locus_tag	LOCUS_06090
825	2393	CDS
			product	SusD/RagB family nutrient-binding outer membrane lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_100991023.1
			protein_id	gnl|my_center|LOCUS_06090
>Feature sequence0252
<1	596	gene
			locus_tag	LOCUS_06100
<1	596	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010919999.1:homocysteine S-methyltransferase family protein
638	1018	gene
			locus_tag	LOCUS_06110
638	1018	CDS
			product	GxxExxY protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_035636367.1
			protein_id	gnl|my_center|LOCUS_06110
>Feature sequence0253
<1	1499	gene
			locus_tag	LOCUS_06120
<1	1499	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963090.1:acetate--CoA ligase
<2467	1936	gene
			locus_tag	LOCUS_06130
<2467	1936	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011986707.1:oligopeptide transporter, OPT family
>Feature sequence0254
2	400	gene
			locus_tag	LOCUS_06140
2	400	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06140
1366	455	gene
			locus_tag	LOCUS_06150
1366	455	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06150
2380	1370	gene
			locus_tag	LOCUS_06160
2380	1370	CDS
			product	bifunctional oligoribonuclease/PAP phosphatase NrnA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963997.1
			protein_id	gnl|my_center|LOCUS_06160
>Feature sequence0255
>Feature sequence0256
>Feature sequence0257
>Feature sequence0258
8	95	gene
			locus_tag	LOCUS_t00070
8	95	tRNA
			product	tRNA-Ser
			inference	COORDINATES:profile:Aragorn:1.2.38
118	192	gene
			locus_tag	LOCUS_t00080
118	192	tRNA
			product	tRNA-Pro
			inference	COORDINATES:profile:Aragorn:1.2.38
488	1756	gene
			locus_tag	LOCUS_06170
488	1756	CDS
			product	site-specific integrase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_016362010.1
			protein_id	gnl|my_center|LOCUS_06170
>Feature sequence0259
1377	67	gene
			locus_tag	LOCUS_06180
			gene	gntT
1377	67	CDS
			product	gluconate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005174795.1
			protein_id	gnl|my_center|LOCUS_06180
1529	2434	gene
			locus_tag	LOCUS_06190
			gene	gnd
1529	2434	CDS
			product	decarboxylating 6-phosphogluconate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001195924.1
			protein_id	gnl|my_center|LOCUS_06190
>Feature sequence0260
>Feature sequence0261
2145	1135	gene
			locus_tag	LOCUS_06200
2145	1135	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06200
>Feature sequence0262
>Feature sequence0263
<1	1027	gene
			locus_tag	LOCUS_06210
<1	1027	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963618.1:outer membrane beta-barrel family protein
2067	1078	gene
			locus_tag	LOCUS_06220
2067	1078	CDS
			product	glycosyltransferase family 9 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010933791.1
			protein_id	gnl|my_center|LOCUS_06220
>Feature sequence0264
1089	190	gene
			locus_tag	LOCUS_06230
			gene	rbsK
1089	190	CDS
			product	ribokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008761960.1
			protein_id	gnl|my_center|LOCUS_06230
<2445	1140	gene
			locus_tag	LOCUS_06240
<2445	1140	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_004082285.1:glycoside hydrolase family 5 protein
>Feature sequence0265
81	680	gene
			locus_tag	LOCUS_06250
81	680	CDS
			product	NifU family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011391278.1
			protein_id	gnl|my_center|LOCUS_06250
797	1903	gene
			locus_tag	LOCUS_06260
797	1903	CDS
			product	DUF2891 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164922099.1
			protein_id	gnl|my_center|LOCUS_06260
1912	2046	gene
			locus_tag	LOCUS_06270
1912	2046	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06270
>Feature sequence0266
1437	1985	gene
			locus_tag	LOCUS_06280
1437	1985	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06280
>Feature sequence0267
177	884	gene
			locus_tag	LOCUS_06290
177	884	CDS
			product	sulfite exporter TauE/SafE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963299.1
			protein_id	gnl|my_center|LOCUS_06290
1207	1055	gene
			locus_tag	LOCUS_06300
1207	1055	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06300
1418	1146	gene
			locus_tag	LOCUS_06310
1418	1146	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06310
1979	1602	gene
			locus_tag	LOCUS_06320
			gene	gcvH
1979	1602	CDS
			product	glycine cleavage system protein GcvH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964219.1
			protein_id	gnl|my_center|LOCUS_06320
>Feature sequence0268
>Feature sequence0269
<1	2236	gene
			locus_tag	LOCUS_06330
<1	2236	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107207.1:alpha-xylosidase
>Feature sequence0270
>Feature sequence0271
439	1482	gene
			locus_tag	LOCUS_06340
439	1482	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06340
2039	1518	gene
			locus_tag	LOCUS_06350
2039	1518	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06350
>Feature sequence0272
1855	551	gene
			locus_tag	LOCUS_06360
			gene	murA
1855	551	CDS
			product	UDP-N-acetylglucosamine 1-carboxyvinyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011108085.1
			protein_id	gnl|my_center|LOCUS_06360
>Feature sequence0273
<1	1996	gene
			locus_tag	LOCUS_06370
<1	1996	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010939362.1:DEAD/DEAH box helicase
>Feature sequence0274
2265	1558	gene
			locus_tag	LOCUS_06380
2265	1558	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, internal stop codon
			protein_id	gnl|my_center|LOCUS_06380
>Feature sequence0275
>Feature sequence0276
<1	651	gene
			locus_tag	LOCUS_06390
<1	651	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011460659.1:dihydroorotase
666	1178	gene
			locus_tag	LOCUS_06400
666	1178	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06400
1181	2122	gene
			locus_tag	LOCUS_06410
1181	2122	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963275.1
			protein_id	gnl|my_center|LOCUS_06410
>Feature sequence0277
458	96	gene
			locus_tag	LOCUS_06420
458	96	CDS
			product	gamma-glutamylcyclotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015444506.1
			protein_id	gnl|my_center|LOCUS_06420
<2372	495	gene
			locus_tag	LOCUS_06430
<2372	495	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202920.1:phenylalanine--tRNA ligase subunit beta
>Feature sequence0278
38	283	gene
			locus_tag	LOCUS_06440
38	283	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06440
300	1355	gene
			locus_tag	LOCUS_06450
			gene	rhaT
300	1355	CDS
			product	L-rhamnose/proton symporter RhaT
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008762702.1
			protein_id	gnl|my_center|LOCUS_06450
>Feature sequence0279
<1	943	gene
			locus_tag	LOCUS_06460
<1	943	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011404453.1:tryptophanase
1502	1002	gene
			locus_tag	LOCUS_06470
1502	1002	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06470
2258	1569	gene
			locus_tag	LOCUS_06480
2258	1569	CDS
			product	HTH domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001079938.1
			protein_id	gnl|my_center|LOCUS_06480
>Feature sequence0280
>Feature sequence0281
<1	923	gene
			locus_tag	LOCUS_06490
<1	923	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010957692.1:acyltransferase
1012	1476	gene
			locus_tag	LOCUS_06500
1012	1476	CDS
			product	methylglyoxal synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012583226.1
			protein_id	gnl|my_center|LOCUS_06500
1469	1969	gene
			locus_tag	LOCUS_06510
1469	1969	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107442.1
			protein_id	gnl|my_center|LOCUS_06510
>Feature sequence0282
<2345	488	gene
			locus_tag	LOCUS_06520
<2345	488	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_002682106.1:DUF4954 family protein
>Feature sequence0283
460	1125	gene
			locus_tag	LOCUS_06530
460	1125	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000695801.1
			protein_id	gnl|my_center|LOCUS_06530
1673	1347	gene
			locus_tag	LOCUS_06540
1673	1347	CDS
			product	CHY zinc finger protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405189.1
			protein_id	gnl|my_center|LOCUS_06540
<2339	1676	gene
			locus_tag	LOCUS_06550
<2339	1676	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963204.1:adenine deaminase
>Feature sequence0284
<1	1279	gene
			locus_tag	LOCUS_06560
<1	1279	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964161.1:penicillin-binding protein
>Feature sequence0285
1921	248	gene
			locus_tag	LOCUS_06570
1921	248	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06570
>Feature sequence0286
<2324	213	gene
			locus_tag	LOCUS_06580
<2324	213	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963906.1:YfhO family protein
>Feature sequence0287
147	1280	gene
			locus_tag	LOCUS_06590
147	1280	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963909.1
			protein_id	gnl|my_center|LOCUS_06590
2315	1281	gene
			locus_tag	LOCUS_06600
2315	1281	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06600
>Feature sequence0288
<2321	276	gene
			locus_tag	LOCUS_06610
<2321	276	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_009195517.1:ABC transporter permease
>Feature sequence0289
1329	244	gene
			locus_tag	LOCUS_06620
1329	244	CDS
			product	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791103.1
			protein_id	gnl|my_center|LOCUS_06620
<2310	1374	gene
			locus_tag	LOCUS_06630
<2310	1374	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108753.1:DEAD/DEAH box helicase
>Feature sequence0290
>Feature sequence0291
371	976	gene
			locus_tag	LOCUS_06640
371	976	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06640
985	1542	gene
			locus_tag	LOCUS_06650
985	1542	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06650
2283	1546	gene
			locus_tag	LOCUS_06660
2283	1546	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06660
>Feature sequence0292
<2307	475	gene
			locus_tag	LOCUS_06670
<2307	475	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005783920.1:translation initiation factor IF-2
>Feature sequence0293
1157	360	gene
			locus_tag	LOCUS_06680
1157	360	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06680
1964	1458	gene
			locus_tag	LOCUS_06690
1964	1458	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06690
>Feature sequence0294
>Feature sequence0295
<2294	429	gene
			locus_tag	LOCUS_06700
<2294	429	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_161889612.1:ribonuclease R
>Feature sequence0296
1373	681	gene
			locus_tag	LOCUS_06710
1373	681	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06710
2220	1801	gene
			locus_tag	LOCUS_06720
2220	1801	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06720
>Feature sequence0297
<2291	1158	gene
			locus_tag	LOCUS_06730
<2291	1158	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008764318.1:sialate O-acetylesterase
>Feature sequence0298
1	567	gene
			locus_tag	LOCUS_06740
1	567	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06740
646	897	gene
			locus_tag	LOCUS_06750
646	897	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06750
>Feature sequence0299
1827	1345	gene
			locus_tag	LOCUS_06760
1827	1345	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06760
>Feature sequence0300
1700	867	gene
			locus_tag	LOCUS_06770
1700	867	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06770
<2280	1712	gene
			locus_tag	LOCUS_06780
<2280	1712	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_087711038.1:GTP-binding protein
>Feature sequence0301
115	957	gene
			locus_tag	LOCUS_06790
115	957	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06790
1555	1028	gene
			locus_tag	LOCUS_06800
1555	1028	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06800
>Feature sequence0302
<1	2006	gene
			locus_tag	LOCUS_06810
<1	2006	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_118839988.1:zinc-dependent metalloprotease
>Feature sequence0303
1222	2205	gene
			locus_tag	LOCUS_06820
1222	2205	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06820
>Feature sequence0304
<1	714	gene
			locus_tag	LOCUS_06830
<1	714	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012639931.1:amidohydrolase family protein
1592	882	gene
			locus_tag	LOCUS_06840
1592	882	CDS
			product	RluA family pseudouridine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002680560.1
			protein_id	gnl|my_center|LOCUS_06840
<2267	1631	gene
			locus_tag	LOCUS_06850
<2267	1631	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008760797.1:pseudouridine synthase
>Feature sequence0305
<2265	1492	gene
			locus_tag	LOCUS_06860
<2265	1492	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_164926853.1:glutamate synthase large subunit
>Feature sequence0306
1135	485	gene
			locus_tag	LOCUS_06870
1135	485	CDS
			product	ATPase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963683.1
			protein_id	gnl|my_center|LOCUS_06870
2056	1181	gene
			locus_tag	LOCUS_06880
2056	1181	CDS
			product	transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964384.1
			protein_id	gnl|my_center|LOCUS_06880
>Feature sequence0307
849	166	gene
			locus_tag	LOCUS_06890
849	166	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06890
1585	1295	gene
			locus_tag	LOCUS_06900
1585	1295	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06900
>Feature sequence0308
<1	716	gene
			locus_tag	LOCUS_06910
<1	716	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010948289.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
<2263	742	gene
			locus_tag	LOCUS_06920
<2263	742	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963285.1:DNA mismatch repair endonuclease MutL
>Feature sequence0309
1375	122	gene
			locus_tag	LOCUS_06930
1375	122	CDS
			product	nucleoside permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963821.1
			protein_id	gnl|my_center|LOCUS_06930
>Feature sequence0310
>Feature sequence0311
>Feature sequence0312
1089	457	gene
			locus_tag	LOCUS_06940
			gene	paiB
1089	457	CDS
			product	protease synthase/sporulation negative transcriptional regulator PaiB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003244329.1
			protein_id	gnl|my_center|LOCUS_06940
1229	1519	gene
			locus_tag	LOCUS_06950
1229	1519	CDS
			product	nucleotidyltransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869619.1
			protein_id	gnl|my_center|LOCUS_06950
>Feature sequence0313
2059	851	gene
			locus_tag	LOCUS_06960
2059	851	CDS
			product	DUF1343 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003234976.1
			protein_id	gnl|my_center|LOCUS_06960
>Feature sequence0314
>Feature sequence0315
<1	1942	gene
			locus_tag	LOCUS_06970
<1	1942	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962626.1:ribonucleoside-diphosphate reductase subunit alpha
>Feature sequence0316
<1	1048	gene
			locus_tag	LOCUS_06980
<1	1048	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108702.1:DUF6443 domain-containing protein
1076	1414	gene
			locus_tag	LOCUS_06990
1076	1414	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_06990
>Feature sequence0317
1129	266	gene
			locus_tag	LOCUS_07000
1129	266	CDS
			product	sugar phosphate isomerase/epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008764604.1
			protein_id	gnl|my_center|LOCUS_07000
<2240	1307	gene
			locus_tag	LOCUS_07010
<2240	1307	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011036450.1:beta-galactosidase GalA
>Feature sequence0318
474	1013	gene
			locus_tag	LOCUS_07020
474	1013	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07020
<2233	1168	gene
			locus_tag	LOCUS_07030
<2233	1168	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha
>Feature sequence0319
522	238	gene
			locus_tag	LOCUS_07040
522	238	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07040
1626	529	gene
			locus_tag	LOCUS_07050
1626	529	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07050
<2230	1623	gene
			locus_tag	LOCUS_07060
<2230	1623	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107097.1:conjugative transposon protein TraN
>Feature sequence0320
158	919	gene
			locus_tag	LOCUS_07070
158	919	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07070
1053	1580	gene
			locus_tag	LOCUS_07080
			gene	bstA
1053	1580	CDS
			product	bacillithiol transferase BstA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000999077.1
			protein_id	gnl|my_center|LOCUS_07080
1580	2143	gene
			locus_tag	LOCUS_07090
1580	2143	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07090
>Feature sequence0321
<1	2204	gene
			locus_tag	LOCUS_07100
<1	2204	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011144184.1:SBBP repeat-containing protein
>Feature sequence0322
1871	993	gene
			locus_tag	LOCUS_07110
1871	993	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07110
>Feature sequence0323
>Feature sequence0324
512	69	gene
			locus_tag	LOCUS_07120
512	69	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07120
1106	1330	gene
			locus_tag	LOCUS_07130
1106	1330	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07130
>Feature sequence0325
895	515	gene
			locus_tag	LOCUS_07140
			gene	rpsL
895	515	CDS
			product	30S ribosomal protein S12
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545079.1
			protein_id	gnl|my_center|LOCUS_07140
2086	1022	gene
			locus_tag	LOCUS_07150
2086	1022	CDS
			product	branched-chain amino acid aminotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001832304.1
			protein_id	gnl|my_center|LOCUS_07150
>Feature sequence0326
<1	728	gene
			locus_tag	LOCUS_07160
<1	728	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_009968069.1:aminotransferase
>Feature sequence0327
<1	1755	gene
			locus_tag	LOCUS_07170
<1	1755	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011021650.1:PAS domain S-box protein
>Feature sequence0328
>Feature sequence0329
1784	588	gene
			locus_tag	LOCUS_07180
1784	588	CDS
			product	pyridoxal phosphate-dependent aminotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962581.1
			protein_id	gnl|my_center|LOCUS_07180
>Feature sequence0330
<2202	682	gene
			locus_tag	LOCUS_07190
<2202	682	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767964.1:phospho-sugar mutase
>Feature sequence0331
<1	1316	gene
			locus_tag	LOCUS_07200
<1	1316	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964024.1:DUF5723 family protein
2033	1413	gene
			locus_tag	LOCUS_07210
2033	1413	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07210
>Feature sequence0332
<1	1587	gene
			locus_tag	LOCUS_07220
