>Feature sequence001 1318 2076 gene locus_tag LOCUS_00010 1318 2076 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_00010 2975 2010 gene locus_tag LOCUS_00020 2975 2010 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_00020 3622 2999 gene locus_tag LOCUS_00030 3622 2999 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_00030 4182 3619 gene locus_tag LOCUS_00040 gene def 4182 3619 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_00040 4358 4561 gene locus_tag LOCUS_00050 gene rpsU 4358 4561 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_00050 6112 4718 gene locus_tag LOCUS_00060 6112 4718 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_00060 6681 6187 gene locus_tag LOCUS_00070 6681 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7578 6781 gene locus_tag LOCUS_00080 7578 6781 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_00080 8915 7575 gene locus_tag LOCUS_00090 gene cysS 8915 7575 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_00090 9042 10271 gene locus_tag LOCUS_00100 9042 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10264 11256 gene locus_tag LOCUS_00110 10264 11256 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_00110 11348 11749 gene locus_tag LOCUS_00120 11348 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11925 14519 gene locus_tag LOCUS_00130 11925 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14522 15796 gene locus_tag LOCUS_00140 14522 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15793 18585 gene locus_tag LOCUS_00150 15793 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18979 18596 gene locus_tag LOCUS_00160 18979 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21924 19069 gene locus_tag LOCUS_00170 21924 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22126 23433 gene locus_tag LOCUS_00180 22126 23433 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_00180 24433 23474 gene locus_tag LOCUS_00190 24433 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24814 25791 gene locus_tag LOCUS_00200 gene trxA 24814 25791 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528773.1 protein_id gnl|my_center|LOCUS_00200 25799 26467 gene locus_tag LOCUS_00210 25799 26467 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_00210 26485 26697 gene locus_tag LOCUS_00220 26485 26697 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_00220 26697 27050 gene locus_tag LOCUS_00230 26697 27050 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_00230 28041 27034 gene locus_tag LOCUS_00240 28041 27034 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_00240 28979 28038 gene locus_tag LOCUS_00250 28979 28038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_00250 29860 28976 gene locus_tag LOCUS_00260 29860 28976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089451.1 protein_id gnl|my_center|LOCUS_00260 30809 29853 gene locus_tag LOCUS_00270 30809 29853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_00270 32448 30835 gene locus_tag LOCUS_00280 32448 30835 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_00280 32624 32992 gene locus_tag LOCUS_00290 32624 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34036 33008 gene locus_tag LOCUS_00300 34036 33008 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970573.1 protein_id gnl|my_center|LOCUS_00300 34235 35332 gene locus_tag LOCUS_00310 34235 35332 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970572.1 protein_id gnl|my_center|LOCUS_00310 35355 36263 gene locus_tag LOCUS_00320 35355 36263 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530826.1 protein_id gnl|my_center|LOCUS_00320 36275 37450 gene locus_tag LOCUS_00330 36275 37450 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970570.1 protein_id gnl|my_center|LOCUS_00330 37462 38214 gene locus_tag LOCUS_00340 37462 38214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970569.1 protein_id gnl|my_center|LOCUS_00340 38229 39422 gene locus_tag LOCUS_00350 38229 39422 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970568.1 protein_id gnl|my_center|LOCUS_00350 39419 40192 gene locus_tag LOCUS_00360 39419 40192 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970566.1 protein_id gnl|my_center|LOCUS_00360 40210 41214 gene locus_tag LOCUS_00370 40210 41214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970565.1 protein_id gnl|my_center|LOCUS_00370 41227 42231 gene locus_tag LOCUS_00380 41227 42231 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970564.1 protein_id gnl|my_center|LOCUS_00380 42279 43760 gene locus_tag LOCUS_00390 42279 43760 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970563.1 protein_id gnl|my_center|LOCUS_00390 43820 44989 gene locus_tag LOCUS_00400 43820 44989 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_00400 44989 46122 gene locus_tag LOCUS_00410 44989 46122 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_00410 46162 47748 gene locus_tag LOCUS_00420 46162 47748 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_00420 49083 47779 gene locus_tag LOCUS_00430 49083 47779 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971002.1 protein_id gnl|my_center|LOCUS_00430 49747 49157 gene locus_tag LOCUS_00440 49747 49157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49763 51166 gene locus_tag LOCUS_00450 gene argH 49763 51166 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_00450 51291 52220 gene locus_tag LOCUS_00460 51291 52220 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 protein_id gnl|my_center|LOCUS_00460 52269 53594 gene locus_tag LOCUS_00470 gene lysA 52269 53594 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388155.1 protein_id gnl|my_center|LOCUS_00470 53605 56241 gene locus_tag LOCUS_00480 53605 56241 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 protein_id gnl|my_center|LOCUS_00480 57816 56416 gene locus_tag LOCUS_00490 gene aceA 57816 56416 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_00490 57965 59353 gene locus_tag LOCUS_00500 gene ramB 57965 59353 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296731.1 protein_id gnl|my_center|LOCUS_00500 60599 59361 gene locus_tag LOCUS_00510 60599 59361 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391407.1 protein_id gnl|my_center|LOCUS_00510 60732 62420 gene locus_tag LOCUS_00520 60732 62420 CDS product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 protein_id gnl|my_center|LOCUS_00520 62535 62459 gene locus_tag LOCUS_t00010 62535 62459 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 286 1221 gene locus_tag LOCUS_00530 gene thyX 286 1221 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_00530 1557 2075 gene locus_tag LOCUS_00540 1557 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2298 3761 gene locus_tag LOCUS_00550 2298 3761 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_00550 3879 4574 gene locus_tag LOCUS_00560 gene aqpZ 3879 4574 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969745.1 protein_id gnl|my_center|LOCUS_00560 4753 4571 gene locus_tag LOCUS_00570 4753 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4671 4892 gene locus_tag LOCUS_00580 4671 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 5922 4900 gene locus_tag LOCUS_00590 5922 4900 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 protein_id gnl|my_center|LOCUS_00590 6989 5958 gene locus_tag LOCUS_00600 6989 5958 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533060.1 protein_id gnl|my_center|LOCUS_00600 8027 6993 gene locus_tag LOCUS_00610 8027 6993 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_00610 8204 11422 gene locus_tag LOCUS_00620 8204 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 11572 12048 gene locus_tag LOCUS_00630 11572 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 12085 12537 gene locus_tag LOCUS_00640 12085 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 13493 12531 gene locus_tag LOCUS_00650 13493 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 13597 14103 gene locus_tag LOCUS_00660 13597 14103 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969913.1 protein_id gnl|my_center|LOCUS_00660 14318 14112 gene locus_tag LOCUS_00670 14318 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 14400 14735 gene locus_tag LOCUS_00680 14400 14735 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_00680 15441 14743 gene locus_tag LOCUS_00690 15441 14743 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918594.1 protein_id gnl|my_center|LOCUS_00690 15628 16794 gene locus_tag LOCUS_00700 15628 16794 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_00700 17013 18002 gene locus_tag LOCUS_00710 17013 18002 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_00710 18637 18128 gene locus_tag LOCUS_00720 18637 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18938 20398 gene locus_tag LOCUS_00730 18938 20398 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265725.1 protein_id gnl|my_center|LOCUS_00730 20400 21413 gene locus_tag LOCUS_00740 20400 21413 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_00740 21429 22082 gene locus_tag LOCUS_00750 21429 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 22126 22839 gene locus_tag LOCUS_00760 22126 22839 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086928.1 protein_id gnl|my_center|LOCUS_00760 22936 24894 gene locus_tag LOCUS_00770 22936 24894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 25699 24905 gene locus_tag LOCUS_00780 25699 24905 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_00780 25774 26085 gene locus_tag LOCUS_00790 gene rhaM 25774 26085 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529957.1 protein_id gnl|my_center|LOCUS_00790 26093 27136 gene locus_tag LOCUS_00800 gene speB 26093 27136 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528438.1 protein_id gnl|my_center|LOCUS_00800 27223 28203 gene locus_tag LOCUS_00810 gene cysK 27223 28203 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_00810 29305 28217 gene locus_tag LOCUS_00820 29305 28217 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_00820 30089 29316 gene locus_tag LOCUS_00830 30089 29316 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_00830 30475 30086 gene locus_tag LOCUS_00840 30475 30086 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_00840 31606 30512 gene locus_tag LOCUS_00850 gene ugpC 31606 30512 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087328.1 protein_id gnl|my_center|LOCUS_00850 32475 31792 gene locus_tag LOCUS_00860 32475 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 33183 32548 gene locus_tag LOCUS_00870 33183 32548 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 protein_id gnl|my_center|LOCUS_00870 34055 33159 gene locus_tag LOCUS_00880 34055 33159 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_00880 34245 36437 gene locus_tag LOCUS_00890 34245 36437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 37315 36428 gene locus_tag LOCUS_00900 37315 36428 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_00900 38229 37312 gene locus_tag LOCUS_00910 38229 37312 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence003 465 574 gene locus_tag LOCUS_r00010 465 574 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 614 690 gene locus_tag LOCUS_t00020 614 690 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 879 2297 gene locus_tag LOCUS_00920 gene hydA 879 2297 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102045048.1 protein_id gnl|my_center|LOCUS_00920 2305 3645 gene locus_tag LOCUS_00930 2305 3645 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_00930 5667 3652 gene locus_tag LOCUS_00940 5667 3652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533440.1 protein_id gnl|my_center|LOCUS_00940 6464 5664 gene locus_tag LOCUS_00950 6464 5664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532882.1 protein_id gnl|my_center|LOCUS_00950 7429 6476 gene locus_tag LOCUS_00960 7429 6476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095091852.1 protein_id gnl|my_center|LOCUS_00960 9106 7442 gene locus_tag LOCUS_00970 9106 7442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532880.1 protein_id gnl|my_center|LOCUS_00970 9947 9174 gene locus_tag LOCUS_00980 9947 9174 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_00980 10107 11069 gene locus_tag LOCUS_00990 10107 11069 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_00990 11976 11083 gene locus_tag LOCUS_01000 gene puuE 11976 11083 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 protein_id gnl|my_center|LOCUS_01000 13540 11987 gene locus_tag LOCUS_01010 13540 11987 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_01010 13730 16156 gene locus_tag LOCUS_01020 13730 16156 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_01020 16153 17082 gene locus_tag LOCUS_01030 16153 17082 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085702.1 protein_id gnl|my_center|LOCUS_01030 18035 17079 gene locus_tag LOCUS_01040 18035 17079 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_01040 19017 18046 gene locus_tag LOCUS_01050 19017 18046 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_01050 19333 20631 gene locus_tag LOCUS_01060 gene urtA 19333 20631 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531849.1 protein_id gnl|my_center|LOCUS_01060 20743 22320 gene locus_tag LOCUS_01070 gene urtB 20743 22320 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 protein_id gnl|my_center|LOCUS_01070 22326 23417 gene locus_tag LOCUS_01080 gene urtC 22326 23417 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 protein_id gnl|my_center|LOCUS_01080 23414 24172 gene locus_tag LOCUS_01090 gene urtD 23414 24172 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972305.1 protein_id gnl|my_center|LOCUS_01090 24191 24886 gene locus_tag LOCUS_01100 gene urtE 24191 24886 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244010.1 protein_id gnl|my_center|LOCUS_01100 24861 25691 gene locus_tag LOCUS_01110 24861 25691 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969965.1 protein_id gnl|my_center|LOCUS_01110 25702 26004 gene locus_tag LOCUS_01120 25702 26004 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_01120 26015 26320 gene locus_tag LOCUS_01130 26015 26320 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066609.1 protein_id gnl|my_center|LOCUS_01130 26320 28029 gene locus_tag LOCUS_01140 gene ureC 26320 28029 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969961.1 protein_id gnl|my_center|LOCUS_01140 28029 28520 gene locus_tag LOCUS_01150 28029 28520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 28517 29191 gene locus_tag LOCUS_01160 28517 29191 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 protein_id gnl|my_center|LOCUS_01160 29188 29820 gene locus_tag LOCUS_01170 gene ureG 29188 29820 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_01170 30376 29774 gene locus_tag LOCUS_01180 30376 29774 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969224.1 protein_id gnl|my_center|LOCUS_01180 31664 30477 gene locus_tag LOCUS_01190 31664 30477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 32166 33452 gene locus_tag LOCUS_01200 gene larA 32166 33452 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_01200 34742 33453 gene locus_tag LOCUS_01210 34742 33453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 36073 34742 gene locus_tag LOCUS_01220 36073 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 36597 36094 gene locus_tag LOCUS_01230 36597 36094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence004 <1 514 gene locus_tag LOCUS_01240 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390186.1:type II 3-dehydroquinate dehydratase 541 978 gene locus_tag LOCUS_01250 gene accB 541 978 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_01250 983 2332 gene locus_tag LOCUS_01260 gene accC 983 2332 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_01260 2989 2360 gene locus_tag LOCUS_01270 2989 2360 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536681.1 protein_id gnl|my_center|LOCUS_01270 3362 3054 gene locus_tag LOCUS_01280 3362 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4075 3362 gene locus_tag LOCUS_01290 4075 3362 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243013.1 protein_id gnl|my_center|LOCUS_01290 4276 4833 gene locus_tag LOCUS_01300 4276 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4926 5312 gene locus_tag LOCUS_01310 4926 5312 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_01310 5775 5353 gene locus_tag LOCUS_01320 5775 5353 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_01320 7651 5834 gene locus_tag LOCUS_01330 7651 5834 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_01330 7886 8338 gene locus_tag LOCUS_01340 7886 8338 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534938.1 protein_id gnl|my_center|LOCUS_01340 10992 8365 gene locus_tag LOCUS_01350 10992 8365 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_01350 11168 12148 gene locus_tag LOCUS_01360 11168 12148 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338161.1 protein_id gnl|my_center|LOCUS_01360 12145 13005 gene locus_tag LOCUS_01370 12145 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 13012 13518 gene locus_tag LOCUS_01380 13012 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14316 13528 gene locus_tag LOCUS_01390 14316 13528 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_01390 15074 14493 gene locus_tag LOCUS_01400 15074 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15439 15113 gene locus_tag LOCUS_01410 15439 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15723 17345 gene locus_tag LOCUS_01420 gene groL 15723 17345 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087406.1 protein_id gnl|my_center|LOCUS_01420 18008 17373 gene locus_tag LOCUS_01430 18008 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090080.1 protein_id gnl|my_center|LOCUS_01430 18578 18057 gene locus_tag LOCUS_01440 18578 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 19162 20850 gene locus_tag LOCUS_01450 gene cdrB 19162 20850 CDS product two-partner secretion system transporter CdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895680.1 protein_id gnl|my_center|LOCUS_01450 20906 27859 gene locus_tag LOCUS_01460 20906 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 27862 30957 gene locus_tag LOCUS_01470 27862 30957 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967710.1 protein_id gnl|my_center|LOCUS_01470 31049 32239 gene locus_tag LOCUS_01480 31049 32239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_01480 32250 33188 gene locus_tag LOCUS_01490 32250 33188 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_01490 33185 34093 gene locus_tag LOCUS_01500 33185 34093 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_01500 34090 34836 gene locus_tag LOCUS_01510 34090 34836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_01510 34830 35510 gene locus_tag LOCUS_01520 34830 35510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_01520 >Feature sequence005 1942 983 gene locus_tag LOCUS_01530 1942 983 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086129.1 protein_id gnl|my_center|LOCUS_01530 2922 2089 gene locus_tag LOCUS_01540 2922 2089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01540 3749 2925 gene locus_tag LOCUS_01550 3749 2925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_01550 4687 3746 gene locus_tag LOCUS_01560 4687 3746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_01560 6270 4687 gene locus_tag LOCUS_01570 6270 4687 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_01570 6557 7321 gene locus_tag LOCUS_01580 6557 7321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_01580 8131 7322 gene locus_tag LOCUS_01590 8131 7322 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_01590 8458 8162 gene locus_tag LOCUS_01600 8458 8162 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525326.1 protein_id gnl|my_center|LOCUS_01600 9192 8455 gene locus_tag LOCUS_01610 9192 8455 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975181.1 protein_id gnl|my_center|LOCUS_01610 10673 9189 gene locus_tag LOCUS_01620 10673 9189 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_01620 11719 10670 gene locus_tag LOCUS_01630 11719 10670 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_01630 12893 11781 gene locus_tag LOCUS_01640 12893 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13761 13000 gene locus_tag LOCUS_01650 13761 13000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205487.1 protein_id gnl|my_center|LOCUS_01650 14600 13758 gene locus_tag LOCUS_01660 14600 13758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973846.1 protein_id gnl|my_center|LOCUS_01660 15502 14597 gene locus_tag LOCUS_01670 15502 14597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338504.1 protein_id gnl|my_center|LOCUS_01670 16560 15499 gene locus_tag LOCUS_01680 16560 15499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394534.1 protein_id gnl|my_center|LOCUS_01680 18146 16563 gene locus_tag LOCUS_01690 18146 16563 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388557.1 protein_id gnl|my_center|LOCUS_01690 18205 18552 gene locus_tag LOCUS_01700 18205 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 18549 19190 gene locus_tag LOCUS_01710 gene bluB 18549 19190 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_01710 19267 19458 gene locus_tag LOCUS_01720 19267 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 19455 19640 gene locus_tag LOCUS_01730 19455 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 19600 20556 gene locus_tag LOCUS_01740 19600 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 20836 20994 gene locus_tag LOCUS_01750 20836 20994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 20987 21313 gene locus_tag LOCUS_01760 20987 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 21453 22562 gene locus_tag LOCUS_01770 21453 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 22559 24097 gene locus_tag LOCUS_01780 22559 24097 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 protein_id gnl|my_center|LOCUS_01780 24094 25080 gene locus_tag LOCUS_01790 24094 25080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_01790 25094 26008 gene locus_tag LOCUS_01800 25094 26008 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064556.1 protein_id gnl|my_center|LOCUS_01800 26005 26478 gene locus_tag LOCUS_01810 26005 26478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 26526 28229 gene locus_tag LOCUS_01820 26526 28229 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_01820 28226 29881 gene locus_tag LOCUS_01830 28226 29881 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_01830 29878 30840 gene locus_tag LOCUS_01840 29878 30840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_01840 30837 31775 gene locus_tag LOCUS_01850 30837 31775 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_01850 31814 32722 gene locus_tag LOCUS_01860 31814 32722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084172.1 protein_id gnl|my_center|LOCUS_01860 32788 33627 gene locus_tag LOCUS_01870 32788 33627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_01870 34417 33629 gene locus_tag LOCUS_01880 34417 33629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_01880 35010 34414 gene locus_tag LOCUS_01890 35010 34414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 35471 35007 gene locus_tag LOCUS_01900 35471 35007 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 protein_id gnl|my_center|LOCUS_01900 <36047 35475 gene locus_tag LOCUS_01910 <36047 35475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965985.1:Rieske 2Fe-2S domain-containing protein >Feature sequence006 <1 1815 gene locus_tag LOCUS_01920 <1 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086745.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1886 4300 gene locus_tag LOCUS_01930 1886 4300 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_01930 4297 5835 gene locus_tag LOCUS_01940 4297 5835 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501515.1 protein_id gnl|my_center|LOCUS_01940 5832 6644 gene locus_tag LOCUS_01950 5832 6644 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419874.1 protein_id gnl|my_center|LOCUS_01950 8140 6626 gene locus_tag LOCUS_01960 8140 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8735 8151 gene locus_tag LOCUS_01970 8735 8151 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085642.1 protein_id gnl|my_center|LOCUS_01970 9238 8732 gene locus_tag LOCUS_01980 9238 8732 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172439.1 protein_id gnl|my_center|LOCUS_01980 9462 9244 gene locus_tag LOCUS_01990 9462 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10448 9480 gene locus_tag LOCUS_02000 10448 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11336 10464 gene locus_tag LOCUS_02010 11336 10464 CDS product carboxyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533154.1 protein_id gnl|my_center|LOCUS_02010 12733 11363 gene locus_tag LOCUS_02020 12733 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 13461 12733 gene locus_tag LOCUS_02030 13461 12733 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533151.1 protein_id gnl|my_center|LOCUS_02030 15558 13474 gene locus_tag LOCUS_02040 15558 13474 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_02040 17418 15574 gene locus_tag LOCUS_02050 17418 15574 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_02050 18476 17448 gene locus_tag LOCUS_02060 18476 17448 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764786.1 protein_id gnl|my_center|LOCUS_02060 18793 18473 gene locus_tag LOCUS_02070 18793 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339639.1 protein_id gnl|my_center|LOCUS_02070 19736 18855 gene locus_tag LOCUS_02080 19736 18855 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764781.1 protein_id gnl|my_center|LOCUS_02080 21176 19800 gene locus_tag LOCUS_02090 21176 19800 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972875.1 protein_id gnl|my_center|LOCUS_02090 22341 21190 gene locus_tag LOCUS_02100 22341 21190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974670.1 protein_id gnl|my_center|LOCUS_02100 23599 22364 gene locus_tag LOCUS_02110 23599 22364 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175401.1 protein_id gnl|my_center|LOCUS_02110 24405 23650 gene locus_tag LOCUS_02120 24405 23650 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066668.1 protein_id gnl|my_center|LOCUS_02120 25162 24425 gene locus_tag LOCUS_02130 25162 24425 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 protein_id gnl|my_center|LOCUS_02130 26007 25159 gene locus_tag LOCUS_02140 26007 25159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855566.1 protein_id gnl|my_center|LOCUS_02140 26914 26009 gene locus_tag LOCUS_02150 26914 26009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 protein_id gnl|my_center|LOCUS_02150 28005 26944 gene locus_tag LOCUS_02160 28005 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 28265 27987 gene locus_tag LOCUS_02170 28265 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 28325 29302 gene locus_tag LOCUS_02180 28325 29302 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207837.1 protein_id gnl|my_center|LOCUS_02180 30527 29310 gene locus_tag LOCUS_02190 30527 29310 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268746.1 protein_id gnl|my_center|LOCUS_02190 30634 30927 gene locus_tag LOCUS_02200 gene bauB 30634 30927 CDS product beta-alanine degradation protein BauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083790.1 protein_id gnl|my_center|LOCUS_02200 30980 32311 gene locus_tag LOCUS_02210 30980 32311 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931468.1 protein_id gnl|my_center|LOCUS_02210 32484 33650 gene locus_tag LOCUS_02220 32484 33650 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence007 474 1916 gene locus_tag LOCUS_02230 gene bchY 474 1916 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338110.1 protein_id gnl|my_center|LOCUS_02230 1920 3383 gene locus_tag LOCUS_02240 gene bchZ 1920 3383 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_02240 3547 3765 gene locus_tag LOCUS_02250 gene pufB 3547 3765 CDS product light-harvesting antenna LH1, beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126701591.1 protein_id gnl|my_center|LOCUS_02250 3778 3951 gene locus_tag LOCUS_02260 gene pufA 3778 3951 CDS product light-harvesting antenna LH1, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390724.1 protein_id gnl|my_center|LOCUS_02260 4079 4903 gene locus_tag LOCUS_02270 gene pufL 4079 4903 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_02270 4923 5900 gene locus_tag LOCUS_02280 gene pufM 4923 5900 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_02280 5897 6943 gene locus_tag LOCUS_02290 5897 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 7899 7639 gene locus_tag LOCUS_02300 7899 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9180 7969 gene locus_tag LOCUS_02310 gene hemA 9180 7969 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312336.1 protein_id gnl|my_center|LOCUS_02310 10016 9189 gene locus_tag LOCUS_02320 gene puhE 10016 9189 CDS product putative photosynthetic complex assembly protein PuhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_02320 11089 10031 gene locus_tag LOCUS_02330 gene acsF 11089 10031 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338129.1 protein_id gnl|my_center|LOCUS_02330 11391 11086 gene locus_tag LOCUS_02340 11391 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 11837 11388 gene locus_tag LOCUS_02350 11837 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 12510 11860 gene locus_tag LOCUS_02360 gene puhB 12510 11860 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_02360 13283 12507 gene locus_tag LOCUS_02370 gene puhA 13283 12507 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_02370 14777 13299 gene locus_tag LOCUS_02380 14777 13299 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_02380 15475 14774 gene locus_tag LOCUS_02390 gene bchM 15475 14774 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_02390 16383 15475 gene locus_tag LOCUS_02400 gene bchL 16383 15475 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_02400 19958 16380 gene locus_tag LOCUS_02410 19958 16380 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_02410 21519 19990 gene locus_tag LOCUS_02420 gene bchB 21519 19990 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_02420 22806 21523 gene locus_tag LOCUS_02430 22806 21523 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_02430 23300 22803 gene locus_tag LOCUS_02440 23300 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 23660 24604 gene locus_tag LOCUS_02450 23660 24604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 24644 26095 gene locus_tag LOCUS_02460 gene ppsR 24644 26095 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_02460 26082 27005 gene locus_tag LOCUS_02470 gene chlG 26082 27005 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_02470 27037 28236 gene locus_tag LOCUS_02480 27037 28236 