<1	1587	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008763401.1:ATP-binding cassette domain-containing protein
>Feature sequence0333
1	783	gene
			locus_tag	LOCUS_07230
1	783	CDS
			product	thiamine pyrophosphate-dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760623.1
			protein_id	gnl|my_center|LOCUS_07230
794	1348	gene
			locus_tag	LOCUS_07240
794	1348	CDS
			product	2-oxoacid:acceptor oxidoreductase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005786493.1
			protein_id	gnl|my_center|LOCUS_07240
>Feature sequence0334
<2196	861	gene
			locus_tag	LOCUS_07250
<2196	861	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108628.1:RagB/SusD family nutrient uptake outer membrane protein
>Feature sequence0335
791	219	gene
			locus_tag	LOCUS_07260
791	219	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07260
<2195	802	gene
			locus_tag	LOCUS_07270
<2195	802	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765321.1:TonB-dependent receptor
>Feature sequence0336
>Feature sequence0337
263	934	gene
			locus_tag	LOCUS_07280
263	934	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07280
1071	2060	gene
			locus_tag	LOCUS_07290
1071	2060	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07290
>Feature sequence0338
207	842	gene
			locus_tag	LOCUS_07300
207	842	CDS
			product	deoxynucleoside kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962436.1
			protein_id	gnl|my_center|LOCUS_07300
1042	1650	gene
			locus_tag	LOCUS_07310
1042	1650	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07310
<2190	1637	gene
			locus_tag	LOCUS_07320
<2190	1637	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_014507326.1:TIGR00730 family Rossman fold protein
>Feature sequence0339
<1	583	gene
			locus_tag	LOCUS_07330
<1	583	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_034099197.1:KpsF/GutQ family sugar-phosphate isomerase
653	1735	gene
			locus_tag	LOCUS_07340
653	1735	CDS
			product	mannose-1-phosphate guanylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963509.1
			protein_id	gnl|my_center|LOCUS_07340
>Feature sequence0340
<1	1089	gene
			locus_tag	LOCUS_07350
<1	1089	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767657.1:DUF1080 domain-containing protein
1270	1584	gene
			locus_tag	LOCUS_07360
1270	1584	CDS
			product	thiamine-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012047969.1
			protein_id	gnl|my_center|LOCUS_07360
<2188	1581	gene
			locus_tag	LOCUS_07370
<2188	1581	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_197530159.1:M15 family metallopeptidase
>Feature sequence0341
>Feature sequence0342
180	1100	gene
			locus_tag	LOCUS_07380
			gene	cyoE
180	1100	CDS
			product	heme o synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964205.1
			protein_id	gnl|my_center|LOCUS_07380
>Feature sequence0343
1427	24	gene
			locus_tag	LOCUS_07390
1427	24	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07390
<2185	1444	gene
			locus_tag	LOCUS_07400
<2185	1444	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003836799.1:glycosyltransferase family 1 protein
>Feature sequence0344
<1	770	gene
			locus_tag	LOCUS_07410
<1	770	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003246400.1:cephalosporin C deacetylase
767	1579	gene
			locus_tag	LOCUS_07420
767	1579	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07420
1745	1659	gene
			locus_tag	LOCUS_t00090
1745	1659	tRNA
			product	tRNA-Leu
			inference	COORDINATES:profile:Aragorn:1.2.38
1858	1785	gene
			locus_tag	LOCUS_t00100
1858	1785	tRNA
			product	tRNA-Gly
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0345
<2182	861	gene
			locus_tag	LOCUS_07430
<2182	861	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000415207.1:oligo-1,6-glucosidase
>Feature sequence0346
375	989	gene
			locus_tag	LOCUS_07440
375	989	CDS
			product	GNAT family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000680361.1
			protein_id	gnl|my_center|LOCUS_07440
1170	1811	gene
			locus_tag	LOCUS_07450
1170	1811	CDS
			product	class I SAM-dependent methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791943.1
			protein_id	gnl|my_center|LOCUS_07450
>Feature sequence0347
536	33	gene
			locus_tag	LOCUS_07460
536	33	CDS
			product	NADH-quinone oxidoreductase subunit J
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964312.1
			protein_id	gnl|my_center|LOCUS_07460
1156	620	gene
			locus_tag	LOCUS_07470
1156	620	CDS
			product	NADH-quinone oxidoreductase subunit I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964313.1
			protein_id	gnl|my_center|LOCUS_07470
1549	1313	gene
			locus_tag	LOCUS_07480
1549	1313	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07480
<2177	1554	gene
			locus_tag	LOCUS_07490
<2177	1554	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964314.1:NADH-quinone oxidoreductase subunit NuoH
>Feature sequence0348
157	717	gene
			locus_tag	LOCUS_07500
157	717	CDS
			product	nucleotide exchange factor GrpE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107672.1
			protein_id	gnl|my_center|LOCUS_07500
793	1956	gene
			locus_tag	LOCUS_07510
			gene	dnaJ
793	1956	CDS
			product	molecular chaperone DnaJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202549.1
			protein_id	gnl|my_center|LOCUS_07510
>Feature sequence0349
1077	193	gene
			locus_tag	LOCUS_07520
1077	193	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07520
>Feature sequence0350
1176	298	gene
			locus_tag	LOCUS_07530
1176	298	CDS
			product	sterol desaturase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010919320.1
			protein_id	gnl|my_center|LOCUS_07530
1577	1314	gene
			locus_tag	LOCUS_07540
1577	1314	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07540
>Feature sequence0351
1003	1446	gene
			locus_tag	LOCUS_07550
1003	1446	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07550
>Feature sequence0352
93	830	gene
			locus_tag	LOCUS_07560
93	830	CDS
			product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011036631.1
			protein_id	gnl|my_center|LOCUS_07560
1752	1072	gene
			locus_tag	LOCUS_07570
1752	1072	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07570
>Feature sequence0353
<2163	901	gene
			locus_tag	LOCUS_07580
<2163	901	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_157567585.1:multidrug efflux RND transporter permease subunit
>Feature sequence0354
581	276	gene
			locus_tag	LOCUS_07590
581	276	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07590
>Feature sequence0355
1911	181	gene
			locus_tag	LOCUS_07600
1911	181	CDS
			product	GMC family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010973790.1
			protein_id	gnl|my_center|LOCUS_07600
>Feature sequence0356
<2149	1153	gene
			locus_tag	LOCUS_07610
<2149	1153	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005787886.1:DNA gyrase subunit A
>Feature sequence0357
398	811	gene
			locus_tag	LOCUS_07620
398	811	CDS
			product	cobalamin B12-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011173118.1
			protein_id	gnl|my_center|LOCUS_07620
866	1321	gene
			locus_tag	LOCUS_07630
866	1321	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07630
>Feature sequence0358
<1	1345	gene
			locus_tag	LOCUS_07640
<1	1345	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008763228.1:chaperonin GroEL
1934	1428	gene
			locus_tag	LOCUS_07650
1934	1428	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07650
>Feature sequence0359
>Feature sequence0360
516	175	gene
			locus_tag	LOCUS_07660
			gene	hypA
516	175	CDS
			product	hydrogenase maturation nickel metallochaperone HypA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011462320.1
			protein_id	gnl|my_center|LOCUS_07660
731	519	gene
			locus_tag	LOCUS_07670
731	519	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07670
834	1292	gene
			locus_tag	LOCUS_07680
834	1292	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07680
<2141	1302	gene
			locus_tag	LOCUS_07690
<2141	1302	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012582502.1:Ni/Fe hydrogenase subunit alpha
>Feature sequence0361
454	1296	gene
			locus_tag	LOCUS_07700
454	1296	CDS
			product	transketolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962842.1
			protein_id	gnl|my_center|LOCUS_07700
<2139	1534	gene
			locus_tag	LOCUS_07710
<2139	1534	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765300.1:FtsX-like permease family protein
>Feature sequence0362
1130	486	gene
			locus_tag	LOCUS_07720
1130	486	CDS
			product	ATP-dependent Clp protease proteolytic subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001115288.1
			protein_id	gnl|my_center|LOCUS_07720
1908	1213	gene
			locus_tag	LOCUS_07730
			gene	clpP
1908	1213	CDS
			product	ATP-dependent Clp endopeptidase proteolytic subunit ClpP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964184.1
			protein_id	gnl|my_center|LOCUS_07730
>Feature sequence0363
<2138	898	gene
			locus_tag	LOCUS_07740
<2138	898	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010968713.1:L-rhamnose catabolism isomerase
>Feature sequence0364
1171	2115	gene
			locus_tag	LOCUS_07750
1171	2115	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962741.1
			protein_id	gnl|my_center|LOCUS_07750
>Feature sequence0365
>Feature sequence0366
1424	66	gene
			locus_tag	LOCUS_07760
			gene	murC
1424	66	CDS
			product	UDP-N-acetylmuramate--L-alanine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964155.1
			protein_id	gnl|my_center|LOCUS_07760
<2134	1421	gene
			locus_tag	LOCUS_07770
<2134	1421	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108837.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
>Feature sequence0367
>Feature sequence0368
1861	557	gene
			locus_tag	LOCUS_07780
1861	557	CDS
			product	TolC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107396.1
			protein_id	gnl|my_center|LOCUS_07780
>Feature sequence0369
756	166	gene
			locus_tag	LOCUS_07790
756	166	CDS
			product	Maf-like protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107938.1
			protein_id	gnl|my_center|LOCUS_07790
1595	771	gene
			locus_tag	LOCUS_07800
1595	771	CDS
			product	geranylgeranylglycerol-phosphate geranylgeranyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963542.1
			protein_id	gnl|my_center|LOCUS_07800
>Feature sequence0370
>Feature sequence0371
<1	804	gene
			locus_tag	LOCUS_07810
<1	804	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108918.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
998	1462	gene
			locus_tag	LOCUS_07820
998	1462	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_034098264.1
			protein_id	gnl|my_center|LOCUS_07820
2018	1464	gene
			locus_tag	LOCUS_07830
2018	1464	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07830
>Feature sequence0372
<2115	1098	gene
			locus_tag	LOCUS_07840
<2115	1098	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962469.1:DUF2723 domain-containing protein
>Feature sequence0373
>Feature sequence0374
420	106	gene
			locus_tag	LOCUS_07850
420	106	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07850
1444	641	gene
			locus_tag	LOCUS_07860
1444	641	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07860
1577	1825	gene
			locus_tag	LOCUS_07870
1577	1825	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07870
>Feature sequence0375
<2104	958	gene
			locus_tag	LOCUS_07880
<2104	958	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012583115.1:ATP-binding protein
>Feature sequence0376
1277	759	gene
			locus_tag	LOCUS_07890
1277	759	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07890
>Feature sequence0377
1553	1479	gene
			locus_tag	LOCUS_t00110
1553	1479	tRNA
			product	tRNA-Lys
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0378
<2098	71	gene
			locus_tag	LOCUS_07900
<2098	71	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962878.1:alpha-ketoacid dehydrogenase subunit alpha/beta
>Feature sequence0379
539	1897	gene
			locus_tag	LOCUS_07910
539	1897	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07910
>Feature sequence0380
1163	399	gene
			locus_tag	LOCUS_07920
1163	399	CDS
			product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015369251.1
			protein_id	gnl|my_center|LOCUS_07920
1923	1345	gene
			locus_tag	LOCUS_07930
1923	1345	CDS
			product	adenylate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760056.1
			protein_id	gnl|my_center|LOCUS_07930
>Feature sequence0381
1273	1659	gene
			locus_tag	LOCUS_07940
			gene	apaG
1273	1659	CDS
			product	Co2+/Mg2+ efflux protein ApaG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962585.1
			protein_id	gnl|my_center|LOCUS_07940
2083	1676	gene
			locus_tag	LOCUS_07950
2083	1676	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07950
>Feature sequence0382
<1	771	gene
			locus_tag	LOCUS_07960
<1	771	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003893645.1:hydrogenase formation protein HypD
788	1843	gene
			locus_tag	LOCUS_07970
			gene	hypE
788	1843	CDS
			product	hydrogenase expression/formation protein HypE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545205.1
			protein_id	gnl|my_center|LOCUS_07970
>Feature sequence0383
<1	1158	gene
			locus_tag	LOCUS_07980
<1	1158	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008764765.1:molecular chaperone DnaK
1699	1902	gene
			locus_tag	LOCUS_07990
1699	1902	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_07990
>Feature sequence0384
>Feature sequence0385
867	109	gene
			locus_tag	LOCUS_08000
867	109	CDS
			product	C4-type zinc ribbon domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005787827.1
			protein_id	gnl|my_center|LOCUS_08000
>Feature sequence0386
313	690	gene
			locus_tag	LOCUS_08010
313	690	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08010
1329	694	gene
			locus_tag	LOCUS_08020
1329	694	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08020
2078	1416	gene
			locus_tag	LOCUS_08030
2078	1416	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08030
>Feature sequence0387
307	1251	gene
			locus_tag	LOCUS_08040
307	1251	CDS
			product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002682158.1
			protein_id	gnl|my_center|LOCUS_08040
1362	1958	gene
			locus_tag	LOCUS_08050
1362	1958	CDS
			product	acyl carrier protein phosphodiesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963009.1
			protein_id	gnl|my_center|LOCUS_08050
>Feature sequence0388
441	1286	gene
			locus_tag	LOCUS_08060
441	1286	CDS
			product	BRO family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962647.1
			protein_id	gnl|my_center|LOCUS_08060
>Feature sequence0389
43	681	gene
			locus_tag	LOCUS_08070
43	681	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08070
742	1386	gene
			locus_tag	LOCUS_08080
742	1386	CDS
			product	archaemetzincin family Zn-dependent metalloprotease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012584147.1
			protein_id	gnl|my_center|LOCUS_08080
<2075	1440	gene
			locus_tag	LOCUS_08090
<2075	1440	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008762838.1:tyrosine--tRNA ligase
>Feature sequence0390
1491	433	gene
			locus_tag	LOCUS_08100
1491	433	CDS
			product	lysylphosphatidylglycerol synthase transmembrane domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_073173113.1
			protein_id	gnl|my_center|LOCUS_08100
>Feature sequence0391
50	751	gene
			locus_tag	LOCUS_08110
50	751	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08110
766	1167	gene
			locus_tag	LOCUS_08120
766	1167	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08120
1957	1190	gene
			locus_tag	LOCUS_08130
1957	1190	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08130
>Feature sequence0392
1457	879	gene
			locus_tag	LOCUS_08140
1457	879	CDS
			product	YdeI family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003234230.1
			protein_id	gnl|my_center|LOCUS_08140
1852	1463	gene
			locus_tag	LOCUS_08150
1852	1463	CDS
			product	DoxX family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001071058.1
			protein_id	gnl|my_center|LOCUS_08150
>Feature sequence0393
330	1	gene
			locus_tag	LOCUS_08160
330	1	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08160
819	355	gene
			locus_tag	LOCUS_08170
819	355	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08170
1108	923	gene
			locus_tag	LOCUS_08180
1108	923	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08180
1759	1178	gene
			locus_tag	LOCUS_08190
1759	1178	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08190
>Feature sequence0394
842	375	gene
			locus_tag	LOCUS_08200
842	375	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08200
>Feature sequence0395
178	744	gene
			locus_tag	LOCUS_08210
178	744	CDS
			product	YceI family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011122143.1
			protein_id	gnl|my_center|LOCUS_08210
1321	812	gene
			locus_tag	LOCUS_08220
1321	812	CDS
			product	DinB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963000.1
			protein_id	gnl|my_center|LOCUS_08220
<2060	1321	gene
			locus_tag	LOCUS_08230
<2060	1321	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964485.1:S8 family peptidase
>Feature sequence0396
<1	966	gene
			locus_tag	LOCUS_08240
<1	966	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005812911.1:cell wall-binding repeat-containing protein
969	1835	gene
			locus_tag	LOCUS_08250
969	1835	CDS
			product	DUF4349 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963736.1
			protein_id	gnl|my_center|LOCUS_08250
>Feature sequence0397
1595	1987	gene
			locus_tag	LOCUS_08260
1595	1987	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08260
>Feature sequence0398
>Feature sequence0399
311	1078	gene
			locus_tag	LOCUS_08270
311	1078	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08270
1106	1501	gene
			locus_tag	LOCUS_08280
1106	1501	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08280
>Feature sequence0400
>Feature sequence0401
>Feature sequence0402
422	967	gene
			locus_tag	LOCUS_08290
422	967	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08290
1085	1618	gene
			locus_tag	LOCUS_08300
			gene	greA
1085	1618	CDS
			product	transcription elongation factor GreA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964455.1
			protein_id	gnl|my_center|LOCUS_08300
>Feature sequence0403
<2039	660	gene
			locus_tag	LOCUS_08310
<2039	660	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203417.1:rRNA cytosine-C5-methyltransferase
>Feature sequence0404
994	1560	gene
			locus_tag	LOCUS_08320