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388387.1 protein_id gnl|my_center|LOCUS_02480 28249 28749 gene locus_tag LOCUS_02490 28249 28749 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_02490 28792 29223 gene locus_tag LOCUS_02500 28792 29223 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_02500 29968 29351 gene locus_tag LOCUS_02510 gene leuD 29968 29351 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528787.1 protein_id gnl|my_center|LOCUS_02510 31371 29965 gene locus_tag LOCUS_02520 gene leuC 31371 29965 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_02520 32258 31398 gene locus_tag LOCUS_02530 32258 31398 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_02530 32887 32255 gene locus_tag LOCUS_02540 32887 32255 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_02540 <33560 32906 gene locus_tag LOCUS_02550 <33560 32906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258126.1:hydantoinase B/oxoprolinase family protein >Feature sequence008 1027 293 gene locus_tag LOCUS_02560 1027 293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_02560 2226 1720 gene locus_tag LOCUS_02570 2226 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2524 2976 gene locus_tag LOCUS_02580 2524 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3058 4377 gene locus_tag LOCUS_02590 3058 4377 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_02590 5774 6127 gene locus_tag LOCUS_02600 5774 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 6394 8520 gene locus_tag LOCUS_02610 6394 8520 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_02610 8517 10193 gene locus_tag LOCUS_02620 gene pimA 8517 10193 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090544.1 protein_id gnl|my_center|LOCUS_02620 10190 11386 gene locus_tag LOCUS_02630 gene pimC 10190 11386 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_02630 11397 12548 gene locus_tag LOCUS_02640 gene pimD 11397 12548 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_02640 12584 13300 gene locus_tag LOCUS_02650 12584 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 13944 13288 gene locus_tag LOCUS_02660 gene leuD 13944 13288 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918084.1 protein_id gnl|my_center|LOCUS_02660 15359 13944 gene locus_tag LOCUS_02670 gene leuC 15359 13944 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_02670 15499 16326 gene locus_tag LOCUS_02680 15499 16326 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_02680 16323 17537 gene locus_tag LOCUS_02690 16323 17537 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_02690 17559 18431 gene locus_tag LOCUS_02700 17559 18431 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_02700 18428 19396 gene locus_tag LOCUS_02710 18428 19396 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_02710 19397 20143 gene locus_tag LOCUS_02720 19397 20143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_02720 20136 20837 gene locus_tag LOCUS_02730 20136 20837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_02730 20844 22265 gene locus_tag LOCUS_02740 20844 22265 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040321.1 protein_id gnl|my_center|LOCUS_02740 22267 23136 gene locus_tag LOCUS_02750 22267 23136 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_02750 23133 24806 gene locus_tag LOCUS_02760 23133 24806 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_02760 24803 26857 gene locus_tag LOCUS_02770 24803 26857 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969300.1 protein_id gnl|my_center|LOCUS_02770 26854 27468 gene locus_tag LOCUS_02780 26854 27468 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808122.1 protein_id gnl|my_center|LOCUS_02780 27465 28874 gene locus_tag LOCUS_02790 27465 28874 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_02790 29046 30188 gene locus_tag LOCUS_02800 29046 30188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_02800 30228 31091 gene locus_tag LOCUS_02810 30228 31091 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_02810 31094 32848 gene locus_tag LOCUS_02820 31094 32848 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530467.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence009 <1 1104 gene locus_tag LOCUS_02830 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389416.1:transcription-repair coupling factor 1385 1146 gene locus_tag LOCUS_02840 1385 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2541 1522 gene locus_tag LOCUS_02850 2541 1522 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965522.1 protein_id gnl|my_center|LOCUS_02850 3497 2598 gene locus_tag LOCUS_02860 3497 2598 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918675.1 protein_id gnl|my_center|LOCUS_02860 3617 4231 gene locus_tag LOCUS_02870 3617 4231 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337407.1 protein_id gnl|my_center|LOCUS_02870 4325 5182 gene locus_tag LOCUS_02880 4325 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456642.1 protein_id gnl|my_center|LOCUS_02880 5215 5784 gene locus_tag LOCUS_02890 5215 5784 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456641.1 protein_id gnl|my_center|LOCUS_02890 5802 6206 gene locus_tag LOCUS_02900 5802 6206 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_02900 6331 6654 gene locus_tag LOCUS_02910 6331 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 6740 8341 gene locus_tag LOCUS_02920 6740 8341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 protein_id gnl|my_center|LOCUS_02920 8434 9438 gene locus_tag LOCUS_02930 8434 9438 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_02930 9438 10328 gene locus_tag LOCUS_02940 9438 10328 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383123.1 protein_id gnl|my_center|LOCUS_02940 10328 11314 gene locus_tag LOCUS_02950 10328 11314 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_02950 11311 12282 gene locus_tag LOCUS_02960 11311 12282 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_02960 12583 12287 gene locus_tag LOCUS_02970 12583 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12930 12604 gene locus_tag LOCUS_02980 12930 12604 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_02980 14451 12952 gene locus_tag LOCUS_02990 14451 12952 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_02990 14698 15729 gene locus_tag LOCUS_03000 14698 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 15745 17379 gene locus_tag LOCUS_03010 15745 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 18199 17402 gene locus_tag LOCUS_03020 18199 17402 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_03020 19625 18318 gene locus_tag LOCUS_03030 gene xylA 19625 18318 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149589.1 protein_id gnl|my_center|LOCUS_03030 20808 19633 gene locus_tag LOCUS_03040 20808 19633 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_03040 21865 20810 gene locus_tag LOCUS_03050 21865 20810 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_03050 22064 23761 gene locus_tag LOCUS_03060 22064 23761 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_03060 23875 24450 gene locus_tag LOCUS_03070 23875 24450 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260948.1 protein_id gnl|my_center|LOCUS_03070 24472 25350 gene locus_tag LOCUS_03080 24472 25350 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205624.1 protein_id gnl|my_center|LOCUS_03080 26320 25394 gene locus_tag LOCUS_03090 26320 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 26459 26836 gene locus_tag LOCUS_03100 26459 26836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 27978 26833 gene locus_tag LOCUS_03110 gene lpxB 27978 26833 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_03110 28823 27975 gene locus_tag LOCUS_03120 28823 27975 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 protein_id gnl|my_center|LOCUS_03120 29446 28841 gene locus_tag LOCUS_03130 29446 28841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_03130 29570 30466 gene locus_tag LOCUS_03140 29570 30466 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_03140 30623 30420 gene locus_tag LOCUS_03150 30623 30420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 30801 32129 gene locus_tag LOCUS_03160 30801 32129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 <33214 32195 gene locus_tag LOCUS_03170 <33214 32195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339417.1:FAD-dependent oxidoreductase >Feature sequence010 313 2130 gene locus_tag LOCUS_03180 313 2130 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 protein_id gnl|my_center|LOCUS_03180 2127 3569 gene locus_tag LOCUS_03190 2127 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3569 4942 gene locus_tag LOCUS_03200 3569 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4997 5698 gene locus_tag LOCUS_03210 4997 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5756 7438 gene locus_tag LOCUS_03220 5756 7438 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_03220 7491 7916 gene locus_tag LOCUS_03230 7491 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 7913 9859 gene locus_tag LOCUS_03240 7913 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9910 11067 gene locus_tag LOCUS_03250 9910 11067 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243008.1 protein_id gnl|my_center|LOCUS_03250 11266 12069 gene locus_tag LOCUS_03260 11266 12069 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195445.1 protein_id gnl|my_center|LOCUS_03260 12827 12072 gene locus_tag LOCUS_03270 12827 12072 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967118.1 protein_id gnl|my_center|LOCUS_03270 13665 12835 gene locus_tag LOCUS_03280 13665 12835 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_03280 14546 13662 gene locus_tag LOCUS_03290 14546 13662 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_03290 15949 14705 gene locus_tag LOCUS_03300 15949 14705 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_03300 17088 15946 gene locus_tag LOCUS_03310 gene ugpC 17088 15946 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525203.1 protein_id gnl|my_center|LOCUS_03310 17294 18169 gene locus_tag LOCUS_03320 17294 18169 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_03320 19369 18224 gene locus_tag LOCUS_03330 19369 18224 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929856.1 protein_id gnl|my_center|LOCUS_03330 20934 19372 gene locus_tag LOCUS_03340 20934 19372 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064463.1 protein_id gnl|my_center|LOCUS_03340 21910 20999 gene locus_tag LOCUS_03350 21910 20999 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 protein_id gnl|my_center|LOCUS_03350 22089 23741 gene locus_tag LOCUS_03360 22089 23741 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_03360 23774 25351 gene locus_tag LOCUS_03370 23774 25351 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 protein_id gnl|my_center|LOCUS_03370 25416 26363 gene locus_tag LOCUS_03380 25416 26363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975337.1 protein_id gnl|my_center|LOCUS_03380 26360 28300 gene locus_tag LOCUS_03390 26360 28300 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_03390 26641 26735 gene locus_tag LOCUS_t00030 26641 26735 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 28297 29112 gene locus_tag LOCUS_03400 28297 29112 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975339.1 protein_id gnl|my_center|LOCUS_03400 <31924 29131 gene locus_tag LOCUS_03410 <31924 29131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337884.1:AsmA-like C-terminal region-containing protein >Feature sequence011 1371 94 gene locus_tag LOCUS_03420 1371 94 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531545.1 protein_id gnl|my_center|LOCUS_03420 3935 1527 gene locus_tag LOCUS_03430 3935 1527 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_03430 4455 3967 gene locus_tag LOCUS_03440 4455 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 7399 4448 gene locus_tag LOCUS_03450 7399 4448 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528150.1 protein_id gnl|my_center|LOCUS_03450 7659 7396 gene locus_tag LOCUS_03460 7659 7396 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536552.1 protein_id gnl|my_center|LOCUS_03460 8917 7670 gene locus_tag LOCUS_03470 8917 7670 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528148.1 protein_id gnl|my_center|LOCUS_03470 10217 8919 gene locus_tag LOCUS_03480 10217 8919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 protein_id gnl|my_center|LOCUS_03480 10396 10554 gene locus_tag LOCUS_03490 10396 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10551 11669 gene locus_tag LOCUS_03500 10551 11669 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_03500 11692 12660 gene locus_tag LOCUS_03510 11692 12660 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212117.1 protein_id gnl|my_center|LOCUS_03510 12807 13883 gene locus_tag LOCUS_03520 12807 13883 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389953.1 protein_id gnl|my_center|LOCUS_03520 13887 14822 gene locus_tag LOCUS_03530 gene rbsK 13887 14822 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339573.1 protein_id gnl|my_center|LOCUS_03530 14819 15583 gene locus_tag LOCUS_03540 14819 15583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_03540 17894 15558 gene locus_tag LOCUS_03550 17894 15558 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_03550 17984 18745 gene locus_tag LOCUS_03560 17984 18745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_03560 18745 19266 gene locus_tag LOCUS_03570 18745 19266 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088818.1 protein_id gnl|my_center|LOCUS_03570 19263 19661 gene locus_tag LOCUS_03580 19263 19661 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086222.1 protein_id gnl|my_center|LOCUS_03580 20180 19758 gene locus_tag LOCUS_03590 20180 19758 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530918.1 protein_id gnl|my_center|LOCUS_03590 20881 20267 gene locus_tag LOCUS_03600 20881 20267 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_03600 22019 20892 gene locus_tag LOCUS_03610 22019 20892 CDS product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_03610 22108 23037 gene locus_tag LOCUS_03620 22108 23037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857652.1 protein_id gnl|my_center|LOCUS_03620 23832 23059 gene locus_tag LOCUS_03630 23832 23059 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965976.1 protein_id gnl|my_center|LOCUS_03630 25382 23832 gene locus_tag LOCUS_03640 25382 23832 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_03640 27535 25385 gene locus_tag LOCUS_03650 27535 25385 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_03650 27701 28039 gene locus_tag LOCUS_03660 27701 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 29122 28046 gene locus_tag LOCUS_03670 29122 28046 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527983.1 protein_id gnl|my_center|LOCUS_03670 29967 29128 gene locus_tag LOCUS_03680 29967 29128 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_03680 30097 31062 gene locus_tag LOCUS_03690 30097 31062 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence012 396 1220 gene locus_tag LOCUS_03700 396 1220 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539808.1 protein_id gnl|my_center|LOCUS_03700 2916 1243 gene locus_tag LOCUS_03710 2916 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_03710 3794 2937 gene locus_tag LOCUS_03720 3794 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4834 3791 gene locus_tag LOCUS_03730 4834 3791 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_03730 5820 4831 gene locus_tag LOCUS_03740 5820 4831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528136.1 protein_id gnl|my_center|LOCUS_03740 6614 5817 gene locus_tag LOCUS_03750 6614 5817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173735.1 protein_id gnl|my_center|LOCUS_03750 7693 6680 gene locus_tag LOCUS_03760 7693 6680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_03760 9242 7701 gene locus_tag LOCUS_03770 9242 7701 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370099.1 protein_id gnl|my_center|LOCUS_03770 9364 10245 gene locus_tag LOCUS_03780 9364 10245 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_03780 10242 11222 gene locus_tag LOCUS_03790 10242 11222 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_03790 11219 11908 gene locus_tag LOCUS_03800 gene mcbR 11219 11908 CDS product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 protein_id gnl|my_center|LOCUS_03800 13135 11915 gene locus_tag LOCUS_03810 13135 11915 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_03810 13250 14797 gene locus_tag LOCUS_03820 13250 14797 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_03820 14833 15753 gene locus_tag LOCUS_03830 14833 15753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_03830 15746 16633 gene locus_tag LOCUS_03840 15746 16633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_03840 16630 17622 gene locus_tag LOCUS_03850 16630 17622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_03850 17619 18587 gene locus_tag LOCUS_03860 17619 18587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967725.1 protein_id gnl|my_center|LOCUS_03860 18602 20035 gene locus_tag LOCUS_03870 18602 20035 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_03870 20150 20857 gene locus_tag LOCUS_03880 gene phaR 20150 20857 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_03880 21002 21502 gene locus_tag LOCUS_03890 21002 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22251 21535 gene locus_tag LOCUS_03900 22251 21535 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_03900 22635 22399 gene locus_tag LOCUS_03910 22635 22399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 22537 23694 gene locus_tag LOCUS_03920 22537 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 25203 23710 gene locus_tag LOCUS_03930 25203 23710 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 protein_id gnl|my_center|LOCUS_03930 26819 25275 gene locus_tag LOCUS_03940 gene tcuA 26819 25275 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_03940 28249 26816 gene locus_tag LOCUS_03950 28249 26816 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 protein_id gnl|my_center|LOCUS_03950 28426 31554 gene locus_tag LOCUS_03960 28426 31554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence013 445 2073 gene locus_tag LOCUS_03970 445 2073 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_03970 2174 2034 gene locus_tag LOCUS_03980 2174 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3382 2540 gene locus_tag LOCUS_03990 3382 2540 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_03990 4221 3379 gene locus_tag LOCUS_04000 gene iolB 4221 3379 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_04000 5211 4234 gene locus_tag LOCUS_04010 gene iolC 5211 4234 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_04010 7076 5211 gene locus_tag LOCUS_04020 gene iolD 7076 5211 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968521.1 protein_id gnl|my_center|LOCUS_04020 7201 8304 gene locus_tag LOCUS_04030 7201 8304 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_04030 8325 9215 gene locus_tag LOCUS_04040 8325 9215 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612349.1 protein_id gnl|my_center|LOCUS_04040 9230 10363 gene locus_tag LOCUS_04050 9230 10363 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383268.1 protein_id gnl|my_center|LOCUS_04050 11304 10360 gene locus_tag LOCUS_04060 11304 10360 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429728.1 protein_id gnl|my_center|LOCUS_04060 11834 12778 gene locus_tag LOCUS_04070 11834 12778 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528361.1 protein_id gnl|my_center|LOCUS_04070 12894 13919 gene locus_tag LOCUS_04080 12894 13919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972979.1 protein_id gnl|my_center|LOCUS_04080 13930 14709 gene locus_tag LOCUS_04090 13930 14709 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528363.1 protein_id gnl|my_center|LOCUS_04090 16283 15042 gene locus_tag LOCUS_04100 16283 15042 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_04100 16391 17140 gene locus_tag LOCUS_04110 16391 17140 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528131.1 protein_id gnl|my_center|LOCUS_04110 18584 17151 gene locus_tag LOCUS_04120 18584 17151 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_04120 18678 20252 gene locus_tag LOCUS_04130 18678 20252 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087817.1 protein_id gnl|my_center|LOCUS_04130 20249 22564 gene locus_tag LOCUS_04140 20249 22564 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_04140 22896 23393 gene locus_tag LOCUS_04150 22896 23393 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_04150 24030 23446 gene locus_tag LOCUS_04160 24030 23446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 25323 24325 gene locus_tag LOCUS_04170 25323 24325 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_04170 26453 25356 gene locus_tag LOCUS_04180 26453 25356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 protein_id gnl|my_center|LOCUS_04180 27257 26463 gene locus_tag LOCUS_04190 27257 26463 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_04190 27444 28433 gene locus_tag LOCUS_04200 27444 28433 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_04200 <30799 28511 gene locus_tag LOCUS_04210 <30799 28511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083663.1:molybdopterin-dependent oxidoreductase >Feature sequence014 <1 508 gene locus_tag LOCUS_04220 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265911.1:aspartate aminotransferase family protein 2109 550 gene locus_tag LOCUS_04230 2109 550 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_04230 3191 2106 gene locus_tag LOCUS_04240 3191 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3703 3191 gene locus_tag LOCUS_04250 3703 3191 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_04250 4581 3751 gene locus_tag LOCUS_04260 4581 3751 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 protein_id gnl|my_center|LOCUS_04260 5458 4592 gene locus_tag LOCUS_04270 5458 4592 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398982.1 protein_id gnl|my_center|LOCUS_04270 6342 5455 gene locus_tag LOCUS_04280 6342 5455 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528721.1 protein_id gnl|my_center|LOCUS_04280 6850 6425 gene locus_tag LOCUS_04290 6850 6425 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085738.1 protein_id gnl|my_center|LOCUS_04290 7821 6859 gene locus_tag LOCUS_04300 gene pip 7821 6859 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_04300 7932 8303 gene locus_tag LOCUS_04310 7932 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8300 9214 gene locus_tag LOCUS_04320 8300 9214 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_04320 9262 9936 gene locus_tag LOCUS_04330 gene rpe 9262 9936 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_04330 9936 11546 gene locus_tag LOCUS_04340 9936 11546 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_04340 11566 12666 gene locus_tag LOCUS_04350 11566 12666 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_04350 12703 14277 gene locus_tag LOCUS_04360 gene purH 12703 14277 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_04360 15438 14302 gene locus_tag LOCUS_04370 15438 14302 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_04370 17436 15457 gene locus_tag LOCUS_04380 17436 15457 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_04380 17500 18552 gene locus_tag LOCUS_04390 17500 18552 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_04390 19821 18517 gene locus_tag LOCUS_04400 19821 18517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_04400 19913 20518 gene locus_tag LOCUS_04410 19913 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 20948 20547 gene locus_tag LOCUS_04420 20948 20547 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_04420 22493 21084 gene locus_tag LOCUS_04430 22493 21084 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_04430 24523 22670 gene locus_tag LOCUS_04440 gene htpG 24523 22670 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061603.1 protein_id gnl|my_center|LOCUS_04440 24662 27172 gene locus_tag LOCUS_04450 24662 27172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 27169 27519 gene locus_tag LOCUS_04460 27169 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence015 136 1026 gene locus_tag LOCUS_04470 136 1026 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_04470 1016 1513 gene locus_tag LOCUS_04480 1016 1513 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088978.1 protein_id gnl|my_center|LOCUS_04480 1564 3903 gene locus_tag LOCUS_04490 1564 3903 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088977.1 protein_id gnl|my_center|LOCUS_04490 3932 5173 gene locus_tag LOCUS_04500 3932 5173 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_04500 5202 6077 gene locus_tag LOCUS_04510 5202 6077 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_04510 6074 7045 gene locus_tag LOCUS_04520 6074 7045 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_04520 7042 7842 gene locus_tag LOCUS_04530 7042 7842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_04530 7835 8554 gene locus_tag LOCUS_04540 7835 8554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_04540 8945 10261 gene locus_tag LOCUS_04550 8945 10261 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729038.1 protein_id gnl|my_center|LOCUS_04550 10318 11331 gene locus_tag LOCUS_04560 10318 11331 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898152.1 protein_id gnl|my_center|LOCUS_04560 11464 12900 gene locus_tag LOCUS_04570 11464 12900 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_04570 12897 13700 gene locus_tag LOCUS_04580 12897 13700 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_04580 13700 15907 gene locus_tag LOCUS_04590 13700 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 16471 16007 gene locus_tag LOCUS_04600 gene ureE 16471 16007 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267500.1 protein_id gnl|my_center|LOCUS_04600 17576 16539 gene locus_tag LOCUS_04610 17576 16539 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_04610 18309 17614 gene locus_tag LOCUS_04620 gene urtE 18309 17614 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 protein_id gnl|my_center|LOCUS_04620 19068 18310 gene locus_tag LOCUS_04630 gene urtD 19068 18310 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 protein_id gnl|my_center|LOCUS_04630 20216 19065 gene locus_tag LOCUS_04640 gene urtC 20216 19065 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 protein_id gnl|my_center|LOCUS_04640 21111 20218 gene locus_tag LOCUS_04650 gene urtB 21111 20218 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215689.1 protein_id gnl|my_center|LOCUS_04650 22438 21185 gene locus_tag LOCUS_04660 22438 21185 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 protein_id gnl|my_center|LOCUS_04660 23268 22663 gene locus_tag LOCUS_04670 23268 22663 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313570.1 protein_id gnl|my_center|LOCUS_04670 24459 23278 gene locus_tag LOCUS_04680 24459 23278 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 protein_id gnl|my_center|LOCUS_04680 24985 24593 gene locus_tag LOCUS_04690 24985 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 25344 25114 gene locus_tag LOCUS_04700 25344 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 26601 25402 gene locus_tag LOCUS_04710 26601 25402 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024078840.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence016 2497 1013 gene locus_tag LOCUS_04720 2497 1013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_04720 3486 2584 gene locus_tag LOCUS_04730 3486 2584 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 protein_id gnl|my_center|LOCUS_04730 5083 3536 gene locus_tag LOCUS_04740 5083 3536 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_04740 5306 6976 gene locus_tag LOCUS_04750 gene ggt 5306 6976 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814321.1 protein_id gnl|my_center|LOCUS_04750 7031 8428 gene locus_tag LOCUS_04760 7031 8428 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140228.1 protein_id gnl|my_center|LOCUS_04760 8425 9051 gene locus_tag LOCUS_04770 8425 9051 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_04770 9048 9845 gene locus_tag LOCUS_04780 gene fetB 9048 9845 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_04780 9865 11367 gene locus_tag LOCUS_04790 gene glpK 9865 11367 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_04790 11869 11351 gene locus_tag LOCUS_04800 11869 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 12017 12730 gene locus_tag LOCUS_04810 12017 12730 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_04810 12805 14973 gene locus_tag LOCUS_04820 12805 14973 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084290.1 protein_id gnl|my_center|LOCUS_04820 15040 15276 gene locus_tag LOCUS_04830 15040 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 15352 16128 gene locus_tag LOCUS_04840 15352 16128 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 protein_id gnl|my_center|LOCUS_04840 16058 16633 gene locus_tag LOCUS_04850 16058 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 16746 18035 gene locus_tag LOCUS_04860 16746 18035 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_04860 19196 18072 gene locus_tag LOCUS_04870 19196 18072 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087319.1 protein_id gnl|my_center|LOCUS_04870 19417 20655 gene locus_tag LOCUS_04880 19417 20655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_04880 21529 20669 gene locus_tag LOCUS_04890 gene purU 21529 20669 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921457.1 protein_id gnl|my_center|LOCUS_04890 24315 21628 gene locus_tag LOCUS_04900 24315 21628 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_04900 24927 24418 gene locus_tag LOCUS_04910 gene popZ 24927 24418 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_04910 26437 25043 gene locus_tag LOCUS_04920 26437 25043 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence017 89 1969 gene locus_tag LOCUS_04930 89 1969 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_04930 1969 6003 gene locus_tag LOCUS_04940 1969 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6803 6012 gene locus_tag LOCUS_04950 6803 6012 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086299.1 protein_id gnl|my_center|LOCUS_04950 8008 6842 gene locus_tag LOCUS_04960 8008 6842 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_04960 9276 8035 gene locus_tag LOCUS_04970 9276 8035 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 protein_id gnl|my_center|LOCUS_04970 10139 9276 gene locus_tag LOCUS_04980 10139 9276 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_04980 10594 10136 gene locus_tag LOCUS_04990 10594 10136 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_04990 