994	1560	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08320
>Feature sequence0405
672	424	gene
			locus_tag	LOCUS_08330
672	424	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08330
1290	856	gene
			locus_tag	LOCUS_08340
1290	856	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08340
<2037	1287	gene
			locus_tag	LOCUS_08350
<2037	1287	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_007334319.1:ATP-binding protein
>Feature sequence0406
905	979	gene
			locus_tag	LOCUS_t00120
905	979	tRNA
			product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
1541	1888	gene
			locus_tag	LOCUS_08360
1541	1888	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08360
>Feature sequence0407
>Feature sequence0408
382	62	gene
			locus_tag	LOCUS_08370
382	62	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08370
722	363	gene
			locus_tag	LOCUS_08380
722	363	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08380
1965	796	gene
			locus_tag	LOCUS_08390
1965	796	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08390
>Feature sequence0409
>Feature sequence0410
>Feature sequence0411
1380	229	gene
			locus_tag	LOCUS_08400
			gene	lpxB
1380	229	CDS
			product	lipid-A-disaccharide synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964419.1
			protein_id	gnl|my_center|LOCUS_08400
1565	1930	gene
			locus_tag	LOCUS_08410
1565	1930	CDS
			product	BlaI/MecI/CopY family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032813773.1
			protein_id	gnl|my_center|LOCUS_08410
>Feature sequence0412
<2027	1132	gene
			locus_tag	LOCUS_08420
<2027	1132	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_164927168.1:glycosyltransferase
>Feature sequence0413
>Feature sequence0414
<1	1050	gene
			locus_tag	LOCUS_08430
<1	1050	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_031153501.1:ice-binding family protein
>Feature sequence0415
<1	627	gene
			locus_tag	LOCUS_08440
<1	627	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000167663.1:SDR family oxidoreductase
794	870	gene
			locus_tag	LOCUS_t00130
794	870	tRNA
			product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
1449	1021	gene
			locus_tag	LOCUS_08450
1449	1021	CDS
			product	response regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000791295.1
			protein_id	gnl|my_center|LOCUS_08450
1770	1585	gene
			locus_tag	LOCUS_08460
1770	1585	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08460
1784	1981	gene
			locus_tag	LOCUS_08470
1784	1981	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08470
>Feature sequence0416
<1	766	gene
			locus_tag	LOCUS_08480
<1	766	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011120545.1:M1 family metallopeptidase
1681	1007	gene
			locus_tag	LOCUS_08490
1681	1007	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08490
>Feature sequence0417
<1	707	gene
			locus_tag	LOCUS_08500
<1	707	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964514.1:Ig-like domain-containing protein
741	1355	gene
			locus_tag	LOCUS_08510
			gene	recR
741	1355	CDS
			product	recombination mediator RecR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763508.1
			protein_id	gnl|my_center|LOCUS_08510
>Feature sequence0418
1942	1361	gene
			locus_tag	LOCUS_08520
1942	1361	CDS
			product	OmpH family outer membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005789239.1
			protein_id	gnl|my_center|LOCUS_08520
>Feature sequence0419
613	1248	gene
			locus_tag	LOCUS_08530
613	1248	CDS
			product	thymidine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763837.1
			protein_id	gnl|my_center|LOCUS_08530
>Feature sequence0420
<1	890	gene
			locus_tag	LOCUS_08540
<1	890	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012257503.1:DegT/DnrJ/EryC1/StrS family aminotransferase
>Feature sequence0421
683	114	gene
			locus_tag	LOCUS_08550
683	114	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08550
1700	1873	gene
			locus_tag	LOCUS_08560
1700	1873	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08560
>Feature sequence0422
844	527	gene
			locus_tag	LOCUS_08570
844	527	CDS
			product	antibiotic biosynthesis monooxygenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003245961.1
			protein_id	gnl|my_center|LOCUS_08570
1440	841	gene
			locus_tag	LOCUS_08580
			gene	coaE
1440	841	CDS
			product	dephospho-CoA kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963935.1
			protein_id	gnl|my_center|LOCUS_08580
>Feature sequence0423
<1	1265	gene
			locus_tag	LOCUS_08590
<1	1265	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107447.1:xylose isomerase
>Feature sequence0424
1528	251	gene
			locus_tag	LOCUS_08600
1528	251	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08600
>Feature sequence0425
811	119	gene
			locus_tag	LOCUS_08610
811	119	CDS
			product	NUDIX domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760645.1
			protein_id	gnl|my_center|LOCUS_08610
<1999	851	gene
			locus_tag	LOCUS_08620
<1999	851	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008766122.1:sodium:solute symporter
>Feature sequence0426
1058	570	gene
			locus_tag	LOCUS_08630
1058	570	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08630
>Feature sequence0427
<1	786	gene
			locus_tag	LOCUS_08640
<1	786	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964585.1:glutamate--tRNA ligase
1739	900	gene
			locus_tag	LOCUS_08650
			gene	ygiD
1739	900	CDS
			product	4,5-DOPA dioxygenase extradiol
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007324092.1
			protein_id	gnl|my_center|LOCUS_08650
>Feature sequence0428
185	1354	gene
			locus_tag	LOCUS_08660
185	1354	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08660
1441	1650	gene
			locus_tag	LOCUS_08670
1441	1650	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08670
>Feature sequence0429
<1993	636	gene
			locus_tag	LOCUS_08680
<1993	636	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963946.1:DNA repair protein RecN
>Feature sequence0430
<1992	1297	gene
			locus_tag	LOCUS_08690
<1992	1297	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_009291350.1:cysteine--tRNA ligase
>Feature sequence0431
132	908	gene
			locus_tag	LOCUS_08700
132	908	CDS
			product	inositol monophosphatase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010941610.1
			protein_id	gnl|my_center|LOCUS_08700
>Feature sequence0432
<1	504	gene
			locus_tag	LOCUS_08710
<1	504	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008764544.1:peptide MFS transporter
>Feature sequence0433
1213	215	gene
			locus_tag	LOCUS_08720
1213	215	CDS
			product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013531457.1
			protein_id	gnl|my_center|LOCUS_08720
>Feature sequence0434
152	694	gene
			locus_tag	LOCUS_08730
152	694	CDS
			product	Crp/Fnr family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765993.1
			protein_id	gnl|my_center|LOCUS_08730
774	1388	gene
			locus_tag	LOCUS_08740
774	1388	CDS
			product	NAD(P)H-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002893583.1
			protein_id	gnl|my_center|LOCUS_08740
>Feature sequence0435
<1	1288	gene
			locus_tag	LOCUS_08750
<1	1288	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_094146567.1:histidine kinase
>Feature sequence0436
>Feature sequence0437
955	29	gene
			locus_tag	LOCUS_08760
955	29	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08760
>Feature sequence0438
934	251	gene
			locus_tag	LOCUS_08770
			gene	trmD
934	251	CDS
			product	tRNA (guanosine(37)-N1)-methyltransferase TrmD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963979.1
			protein_id	gnl|my_center|LOCUS_08770
1400	1002	gene
			locus_tag	LOCUS_08780
1400	1002	CDS
			product	RNA-binding S4 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004194347.1
			protein_id	gnl|my_center|LOCUS_08780
>Feature sequence0439
<1957	564	gene
			locus_tag	LOCUS_08790
<1957	564	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963483.1:Mur ligase family protein
>Feature sequence0440
<1	689	gene
			locus_tag	LOCUS_08800
<1	689	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962816.1:bacillithiol biosynthesis deacetylase BshB1
1289	690	gene
			locus_tag	LOCUS_08810
1289	690	CDS
			product	HDIG domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_196768286.1
			protein_id	gnl|my_center|LOCUS_08810
>Feature sequence0441
>Feature sequence0442
<1	1866	gene
			locus_tag	LOCUS_08820
<1	1866	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962206.1:transglycosylase domain-containing protein
>Feature sequence0443
1015	446	gene
			locus_tag	LOCUS_08830
1015	446	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08830
<1950	1130	gene
			locus_tag	LOCUS_08840
<1950	1130	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein
>Feature sequence0444
563	1192	gene
			locus_tag	LOCUS_08850
563	1192	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08850
1372	1770	gene
			locus_tag	LOCUS_08860
1372	1770	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003594462.1
			protein_id	gnl|my_center|LOCUS_08860
>Feature sequence0445
2	1360	gene
			locus_tag	LOCUS_08870
2	1360	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08870
>Feature sequence0446
<1947	160	gene
			locus_tag	LOCUS_08880
<1947	160	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_004080599.1:M3 family oligoendopeptidase
>Feature sequence0447
874	515	gene
			locus_tag	LOCUS_08890
874	515	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08890
1312	1581	gene
			locus_tag	LOCUS_08900
			gene	sdpR
1312	1581	CDS
			product	sporulation delaying system autorepressor SdpR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003243541.1
			protein_id	gnl|my_center|LOCUS_08900
>Feature sequence0448
>Feature sequence0449
208	1458	gene
			locus_tag	LOCUS_08910
208	1458	CDS
			product	Nramp family divalent metal transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_041958803.1
			protein_id	gnl|my_center|LOCUS_08910
>Feature sequence0450
477	85	gene
			locus_tag	LOCUS_08920
477	85	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08920
858	508	gene
			locus_tag	LOCUS_08930
858	508	CDS
			product	ArsC family reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000258247.1
			protein_id	gnl|my_center|LOCUS_08930
1388	873	gene
			locus_tag	LOCUS_08940
1388	873	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962916.1
			protein_id	gnl|my_center|LOCUS_08940
1595	1392	gene
			locus_tag	LOCUS_08950
1595	1392	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08950
1825	1595	gene
			locus_tag	LOCUS_08960
1825	1595	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08960
>Feature sequence0451
773	270	gene
			locus_tag	LOCUS_08970
773	270	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08970
1776	889	gene
			locus_tag	LOCUS_08980
1776	889	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_08980
>Feature sequence0452
<1931	1045	gene
			locus_tag	LOCUS_08990
<1931	1045	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010880935.1:cation-translocating P-type ATPase
>Feature sequence0453
1641	1420	gene
			locus_tag	LOCUS_09000
1641	1420	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09000
>Feature sequence0454
>Feature sequence0455
<1928	555	gene
			locus_tag	LOCUS_09010
<1928	555	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005455828.1:glucose-6-phosphate isomerase
>Feature sequence0456
311	910	gene
			locus_tag	LOCUS_09020
311	910	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09020
>Feature sequence0457
1855	440	gene
			locus_tag	LOCUS_09030
			gene	uxaC
1855	440	CDS
			product	glucuronate isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765680.1
			protein_id	gnl|my_center|LOCUS_09030
>Feature sequence0458
1414	782	gene
			locus_tag	LOCUS_09040
1414	782	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, internal stop codon, frameshifted
			protein_id	gnl|my_center|LOCUS_09040
>Feature sequence0459
<1	1378	gene
			locus_tag	LOCUS_09050
<1	1378	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765828.1:SusC/RagA family TonB-linked outer membrane protein
>Feature sequence0460
705	190	gene
			locus_tag	LOCUS_09060
705	190	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09060
1384	941	gene
			locus_tag	LOCUS_09070
1384	941	CDS
			product	30S ribosomal protein S16
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763025.1
			protein_id	gnl|my_center|LOCUS_09070
>Feature sequence0461
<1913	531	gene
			locus_tag	LOCUS_09080
<1913	531	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010973790.1:GMC family oxidoreductase
>Feature sequence0462
69	1256	gene
			locus_tag	LOCUS_09090
69	1256	CDS
			product	proline dehydrogenase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963816.1
			protein_id	gnl|my_center|LOCUS_09090
>Feature sequence0463
<1	1649	gene
			locus_tag	LOCUS_09100
<1	1649	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012868905.1:NADH-quinone oxidoreductase subunit NuoF
>Feature sequence0464
<1	741	gene
			locus_tag	LOCUS_09110
<1	741	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012258021.1:alpha/beta fold hydrolase
775	1569	gene
			locus_tag	LOCUS_09120
775	1569	CDS
			product	alpha/beta fold hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012258021.1
			protein_id	gnl|my_center|LOCUS_09120
>Feature sequence0465
1655	111	gene
			locus_tag	LOCUS_09130
1655	111	CDS
			product	YifB family Mg chelatase-like AAA ATPase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008661626.1
			protein_id	gnl|my_center|LOCUS_09130
>Feature sequence0466
929	1150	gene
			locus_tag	LOCUS_09140
929	1150	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963325.1
			protein_id	gnl|my_center|LOCUS_09140
<1904	1224	gene
			locus_tag	LOCUS_09150
<1904	1224	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008759991.1:3-deoxy-8-phosphooctulonate synthase
>Feature sequence0467
1216	314	gene
			locus_tag	LOCUS_09160
1216	314	CDS
			product	ribonuclease Z
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963815.1
			protein_id	gnl|my_center|LOCUS_09160
1664	1266	gene
			locus_tag	LOCUS_09170
1664	1266	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09170
>Feature sequence0468
<1903	533	gene
			locus_tag	LOCUS_09180
<1903	533	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964545.1:F0F1 ATP synthase subunit alpha
>Feature sequence0469
1641	1042	gene
			locus_tag	LOCUS_09190
1641	1042	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09190
>Feature sequence0470
<1902	764	gene
			locus_tag	LOCUS_09200
<1902	764	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein
>Feature sequence0471
1533	412	gene
			locus_tag	LOCUS_09210
1533	412	CDS
			product	2Fe-2S iron-sulfur cluster-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964315.1
			protein_id	gnl|my_center|LOCUS_09210
>Feature sequence0472
<1	981	gene
			locus_tag	LOCUS_09220
<1	981	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005460183.1:polyphosphate kinase 1
962	1846	gene
			locus_tag	LOCUS_09230
962	1846	CDS
			product	Ppx/GppA family phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_009292463.1
			protein_id	gnl|my_center|LOCUS_09230
>Feature sequence0473
426	1523	gene
			locus_tag	LOCUS_09240
426	1523	CDS
			product	6-phosphofructokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010942347.1
			protein_id	gnl|my_center|LOCUS_09240
>Feature sequence0474
<1	1582	gene
			locus_tag	LOCUS_09250
<1	1582	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107458.1:isoleucine--tRNA ligase
>Feature sequence0475
1007	1081	gene
			locus_tag	LOCUS_t00140
1007	1081	tRNA
			product	tRNA-His
			inference	COORDINATES:profile:Aragorn:1.2.38
1145	1750	gene
			locus_tag	LOCUS_09260
1145	1750	CDS
			product	DUF445 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011393261.1
			protein_id	gnl|my_center|LOCUS_09260
>Feature sequence0476
>Feature sequence0477
<1	663	gene
			locus_tag	LOCUS_09270
<1	663	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012869041.1:methylmalonyl-CoA mutase family protein
>Feature sequence0478
1604	1371	gene
			locus_tag	LOCUS_09280
1604	1371	CDS
			product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000974621.1
			protein_id	gnl|my_center|LOCUS_09280
>Feature sequence0479
1823	36	gene
			locus_tag	LOCUS_09290
1823	36	CDS
			product	long-chain fatty acid--CoA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_026955981.1
			protein_id	gnl|my_center|LOCUS_09290
>Feature sequence0480
1137	214	gene
			locus_tag	LOCUS_09300
1137	214	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000867340.1
			protein_id	gnl|my_center|LOCUS_09300
>Feature sequence0481
23	418	gene
			locus_tag	LOCUS_09310
23	418	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09310
495	1073	gene
			locus_tag	LOCUS_09320
			gene	sigZ
495	1073	CDS
			product	RNA polymerase sigma factor SigZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011261608.1
			protein_id	gnl|my_center|LOCUS_09320
1086	1442	gene
			locus_tag	LOCUS_09330
1086	1442	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09330
1457	1669	gene
			locus_tag	LOCUS_09340
1457	1669	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09340
>Feature sequence0482
>Feature sequence0483
66	470	gene
			locus_tag	LOCUS_09350
66	470	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09350
477	893	gene
			locus_tag	LOCUS_09360
477	893	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09360
905	1351	gene
			locus_tag	LOCUS_09370
905	1351	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09370
>Feature sequence0484
>Feature sequence0485
193	690	gene
			locus_tag	LOCUS_09380
193	690	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962860.1
			protein_id	gnl|my_center|LOCUS_09380
710	1444	gene
			locus_tag	LOCUS_09390
710	1444	CDS
			product	NRDE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962859.1
			protein_id	gnl|my_center|LOCUS_09390
>Feature sequence0486
1060	350	gene
			locus_tag	LOCUS_09400
1060	350	CDS
			product	ATP-binding cassette domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962683.1
			protein_id	gnl|my_center|LOCUS_09400
1861	1136	gene
			locus_tag	LOCUS_09410
1861	1136	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09410
>Feature sequence0487
<1861	1142	gene
			locus_tag	LOCUS_09420
<1861	1142	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963938.1:metallophosphatase
>Feature sequence0488
<1	683	gene
			locus_tag	LOCUS_09430
<1	683	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202338.1:SusC/RagA family TonB-linked outer membrane protein
>Feature sequence0489
>Feature sequence0490
336	1154	gene
			locus_tag	LOCUS_09440
336	1154	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09440
>Feature sequence0491
<1	788	gene
			locus_tag	LOCUS_09450
<1	788	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962751.1:dihydrolipoamide acetyltransferase family protein
941	1768	gene
			locus_tag	LOCUS_09460
941	1768	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09460
>Feature sequence0492
95	454	gene
			locus_tag	LOCUS_09470
95	454	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09470
>Feature sequence0493
<1842	586	gene
			locus_tag	LOCUS_09480
<1842	586	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962780.1:KUP/HAK/KT family potassium transporter
>Feature sequence0494
>Feature sequence0495
588	1124	gene
			locus_tag	LOCUS_09490
588	1124	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09490
<1838	1102	gene
			locus_tag	LOCUS_09500
<1838	1102	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964484.1:MBL fold metallo-hydrolase
>Feature sequence0496
614	1789	gene
			locus_tag	LOCUS_09510
614	1789	CDS
			product	O-succinylhomoserine sulfhydrylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005770586.1
			protein_id	gnl|my_center|LOCUS_09510
>Feature sequence0497
818	435	gene
			locus_tag	LOCUS_09520
818	435	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09520
1061	1133	gene
			locus_tag	LOCUS_t00150
1061	1133	tRNA
			product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0498
872	228	gene
			locus_tag	LOCUS_09530
			gene	pdxH
872	228	CDS
			product	pyridoxamine 5'-phosphate oxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011403320.1
			protein_id	gnl|my_center|LOCUS_09530
1826	987	gene
			locus_tag	LOCUS_09540
1826	987	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09540
>Feature sequence0499
1004	600	gene
			locus_tag	LOCUS_09550
1004	600	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09550
<1830	1114	gene
			locus_tag	LOCUS_09560
<1830	1114	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011037441.1:DUF1684 domain-containing protein
>Feature sequence0500
464	1102	gene
			locus_tag	LOCUS_09570
464	1102	CDS
			product	thiamine phosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962600.1
			protein_id	gnl|my_center|LOCUS_09570
>Feature sequence0501
191	1399	gene
			locus_tag	LOCUS_09580
191	1399	CDS
			product	MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005786507.1
			protein_id	gnl|my_center|LOCUS_09580
>Feature sequence0502
333	1541	gene
			locus_tag	LOCUS_09590
333	1541	CDS
			product	dicarboxylate/amino acid:cation symporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001223621.1
			protein_id	gnl|my_center|LOCUS_09590
>Feature sequence0503
>Feature sequence0504
688	1269	gene
			locus_tag	LOCUS_09600
			gene	ruvA
688	1269	CDS
			product	Holliday junction branch migration protein RuvA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964221.1
			protein_id	gnl|my_center|LOCUS_09600
>Feature sequence0505
929	249	gene
			locus_tag	LOCUS_09610
929	249	CDS
			product	lysophospholipid acyltransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964336.1
			protein_id	gnl|my_center|LOCUS_09610
1817	1056	gene
			locus_tag	LOCUS_09620
			gene	ispE
1817	1056	CDS
			product	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005793430.1
			protein_id	gnl|my_center|LOCUS_09620
>Feature sequence0506
>Feature sequence0507
<1	528	gene
			locus_tag	LOCUS_09630
<1	528	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M
>Feature sequence0508
287	610	gene
			locus_tag	LOCUS_09640
287	610	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09640
1810	671	gene
			locus_tag	LOCUS_09650
1810	671	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09650
>Feature sequence0509
<1807	353	gene
			locus_tag	LOCUS_09660
<1807	353	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_015705837.1:alpha,alpha-trehalase
>Feature sequence0510
1074	1487	gene
			locus_tag	LOCUS_09670
1074	1487	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09670
>Feature sequence0511
1725	442	gene
			locus_tag	LOCUS_09680
1725	442	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_09680
>Feature sequence0512
1001	30	gene
			locus_tag	LOCUS_09690
1001	30	CDS
			product	NAD-dependent epimerase/dehydratase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962339.1
			protein_id	gnl|my_center|LOCUS_09690
1481	1065	gene
			locus_tag	LOCUS_09700
1481	1065	CDS
			product	transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763608.1
			protein_id	gnl|my_center|LOCUS_09700
>Feature sequence0513
<1	941	gene
			locus_tag	LOCUS_09710
<1	941	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012259148.1:DUF1501 domain-containing protein
>Feature sequence0514
1182	835	gene
			locus_tag	LOCUS_09720
1182	835	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09720
>Feature sequence0515
<1800	605	gene
			locus_tag	LOCUS_09730
<1800	605	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012584145.1:GH1 family beta-glucosidase
>Feature sequence0516
1017	169	gene
			locus_tag	LOCUS_09740
1017	169	CDS
			product	5'-methylthioadenosine/adenosylhomocysteine nucleosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005900142.1
			protein_id	gnl|my_center|LOCUS_09740
<1799	1067	gene
			locus_tag	LOCUS_09750
<1799	1067	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000124583.1:SDR family oxidoreductase
>Feature sequence0517
<1797	381	gene
			locus_tag	LOCUS_09760
<1797	381	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011056543.1:NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta
>Feature sequence0518
<1795	731	gene
			locus_tag	LOCUS_09770
<1795	731	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011729994.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)
>Feature sequence0519
905	474	gene
			locus_tag	LOCUS_09780
905	474	CDS
			product	nuclear transport factor 2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011268377.1
			protein_id	gnl|my_center|LOCUS_09780
1406	909	gene
			locus_tag	LOCUS_09790
1406	909	CDS
			product	NAD(P)H-dependent oxidoreductase subunit E
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964318.1
			protein_id	gnl|my_center|LOCUS_09790
>Feature sequence0520
>Feature sequence0521
<1	520	gene
			locus_tag	LOCUS_09800
<1	520	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012583480.1:phosphodiester glycosidase family protein
1320	613	gene
			locus_tag	LOCUS_09810
1320	613	CDS
			product	VIT1/CCC1 transporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962918.1
			protein_id	gnl|my_center|LOCUS_09810
>Feature sequence0522
1370	765	gene
			locus_tag	LOCUS_09820
1370	765	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09820
>Feature sequence0523
<1792	727	gene
			locus_tag	LOCUS_09830
<1792	727	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_014206391.1:aldehyde dehydrogenase (NADP(+))
>Feature sequence0524
1626	1255	gene
			locus_tag	LOCUS_09840
1626	1255	CDS
			product	DUF1573 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763504.1
			protein_id	gnl|my_center|LOCUS_09840
>Feature sequence0525
413	24	gene
			locus_tag	LOCUS_09850
			gene	rpsI
413	24	CDS
			product	30S ribosomal protein S9
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791749.1
			protein_id	gnl|my_center|LOCUS_09850
926	483	gene
			locus_tag	LOCUS_09860
			gene	rplM
926	483	CDS
			product	50S ribosomal protein L13
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000847599.1
			protein_id	gnl|my_center|LOCUS_09860
>Feature sequence0526
>Feature sequence0527
7	1218	gene
			locus_tag	LOCUS_09870
7	1218	CDS
			product	tetratricopeptide repeat protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010963734.1
			protein_id	gnl|my_center|LOCUS_09870
>Feature sequence0528
<1768	419	gene
			locus_tag	LOCUS_09880
<1768	419	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962204.1:regulatory iron-sulfur-containing complex subunit RicT
>Feature sequence0529
930	1325	gene
			locus_tag	LOCUS_09890
930	1325	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09890
1331	1534	gene
			locus_tag	LOCUS_09900
1331	1534	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09900
>Feature sequence0530
562	1692	gene
			locus_tag	LOCUS_09910
562	1692	CDS
			product	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001020567.1
			protein_id	gnl|my_center|LOCUS_09910
>Feature sequence0531
246	1550	gene
			locus_tag	LOCUS_09920
246	1550	CDS
			product	MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011038455.1
			protein_id	gnl|my_center|LOCUS_09920
>Feature sequence0532
537	64	gene
			locus_tag	LOCUS_09930
537	64	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09930
1129	770	gene
			locus_tag	LOCUS_09940
1129	770	CDS
			product	CoA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963434.1
			protein_id	gnl|my_center|LOCUS_09940
1281	1700	gene
			locus_tag	LOCUS_09950
1281	1700	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09950
>Feature sequence0533
290	138	gene
			locus_tag	LOCUS_09960
290	138	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09960
>Feature sequence0534
97	291	gene
			locus_tag	LOCUS_09970
97	291	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_09970
299	901	gene
			locus_tag	LOCUS_09980
			gene	nusG
299	901	CDS
			product	transcription termination/antitermination protein NusG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005782159.1
			protein_id	gnl|my_center|LOCUS_09980
1078	1521	gene
			locus_tag	LOCUS_09990
			gene	rplK
1078	1521	CDS
			product	50S ribosomal protein L11
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005791514.1
			protein_id	gnl|my_center|LOCUS_09990
>Feature sequence0535
1	906	gene
			locus_tag	LOCUS_10000
1	906	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10000
>Feature sequence0536
>Feature sequence0537
<1748	902	gene
			locus_tag	LOCUS_10010
<1748	902	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_120701253.1:ATP-dependent DNA helicase
>Feature sequence0538
<1747	914	gene
			locus_tag	LOCUS_10020
<1747	914	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003107426.1:metallopeptidase MdpA
>Feature sequence0539
805	173	gene
			locus_tag	LOCUS_10030
805	173	CDS
			product	class I SAM-dependent methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010966112.1
			protein_id	gnl|my_center|LOCUS_10030
1275	856	gene
			locus_tag	LOCUS_10040
			gene	trxA
1275	856	CDS
			product	thioredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003400164.1
			protein_id	gnl|my_center|LOCUS_10040
1745	1278	gene
			locus_tag	LOCUS_10050
1745	1278	CDS
			product	DUF1847 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869954.1
			protein_id	gnl|my_center|LOCUS_10050
>Feature sequence0540
1167	700	gene
			locus_tag	LOCUS_10060
1167	700	CDS
			product	acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095038.1
			protein_id	gnl|my_center|LOCUS_10060
<1746	1170	gene
			locus_tag	LOCUS_10070
<1746	1170	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012048116.1:Gfo/Idh/MocA family oxidoreductase
>Feature sequence0541
600	1184	gene
			locus_tag	LOCUS_10080
600	1184	CDS
			product	peroxiredoxin-like family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164922512.1
			protein_id	gnl|my_center|LOCUS_10080
>Feature sequence0542
>Feature sequence0543
1292	564	gene
			locus_tag	LOCUS_10090
1292	564	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10090
>Feature sequence0544
<1742	550	gene
			locus_tag	LOCUS_10100
<1742	550	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962398.1:excinuclease ABC subunit UvrC
>Feature sequence0545
<1	543	gene
			locus_tag	LOCUS_10110
<1	543	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010964764.1:response regulator transcription factor
>Feature sequence0546
<1	753	gene
			locus_tag	LOCUS_10120
<1	753	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202023.1:D-alanine--D-alanine ligase
923	1642	gene
			locus_tag	LOCUS_10130
923	1642	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10130
>Feature sequence0547
261	485	gene
			locus_tag	LOCUS_10140
261	485	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10140
503	1000	gene
			locus_tag	LOCUS_10150
503	1000	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10150
1237	1698	gene
			locus_tag	LOCUS_10160
1237	1698	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10160
>Feature sequence0548
146	904	gene
			locus_tag	LOCUS_10170
146	904	CDS
			product	C40 family peptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962928.1
			protein_id	gnl|my_center|LOCUS_10170
1118	957	gene
			locus_tag	LOCUS_10180
1118	957	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10180
1591	1172	gene
			locus_tag	LOCUS_10190
1591	1172	CDS
			product	sulfite exporter TauE/SafE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_164927201.1
			protein_id	gnl|my_center|LOCUS_10190
>Feature sequence0549
>Feature sequence0550
<1	1035	gene
			locus_tag	LOCUS_10200
<1	1035	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962537.1:glycosyltransferase
>Feature sequence0551
>Feature sequence0552
<1	1401	gene
			locus_tag	LOCUS_10210
<1	1401	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964569.1:GH3 auxin-responsive promoter family protein
>Feature sequence0553
1591	1106	gene
			locus_tag	LOCUS_10220
1591	1106	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10220
>Feature sequence0554
>Feature sequence0555
<1	595	gene
			locus_tag	LOCUS_10230
<1	595	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963513.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha
625	1314	gene
			locus_tag	LOCUS_10240
625	1314	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964103.1
			protein_id	gnl|my_center|LOCUS_10240
>Feature sequence0556
261	1421	gene
			locus_tag	LOCUS_10250
			gene	dinB
261	1421	CDS
			product	DNA polymerase IV
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_087861794.1
			protein_id	gnl|my_center|LOCUS_10250
>Feature sequence0557
1	534	gene
			locus_tag	LOCUS_10260
			gene	radC
1	534	CDS
			product	DNA repair protein RadC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963482.1
			protein_id	gnl|my_center|LOCUS_10260
591	953	gene
			locus_tag	LOCUS_10270
591	953	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10270
1326	1015	gene
			locus_tag	LOCUS_10280
1326	1015	CDS
			product	DUF3467 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963310.1
			protein_id	gnl|my_center|LOCUS_10280
>Feature sequence0558
>Feature sequence0559
573	1487	gene
			locus_tag	LOCUS_10290
573	1487	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202693.1
			protein_id	gnl|my_center|LOCUS_10290
>Feature sequence0560
<1	1334	gene
			locus_tag	LOCUS_10300
<1	1334	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108281.1:threonine synthase
>Feature sequence0561
1525	605	gene
			locus_tag	LOCUS_10310
1525	605	CDS
			product	IS1595 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013529345.1
			protein_id	gnl|my_center|LOCUS_10310
>Feature sequence0562
1170	325	gene
			locus_tag	LOCUS_10320
			gene	pstA
1170	325	CDS
			product	phosphate ABC transporter permease PstA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012582861.1
			protein_id	gnl|my_center|LOCUS_10320
<1702	1178	gene
			locus_tag	LOCUS_10330
<1702	1178	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005656744.1:phosphate ABC transporter permease subunit PstC
>Feature sequence0563
<1	1160	gene
			locus_tag	LOCUS_10340
<1	1160	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963738.1:tRNA lysidine(34) synthetase TilS
<1700	1169	gene
			locus_tag	LOCUS_10350
<1700	1169	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964462.1:saccharopine dehydrogenase C-terminal domain-containing protein
>Feature sequence0564
>Feature sequence0565
323	1345	gene
			locus_tag	LOCUS_10360
323	1345	CDS
			product	AI-2E family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107805.1
			protein_id	gnl|my_center|LOCUS_10360
>Feature sequence0566
<1696	298	gene
			locus_tag	LOCUS_10370
<1696	298	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011072006.1:L,D-transpeptidase family protein
>Feature sequence0567
56	1084	gene
			locus_tag	LOCUS_10380
56	1084	CDS
			product	efflux RND transporter periplasmic adaptor subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005784707.1
			protein_id	gnl|my_center|LOCUS_10380
>Feature sequence0568
>Feature sequence0569
560	1030	gene
			locus_tag	LOCUS_10390
560	1030	CDS
			product	JAB domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107090.1
			protein_id	gnl|my_center|LOCUS_10390
1528	1061	gene
			locus_tag	LOCUS_10400
1528	1061	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10400
>Feature sequence0570
<1	1509	gene
			locus_tag	LOCUS_10410
<1	1509	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011108899.1:alpha-N-acetylglucosaminidase
>Feature sequence0571
>Feature sequence0572
<1	948	gene
			locus_tag	LOCUS_10420
<1	948	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962401.1:homogentisate 1,2-dioxygenase
>Feature sequence0573
<1682	1074	gene
			locus_tag	LOCUS_10430
<1682	1074	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011073343.1:DUF5009 domain-containing protein
>Feature sequence0574
1377	1156	gene
			locus_tag	LOCUS_10440
1377	1156	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10440
>Feature sequence0575
>Feature sequence0576
1388	453	gene
			locus_tag	LOCUS_10450
1388	453	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10450
>Feature sequence0577
142	765	gene
			locus_tag	LOCUS_10460
142	765	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10460
801	1355	gene
			locus_tag	LOCUS_10470
801	1355	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10470
>Feature sequence0578
>Feature sequence0579
>Feature sequence0580
283	879	gene
			locus_tag	LOCUS_10480
			gene	cobC
283	879	CDS
			product	alpha-ribazole phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963576.1
			protein_id	gnl|my_center|LOCUS_10480
933	1079	gene
			locus_tag	LOCUS_10490
933	1079	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10490
>Feature sequence0581
<1	620	gene
			locus_tag	LOCUS_10500
<1	620	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765637.1:4Fe-4S binding protein