10707 12089 gene locus_tag LOCUS_05000 10707 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 12082 13026 gene locus_tag LOCUS_05010 12082 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 13056 14228 gene locus_tag LOCUS_05020 13056 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 14231 16252 gene locus_tag LOCUS_05030 14231 16252 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_05030 16252 18021 gene locus_tag LOCUS_05040 16252 18021 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_05040 18018 19241 gene locus_tag LOCUS_05050 18018 19241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089187.1 protein_id gnl|my_center|LOCUS_05050 19241 20131 gene locus_tag LOCUS_05060 19241 20131 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_05060 20118 21119 gene locus_tag LOCUS_05070 20118 21119 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_05070 21116 21841 gene locus_tag LOCUS_05080 21116 21841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_05080 21838 22560 gene locus_tag LOCUS_05090 21838 22560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_05090 22624 23367 gene locus_tag LOCUS_05100 22624 23367 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929678.1 protein_id gnl|my_center|LOCUS_05100 23480 24799 gene locus_tag LOCUS_05110 23480 24799 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965985.1 protein_id gnl|my_center|LOCUS_05110 24803 25267 gene locus_tag LOCUS_05120 24803 25267 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence018 1412 1041 gene locus_tag LOCUS_05130 1412 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1823 2161 gene locus_tag LOCUS_05140 1823 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2235 3209 gene locus_tag LOCUS_05150 2235 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3206 3958 gene locus_tag LOCUS_05160 3206 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3971 4507 gene locus_tag LOCUS_05170 3971 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4504 5187 gene locus_tag LOCUS_05180 4504 5187 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_05180 5171 6577 gene locus_tag LOCUS_05190 5171 6577 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_05190 8015 6738 gene locus_tag LOCUS_05200 8015 6738 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229236.1 protein_id gnl|my_center|LOCUS_05200 8953 8093 gene locus_tag LOCUS_05210 8953 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 9200 10897 gene locus_tag LOCUS_05220 9200 10897 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272247.1 protein_id gnl|my_center|LOCUS_05220 10935 11399 gene locus_tag LOCUS_05230 10935 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 11486 12634 gene locus_tag LOCUS_05240 11486 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 12731 15283 gene locus_tag LOCUS_05250 12731 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 15280 16269 gene locus_tag LOCUS_05260 15280 16269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528929.1 protein_id gnl|my_center|LOCUS_05260 16353 16279 gene locus_tag LOCUS_t00040 16353 16279 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17646 16444 gene locus_tag LOCUS_05270 17646 16444 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921556.1 protein_id gnl|my_center|LOCUS_05270 18598 17651 gene locus_tag LOCUS_05280 18598 17651 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090550.1 protein_id gnl|my_center|LOCUS_05280 19482 18598 gene locus_tag LOCUS_05290 19482 18598 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_05290 20168 19485 gene locus_tag LOCUS_05300 20168 19485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_05300 21015 20179 gene locus_tag LOCUS_05310 21015 20179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_05310 22207 21146 gene locus_tag LOCUS_05320 22207 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 23460 22213 gene locus_tag LOCUS_05330 23460 22213 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881275.1 protein_id gnl|my_center|LOCUS_05330 24530 23457 gene locus_tag LOCUS_05340 24530 23457 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391982.1 protein_id gnl|my_center|LOCUS_05340 <25250 24527 gene locus_tag LOCUS_05350 <25250 24527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880219.1:radical SAM protein >Feature sequence019 1308 313 gene locus_tag LOCUS_05360 1308 313 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_05360 1432 2328 gene locus_tag LOCUS_05370 1432 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3132 2347 gene locus_tag LOCUS_05380 3132 2347 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_05380 3887 3129 gene locus_tag LOCUS_05390 3887 3129 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173811.1 protein_id gnl|my_center|LOCUS_05390 3917 5191 gene locus_tag LOCUS_05400 3917 5191 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_05400 5209 5721 gene locus_tag LOCUS_05410 5209 5721 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444444.1 protein_id gnl|my_center|LOCUS_05410 6948 5731 gene locus_tag LOCUS_05420 gene choV 6948 5731 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096690.1 protein_id gnl|my_center|LOCUS_05420 7802 6945 gene locus_tag LOCUS_05430 gene choW 7802 6945 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463667.1 protein_id gnl|my_center|LOCUS_05430 8801 7863 gene locus_tag LOCUS_05440 8801 7863 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975284.1 protein_id gnl|my_center|LOCUS_05440 8975 11020 gene locus_tag LOCUS_05450 gene parE 8975 11020 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_05450 11071 12132 gene locus_tag LOCUS_05460 11071 12132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_05460 12129 13013 gene locus_tag LOCUS_05470 12129 13013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_05470 14018 13014 gene locus_tag LOCUS_05480 14018 13014 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098445.1 protein_id gnl|my_center|LOCUS_05480 14997 14098 gene locus_tag LOCUS_05490 14997 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 16016 15123 gene locus_tag LOCUS_05500 16016 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089645.1 protein_id gnl|my_center|LOCUS_05500 16832 16035 gene locus_tag LOCUS_05510 16832 16035 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_05510 16964 17971 gene locus_tag LOCUS_05520 16964 17971 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_05520 18119 17934 gene locus_tag LOCUS_05530 gene ccoS 18119 17934 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_05530 20488 18116 gene locus_tag LOCUS_05540 20488 18116 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_05540 20967 20485 gene locus_tag LOCUS_05550 20967 20485 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391072.1 protein_id gnl|my_center|LOCUS_05550 22452 20986 gene locus_tag LOCUS_05560 gene ccoG 22452 20986 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_05560 23344 22475 gene locus_tag LOCUS_05570 gene ccoP 23344 22475 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 protein_id gnl|my_center|LOCUS_05570 23506 23357 gene locus_tag LOCUS_05580 23506 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 24242 23517 gene locus_tag LOCUS_05590 gene ccoO 24242 23517 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085549.1 protein_id gnl|my_center|LOCUS_05590 <24943 24244 gene locus_tag LOCUS_05600 <24943 24244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391079.1:cytochrome-c oxidase, cbb3-type subunit I >Feature sequence020 457 1395 gene locus_tag LOCUS_05610 457 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5565 1402 gene locus_tag LOCUS_05620 5565 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 7009 5570 gene locus_tag LOCUS_05630 gene glgA 7009 5570 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_05630 8283 7015 gene locus_tag LOCUS_05640 gene glgC 8283 7015 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089198.1 protein_id gnl|my_center|LOCUS_05640 10560 8356 gene locus_tag LOCUS_05650 gene glgB 10560 8356 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 protein_id gnl|my_center|LOCUS_05650 13085 10581 gene locus_tag LOCUS_05660 13085 10581 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403097.1 protein_id gnl|my_center|LOCUS_05660 15260 13212 gene locus_tag LOCUS_05670 15260 13212 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_05670 15324 17756 gene locus_tag LOCUS_05680 gene hrpB 15324 17756 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_05680 18023 17829 gene locus_tag LOCUS_05690 18023 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 17938 18942 gene locus_tag LOCUS_05700 17938 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18961 19644 gene locus_tag LOCUS_05710 18961 19644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_05710 19734 21152 gene locus_tag LOCUS_05720 19734 21152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_05720 21160 21459 gene locus_tag LOCUS_05730 21160 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 22144 21476 gene locus_tag LOCUS_05740 22144 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 23175 22210 gene locus_tag LOCUS_05750 23175 22210 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_05750 23309 23614 gene locus_tag LOCUS_05760 gene clpS 23309 23614 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085422.1 protein_id gnl|my_center|LOCUS_05760 23930 23625 gene locus_tag LOCUS_05770 23930 23625 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173016.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence021 2030 1002 gene locus_tag LOCUS_05780 2030 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3487 2111 gene locus_tag LOCUS_05790 3487 2111 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975734.1 protein_id gnl|my_center|LOCUS_05790 5580 3484 gene locus_tag LOCUS_05800 5580 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6045 5969 gene locus_tag LOCUS_t00050 6045 5969 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6369 6058 gene locus_tag LOCUS_05810 6369 6058 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_05810 6481 6405 gene locus_tag LOCUS_t00060 6481 6405 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7027 6539 gene locus_tag LOCUS_05820 7027 6539 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626214.1 protein_id gnl|my_center|LOCUS_05820 8154 7024 gene locus_tag LOCUS_05830 8154 7024 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 protein_id gnl|my_center|LOCUS_05830 8298 8504 gene locus_tag LOCUS_05840 8298 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 10124 8514 gene locus_tag LOCUS_05850 10124 8514 CDS product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918646.1 protein_id gnl|my_center|LOCUS_05850 11728 10121 gene locus_tag LOCUS_05860 gene cydD 11728 10121 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918647.1 protein_id gnl|my_center|LOCUS_05860 11862 13427 gene locus_tag LOCUS_05870 11862 13427 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918648.1 protein_id gnl|my_center|LOCUS_05870 13440 14588 gene locus_tag LOCUS_05880 gene cydB 13440 14588 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918649.1 protein_id gnl|my_center|LOCUS_05880 14604 14723 gene locus_tag LOCUS_05890 gene cydX 14604 14723 CDS product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640056.1 protein_id gnl|my_center|LOCUS_05890 15360 14743 gene locus_tag LOCUS_05900 15360 14743 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_05900 15701 15357 gene locus_tag LOCUS_05910 15701 15357 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_05910 16119 15763 gene locus_tag LOCUS_05920 16119 15763 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_05920 16395 16192 gene locus_tag LOCUS_05930 16395 16192 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_05930 16856 16407 gene locus_tag LOCUS_05940 gene trxC 16856 16407 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_05940 18157 16868 gene locus_tag LOCUS_05950 18157 16868 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_05950 18285 18626 gene locus_tag LOCUS_05960 18285 18626 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 protein_id gnl|my_center|LOCUS_05960 18649 18984 gene locus_tag LOCUS_05970 18649 18984 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_05970 19201 21498 gene locus_tag LOCUS_05980 19201 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence022 775 2088 gene locus_tag LOCUS_05990 gene fliI 775 2088 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920876.1 protein_id gnl|my_center|LOCUS_05990 2081 2518 gene locus_tag LOCUS_06000 2081 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2580 3893 gene locus_tag LOCUS_06010 2580 3893 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_06010 3890 5578 gene locus_tag LOCUS_06020 3890 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 7096 5600 gene locus_tag LOCUS_06030 7096 5600 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_06030 7535 8227 gene locus_tag LOCUS_06040 gene cysD 7535 8227 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_06040 8229 10136 gene locus_tag LOCUS_06050 gene cysN 8229 10136 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_06050 10162 11325 gene locus_tag LOCUS_06060 10162 11325 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967043.1 protein_id gnl|my_center|LOCUS_06060 11476 11700 gene locus_tag LOCUS_06070 11476 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 13191 11704 gene locus_tag LOCUS_06080 13191 11704 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175379.1 protein_id gnl|my_center|LOCUS_06080 13952 13347 gene locus_tag LOCUS_06090 13952 13347 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833880.1 protein_id gnl|my_center|LOCUS_06090 14069 14740 gene locus_tag LOCUS_06100 14069 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 14737 15897 gene locus_tag LOCUS_06110 14737 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_06110 16811 15900 gene locus_tag LOCUS_06120 16811 15900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_06120 17856 16801 gene locus_tag LOCUS_06130 17856 16801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_06130 18023 19093 gene locus_tag LOCUS_06140 18023 19093 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965491.1 protein_id gnl|my_center|LOCUS_06140 19103 20167 gene locus_tag LOCUS_06150 19103 20167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_06150 20157 21014 gene locus_tag LOCUS_06160 20157 21014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089930.1 protein_id gnl|my_center|LOCUS_06160 21035 21799 gene locus_tag LOCUS_06170 21035 21799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 protein_id gnl|my_center|LOCUS_06170 21891 22670 gene locus_tag LOCUS_06180 21891 22670 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815696.1 protein_id gnl|my_center|LOCUS_06180 22674 23819 gene locus_tag LOCUS_06190 22674 23819 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976305.