>Feature sequence0582
778	74	gene
			locus_tag	LOCUS_10510
778	74	CDS
			product	SAM-dependent methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963342.1
			protein_id	gnl|my_center|LOCUS_10510
1562	792	gene
			locus_tag	LOCUS_10520
1562	792	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10520
>Feature sequence0583
>Feature sequence0584
683	522	gene
			locus_tag	LOCUS_10530
683	522	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10530
<1661	836	gene
			locus_tag	LOCUS_10540
<1661	836	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963291.1:heavy metal translocating P-type ATPase metal-binding domain-containing protein
>Feature sequence0585
370	62	gene
			locus_tag	LOCUS_10550
370	62	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10550
<1658	385	gene
			locus_tag	LOCUS_10560
<1658	385	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963916.1:efflux RND transporter permease subunit
>Feature sequence0586
1196	606	gene
			locus_tag	LOCUS_10570
1196	606	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10570
>Feature sequence0587
879	94	gene
			locus_tag	LOCUS_10580
			gene	surE
879	94	CDS
			product	5'/3'-nucleotidase SurE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964421.1
			protein_id	gnl|my_center|LOCUS_10580
>Feature sequence0588
175	810	gene
			locus_tag	LOCUS_10590
175	810	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10590
1164	880	gene
			locus_tag	LOCUS_10600
1164	880	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10600
1650	1336	gene
			locus_tag	LOCUS_10610
1650	1336	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10610
>Feature sequence0589
<1	696	gene
			locus_tag	LOCUS_10620
<1	696	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962991.1:YebC/PmpR family DNA-binding transcriptional regulator
1150	782	gene
			locus_tag	LOCUS_10630
1150	782	CDS
			product	type II toxin-antitoxin system VapC family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011392206.1
			protein_id	gnl|my_center|LOCUS_10630
1311	1132	gene
			locus_tag	LOCUS_10640
1311	1132	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10640
>Feature sequence0590
<1647	530	gene
			locus_tag	LOCUS_10650
<1647	530	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_106133626.1:TonB-dependent receptor
>Feature sequence0591
1170	337	gene
			locus_tag	LOCUS_10660
1170	337	CDS
			product	glutaminyl-peptide cyclotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002211996.1
			protein_id	gnl|my_center|LOCUS_10660
>Feature sequence0592
<1	1071	gene
			locus_tag	LOCUS_10670
<1	1071	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008764125.1:OstA-like protein
>Feature sequence0593
508	1251	gene
			locus_tag	LOCUS_10680
508	1251	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10680
>Feature sequence0594
7	537	gene
			locus_tag	LOCUS_10690
7	537	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10690
>Feature sequence0595
>Feature sequence0596
<1632	275	gene
			locus_tag	LOCUS_10700
<1632	275	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964580.1:glutamine--tRNA ligase/YqeY domain fusion protein
>Feature sequence0597
74	1363	gene
			locus_tag	LOCUS_10710
74	1363	CDS
			product	anthranilate synthase component I family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963737.1
			protein_id	gnl|my_center|LOCUS_10710
>Feature sequence0598
356	1069	gene
			locus_tag	LOCUS_10720
			gene	pxpA
356	1069	CDS
			product	5-oxoprolinase subunit PxpA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001261793.1
			protein_id	gnl|my_center|LOCUS_10720
>Feature sequence0599
1067	210	gene
			locus_tag	LOCUS_10730
1067	210	CDS
			product	fumarylacetoacetate hydrolase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012061879.1
			protein_id	gnl|my_center|LOCUS_10730
<1627	1088	gene
			locus_tag	LOCUS_10740
<1627	1088	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012584118.1:glucose 1-dehydrogenase
>Feature sequence0600
>Feature sequence0601
<1626	636	gene
			locus_tag	LOCUS_10750
<1626	636	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_236615762.1:amidohydrolase family protein
>Feature sequence0602
>Feature sequence0603
1126	20	gene
			locus_tag	LOCUS_10760
1126	20	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10760
>Feature sequence0604
1069	167	gene
			locus_tag	LOCUS_10770
1069	167	CDS
			product	helix-hairpin-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202005.1
			protein_id	gnl|my_center|LOCUS_10770
<1621	1102	gene
			locus_tag	LOCUS_10780
<1621	1102	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011403269.1:MBL fold metallo-hydrolase
>Feature sequence0605
>Feature sequence0606
882	469	gene
			locus_tag	LOCUS_10790
882	469	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10790
<1620	901	gene
			locus_tag	LOCUS_10800
<1620	901	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000576382.1:DUF5777 family beta-barrel protein
>Feature sequence0607
<1619	954	gene
			locus_tag	LOCUS_10810
<1619	954	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_013384496.1:alpha-E domain-containing protein
>Feature sequence0608
<1618	84	gene
			locus_tag	LOCUS_10820
<1618	84	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203753.1:leucine--tRNA ligase
>Feature sequence0609
<1	535	gene
			locus_tag	LOCUS_10830
<1	535	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_038965326.1:aminotransferase class V-fold PLP-dependent enzyme
1316	618	gene
			locus_tag	LOCUS_10840
1316	618	CDS
			product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011405485.1
			protein_id	gnl|my_center|LOCUS_10840
>Feature sequence0610
>Feature sequence0611
873	475	gene
			locus_tag	LOCUS_10850
873	475	CDS
			product	GxxExxY protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963175.1
			protein_id	gnl|my_center|LOCUS_10850
<1616	930	gene
			locus_tag	LOCUS_10860
<1616	930	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005783731.1:Holliday junction branch migration DNA helicase RuvB
>Feature sequence0612
871	1014	gene
			locus_tag	LOCUS_10870
871	1014	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10870
>Feature sequence0613
32	650	repeat_region
			inference	COORDINATES:alignment:CRT:1.2
			rpt_family	CRISPR
			rpt_type	direct
			rpt_unit_seq	ctttcaatcgcaccatataggaattgaaat
1210	725	gene
			locus_tag	LOCUS_10880
1210	725	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10880
1612	1322	gene
			locus_tag	LOCUS_10890
1612	1322	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10890
>Feature sequence0614
<1613	873	gene
			locus_tag	LOCUS_10900
<1613	873	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_004082978.1:acetate kinase
>Feature sequence0615
169	1020	gene
			locus_tag	LOCUS_10910
169	1020	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011016190.1
			protein_id	gnl|my_center|LOCUS_10910
1023	1340	gene
			locus_tag	LOCUS_10920
1023	1340	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10920
>Feature sequence0616
>Feature sequence0617
>Feature sequence0618
>Feature sequence0619
<1606	74	gene
			locus_tag	LOCUS_10930
<1606	74	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003148287.1:sulfite exporter TauE/SafE family protein
>Feature sequence0620
>Feature sequence0621
286	636	gene
			locus_tag	LOCUS_10940
286	636	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10940
648	1577	gene
			locus_tag	LOCUS_10950
648	1577	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10950
>Feature sequence0622
1017	1268	gene
			locus_tag	LOCUS_10960
			gene	rpsT
1017	1268	CDS
			product	30S ribosomal protein S20
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783989.1
			protein_id	gnl|my_center|LOCUS_10960
>Feature sequence0623
>Feature sequence0624
<1594	869	gene
			locus_tag	LOCUS_10970
<1594	869	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012583020.1:glycoside hydrolase family 31 protein
>Feature sequence0625
234	1121	gene
			locus_tag	LOCUS_10980
			gene	dapA
234	1121	CDS
			product	4-hydroxy-tetrahydrodipicolinate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008761561.1
			protein_id	gnl|my_center|LOCUS_10980
>Feature sequence0626
554	186	gene
			locus_tag	LOCUS_10990
554	186	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_10990
714	1412	gene
			locus_tag	LOCUS_11000
714	1412	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11000
>Feature sequence0627
3	752	gene
			locus_tag	LOCUS_11010
3	752	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11010
756	1499	gene
			locus_tag	LOCUS_11020
756	1499	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11020
>Feature sequence0628
<1	842	gene
			locus_tag	LOCUS_11030
<1	842	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_038744192.1:alkaline phosphatase family protein
<1590	978	gene
			locus_tag	LOCUS_11040
<1590	978	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005784478.1:FAD-dependent oxidoreductase
>Feature sequence0629
>Feature sequence0630
878	348	gene
			locus_tag	LOCUS_11050
878	348	CDS
			product	DUF1080 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007338989.1
			protein_id	gnl|my_center|LOCUS_11050
>Feature sequence0631
>Feature sequence0632
>Feature sequence0633
>Feature sequence0634
>Feature sequence0635
<1584	1034	gene
			locus_tag	LOCUS_11060
<1584	1034	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964527.1:peptidoglycan DD-metalloendopeptidase family protein
>Feature sequence0636
1216	89	gene
			locus_tag	LOCUS_11070
1216	89	CDS
			product	cysteine desulfurase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008588454.1
			protein_id	gnl|my_center|LOCUS_11070
>Feature sequence0637
>Feature sequence0638
<1573	650	gene
			locus_tag	LOCUS_11080
<1573	650	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203679.1:beta-glucosidase BglX
>Feature sequence0639
<1572	382	gene
			locus_tag	LOCUS_11090
<1572	382	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202161.1:glycoside hydrolase family 3 C-terminal domain-containing protein
>Feature sequence0640
1142	516	gene
			locus_tag	LOCUS_11100
1142	516	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004528392.1
			protein_id	gnl|my_center|LOCUS_11100
>Feature sequence0641
854	549	gene
			locus_tag	LOCUS_11110
854	549	CDS
			product	DUF4286 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962251.1
			protein_id	gnl|my_center|LOCUS_11110
<1569	857	gene
			locus_tag	LOCUS_11120
<1569	857	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765510.1:exodeoxyribonuclease III
>Feature sequence0642
>Feature sequence0643
>Feature sequence0644
186	473	gene
			locus_tag	LOCUS_11130
186	473	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11130
766	620	gene
			locus_tag	LOCUS_11140
766	620	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11140
894	1523	gene
			locus_tag	LOCUS_11150
894	1523	CDS
			product	Crp/Fnr family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963290.1
			protein_id	gnl|my_center|LOCUS_11150
>Feature sequence0645
>Feature sequence0646
<1	963	gene
			locus_tag	LOCUS_11160
<1	963	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_118838136.1:histidine kinase
>Feature sequence0647
1519	980	gene
			locus_tag	LOCUS_11170
1519	980	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11170
>Feature sequence0648
<1559	235	gene
			locus_tag	LOCUS_11180
<1559	235	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767220.1:methionine--tRNA ligase
>Feature sequence0649
>Feature sequence0650
>Feature sequence0651
<1	641	gene
			locus_tag	LOCUS_11190
<1	641	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964558.1:uracil phosphoribosyltransferase
>Feature sequence0652
450	983	gene
			locus_tag	LOCUS_11200
450	983	CDS
			product	glutathione peroxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005802164.1
			protein_id	gnl|my_center|LOCUS_11200
>Feature sequence0653
1443	625	gene
			locus_tag	LOCUS_11210
1443	625	CDS
			product	NAD(P)-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013530170.1
			protein_id	gnl|my_center|LOCUS_11210
>Feature sequence0654
<1	633	gene
			locus_tag	LOCUS_11220
<1	633	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_002679079.1:MBL fold metallo-hydrolase
752	1381	gene
			locus_tag	LOCUS_11230
752	1381	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11230
>Feature sequence0655
<1542	46	gene
			locus_tag	LOCUS_11240
<1542	46	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962906.1:ATP-dependent Clp protease ATP-binding subunit
>Feature sequence0656
<1	1003	gene
			locus_tag	LOCUS_11250
<1	1003	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963912.1:adenylosuccinate lyase
>Feature sequence0657
>Feature sequence0658
1539	1225	gene
			locus_tag	LOCUS_11260
1539	1225	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11260
>Feature sequence0659
>Feature sequence0660
>Feature sequence0661
644	174	gene
			locus_tag	LOCUS_11270
			gene	rimP
644	174	CDS
			product	ribosome assembly cofactor RimP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962637.1
			protein_id	gnl|my_center|LOCUS_11270
810	1031	gene
			locus_tag	LOCUS_11280
810	1031	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11280
>Feature sequence0662
>Feature sequence0663
966	514	gene
			locus_tag	LOCUS_11290
966	514	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11290
>Feature sequence0664
<1	1121	gene
			locus_tag	LOCUS_11300
<1	1121	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767085.1:sodium:solute symporter
>Feature sequence0665
>Feature sequence0666
8	388	gene
			locus_tag	LOCUS_11310
8	388	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11310
<1528	454	gene
			locus_tag	LOCUS_11320
<1528	454	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005788733.1:folylpolyglutamate synthase/dihydrofolate synthase family protein
>Feature sequence0667
<1	880	gene
			locus_tag	LOCUS_11330
<1	880	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_106527181.1:aminotransferase class V-fold PLP-dependent enzyme
<1526	886	gene
			locus_tag	LOCUS_11340
<1526	886	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003114921.1:xanthine dehydrogenase family protein molybdopterin-binding subunit
>Feature sequence0668
>Feature sequence0669
<1525	658	gene
			locus_tag	LOCUS_11350
<1525	658	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765881.1:glycosyltransferase family 2 protein
>Feature sequence0670
<1525	548	gene
			locus_tag	LOCUS_11360
<1525	548	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_029446868.1:two-component regulator propeller domain-containing protein
>Feature sequence0671
1305	970	gene
			locus_tag	LOCUS_11370
1305	970	CDS
			product	cupin domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011403747.1
			protein_id	gnl|my_center|LOCUS_11370
>Feature sequence0672
99	455	gene
			locus_tag	LOCUS_11380
99	455	CDS
			product	iron-sulfur cluster assembly accessory protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964483.1
			protein_id	gnl|my_center|LOCUS_11380
655	1377	gene
			locus_tag	LOCUS_11390
			gene	gldF
655	1377	CDS
			product	gliding motility-associated ABC transporter permease subunit GldF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963228.1
			protein_id	gnl|my_center|LOCUS_11390
>Feature sequence0673
>Feature sequence0674
<1	1278	gene
			locus_tag	LOCUS_11400
<1	1278	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010920248.1:CusA/CzcA family heavy metal efflux RND transporter
>Feature sequence0675
<1517	427	gene
			locus_tag	LOCUS_11410
<1517	427	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_001221646.1:glycosyltransferase
>Feature sequence0676
98	1306	gene
			locus_tag	LOCUS_11420
98	1306	CDS
			product	ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964503.1
			protein_id	gnl|my_center|LOCUS_11420
>Feature sequence0677
>Feature sequence0678
242	1255	gene
			locus_tag	LOCUS_11430
			gene	gap
242	1255	CDS
			product	type I glyceraldehyde-3-phosphate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011016560.1
			protein_id	gnl|my_center|LOCUS_11430
>Feature sequence0679
<1	1035	gene
			locus_tag	LOCUS_11440
<1	1035	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_138280268.1:FecR family protein
>Feature sequence0680
<1507	127	gene
			locus_tag	LOCUS_11450
<1507	127	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963618.1:outer membrane beta-barrel family protein
>Feature sequence0681
>Feature sequence0682
146	952	gene
			locus_tag	LOCUS_11460
146	952	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11460
1163	1414	gene
			locus_tag	LOCUS_11470
1163	1414	CDS
			product	type II toxin-antitoxin system ParD family antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010918759.1
			protein_id	gnl|my_center|LOCUS_11470
>Feature sequence0683
111	1028	gene
			locus_tag	LOCUS_11480
111	1028	CDS
			product	AraC family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008767385.1
			protein_id	gnl|my_center|LOCUS_11480
>Feature sequence0684
>Feature sequence0685
<1	1317	gene
			locus_tag	LOCUS_11490
<1	1317	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011109132.1:glycoside hydrolase family 28 protein
>Feature sequence0686
287	1210	gene
			locus_tag	LOCUS_11500
287	1210	CDS
			product	rhomboid family intramembrane serine protease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963287.1
			protein_id	gnl|my_center|LOCUS_11500
>Feature sequence0687
<1	1221	gene
			locus_tag	LOCUS_11510
<1	1221	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_013533356.1:M20 family metallopeptidase
>Feature sequence0688
>Feature sequence0689
181	798	gene
			locus_tag	LOCUS_11520
181	798	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, internal stop codon
			protein_id	gnl|my_center|LOCUS_11520
>Feature sequence0690
>Feature sequence0691
578	306	gene
			locus_tag	LOCUS_11530
578	306	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11530
<1492	741	gene
			locus_tag	LOCUS_11540
<1492	741	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963211.1:PglZ domain-containing protein
>Feature sequence0692
1130	333	gene
			locus_tag	LOCUS_11550
1130	333	CDS
			product	nitrilase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_143916869.1
			protein_id	gnl|my_center|LOCUS_11550
>Feature sequence0693
>Feature sequence0694
>Feature sequence0695
<1	868	gene
			locus_tag	LOCUS_11560
<1	868	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010932909.1:phosphoribosylformylglycinamidine synthase subunit PurL
>Feature sequence0696
341	1120	gene
			locus_tag	LOCUS_11570
341	1120	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11570
>Feature sequence0697
>Feature sequence0698
441	1103	gene
			locus_tag	LOCUS_11580
441	1103	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11580
1264	1106	gene
			locus_tag	LOCUS_11590
1264	1106	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11590
>Feature sequence0699
>Feature sequence0700
59	280	gene
			locus_tag	LOCUS_11600
59	280	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11600
1217	273	gene
			locus_tag	LOCUS_11610
1217	273	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11610
>Feature sequence0701
>Feature sequence0702
1395	1081	gene
			locus_tag	LOCUS_11620
1395	1081	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11620
>Feature sequence0703
>Feature sequence0704
<1	762	gene
			locus_tag	LOCUS_11630
<1	762	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963426.1:dTDP-glucose 4,6-dehydratase
840	1397	gene
			locus_tag	LOCUS_11640
			gene	rfbC
840	1397	CDS
			product	dTDP-4-dehydrorhamnose 3,5-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964566.1
			protein_id	gnl|my_center|LOCUS_11640
>Feature sequence0705
209	607	gene
			locus_tag	LOCUS_11650
209	607	CDS
			product	four helix bundle protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011404040.1
			protein_id	gnl|my_center|LOCUS_11650
>Feature sequence0706
728	375	gene
			locus_tag	LOCUS_11660
728	375	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11660
826	1260	gene
			locus_tag	LOCUS_11670
826	1260	CDS
			product	type I restriction enzyme HsdR N-terminal domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963199.1
			protein_id	gnl|my_center|LOCUS_11670
>Feature sequence0707
792	193	gene
			locus_tag	LOCUS_11680
			gene	hisH
792	193	CDS
			product	imidazole glycerol phosphate synthase subunit HisH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005803062.1
			protein_id	gnl|my_center|LOCUS_11680
820	893	gene
			locus_tag	LOCUS_t00160
820	893	tRNA
			product	tRNA-Gly
			inference	COORDINATES:profile:Aragorn:1.2.38
<1470	896	gene
			locus_tag	LOCUS_11690
<1470	896	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765046.1:tryptophan synthase subunit alpha
>Feature sequence0708
351	896	gene
			locus_tag	LOCUS_11700
351	896	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11700
1444	989	gene
			locus_tag	LOCUS_11710
1444	989	CDS
			product	peptidylprolyl isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010933554.1
			protein_id	gnl|my_center|LOCUS_11710
>Feature sequence0709
>Feature sequence0710
1032	511	gene
			locus_tag	LOCUS_11720
1032	511	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11720
>Feature sequence0711
1021	530	gene
			locus_tag	LOCUS_11730
1021	530	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11730
>Feature sequence0712
1109	606	gene
			locus_tag	LOCUS_11740
1109	606	CDS
			product	YdeI/OmpD-associated family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005788988.1
			protein_id	gnl|my_center|LOCUS_11740
>Feature sequence0713
>Feature sequence0714
>Feature sequence0715
>Feature sequence0716
<1	1459	gene
			locus_tag	LOCUS_11750
<1	1459	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010867265.1:amidohydrolase family protein
>Feature sequence0717
1172	261	gene
			locus_tag	LOCUS_11760
1172	261	CDS
			product	DUF5777 family beta-barrel protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000576382.1
			protein_id	gnl|my_center|LOCUS_11760
>Feature sequence0718
>Feature sequence0719
>Feature sequence0720
<1453	28	gene
			locus_tag	LOCUS_11770
<1453	28	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_224134611.1:cell division protein FtsZ
>Feature sequence0721
2	1048	gene
			locus_tag	LOCUS_11780
2	1048	CDS
			product	HlyD family secretion protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962667.1
			protein_id	gnl|my_center|LOCUS_11780
>Feature sequence0722
1	150	gene
			locus_tag	LOCUS_11790
1	150	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11790
259	942	gene
			locus_tag	LOCUS_11800
259	942	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005783816.1
			protein_id	gnl|my_center|LOCUS_11800
>Feature sequence0723
1357	20	gene
			locus_tag	LOCUS_11810
1357	20	CDS
			product	aspartate aminotransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005481438.1
			protein_id	gnl|my_center|LOCUS_11810
>Feature sequence0724
1086	262	gene
			locus_tag	LOCUS_11820
1086	262	CDS
			product	lipid A biosynthesis protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963017.1
			protein_id	gnl|my_center|LOCUS_11820
>Feature sequence0725
654	1439	gene
			locus_tag	LOCUS_11830
			gene	bamD
654	1439	CDS
			product	outer membrane protein assembly factor BamD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763159.1
			protein_id	gnl|my_center|LOCUS_11830
>Feature sequence0726
1210	179	gene
			locus_tag	LOCUS_11840
			gene	pheS
1210	179	CDS
			product	phenylalanine--tRNA ligase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008763378.1
			protein_id	gnl|my_center|LOCUS_11840
>Feature sequence0727
>Feature sequence0728
115	609	gene
			locus_tag	LOCUS_11850
115	609	CDS
			product	F0F1 ATP synthase subunit B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964547.1
			protein_id	gnl|my_center|LOCUS_11850
613	1173	gene
			locus_tag	LOCUS_11860
			gene	atpH
613	1173	CDS
			product	ATP synthase F1 subunit delta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964546.1
			protein_id	gnl|my_center|LOCUS_11860
>Feature sequence0729
<1442	841	gene
			locus_tag	LOCUS_11870
<1442	841	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005800633.1:galactokinase
>Feature sequence0730
631	71	gene
			locus_tag	LOCUS_11880
631	71	CDS
			product	UbiX family flavin prenyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869594.1
			protein_id	gnl|my_center|LOCUS_11880
707	1189	gene
			locus_tag	LOCUS_11890
707	1189	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11890
>Feature sequence0731
256	17	gene
			locus_tag	LOCUS_11900
256	17	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11900
<1441	331	gene
			locus_tag	LOCUS_11910
<1441	331	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964503.1:ABC transporter permease
>Feature sequence0732
>Feature sequence0733
710	318	gene
			locus_tag	LOCUS_11920
710	318	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11920
957	1247	gene
			locus_tag	LOCUS_11930
957	1247	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11930
>Feature sequence0734
<1	579	gene
			locus_tag	LOCUS_11940
<1	579	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010968098.1:NAD(P)-dependent oxidoreductase
646	1215	gene
			locus_tag	LOCUS_11950
646	1215	CDS
			product	YeeE/YedE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010889422.1
			protein_id	gnl|my_center|LOCUS_11950
>Feature sequence0735
<1	518	gene
			locus_tag	LOCUS_11960
<1	518	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005782842.1:RNA methyltransferase
>Feature sequence0736
>Feature sequence0737
<1435	591	gene
			locus_tag	LOCUS_11970
<1435	591	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_218080540.1:amidohydrolase family protein
>Feature sequence0738
>Feature sequence0739
>Feature sequence0740
940	512	gene
			locus_tag	LOCUS_11980
940	512	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	possible pseudo, frameshifted
			protein_id	gnl|my_center|LOCUS_11980
>Feature sequence0741
1191	958	gene
			locus_tag	LOCUS_11990
1191	958	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_11990
>Feature sequence0742
<1	979	gene
			locus_tag	LOCUS_12000
<1	979	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202268.1:TonB-dependent receptor
>Feature sequence0743
<1424	725	gene
			locus_tag	LOCUS_12010
<1424	725	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_038744192.1:alkaline phosphatase family protein
>Feature sequence0744
>Feature sequence0745
144	596	gene
			locus_tag	LOCUS_12020
144	596	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010965831.1
			protein_id	gnl|my_center|LOCUS_12020
1158	751	gene
			locus_tag	LOCUS_12030
1158	751	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12030
1270	1199	gene
			locus_tag	LOCUS_t00170
1270	1199	tRNA
			product	tRNA-Cys
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0746
345	163	gene
			locus_tag	LOCUS_12040
345	163	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12040
1375	350	gene
			locus_tag	LOCUS_12050
			gene	metX
1375	350	CDS
			product	homoserine O-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010932292.1
			protein_id	gnl|my_center|LOCUS_12050
>Feature sequence0747
112	654	gene
			locus_tag	LOCUS_12060
112	654	CDS
			product	LemA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008764419.1
			protein_id	gnl|my_center|LOCUS_12060
673	1134	gene
			locus_tag	LOCUS_12070
673	1134	CDS
			product	TPM domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964049.1
			protein_id	gnl|my_center|LOCUS_12070
>Feature sequence0748
>Feature sequence0749
1326	523	gene
			locus_tag	LOCUS_12080
1326	523	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12080
>Feature sequence0750
>Feature sequence0751
<1414	530	gene
			locus_tag	LOCUS_12090
<1414	530	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010878303.1:diaminopimelate decarboxylase
>Feature sequence0752
<1	591	gene
			locus_tag	LOCUS_12100
<1	591	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011404915.1:cytochrome c biogenesis protein CcsA
584	796	gene
			locus_tag	LOCUS_12110
584	796	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12110
>Feature sequence0753
<1407	50	gene
			locus_tag	LOCUS_12120
<1407	50	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107841.1:DUF5686 and carboxypeptidase-like regulatory domain-containing protein
>Feature sequence0754
>Feature sequence0755
<1	510	gene
			locus_tag	LOCUS_12130
<1	510	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963929.1:quinone-dependent dihydroorotate dehydrogenase
1095	940	gene
			locus_tag	LOCUS_12140
1095	940	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12140
1046	1312	gene
			locus_tag	LOCUS_12150
1046	1312	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12150
>Feature sequence0756
<1402	462	gene
			locus_tag	LOCUS_12160
<1402	462	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005802867.1:DNA polymerase III subunit gamma/tau
			note	possible pseudo, frameshifted
>Feature sequence0757
>Feature sequence0758
<1399	867	gene
			locus_tag	LOCUS_12170
<1399	867	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005814588.1:GNAT family N-acetyltransferase
>Feature sequence0759
2	229	gene
			locus_tag	LOCUS_12180
2	229	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12180
1136	261	gene
			locus_tag	LOCUS_12190
			gene	cynR
1136	261	CDS
			product	transcriptional regulator CynR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012256690.1
			protein_id	gnl|my_center|LOCUS_12190
>Feature sequence0760
902	273	gene
			locus_tag	LOCUS_12200
902	273	CDS
			product	thiamine phosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005788060.1
			protein_id	gnl|my_center|LOCUS_12200
>Feature sequence0761
<1	859	gene
			locus_tag	LOCUS_12210
<1	859	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010980127.1:cbb3-type cytochrome c oxidase subunit I
>Feature sequence0762
862	227	gene
			locus_tag	LOCUS_12220
862	227	CDS
			product	MarC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005778522.1
			protein_id	gnl|my_center|LOCUS_12220
1308	994	gene
			locus_tag	LOCUS_12230
1308	994	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12230
>Feature sequence0763
<1	612	gene
			locus_tag	LOCUS_12240
<1	612	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010941110.1:aminofutalosine synthase MqnE
1105	731	gene
			locus_tag	LOCUS_12250
1105	731	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12250
>Feature sequence0764
>Feature sequence0765
272	84	gene
			locus_tag	LOCUS_12260
272	84	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12260
>Feature sequence0766
>Feature sequence0767
1305	403	gene
			locus_tag	LOCUS_12270
1305	403	CDS
			product	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011704703.1
			protein_id	gnl|my_center|LOCUS_12270
>Feature sequence0768
1306	581	gene
			locus_tag	LOCUS_12280
1306	581	CDS
			product	2-phosphosulfolactate phosphatase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004080870.1
			protein_id	gnl|my_center|LOCUS_12280
>Feature sequence0769
851	228	gene
			locus_tag	LOCUS_12290
851	228	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12290
>Feature sequence0770
743	192	gene
			locus_tag	LOCUS_12300
743	192	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12300
1039	881	gene
			locus_tag	LOCUS_12310
1039	881	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12310
>Feature sequence0771
1039	296	gene
			locus_tag	LOCUS_12320
1039	296	CDS
			product	electron transfer flavoprotein subunit beta/FixA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962507.1
			protein_id	gnl|my_center|LOCUS_12320
>Feature sequence0772
>Feature sequence0773
<1391	50	gene
			locus_tag	LOCUS_12330
<1391	50	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_013099283.1:ketol-acid reductoisomerase
>Feature sequence0774
<1390	262	gene
			locus_tag	LOCUS_12340
<1390	262	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203214.1:phosphoglycerate kinase
>Feature sequence0775
>Feature sequence0776
<1	983	gene
			locus_tag	LOCUS_12350
<1	983	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963529.1:bacillithiol biosynthesis cysteine-adding enzyme BshC
>Feature sequence0777
>Feature sequence0778
292	1224	gene
			locus_tag	LOCUS_12360
292	1224	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12360
>Feature sequence0779
>Feature sequence0780
959	189	gene
			locus_tag	LOCUS_12370
959	189	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12370
>Feature sequence0781
<1385	16	gene
			locus_tag	LOCUS_12380
<1385	16	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008764299.1:NADH-quinone oxidoreductase subunit L
>Feature sequence0782
129	1151	gene
			locus_tag	LOCUS_12390
129	1151	CDS
			product	aldose 1-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_052846458.1
			protein_id	gnl|my_center|LOCUS_12390
>Feature sequence0783
<1	955	gene
			locus_tag	LOCUS_12400
<1	955	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_205421524.1:amidase
>Feature sequence0784
685	59	gene
			locus_tag	LOCUS_12410
685	59	CDS
			product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000695801.1
			protein_id	gnl|my_center|LOCUS_12410
>Feature sequence0785
>Feature sequence0786
603	184	gene
			locus_tag	LOCUS_12420
			gene	tsaE
603	184	CDS
			product	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005784762.1
			protein_id	gnl|my_center|LOCUS_12420
>Feature sequence0787
>Feature sequence0788
<1	1163	gene
			locus_tag	LOCUS_12430
<1	1163	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010963345.1:DUF1015 domain-containing protein
>Feature sequence0789
>Feature sequence0790
694	1224	gene
			locus_tag	LOCUS_12440
694	1224	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12440
>Feature sequence0791
356	898	gene
			locus_tag	LOCUS_12450
356	898	CDS
			product	hydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012582501.1
			protein_id	gnl|my_center|LOCUS_12450
>Feature sequence0792
626	928	gene
			locus_tag	LOCUS_12460
626	928	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12460
>Feature sequence0793
<1376	494	gene
			locus_tag	LOCUS_12470
<1376	494	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_162179062.1:LD-carboxypeptidase
>Feature sequence0794
>Feature sequence0795
531	1085	gene
			locus_tag	LOCUS_12480
			gene	gmhB
531	1085	CDS
			product	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107287.1
			protein_id	gnl|my_center|LOCUS_12480
>Feature sequence0796
1209	223	gene
			locus_tag	LOCUS_12490
1209	223	CDS
			product	lysylphosphatidylglycerol synthase domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962386.1
			protein_id	gnl|my_center|LOCUS_12490
>Feature sequence0797
>Feature sequence0798
<1	684	gene
			locus_tag	LOCUS_12500
<1	684	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008760516.1:ATP phosphoribosyltransferase
>Feature sequence0799
>Feature sequence0800
<1360	547	gene
			locus_tag	LOCUS_12510
<1360	547	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011403981.1:aldehyde dehydrogenase family protein
>Feature sequence0801
>Feature sequence0802
>Feature sequence0803
<1	1199	gene
			locus_tag	LOCUS_12520
<1	1199	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963977.1:isocitrate dehydrogenase (NADP(+))
>Feature sequence0804
>Feature sequence0805
>Feature sequence0806
593	243	gene
			locus_tag	LOCUS_12530
593	243	CDS
			product	NADH-quinone oxidoreductase subunit A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005775585.1
			protein_id	gnl|my_center|LOCUS_12530
<1353	769	gene
			locus_tag	LOCUS_12540
<1353	769	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase
>Feature sequence0807
>Feature sequence0808
>Feature sequence0809
<1	786	gene
			locus_tag	LOCUS_12550
<1	786	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008760893.1:TonB-dependent receptor
>Feature sequence0810
>Feature sequence0811
>Feature sequence0812
>Feature sequence0813
>Feature sequence0814
456	866	gene
			locus_tag	LOCUS_12560
			gene	rpsK
456	866	CDS
			product	30S ribosomal protein S11
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963447.1
			protein_id	gnl|my_center|LOCUS_12560
>Feature sequence0815
<1	748	gene
			locus_tag	LOCUS_12570
<1	748	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000786086.1:threonine--tRNA ligase
>Feature sequence0816
572	1021	gene
			locus_tag	LOCUS_12580
572	1021	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12580
1033	1323	gene
			locus_tag	LOCUS_12590
1033	1323	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12590
>Feature sequence0817
705	211	gene
			locus_tag	LOCUS_12600
705	211	CDS
			product	SRPBCC domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013226555.1
			protein_id	gnl|my_center|LOCUS_12600
>Feature sequence0818
<1	1144	gene
			locus_tag	LOCUS_12610