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence023 <1 2830 gene locus_tag LOCUS_06200 <1 2830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105234.1:transglutaminase family protein 2905 4392 gene locus_tag LOCUS_06210 2905 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4389 4910 gene locus_tag LOCUS_06220 4389 4910 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_06220 5429 4974 gene locus_tag LOCUS_06230 5429 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5536 5910 gene locus_tag LOCUS_06240 5536 5910 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_06240 5928 6725 gene locus_tag LOCUS_06250 5928 6725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338656.1 protein_id gnl|my_center|LOCUS_06250 6846 6989 gene locus_tag LOCUS_06260 6846 6989 CDS product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528205.1 protein_id gnl|my_center|LOCUS_06260 8105 6999 gene locus_tag LOCUS_06270 8105 6999 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398410.1 protein_id gnl|my_center|LOCUS_06270 8262 9053 gene locus_tag LOCUS_06280 8262 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 9906 9025 gene locus_tag LOCUS_06290 9906 9025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808813.1 protein_id gnl|my_center|LOCUS_06290 10408 9968 gene locus_tag LOCUS_06300 10408 9968 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531820.1 protein_id gnl|my_center|LOCUS_06300 10833 10492 gene locus_tag LOCUS_06310 10833 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 13163 11223 gene locus_tag LOCUS_06320 gene shc 13163 11223 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_06320 14401 13160 gene locus_tag LOCUS_06330 gene hpnE 14401 13160 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_06330 15719 14553 gene locus_tag LOCUS_06340 15719 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 16038 17933 gene locus_tag LOCUS_06350 16038 17933 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_06350 17938 18180 gene locus_tag LOCUS_06360 17938 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 18212 22849 gene locus_tag LOCUS_06370 18212 22849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 22846 23298 gene locus_tag LOCUS_06380 22846 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence024 775 1614 gene locus_tag LOCUS_06390 gene mutM 775 1614 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_06390 1655 2425 gene locus_tag LOCUS_06400 1655 2425 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_06400 2714 2983 gene locus_tag LOCUS_06410 gene rpsT 2714 2983 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 protein_id gnl|my_center|LOCUS_06410 3558 3133 gene locus_tag LOCUS_06420 3558 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 3442 4806 gene locus_tag LOCUS_06430 gene dnaA 3442 4806 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_06430 4948 6072 gene locus_tag LOCUS_06440 gene dnaN 4948 6072 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_06440 6080 7267 gene locus_tag LOCUS_06450 gene recF 6080 7267 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651375.1 protein_id gnl|my_center|LOCUS_06450 7320 9764 gene locus_tag LOCUS_06460 gene gyrB 7320 9764 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_06460 10015 10755 gene locus_tag LOCUS_06470 10015 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 11080 11811 gene locus_tag LOCUS_06480 11080 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11970 12938 gene locus_tag LOCUS_06490 11970 12938 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393170.1 protein_id gnl|my_center|LOCUS_06490 12966 14396 gene locus_tag LOCUS_06500 12966 14396 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254855.1 protein_id gnl|my_center|LOCUS_06500 14496 15416 gene locus_tag LOCUS_06510 14496 15416 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536394.1 protein_id gnl|my_center|LOCUS_06510 15403 16272 gene locus_tag LOCUS_06520 15403 16272 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331590.1 protein_id gnl|my_center|LOCUS_06520 16269 17372 gene locus_tag LOCUS_06530 16269 17372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393150.1 protein_id gnl|my_center|LOCUS_06530 16491 16408 gene locus_tag LOCUS_t00070 16491 16408 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17369 18457 gene locus_tag LOCUS_06540 17369 18457 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976290.1 protein_id gnl|my_center|LOCUS_06540 18454 20025 gene locus_tag LOCUS_06550 18454 20025 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243667.1 protein_id gnl|my_center|LOCUS_06550 20015 21070 gene locus_tag LOCUS_06560 20015 21070 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_06560 21076 22569 gene locus_tag LOCUS_06570 21076 22569 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence025 <1 1047 gene locus_tag LOCUS_06580 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336960.1:M24 family metallopeptidase 1653 1057 gene locus_tag LOCUS_06590 1653 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2366 1707 gene locus_tag LOCUS_06600 2366 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2448 3305 gene locus_tag LOCUS_06610 2448 3305 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_06610 4108 3302 gene locus_tag LOCUS_06620 4108 3302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768044.1 protein_id gnl|my_center|LOCUS_06620 5329 4115 gene locus_tag LOCUS_06630 5329 4115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_06630 6399 5326 gene locus_tag LOCUS_06640 6399 5326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 protein_id gnl|my_center|LOCUS_06640 7448 6420 gene locus_tag LOCUS_06650 7448 6420 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188909205.1 protein_id gnl|my_center|LOCUS_06650 7706 8119 gene locus_tag LOCUS_06660 7706 8119 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 protein_id gnl|my_center|LOCUS_06660 8121 8804 gene locus_tag LOCUS_06670 8121 8804 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 protein_id gnl|my_center|LOCUS_06670 8854 9267 gene locus_tag LOCUS_06680 8854 9267 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088450.1 protein_id gnl|my_center|LOCUS_06680 9360 10046 gene locus_tag LOCUS_06690 9360 10046 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039926.1 protein_id gnl|my_center|LOCUS_06690 10984 10043 gene locus_tag LOCUS_06700 10984 10043 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_06700 11880 10981 gene locus_tag LOCUS_06710 11880 10981 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_06710 12593 11877 gene locus_tag LOCUS_06720 12593 11877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_06720 13345 12590 gene locus_tag LOCUS_06730 13345 12590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_06730 13419 13892 gene locus_tag LOCUS_06740 13419 13892 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532979.1 protein_id gnl|my_center|LOCUS_06740 13924 14274 gene locus_tag LOCUS_06750 13924 14274 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_06750 14271 15308 gene locus_tag LOCUS_06760 14271 15308 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_06760 15330 16637 gene locus_tag LOCUS_06770 15330 16637 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_06770 16634 17914 gene locus_tag LOCUS_06780 16634 17914 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532985.1 protein_id gnl|my_center|LOCUS_06780 18414 17920 gene locus_tag LOCUS_06790 18414 17920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 18580 19368 gene locus_tag LOCUS_06800 18580 19368 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_06800 19395 20936 gene locus_tag LOCUS_06810 gene xylB 19395 20936 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_06810 21065 22036 gene locus_tag LOCUS_06820 21065 22036 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence026 <1 929 gene locus_tag LOCUS_06830 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064509752.1:glycosyltransferase family 2 protein 940 2847 gene locus_tag LOCUS_06840 940 2847 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_06840 2844 3956 gene locus_tag LOCUS_06850 2844 3956 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626518.1 protein_id gnl|my_center|LOCUS_06850 4575 4024 gene locus_tag LOCUS_06860 4575 4024 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_06860 4879 4718 gene locus_tag LOCUS_06870 4879 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5111 6223 gene locus_tag LOCUS_06880 5111 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6232 7671 gene locus_tag LOCUS_06890 6232 7671 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058017.1 protein_id gnl|my_center|LOCUS_06890 7871 9181 gene locus_tag LOCUS_06900 7871 9181 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524110.1 protein_id gnl|my_center|LOCUS_06900 10207 9185 gene locus_tag LOCUS_06910 10207 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 11178 10204 gene locus_tag LOCUS_06920 11178 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 11273 12847 gene locus_tag LOCUS_06930 11273 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 11520 11618 gene locus_tag LOCUS_t00080 11520 11618 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 14094 12760 gene locus_tag LOCUS_06940 14094 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 14960 14091 gene locus_tag LOCUS_06950 14960 14091 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_06950 15991 14957 gene locus_tag LOCUS_06960 15991 14957 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_06960 17923 16076 gene locus_tag LOCUS_06970 17923 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 18981 17995 gene locus_tag LOCUS_06980 18981 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 20528 18984 gene locus_tag LOCUS_06990 20528 18984 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_06990 21206 20541 gene locus_tag LOCUS_07000 21206 20541 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_07000 21359 21285 gene locus_tag LOCUS_t00090 21359 21285 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21897 21676 gene locus_tag LOCUS_07010 21897 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence027 886 95 gene locus_tag LOCUS_07020 886 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2441 861 gene locus_tag LOCUS_07030 gene nusA 2441 861 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_07030 2921 2454 gene locus_tag LOCUS_07040 2921 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4491 3079 gene locus_tag LOCUS_07050 4491 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 5192 4563 gene locus_tag LOCUS_07060 gene trmB 5192 4563 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07060 6466 5279 gene locus_tag LOCUS_07070 gene metK 6466 5279 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_07070 7321 6569 gene locus_tag LOCUS_07080 gene dapB 7321 6569 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_07080 7441 8052 gene locus_tag LOCUS_07090 7441 8052 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_07090 9249 8107 gene locus_tag LOCUS_07100 gene dnaJ 9249 8107 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_07100 11259 9340 gene locus_tag LOCUS_07110 gene dnaK 11259 9340 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_07110 12034 11402 gene locus_tag LOCUS_07120 gene grpE 12034 11402 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974227.1 protein_id gnl|my_center|LOCUS_07120 12403 12140 gene locus_tag LOCUS_07130 12403 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14007 12400 gene locus_tag LOCUS_07140 14007 12400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_07140 15032 14004 gene locus_tag LOCUS_07150 15032 14004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390916.1 protein_id gnl|my_center|LOCUS_07150 16117 15038 gene locus_tag LOCUS_07160 gene yejB 16117 15038 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390915.1 protein_id gnl|my_center|LOCUS_07160 18083 16137 gene locus_tag LOCUS_07170 18083 16137 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104691.1 protein_id gnl|my_center|LOCUS_07170 18896 18090 gene locus_tag LOCUS_07180 gene hisN 18896 18090 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_07180 19211 19948 gene locus_tag LOCUS_07190 19211 19948 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_07190 19945 20796 gene locus_tag LOCUS_07200 19945 20796 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_07200 21496 20819 gene locus_tag LOCUS_07210 21496 20819 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974434.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence028 241 1506 gene locus_tag LOCUS_07220 241 1506 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 protein_id gnl|my_center|LOCUS_07220 1503 2273 gene locus_tag LOCUS_07230 1503 2273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_07230 2270 2995 gene locus_tag LOCUS_07240 2270 2995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_07240 3042 3920 gene locus_tag LOCUS_07250 3042 3920 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_07250 3924 5462 gene locus_tag LOCUS_07260 3924 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5488 7803 gene locus_tag LOCUS_07270 5488 7803 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_07270 7906 9963 gene locus_tag LOCUS_07280 7906 9963 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275305.1 protein_id gnl|my_center|LOCUS_07280 9972 10943 gene locus_tag LOCUS_07290 9972 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10940 12160 gene locus_tag LOCUS_07300 10940 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 13959 12157 gene locus_tag LOCUS_07310 13959 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 13934 14143 gene locus_tag LOCUS_07320 13934 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 14520 17204 gene locus_tag LOCUS_07330 14520 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 17717 17214 gene locus_tag LOCUS_07340 17717 17214 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 protein_id gnl|my_center|LOCUS_07340 18037 17714 gene locus_tag LOCUS_07350 18037 17714 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 protein_id gnl|my_center|LOCUS_07350 18154 19362 gene locus_tag LOCUS_07360 18154 19362 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393073.1 protein_id gnl|my_center|LOCUS_07360 20373 19369 gene locus_tag LOCUS_07370 20373 19369 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529341.1 protein_id gnl|my_center|LOCUS_07370 21541 20408 gene locus_tag LOCUS_07380 21541 20408 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence029 203 1033 gene locus_tag LOCUS_07390 gene cobA 203 1033 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531077.1 protein_id gnl|my_center|LOCUS_07390 1018 2346 gene locus_tag LOCUS_07400 1018 2346 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531076.1 protein_id gnl|my_center|LOCUS_07400 2343 3359 gene locus_tag LOCUS_07410 gene cobT 2343 3359 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 protein_id gnl|my_center|LOCUS_07410 3364 4110 gene locus_tag LOCUS_07420 gene cobS 3364 4110 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388426.1 protein_id gnl|my_center|LOCUS_07420 4619 4035 gene locus_tag LOCUS_07430 4619 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5791 4616 gene locus_tag LOCUS_07440 gene rhmD 5791 4616 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_07440 6344 5859 gene locus_tag LOCUS_07450 6344 5859 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606946.1 protein_id gnl|my_center|LOCUS_07450 6517 6432 gene locus_tag LOCUS_t00100 6517 6432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6562 7224 gene locus_tag LOCUS_07460 gene lipB 6562 7224 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389749.1 protein_id gnl|my_center|LOCUS_07460 7720 7229 gene locus_tag LOCUS_07470 7720 7229 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087128.1 protein_id gnl|my_center|LOCUS_07470 7992 7717 gene locus_tag LOCUS_07480 7992 7717 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_07480 8696 7989 gene locus_tag LOCUS_07490 8696 7989 