<1	1144	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008763196.1:2-isopropylmalate synthase
>Feature sequence0819
>Feature sequence0820
>Feature sequence0821
>Feature sequence0822
374	811	gene
			locus_tag	LOCUS_12620
374	811	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12620
>Feature sequence0823
<1	797	gene
			locus_tag	LOCUS_12630
<1	797	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_206578673.1:LacI family DNA-binding transcriptional regulator
<1326	794	gene
			locus_tag	LOCUS_12640
<1326	794	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008760645.1:NUDIX domain-containing protein
>Feature sequence0824
1322	396	gene
			locus_tag	LOCUS_12650
1322	396	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12650
>Feature sequence0825
782	120	gene
			locus_tag	LOCUS_12660
782	120	CDS
			product	metalloregulator ArsR/SmtB family transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004537687.1
			protein_id	gnl|my_center|LOCUS_12660
>Feature sequence0826
635	423	gene
			locus_tag	LOCUS_12670
635	423	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12670
941	642	gene
			locus_tag	LOCUS_12680
			gene	trxA
941	642	CDS
			product	thioredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963919.1
			protein_id	gnl|my_center|LOCUS_12680
>Feature sequence0827
<1318	185	gene
			locus_tag	LOCUS_12690
<1318	185	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_103036562.1:TonB-dependent receptor
>Feature sequence0828
>Feature sequence0829
>Feature sequence0830
153	605	gene
			locus_tag	LOCUS_12700
			gene	dtd
153	605	CDS
			product	D-aminoacyl-tRNA deacylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962422.1
			protein_id	gnl|my_center|LOCUS_12700
646	981	gene
			locus_tag	LOCUS_12710
646	981	CDS
			product	nucleotide pyrophosphohydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962417.1
			protein_id	gnl|my_center|LOCUS_12710
>Feature sequence0831
253	1152	gene
			locus_tag	LOCUS_12720
			gene	nusB
253	1152	CDS
			product	transcription antitermination factor NusB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962698.1
			protein_id	gnl|my_center|LOCUS_12720
>Feature sequence0832
783	85	gene
			locus_tag	LOCUS_12730
783	85	CDS
			product	TIGR04283 family arsenosugar biosynthesis glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010933083.1
			protein_id	gnl|my_center|LOCUS_12730
<1311	780	gene
			locus_tag	LOCUS_12740
<1311	780	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010933082.1:TIGR04282 family arsenosugar biosynthesis glycosyltransferase
>Feature sequence0833
>Feature sequence0834
<1	636	gene
			locus_tag	LOCUS_12750
<1	636	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107216.1:RagB/SusD family nutrient uptake outer membrane protein
>Feature sequence0835
<1	556	gene
			locus_tag	LOCUS_12760
<1	556	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011405558.1:histidine kinase
>Feature sequence0836
540	40	gene
			locus_tag	LOCUS_12770
540	40	CDS
			product	Lrp/AsnC family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963844.1
			protein_id	gnl|my_center|LOCUS_12770
>Feature sequence0837
<1	890	gene
			locus_tag	LOCUS_12780
<1	890	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011140949.1:MBOAT family protein
>Feature sequence0838
>Feature sequence0839
>Feature sequence0840
>Feature sequence0841
<1	930	gene
			locus_tag	LOCUS_12790
<1	930	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011120634.1:glycosyhydrolase
>Feature sequence0842
<1	936	gene
			locus_tag	LOCUS_12800
<1	936	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012582837.1:family 16 glycosylhydrolase
>Feature sequence0843
436	750	gene
			locus_tag	LOCUS_12810
436	750	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12810
>Feature sequence0844
>Feature sequence0845
>Feature sequence0846
111	638	gene
			locus_tag	LOCUS_12820
111	638	CDS
			product	YceI family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_089711913.1
			protein_id	gnl|my_center|LOCUS_12820
674	1240	gene
			locus_tag	LOCUS_12830
674	1240	CDS
			product	NAD(P)H-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005080770.1
			protein_id	gnl|my_center|LOCUS_12830
>Feature sequence0847
>Feature sequence0848
>Feature sequence0849
<1286	482	gene
			locus_tag	LOCUS_12840
<1286	482	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008769569.1:histidine kinase
>Feature sequence0850
185	586	gene
			locus_tag	LOCUS_12850
185	586	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12850
772	1239	gene
			locus_tag	LOCUS_12860
772	1239	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12860
>Feature sequence0851
1105	365	gene
			locus_tag	LOCUS_12870
1105	365	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12870
>Feature sequence0852
>Feature sequence0853
<1	730	gene
			locus_tag	LOCUS_12880
<1	730	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003356351.1:LacI family DNA-binding transcriptional regulator
>Feature sequence0854
<1280	517	gene
			locus_tag	LOCUS_12890
<1280	517	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202496.1:TonB-dependent receptor
>Feature sequence0855
<1279	197	gene
			locus_tag	LOCUS_12900
<1279	197	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962672.1:tryptophan synthase subunit beta
>Feature sequence0856
>Feature sequence0857
>Feature sequence0858
3	602	gene
			locus_tag	LOCUS_12910
3	602	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12910
>Feature sequence0859
3	170	gene
			locus_tag	LOCUS_12920
3	170	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12920
>Feature sequence0860
1273	608	gene
			locus_tag	LOCUS_12930
1273	608	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12930
>Feature sequence0861
707	288	gene
			locus_tag	LOCUS_12940
707	288	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12940
>Feature sequence0862
333	767	gene
			locus_tag	LOCUS_12950
333	767	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_12950
>Feature sequence0863
>Feature sequence0864
530	602	gene
			locus_tag	LOCUS_t00180
530	602	tRNA
			product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
>Feature sequence0865
710	75	gene
			locus_tag	LOCUS_12960
710	75	CDS
			product	LysE family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964578.1
			protein_id	gnl|my_center|LOCUS_12960
<1268	741	gene
			locus_tag	LOCUS_12970
<1268	741	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005783832.1:GH3 auxin-responsive promoter family protein
>Feature sequence0866
>Feature sequence0867
238	1131	gene
			locus_tag	LOCUS_12980
238	1131	CDS
			product	TIM barrel protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011123560.1
			protein_id	gnl|my_center|LOCUS_12980
>Feature sequence0868
<1	959	gene
			locus_tag	LOCUS_12990
<1	959	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767105.1:NPCBM/NEW2 domain-containing protein
>Feature sequence0869
745	542	gene
			locus_tag	LOCUS_13000
745	542	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13000
>Feature sequence0870
189	842	gene
			locus_tag	LOCUS_13010
			gene	plsY
189	842	CDS
			product	glycerol-3-phosphate 1-O-acyltransferase PlsY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011016461.1
			protein_id	gnl|my_center|LOCUS_13010
>Feature sequence0871
>Feature sequence0872
327	929	gene
			locus_tag	LOCUS_13020
327	929	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13020
933	1235	gene
			locus_tag	LOCUS_13030
933	1235	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13030
>Feature sequence0873
>Feature sequence0874
>Feature sequence0875
73	552	gene
			locus_tag	LOCUS_13040
73	552	CDS
			product	lipocalin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010942963.1
			protein_id	gnl|my_center|LOCUS_13040
563	1000	gene
			locus_tag	LOCUS_13050
563	1000	CDS
			product	pyrimidine dimer DNA glycosylase/endonuclease V
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_152268637.1
			protein_id	gnl|my_center|LOCUS_13050
>Feature sequence0876
>Feature sequence0877
<1	1017	gene
			locus_tag	LOCUS_13060
<1	1017	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_042402692.1:phosphotransferase
>Feature sequence0878
>Feature sequence0879
>Feature sequence0880
>Feature sequence0881
>Feature sequence0882
>Feature sequence0883
>Feature sequence0884
646	107	gene
			locus_tag	LOCUS_13070
			gene	hpt
646	107	CDS
			product	hypoxanthine phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008760055.1
			protein_id	gnl|my_center|LOCUS_13070
>Feature sequence0885
571	311	gene
			locus_tag	LOCUS_13080
571	311	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13080
908	591	gene
			locus_tag	LOCUS_13090
908	591	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13090
1074	919	gene
			locus_tag	LOCUS_13100
1074	919	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13100
>Feature sequence0886
948	421	gene
			locus_tag	LOCUS_13110
948	421	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004527197.1
			protein_id	gnl|my_center|LOCUS_13110
>Feature sequence0887
105	536	gene
			locus_tag	LOCUS_13120
105	536	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13120
1226	753	gene
			locus_tag	LOCUS_13130
1226	753	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13130
>Feature sequence0888
>Feature sequence0889
1183	857	gene
			locus_tag	LOCUS_13140
1183	857	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13140
>Feature sequence0890
314	922	gene
			locus_tag	LOCUS_13150
314	922	CDS
			product	pseudouridine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964094.1
			protein_id	gnl|my_center|LOCUS_13150
>Feature sequence0891
>Feature sequence0892
1028	318	gene
			locus_tag	LOCUS_13160
1028	318	CDS
			product	NAD-dependent deacylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963913.1
			protein_id	gnl|my_center|LOCUS_13160
>Feature sequence0893
229	489	gene
			locus_tag	LOCUS_13170
229	489	CDS
			product	SemiSWEET transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011089200.1
			protein_id	gnl|my_center|LOCUS_13170
837	616	gene
			locus_tag	LOCUS_13180
837	616	CDS
			product	DUF2795 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002558131.1
			protein_id	gnl|my_center|LOCUS_13180
>Feature sequence0894
>Feature sequence0895
<1	1022	gene
			locus_tag	LOCUS_13190
<1	1022	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963471.1:elongation factor G
>Feature sequence0896
>Feature sequence0897
1148	390	gene
			locus_tag	LOCUS_13200
1148	390	CDS
			product	succinate dehydrogenase/fumarate reductase cytochrome b subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008761733.1
			protein_id	gnl|my_center|LOCUS_13200
>Feature sequence0898
<1	944	gene
			locus_tag	LOCUS_13210
<1	944	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963960.1:YihY/virulence factor BrkB family protein
>Feature sequence0899
<1222	515	gene
			locus_tag	LOCUS_13220
<1222	515	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000028204.1:isocitrate lyase/phosphoenolpyruvate mutase family protein
>Feature sequence0900
<1221	655	gene
			locus_tag	LOCUS_13230
<1221	655	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107327.1:ABC transporter permease
>Feature sequence0901
>Feature sequence0902
>Feature sequence0903
<1	896	gene
			locus_tag	LOCUS_13240
<1	896	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963326.1:DUF2851 family protein
>Feature sequence0904
>Feature sequence0905
>Feature sequence0906
83	1006	gene
			locus_tag	LOCUS_13250
83	1006	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13250
>Feature sequence0907
>Feature sequence0908
1156	584	gene
			locus_tag	LOCUS_13260
1156	584	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13260
>Feature sequence0909
>Feature sequence0910
893	687	gene
			locus_tag	LOCUS_13270
893	687	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13270
>Feature sequence0911
989	69	gene
			locus_tag	LOCUS_13280
989	69	CDS
			product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010966350.1
			protein_id	gnl|my_center|LOCUS_13280
>Feature sequence0912
200	1156	gene
			locus_tag	LOCUS_13290
			gene	fmt
200	1156	CDS
			product	methionyl-tRNA formyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008770001.1
			protein_id	gnl|my_center|LOCUS_13290
>Feature sequence0913
>Feature sequence0914
>Feature sequence0915
1010	72	gene
			locus_tag	LOCUS_13300
			gene	rsmH
1010	72	CDS
			product	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_172605046.1
			protein_id	gnl|my_center|LOCUS_13300
1208	1026	gene
			locus_tag	LOCUS_13310
1208	1026	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13310
>Feature sequence0916
>Feature sequence0917
864	181	gene
			locus_tag	LOCUS_13320
864	181	CDS
			product	metal-dependent hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003245964.1
			protein_id	gnl|my_center|LOCUS_13320
>Feature sequence0918
<1	697	gene
			locus_tag	LOCUS_13330
<1	697	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005455502.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
>Feature sequence0919
<1	765	gene
			locus_tag	LOCUS_13340
<1	765	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203495.1:S-adenosylmethionine:tRNA ribosyltransferase-isomerase
>Feature sequence0920
<1205	188	gene
			locus_tag	LOCUS_13350
<1205	188	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011144406.1:M20/M25/M40 family metallo-hydrolase
>Feature sequence0921
1121	303	gene
			locus_tag	LOCUS_13360
1121	303	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13360
>Feature sequence0922
>Feature sequence0923
>Feature sequence0924
>Feature sequence0925
<1	806	gene
			locus_tag	LOCUS_13370
<1	806	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011027183.1:Gfo/Idh/MocA family oxidoreductase
>Feature sequence0926
617	447	gene
			locus_tag	LOCUS_13380
617	447	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13380
<1202	701	gene
			locus_tag	LOCUS_13390
<1202	701	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964065.1:ribosome biogenesis GTPase Der
>Feature sequence0927
<1202	471	gene
			locus_tag	LOCUS_13400
<1202	471	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005785778.1:putative sulfate exporter family transporter
>Feature sequence0928
<1201	522	gene
			locus_tag	LOCUS_13410
<1201	522	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008761569.1:VWA domain-containing protein
>Feature sequence0929
>Feature sequence0930
2	1030	gene
			locus_tag	LOCUS_13420
2	1030	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13420
>Feature sequence0931
<1	822	gene
			locus_tag	LOCUS_13430
<1	822	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962341.1:dihydroorotase
>Feature sequence0932
<1	577	gene
			locus_tag	LOCUS_13440
<1	577	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963545.1:ABC transporter ATP-binding protein
657	920	gene
			locus_tag	LOCUS_13450
657	920	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13450
>Feature sequence0933
<1	1074	gene
			locus_tag	LOCUS_13460
<1	1074	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008765042.1:sugar transferase
>Feature sequence0934
>Feature sequence0935
>Feature sequence0936
>Feature sequence0937
317	123	gene
			locus_tag	LOCUS_13470
			gene	rpmF
317	123	CDS
			product	50S ribosomal protein L32
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964469.1
			protein_id	gnl|my_center|LOCUS_13470
887	345	gene
			locus_tag	LOCUS_13480
887	345	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13480
>Feature sequence0938
>Feature sequence0939
250	831	gene
			locus_tag	LOCUS_13490
250	831	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13490
>Feature sequence0940
691	1014	gene
			locus_tag	LOCUS_13500
691	1014	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13500
>Feature sequence0941
>Feature sequence0942
50	787	gene
			locus_tag	LOCUS_13510
50	787	CDS
			product	thioredoxin domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964101.1
			protein_id	gnl|my_center|LOCUS_13510
900	1175	gene
			locus_tag	LOCUS_13520
900	1175	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13520
>Feature sequence0943
217	612	gene
			locus_tag	LOCUS_13530
217	612	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13530
<1192	613	gene
			locus_tag	LOCUS_13540
<1192	613	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964090.1:ion channel
>Feature sequence0944
>Feature sequence0945
>Feature sequence0946
<1	567	gene
			locus_tag	LOCUS_13550
<1	567	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963246.1:excinuclease ABC subunit UvrA
704	922	gene
			locus_tag	LOCUS_13560
			gene	infA
704	922	CDS
			product	translation initiation factor IF-1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002558052.1
			protein_id	gnl|my_center|LOCUS_13560
>Feature sequence0947
>Feature sequence0948
641	39	gene
			locus_tag	LOCUS_13570
641	39	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962857.1
			protein_id	gnl|my_center|LOCUS_13570
>Feature sequence0949
>Feature sequence0950
<1184	616	gene
			locus_tag	LOCUS_13580
<1184	616	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_108636457.1:AsmA-like C-terminal region-containing protein
>Feature sequence0951
677	18	gene
			locus_tag	LOCUS_13590
677	18	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13590
>Feature sequence0952
1038	283	gene
			locus_tag	LOCUS_13600
			gene	rsmA
1038	283	CDS
			product	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962249.1
			protein_id	gnl|my_center|LOCUS_13600
>Feature sequence0953
868	224	gene
			locus_tag	LOCUS_13610
			gene	aat
868	224	CDS
			product	leucyl/phenylalanyl-tRNA--protein transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964441.1
			protein_id	gnl|my_center|LOCUS_13610
1182	925	gene
			locus_tag	LOCUS_13620
1182	925	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13620
>Feature sequence0954
>Feature sequence0955
>Feature sequence0956
>Feature sequence0957
<1	598	gene
			locus_tag	LOCUS_13630
<1	598	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_003100071.1:Tex family protein
>Feature sequence0958
<1173	512	gene
			locus_tag	LOCUS_13640
<1173	512	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010979494.1:acetolactate synthase large subunit
>Feature sequence0959
>Feature sequence0960
378	305	gene
			locus_tag	LOCUS_t00190
378	305	tRNA
			product	tRNA-Phe
			inference	COORDINATES:profile:Aragorn:1.2.38