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_07490 11285 8703 gene locus_tag LOCUS_07500 11285 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 12371 11370 gene locus_tag LOCUS_07510 12371 11370 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_07510 13678 12368 gene locus_tag LOCUS_07520 13678 12368 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_07520 14729 13734 gene locus_tag LOCUS_07530 14729 13734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389954.1 protein_id gnl|my_center|LOCUS_07530 15731 14742 gene locus_tag LOCUS_07540 15731 14742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389955.1 protein_id gnl|my_center|LOCUS_07540 17227 15728 gene locus_tag LOCUS_07550 17227 15728 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626345.1 protein_id gnl|my_center|LOCUS_07550 18357 17296 gene locus_tag LOCUS_07560 18357 17296 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389957.1 protein_id gnl|my_center|LOCUS_07560 18683 19072 gene locus_tag LOCUS_07570 18683 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 19069 20295 gene locus_tag LOCUS_07580 19069 20295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_07580 20292 21017 gene locus_tag LOCUS_07590 20292 21017 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence030 <1 1614 gene locus_tag LOCUS_07600 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162491196.1:hydantoinase/oxoprolinase family protein 1611 3380 gene locus_tag LOCUS_07610 1611 3380 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_07610 3554 4294 gene locus_tag LOCUS_07620 3554 4294 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434512.1 protein_id gnl|my_center|LOCUS_07620 4284 5324 gene locus_tag LOCUS_07630 4284 5324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530853.1 protein_id gnl|my_center|LOCUS_07630 5392 6408 gene locus_tag LOCUS_07640 5392 6408 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970486.1 protein_id gnl|my_center|LOCUS_07640 6483 7604 gene locus_tag LOCUS_07650 6483 7604 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_07650 7983 7741 gene locus_tag LOCUS_07660 7983 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7906 8127 gene locus_tag LOCUS_07670 7906 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8994 8173 gene locus_tag LOCUS_07680 8994 8173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969509.1 protein_id gnl|my_center|LOCUS_07680 10137 9130 gene locus_tag LOCUS_07690 10137 9130 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066596.1 protein_id gnl|my_center|LOCUS_07690 11004 10171 gene locus_tag LOCUS_07700 11004 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 11870 11004 gene locus_tag LOCUS_07710 11870 11004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394444.1 protein_id gnl|my_center|LOCUS_07710 12669 11863 gene locus_tag LOCUS_07720 12669 11863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_07720 13945 12680 gene locus_tag LOCUS_07730 13945 12680 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085703.1 protein_id gnl|my_center|LOCUS_07730 15216 13942 gene locus_tag LOCUS_07740 gene preA 15216 13942 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_07740 16578 15232 gene locus_tag LOCUS_07750 16578 15232 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563248.1 protein_id gnl|my_center|LOCUS_07750 16719 17378 gene locus_tag LOCUS_07760 16719 17378 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529814.1 protein_id gnl|my_center|LOCUS_07760 17396 18844 gene locus_tag LOCUS_07770 gene hydA 17396 18844 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 protein_id gnl|my_center|LOCUS_07770 18841 19722 gene locus_tag LOCUS_07780 18841 19722 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970634.1 protein_id gnl|my_center|LOCUS_07780 21057 19723 gene locus_tag LOCUS_07790 21057 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence031 939 1832 gene locus_tag LOCUS_07800 939 1832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_07800 1829 2632 gene locus_tag LOCUS_07810 1829 2632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970689.1 protein_id gnl|my_center|LOCUS_07810 2629 3492 gene locus_tag LOCUS_07820 gene aguB 2629 3492 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189258.1 protein_id gnl|my_center|LOCUS_07820 3643 4644 gene locus_tag LOCUS_07830 3643 4644 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 protein_id gnl|my_center|LOCUS_07830 4706 5749 gene locus_tag LOCUS_07840 4706 5749 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_07840 5746 7287 gene locus_tag LOCUS_07850 5746 7287 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085058.1 protein_id gnl|my_center|LOCUS_07850 7284 8258 gene locus_tag LOCUS_07860 7284 8258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972725.1 protein_id gnl|my_center|LOCUS_07860 8340 9224 gene locus_tag LOCUS_07870 gene yghU 8340 9224 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_07870 9305 10315 gene locus_tag LOCUS_07880 9305 10315 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974199.1 protein_id gnl|my_center|LOCUS_07880 10369 12132 gene locus_tag LOCUS_07890 10369 12132 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087283.1 protein_id gnl|my_center|LOCUS_07890 13067 12129 gene locus_tag LOCUS_07900 13067 12129 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_07900 13188 13595 gene locus_tag LOCUS_07910 13188 13595 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_07910 13619 14602 gene locus_tag LOCUS_07920 13619 14602 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_07920 14809 16101 gene locus_tag LOCUS_07930 14809 16101 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_07930 16132 16932 gene locus_tag LOCUS_07940 gene surE 16132 16932 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_07940 16929 17942 gene locus_tag LOCUS_07950 16929 17942 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_07950 18863 17952 gene locus_tag LOCUS_07960 18863 17952 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 protein_id gnl|my_center|LOCUS_07960 19701 18868 gene locus_tag LOCUS_07970 19701 18868 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_07970 20609 19722 gene locus_tag LOCUS_07980 20609 19722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence032 1650 625 gene locus_tag LOCUS_07990 1650 625 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170068.1 protein_id gnl|my_center|LOCUS_07990 2916 1651 gene locus_tag LOCUS_08000 2916 1651 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815570.1 protein_id gnl|my_center|LOCUS_08000 3012 3977 gene locus_tag LOCUS_08010 3012 3977 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_08010 3989 4951 gene locus_tag LOCUS_08020 3989 4951 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_08020 7345 4967 gene locus_tag LOCUS_08030 7345 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7479 8123 gene locus_tag LOCUS_08040 7479 8123 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086182.1 protein_id gnl|my_center|LOCUS_08040 8358 8155 gene locus_tag LOCUS_08050 8358 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10107 8539 gene locus_tag LOCUS_08060 10107 8539 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_08060 10672 10124 gene locus_tag LOCUS_08070 10672 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_08070 11099 10704 gene locus_tag LOCUS_08080 11099 10704 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090221.1 protein_id gnl|my_center|LOCUS_08080 11493 11101 gene locus_tag LOCUS_08090 11493 11101 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174648.1 protein_id gnl|my_center|LOCUS_08090 11910 11581 gene locus_tag LOCUS_08100 11910 11581 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533207.1 protein_id gnl|my_center|LOCUS_08100 12187 13572 gene locus_tag LOCUS_08110 12187 13572 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 protein_id gnl|my_center|LOCUS_08110 14097 13576 gene locus_tag LOCUS_08120 14097 13576 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_08120 15400 14156 gene locus_tag LOCUS_08130 gene soxC 15400 14156 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_08130 17096 15489 gene locus_tag LOCUS_08140 17096 15489 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921437.1 protein_id gnl|my_center|LOCUS_08140 18103 17093 gene locus_tag LOCUS_08150 18103 17093 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014745580.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence033 133 936 gene locus_tag LOCUS_08160 133 936 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_08160 933 1070 gene locus_tag LOCUS_08170 933 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1095 1613 gene locus_tag LOCUS_08180 gene ccmE 1095 1613 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_08180 1610 3586 gene locus_tag LOCUS_08190 1610 3586 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974837.1 protein_id gnl|my_center|LOCUS_08190 3583 4116 gene locus_tag LOCUS_08200 3583 4116 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921501.1 protein_id gnl|my_center|LOCUS_08200 4113 4595 gene locus_tag LOCUS_08210 4113 4595 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_08210 4592 5308 gene locus_tag LOCUS_08220 4592 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08220 5752 5312 gene locus_tag LOCUS_08230 5752 5312 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384877.1 protein_id gnl|my_center|LOCUS_08230 5797 6516 gene locus_tag LOCUS_08240 5797 6516 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_08240 6513 7253 gene locus_tag LOCUS_08250 6513 7253 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08250 7250 7798 gene locus_tag LOCUS_08260 gene rsmD 7250 7798 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_08260 8050 9171 gene locus_tag LOCUS_08270 8050 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9171 10583 gene locus_tag LOCUS_08280 9171 10583 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_08280 11169 10639 gene locus_tag LOCUS_08290 11169 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 11330 12154 gene locus_tag LOCUS_08300 gene moeB 11330 12154 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_08300 12144 12530 gene locus_tag LOCUS_08310 12144 12530 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391539.1 protein_id gnl|my_center|LOCUS_08310 12583 13506 gene locus_tag LOCUS_08320 12583 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 13538 13861 gene locus_tag LOCUS_08330 13538 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 13861 14139 gene locus_tag LOCUS_08340 13861 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 14136 14714 gene locus_tag LOCUS_08350 gene nthA 14136 14714 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_08350 14798 16381 gene locus_tag LOCUS_08360 gene ggt 14798 16381 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816913.1 protein_id gnl|my_center|LOCUS_08360 16427 17866 gene locus_tag LOCUS_08370 16427 17866 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_08370 18653 17835 gene locus_tag LOCUS_08380 18653 17835 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085395.1 protein_id gnl|my_center|LOCUS_08380 19698 18664 gene locus_tag LOCUS_08390 19698 18664 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066983.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence034 1732 377 gene locus_tag LOCUS_08400 gene pcaB 1732 377 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_08400 2404 1886 gene locus_tag LOCUS_08410 gene pcaG 2404 1886 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035622.1 protein_id gnl|my_center|LOCUS_08410 3135 2404 gene locus_tag LOCUS_08420 gene pcaH 3135 2404 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920266.1 protein_id gnl|my_center|LOCUS_08420 3929 3147 gene locus_tag LOCUS_08430 gene pcaD 3929 3147 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113259.1 protein_id gnl|my_center|LOCUS_08430 4865 3999 gene locus_tag LOCUS_08440 4865 3999 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_08440 5004 5489 gene locus_tag LOCUS_08450 5004 5489 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967890.1 protein_id gnl|my_center|LOCUS_08450 6339 5533 gene locus_tag LOCUS_08460 6339 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08460 7113 6370 gene locus_tag LOCUS_08470 7113 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8595 7189 gene locus_tag LOCUS_08480 8595 7189 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_08480 10644 8650 gene locus_tag LOCUS_08490 10644 8650 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968324.1 protein_id gnl|my_center|LOCUS_08490 11629 10964 gene locus_tag LOCUS_08500 11629 10964 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_08500 11842 12873 gene locus_tag LOCUS_08510 11842 12873 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244659.1 protein_id gnl|my_center|LOCUS_08510 12896 14011 gene locus_tag LOCUS_08520 12896 14011 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_08520 14056 15129 gene locus_tag LOCUS_08530 14056 15129 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_08530 15851 15126 gene locus_tag LOCUS_08540 15851 15126 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966686.1 protein_id gnl|my_center|LOCUS_08540 15983 18211 gene locus_tag LOCUS_08550 15983 18211 CDS product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence035 1370 705 gene locus_tag LOCUS_08560 1370 705 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530018.1 protein_id gnl|my_center|LOCUS_08560 2267 1392 gene locus_tag LOCUS_08570 2267 1392 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_08570 3222 2269 gene locus_tag LOCUS_08580 3222 2269 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156434651.1 protein_id gnl|my_center|LOCUS_08580 3306 3788 gene locus_tag LOCUS_08590 3306 3788 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_08590 4954 3794 gene locus_tag LOCUS_08600 4954 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5364 4951 gene locus_tag LOCUS_08610 5364 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6479 5508 gene locus_tag LOCUS_08620 6479 5508 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529505.1 protein_id gnl|my_center|LOCUS_08620 7201 6482 gene locus_tag LOCUS_08630 7201 6482 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529506.1 protein_id gnl|my_center|LOCUS_08630 8367 7198 gene locus_tag LOCUS_08640 8367 7198 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027990143.1 protein_id gnl|my_center|LOCUS_08640 9265 8378 gene locus_tag LOCUS_08650 9265 8378 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970669.1 protein_id gnl|my_center|LOCUS_08650 9542 10033 gene locus_tag LOCUS_08660 9542 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 10068 11204 gene locus_tag LOCUS_08670 10068 11204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_08670 11273 12703 gene locus_tag LOCUS_08680 11273 12703 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_08680 12791 13777 gene locus_tag LOCUS_08690 12791 13777 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156434651.1 protein_id gnl|my_center|LOCUS_08690 13791 14663 gene locus_tag LOCUS_08700 13791 14663 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529496.1 protein_id gnl|my_center|LOCUS_08700 14675 15787 gene locus_tag LOCUS_08710 gene ugpC 14675 15787 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539810.1 protein_id gnl|my_center|LOCUS_08710 15784 16101 gene locus_tag LOCUS_08720 15784 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 16958 16107 gene locus_tag