<1172	453	gene
			locus_tag	LOCUS_13650
<1172	453	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964340.1:asparagine--tRNA ligase
>Feature sequence0961
>Feature sequence0962
>Feature sequence0963
>Feature sequence0964
180	821	gene
			locus_tag	LOCUS_13660
180	821	CDS
			product	Crp/Fnr family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963076.1
			protein_id	gnl|my_center|LOCUS_13660
>Feature sequence0965
>Feature sequence0966
>Feature sequence0967
>Feature sequence0968
<1168	371	gene
			locus_tag	LOCUS_13670
<1168	371	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011202952.1:ABC transporter permease
>Feature sequence0969
<1	989	gene
			locus_tag	LOCUS_13680
<1	989	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005786603.1:nucleoside-diphosphate sugar epimerase/dehydratase
			note	possible pseudo, frameshifted
970	1158	gene
			locus_tag	LOCUS_13690
970	1158	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13690
>Feature sequence0970
>Feature sequence0971
<1166	66	gene
			locus_tag	LOCUS_13700
<1166	66	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107563.1:glycoside hydrolase family 127 protein
>Feature sequence0972
142	67	gene
			locus_tag	LOCUS_t00200
142	67	tRNA
			product	tRNA-Val
			inference	COORDINATES:profile:Aragorn:1.2.38
501	211	gene
			locus_tag	LOCUS_13710
501	211	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13710
629	958	gene
			locus_tag	LOCUS_13720
629	958	CDS
			product	DMT family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010940209.1
			protein_id	gnl|my_center|LOCUS_13720
>Feature sequence0973
>Feature sequence0974
1027	539	gene
			locus_tag	LOCUS_13730
1027	539	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13730
>Feature sequence0975
>Feature sequence0976
>Feature sequence0977
<1157	226	gene
			locus_tag	LOCUS_13740
<1157	226	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008762996.1:TlpA disulfide reductase family protein
>Feature sequence0978
947	69	gene
			locus_tag	LOCUS_13750
947	69	CDS
			product	aldose 1-epimerase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002382347.1
			protein_id	gnl|my_center|LOCUS_13750
>Feature sequence0979
<1	581	gene
			locus_tag	LOCUS_13760
<1	581	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962858.1:D-alanine--D-alanine ligase
>Feature sequence0980
<1	610	gene
			locus_tag	LOCUS_13770
<1	610	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005791295.1:glucoamylase family protein
>Feature sequence0981
940	470	gene
			locus_tag	LOCUS_13780
940	470	CDS
			product	DinB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000991273.1
			protein_id	gnl|my_center|LOCUS_13780
>Feature sequence0982
>Feature sequence0983
<1	682	gene
			locus_tag	LOCUS_13790
<1	682	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011107222.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein
>Feature sequence0984
>Feature sequence0985
462	833	gene
			locus_tag	LOCUS_13800
462	833	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13800
>Feature sequence0986
<1148	135	gene
			locus_tag	LOCUS_13810
<1148	135	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_010931817.1:peptide chain release factor 1
>Feature sequence0987
>Feature sequence0988
<1	965	gene
			locus_tag	LOCUS_13820
<1	965	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_047817440.1:UbiD family decarboxylase
>Feature sequence0989
740	327	gene
			locus_tag	LOCUS_13830
740	327	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13830
>Feature sequence0990
814	401	gene
			locus_tag	LOCUS_13840
814	401	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13840
>Feature sequence0991
>Feature sequence0992
934	224	gene
			locus_tag	LOCUS_13850
934	224	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13850
>Feature sequence0993
48	827	gene
			locus_tag	LOCUS_13860
48	827	CDS
			product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964165.1
			protein_id	gnl|my_center|LOCUS_13860
>Feature sequence0994
986	90	gene
			locus_tag	LOCUS_13870
986	90	CDS
			product	polyphosphate kinase 2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765640.1
			protein_id	gnl|my_center|LOCUS_13870
>Feature sequence0995
656	291	gene
			locus_tag	LOCUS_13880
656	291	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13880
>Feature sequence0996
<1135	473	gene
			locus_tag	LOCUS_13890
<1135	473	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_103036501.1:carboxypeptidase
>Feature sequence0997
702	1010	gene
			locus_tag	LOCUS_13900
702	1010	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13900
>Feature sequence0998
>Feature sequence0999
<1133	456	gene
			locus_tag	LOCUS_13910
<1133	456	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005783735.1:TIGR00341 family protein
>Feature sequence1000
>Feature sequence1001
<1130	460	gene
			locus_tag	LOCUS_13920
<1130	460	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_118838378.1:ABC transporter ATP-binding protein
>Feature sequence1002
>Feature sequence1003
>Feature sequence1004
>Feature sequence1005
<1	917	gene
			locus_tag	LOCUS_13930
<1	917	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011705177.1:ABC transporter permease
>Feature sequence1006
>Feature sequence1007
276	731	gene
			locus_tag	LOCUS_13940
276	731	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13940
>Feature sequence1008
415	1101	gene
			locus_tag	LOCUS_13950
415	1101	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13950
>Feature sequence1009
>Feature sequence1010
358	107	gene
			locus_tag	LOCUS_13960
358	107	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13960
558	986	gene
			locus_tag	LOCUS_13970
558	986	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_13970
>Feature sequence1011
987	100	gene
			locus_tag	LOCUS_13980
987	100	CDS
			product	NmrA family NAD(P)-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010932762.1
			protein_id	gnl|my_center|LOCUS_13980
>Feature sequence1012
>Feature sequence1013
>Feature sequence1014
>Feature sequence1015
<1113	463	gene
			locus_tag	LOCUS_13990
<1113	463	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964517.1:glycine--tRNA ligase
>Feature sequence1016
>Feature sequence1017
>Feature sequence1018
>Feature sequence1019
920	588	gene
			locus_tag	LOCUS_14000
920	588	CDS
			product	MmcQ/YjbR family DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011028411.1
			protein_id	gnl|my_center|LOCUS_14000
>Feature sequence1020
>Feature sequence1021
>Feature sequence1022
<1	1054	gene
			locus_tag	LOCUS_14010
<1	1054	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963747.1:glycosyltransferase family 87 protein
>Feature sequence1023
>Feature sequence1024
>Feature sequence1025
>Feature sequence1026
616	368	gene
			locus_tag	LOCUS_14020
			gene	purS
616	368	CDS
			product	phosphoribosylformylglycinamidine synthase subunit PurS
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003722248.1
			protein_id	gnl|my_center|LOCUS_14020
>Feature sequence1027
>Feature sequence1028
223	783	gene
			locus_tag	LOCUS_14030
223	783	CDS
			product	biopolymer transporter ExbD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964298.1
			protein_id	gnl|my_center|LOCUS_14030
>Feature sequence1029
>Feature sequence1030
<1100	504	gene
			locus_tag	LOCUS_14040
<1100	504	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963367.1:twin-arginine translocase subunit TatC
>Feature sequence1031
>Feature sequence1032
344	868	gene
			locus_tag	LOCUS_14050
344	868	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14050
>Feature sequence1033
1	210	gene
			locus_tag	LOCUS_14060
1	210	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14060
324	911	gene
			locus_tag	LOCUS_14070
324	911	CDS
			product	bifunctional nuclease family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962505.1
			protein_id	gnl|my_center|LOCUS_14070
>Feature sequence1034
<1	952	gene
			locus_tag	LOCUS_14080
<1	952	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008768487.1:glycosyltransferase family 2 protein
>Feature sequence1035
510	13	gene
			locus_tag	LOCUS_14090
510	13	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765089.1
			protein_id	gnl|my_center|LOCUS_14090
<1095	510	gene
			locus_tag	LOCUS_14100
<1095	510	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005783481.1:phosphatase PAP2 family protein
>Feature sequence1036
9	767	gene
			locus_tag	LOCUS_14110
9	767	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14110
>Feature sequence1037
>Feature sequence1038
>Feature sequence1039
190	975	gene
			locus_tag	LOCUS_14120
190	975	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14120
>Feature sequence1040
>Feature sequence1041
>Feature sequence1042
>Feature sequence1043
>Feature sequence1044
172	531	gene
			locus_tag	LOCUS_14130
172	531	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14130
>Feature sequence1045
>Feature sequence1046
<1	999	gene
			locus_tag	LOCUS_14140
<1	999	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203676.1:family 43 glycosylhydrolase
>Feature sequence1047
>Feature sequence1048
>Feature sequence1049
1044	175	gene
			locus_tag	LOCUS_14150
1044	175	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14150
>Feature sequence1050
<1085	185	gene
			locus_tag	LOCUS_14160
<1085	185	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963059.1:ADP-forming succinate--CoA ligase subunit beta
>Feature sequence1051
895	287	gene
			locus_tag	LOCUS_14170
895	287	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14170
>Feature sequence1052
>Feature sequence1053
>Feature sequence1054
573	31	gene
			locus_tag	LOCUS_14180
573	31	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14180
>Feature sequence1055
>Feature sequence1056
<1079	231	gene
			locus_tag	LOCUS_14190
<1079	231	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963288.1:endonuclease/exonuclease/phosphatase family protein
>Feature sequence1057
>Feature sequence1058
>Feature sequence1059
>Feature sequence1060
>Feature sequence1061
>Feature sequence1062
>Feature sequence1063
>Feature sequence1064
811	527	gene
			locus_tag	LOCUS_14200
811	527	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14200
>Feature sequence1065
<1	673	gene
			locus_tag	LOCUS_14210
<1	673	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011962449.1:aspartate--tRNA ligase
>Feature sequence1066
956	726	gene
			locus_tag	LOCUS_14220
956	726	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14220
>Feature sequence1067
>Feature sequence1068
>Feature sequence1069
405	28	gene
			locus_tag	LOCUS_14230
405	28	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14230
1066	488	gene
			locus_tag	LOCUS_14240
1066	488	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14240
>Feature sequence1070
<1	575	gene
			locus_tag	LOCUS_14250
<1	575	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011949161.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha
>Feature sequence1071
>Feature sequence1072
>Feature sequence1073
<1	572	gene
			locus_tag	LOCUS_14260
<1	572	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011963217.1:M42 family metallopeptidase
>Feature sequence1074
>Feature sequence1075
565	1014	gene
			locus_tag	LOCUS_14270
565	1014	CDS
			product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_034100451.1
			protein_id	gnl|my_center|LOCUS_14270
>Feature sequence1076
383	874	gene
			locus_tag	LOCUS_14280
383	874	CDS
			product	YajQ family cyclic di-GMP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010939267.1
			protein_id	gnl|my_center|LOCUS_14280
>Feature sequence1077
>Feature sequence1078
<1057	423	gene
			locus_tag	LOCUS_14290
<1057	423	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_004079973.1:bifunctional L-alanine/L-glutamate racemase
>Feature sequence1079
>Feature sequence1080
>Feature sequence1081
>Feature sequence1082
>Feature sequence1083
>Feature sequence1084
>Feature sequence1085
1022	426	gene
			locus_tag	LOCUS_14300
1022	426	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14300
>Feature sequence1086
766	275	gene
			locus_tag	LOCUS_14310
766	275	CDS
			product	RNA polymerase sigma factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964176.1
			protein_id	gnl|my_center|LOCUS_14310
>Feature sequence1087
>Feature sequence1088
>Feature sequence1089
>Feature sequence1090
>Feature sequence1091
>Feature sequence1092
>Feature sequence1093
<1	628	gene
			locus_tag	LOCUS_14320
<1	628	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_012583799.1:phosphate acyltransferase PlsX
>Feature sequence1094
<1043	478	gene
			locus_tag	LOCUS_14330
<1043	478	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005784230.1:ATPase
>Feature sequence1095
>Feature sequence1096
>Feature sequence1097
>Feature sequence1098
>Feature sequence1099
769	245	gene
			locus_tag	LOCUS_14340
			gene	pyrR
769	245	CDS
			product	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963903.1
			protein_id	gnl|my_center|LOCUS_14340
>Feature sequence1100
>Feature sequence1101
1038	208	gene
			locus_tag	LOCUS_14350
1038	208	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14350
>Feature sequence1102
>Feature sequence1103
>Feature sequence1104
>Feature sequence1105
>Feature sequence1106
471	641	gene
			locus_tag	LOCUS_14360
471	641	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14360
641	1027	gene
			locus_tag	LOCUS_14370
641	1027	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14370
>Feature sequence1107
<1034	173	gene
			locus_tag	LOCUS_14380
<1034	173	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011143551.1:chemotaxis protein CheB
>Feature sequence1108
>Feature sequence1109
<1033	129	gene
			locus_tag	LOCUS_14390
<1033	129	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_184492906.1:TolC family protein
>Feature sequence1110
>Feature sequence1111
123	704	gene
			locus_tag	LOCUS_14400
123	704	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14400
>Feature sequence1112
>Feature sequence1113
<1030	323	gene
			locus_tag	LOCUS_14410
<1030	323	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_093328686.1:M1 family metallopeptidase
>Feature sequence1114
>Feature sequence1115
>Feature sequence1116
>Feature sequence1117
<1	966	gene
			locus_tag	LOCUS_14420
<1	966	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011964521.1:membrane protein
>Feature sequence1118
<1023	320	gene
			locus_tag	LOCUS_14430
<1023	320	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_118838741.1:MBL fold metallo-hydrolase
>Feature sequence1119
425	730	gene
			locus_tag	LOCUS_14440
425	730	CDS
			product	septum formation initiator family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963258.1
			protein_id	gnl|my_center|LOCUS_14440
>Feature sequence1120
<1022	352	gene
			locus_tag	LOCUS_14450
<1022	352	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_005785156.1:PhoH family protein
>Feature sequence1121
>Feature sequence1122
<1	943	gene
			locus_tag	LOCUS_14460
<1	943	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_011203604.1:glycosyltransferase N-terminal domain-containing protein
>Feature sequence1123
1	786	gene
			locus_tag	LOCUS_14470
1	786	CDS
			product	DMT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963784.1
			protein_id	gnl|my_center|LOCUS_14470
>Feature sequence1124
>Feature sequence1125
>Feature sequence1126
>Feature sequence1127
>Feature sequence1128
>Feature sequence1129
>Feature sequence1130
2	277	gene
			locus_tag	LOCUS_14480
2	277	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14480
281	898	gene
			locus_tag	LOCUS_14490
			gene	traK
281	898	CDS
			product	conjugative transposon protein TraK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107100.1
			protein_id	gnl|my_center|LOCUS_14490
>Feature sequence1131
>Feature sequence1132
946	587	gene
			locus_tag	LOCUS_14500
946	587	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14500
>Feature sequence1133
>Feature sequence1134
>Feature sequence1135
>Feature sequence1136
>Feature sequence1137
17	310	gene
			locus_tag	LOCUS_14510
17	310	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14510
>Feature sequence1138
>Feature sequence1139
>Feature sequence1140
>Feature sequence1141
>Feature sequence1142
>Feature sequence1143
>Feature sequence1144
<1	745	gene
			locus_tag	LOCUS_14520
<1	745	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008763543.1:MotA/TolQ/ExbB proton channel family protein
>Feature sequence1145
>Feature sequence1146
>Feature sequence1147
>Feature sequence1148
>Feature sequence1149
<1	563	gene
			locus_tag	LOCUS_14530
<1	563	misc_feature
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_008767392.1:OmpA family protein
>Feature sequence1150
803	153	gene
			locus_tag	LOCUS_14540
803	153	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14540
>Feature sequence1151
98	538	gene
			locus_tag	LOCUS_14550
			gene	smpB
98	538	CDS
			product	SsrA-binding protein SmpB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011943280.1
			protein_id	gnl|my_center|LOCUS_14550
>Feature sequence1152
>Feature sequence1153
>Feature sequence1154
>Feature sequence1155
>Feature sequence1156
>Feature sequence1157
477	52	gene
			locus_tag	LOCUS_14560
477	52	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14560
>Feature sequence1158
>Feature sequence1159
>Feature sequence1160
>Feature sequence1161
>Feature sequence1162
>Feature sequence1163
>Feature sequence1164
>Feature sequence1165
>Feature sequence1166
>Feature sequence1167
>Feature sequence1168
>Feature sequence1169
>Feature sequence1170
>Feature sequence1171
<1	214	repeat_region
			inference	COORDINATES:alignment:CRT:1.2
			rpt_family	CRISPR
			rpt_type	direct
			rpt_unit_seq	nnnnnnnnnnnnatatggtgcgattgaaaga
>Feature sequence1172
126	614	gene
			locus_tag	LOCUS_14570
126	614	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14570
>Feature sequence1173
>Feature sequence1174
>Feature sequence1175
>Feature sequence1176
>Feature sequence1177
>Feature sequence1178
>Feature sequence1179
>Feature sequence1180
>Feature sequence1181
>Feature sequence1182
>Feature sequence1183
>Feature sequence1184
>Feature sequence1185
>Feature sequence1186
>Feature sequence1187
>Feature sequence1188
217	71	gene
			locus_tag	LOCUS_14580
217	71	CDS
			product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			protein_id	gnl|my_center|LOCUS_14580
>Feature sequence1189