LOCUS_08730 16958 16107 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970670.1 protein_id gnl|my_center|LOCUS_08730 17866 17039 gene locus_tag LOCUS_08740 17866 17039 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969787.1 protein_id gnl|my_center|LOCUS_08740 19119 17866 gene locus_tag LOCUS_08750 19119 17866 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393138.1 protein_id gnl|my_center|LOCUS_08750 <19808 19116 gene locus_tag LOCUS_08760 <19808 19116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529336.1:class II aldolase/adducin family protein >Feature sequence036 <1 1546 gene locus_tag LOCUS_08770 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728553.1:molybdopterin guanine dinucleotide-containing S/N-oxide reductase 2296 1634 gene locus_tag LOCUS_08780 2296 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3804 2914 gene locus_tag LOCUS_08790 3804 2914 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_08790 4875 3898 gene locus_tag LOCUS_08800 gene trxB 4875 3898 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_08800 5021 5500 gene locus_tag LOCUS_08810 5021 5500 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_08810 5593 6954 gene locus_tag LOCUS_08820 5593 6954 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_08820 6954 7943 gene locus_tag LOCUS_08830 6954 7943 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967041.1 protein_id gnl|my_center|LOCUS_08830 8084 9190 gene locus_tag LOCUS_08840 8084 9190 CDS product MotB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378631.1 protein_id gnl|my_center|LOCUS_08840 9203 10069 gene locus_tag LOCUS_08850 gene motA 9203 10069 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_08850 11222 10077 gene locus_tag LOCUS_08860 11222 10077 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269079.1 protein_id gnl|my_center|LOCUS_08860 12468 11326 gene locus_tag LOCUS_08870 12468 11326 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_08870 13481 12747 gene locus_tag LOCUS_08880 13481 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 13701 14636 gene locus_tag LOCUS_08890 13701 14636 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_08890 14645 16543 gene locus_tag LOCUS_08900 14645 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 16593 18680 gene locus_tag LOCUS_08910 16593 18680 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence037 159 785 gene locus_tag LOCUS_08920 159 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 793 1971 gene locus_tag LOCUS_08930 gene hpnI 793 1971 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527445.1 protein_id gnl|my_center|LOCUS_08930 1986 3410 gene locus_tag LOCUS_08940 gene hpnJ 1986 3410 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_08940 3407 4270 gene locus_tag LOCUS_08950 gene hpnK 3407 4270 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_08950 6779 4194 gene locus_tag LOCUS_08960 6779 4194 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_08960 7056 6844 gene locus_tag LOCUS_08970 7056 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7606 7184 gene locus_tag LOCUS_08980 7606 7184 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_08980 7767 8249 gene locus_tag LOCUS_08990 7767 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9003 8215 gene locus_tag LOCUS_09000 9003 8215 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 protein_id gnl|my_center|LOCUS_09000 10299 9013 gene locus_tag LOCUS_09010 10299 9013 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_09010 10961 10299 gene locus_tag LOCUS_09020 10961 10299 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_09020 11105 11659 gene locus_tag LOCUS_09030 11105 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 11754 12248 gene locus_tag LOCUS_09040 gene secB 11754 12248 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_09040 12927 12250 gene locus_tag LOCUS_09050 gene dnaQ 12927 12250 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_09050 13523 12924 gene locus_tag LOCUS_09060 gene coaE 13523 12924 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_09060 13664 14752 gene locus_tag LOCUS_09070 13664 14752 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_09070 15527 14754 gene locus_tag LOCUS_09080 15527 14754 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 protein_id gnl|my_center|LOCUS_09080 16680 15538 gene locus_tag LOCUS_09090 16680 15538 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085697.1 protein_id gnl|my_center|LOCUS_09090 17894 16683 gene locus_tag LOCUS_09100 17894 16683 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_09100 18946 17963 gene locus_tag LOCUS_09110 18946 17963 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence038 <1 1883 gene locus_tag LOCUS_09120 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940876.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 2991 1852 gene locus_tag LOCUS_09130 2991 1852 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932130.1 protein_id gnl|my_center|LOCUS_09130 4198 3074 gene locus_tag LOCUS_09140 gene ald 4198 3074 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_09140 4330 5793 gene locus_tag LOCUS_09150 gene xdhA 4330 5793 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640539.1 protein_id gnl|my_center|LOCUS_09150 5790 8150 gene locus_tag LOCUS_09160 gene xdhB 5790 8150 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_09160 8153 8974 gene locus_tag LOCUS_09170 gene xdhC 8153 8974 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_09170 8971 9441 gene locus_tag LOCUS_09180 8971 9441 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760614.1 protein_id gnl|my_center|LOCUS_09180 9441 10988 gene locus_tag LOCUS_09190 9441 10988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_09190 10978 12069 gene locus_tag LOCUS_09200 10978 12069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_09200 12062 12991 gene locus_tag LOCUS_09210 12062 12991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_09210 13022 14107 gene locus_tag LOCUS_09220 13022 14107 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_09220 14125 15471 gene locus_tag LOCUS_09230 14125 15471 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966720.1 protein_id gnl|my_center|LOCUS_09230 15468 15824 gene locus_tag LOCUS_09240 15468 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15895 16836 gene locus_tag LOCUS_09250 15895 16836 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_09250 17151 16882 gene locus_tag LOCUS_09260 17151 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 17181 17483 gene locus_tag LOCUS_09270 17181 17483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 19137 17626 gene locus_tag LOCUS_09280 gene iolD 19137 17626 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528372.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence039 111 2375 gene locus_tag LOCUS_09290 111 2375 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530703.1 protein_id gnl|my_center|LOCUS_09290 2754 2392 gene locus_tag LOCUS_09300 2754 2392 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528358.1 protein_id gnl|my_center|LOCUS_09300 3560 2751 gene locus_tag LOCUS_09310 3560 2751 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525223.1 protein_id gnl|my_center|LOCUS_09310 4637 3573 gene locus_tag LOCUS_09320 4637 3573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311331.1 protein_id gnl|my_center|LOCUS_09320 5716 4727 gene locus_tag LOCUS_09330 5716 4727 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967117.1 protein_id gnl|my_center|LOCUS_09330 5970 7064 gene locus_tag LOCUS_09340 5970 7064 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393077.1 protein_id gnl|my_center|LOCUS_09340 7080 7877 gene locus_tag LOCUS_09350 7080 7877 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061913.1 protein_id gnl|my_center|LOCUS_09350 7870 8898 gene locus_tag LOCUS_09360 7870 8898 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968074.1 protein_id gnl|my_center|LOCUS_09360 10036 8915 gene locus_tag LOCUS_09370 10036 8915 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975109.1 protein_id gnl|my_center|LOCUS_09370 10236 11504 gene locus_tag LOCUS_09380 10236 11504 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975100.1 protein_id gnl|my_center|LOCUS_09380 13553 11514 gene locus_tag LOCUS_09390 13553 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 15292 13550 gene locus_tag LOCUS_09400 15292 13550 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 protein_id gnl|my_center|LOCUS_09400 16272 15289 gene locus_tag LOCUS_09410 16272 15289 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_09410 16671 16276 gene locus_tag LOCUS_09420 16671 16276 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883997.1 protein_id gnl|my_center|LOCUS_09420 17116 16676 gene locus_tag LOCUS_09430 17116 16676 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_09430 18007 17129 gene locus_tag LOCUS_09440 18007 17129 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence040 869 525 gene locus_tag LOCUS_09450 869 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 1025 1657 gene locus_tag LOCUS_09460 1025 1657 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529856.1 protein_id gnl|my_center|LOCUS_09460 2080 1688 gene locus_tag LOCUS_09470 2080 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2192 3229 gene locus_tag LOCUS_09480 2192 3229 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529867.1 protein_id gnl|my_center|LOCUS_09480 3243 4808 gene locus_tag LOCUS_09490 3243 4808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529868.1 protein_id gnl|my_center|LOCUS_09490 4805 5824 gene locus_tag LOCUS_09500 4805 5824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529869.1 protein_id gnl|my_center|LOCUS_09500 5828 6763 gene locus_tag LOCUS_09510 5828 6763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529870.1 protein_id gnl|my_center|LOCUS_09510 6760 7185 gene locus_tag LOCUS_09520 6760 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7372 8100 gene locus_tag LOCUS_09530 7372 8100 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312086.1 protein_id gnl|my_center|LOCUS_09530 8114 9310 gene locus_tag LOCUS_09540 8114 9310 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967031.1 protein_id gnl|my_center|LOCUS_09540 9354 10331 gene locus_tag LOCUS_09550 9354 10331 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445392.1 protein_id gnl|my_center|LOCUS_09550 10393 11376 gene locus_tag LOCUS_09560 10393 11376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 protein_id gnl|my_center|LOCUS_09560 11373 12104 gene locus_tag LOCUS_09570 11373 12104 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970636.1 protein_id gnl|my_center|LOCUS_09570 13383 12166 gene locus_tag LOCUS_09580 13383 12166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_09580 13603 14256 gene locus_tag LOCUS_09590 13603 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 14259 15596 gene locus_tag LOCUS_09600 gene bamB 14259 15596 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098274.1 protein_id gnl|my_center|LOCUS_09600 15607 16941 gene locus_tag LOCUS_09610 gene der 15607 16941 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_09610 17902 16970 gene locus_tag LOCUS_09620 17902 16970 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533047.1 protein_id gnl|my_center|LOCUS_09620 <18522 17915 gene locus_tag LOCUS_09630 <18522 17915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533048.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence041 562 798 gene locus_tag LOCUS_09640 562 798 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_09640 795 1727 gene locus_tag LOCUS_09650 795 1727 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_09650 1822 2082 gene locus_tag LOCUS_09660 1822 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2093 4024 gene locus_tag LOCUS_09670 gene dxs 2093 4024 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_09670 4030 4806 gene locus_tag LOCUS_09680 4030 4806 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_09680 5957 4791 gene locus_tag LOCUS_09690 5957 4791 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391942.1 protein_id gnl|my_center|LOCUS_09690 6107 6541 gene locus_tag LOCUS_09700 6107 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7531 6545 gene locus_tag LOCUS_09710 7531 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7642 8610 gene locus_tag LOCUS_09720 7642 8610 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967362.1 protein_id gnl|my_center|LOCUS_09720 8667 9908 gene locus_tag LOCUS_09730 8667 9908 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531545.1 protein_id gnl|my_center|LOCUS_09730 9892 11433 gene locus_tag LOCUS_09740 9892 11433 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 protein_id gnl|my_center|LOCUS_09740 11430 12461 gene locus_tag LOCUS_09750 11430 12461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088527.1 protein_id gnl|my_center|LOCUS_09750 12548 13480 gene locus_tag LOCUS_09760 12548 13480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173320.1 protein_id gnl|my_center|LOCUS_09760 13606 15084 gene locus_tag LOCUS_09770 gene zwf 13606 15084 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 protein_id gnl|my_center|LOCUS_09770 15114 16202 gene locus_tag LOCUS_09780 15114 16202 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528759.1 protein_id gnl|my_center|LOCUS_09780 16219 17082 gene locus_tag LOCUS_09790 16219 17082 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965686.1 protein_id gnl|my_center|LOCUS_09790 17218 17967 gene locus_tag LOCUS_09800 17218 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence042 125 1804 gene locus_tag LOCUS_09810 gene ettA 125 1804 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_09810 1866 2372 gene locus_tag LOCUS_09820 1866 2372 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966472.1 protein_id gnl|my_center|LOCUS_09820 3164 2373 gene locus_tag LOCUS_09830 3164 2373 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_09830 3796 3173 gene locus_tag LOCUS_09840 3796 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4580 3822 gene locus_tag LOCUS_09850 4580 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4857 5822 gene locus_tag LOCUS_09860 gene metF 4857 5822 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_09860 5863 8049 gene locus_tag LOCUS_09870 5863 8049 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09870 8046 8951 gene locus_tag LOCUS_09880 8046 8951 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_09880 8981 9742 gene locus_tag LOCUS_09890 8981 9742 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_09890 11170 9755 gene locus_tag LOCUS_09900 11170 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919600.1 protein_id gnl|my_center|LOCUS_09900 12276 11170 gene locus_tag LOCUS_09910 12276 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 12903 12292 gene locus_tag LOCUS_09920 12903 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 14539 12887 gene locus_tag LOCUS_09930 14539 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 protein_id gnl|my_center|LOCUS_09930 15543 14536 gene locus_tag LOCUS_09940 15543 14536 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_09940 16532 15540 gene locus_tag LOCUS_09950 16532 15540 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_09950 16672 17322 gene locus_tag LOCUS_09960 16672 17322 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_09960 17397 17840 gene locus_tag LOCUS_09970 17397 17840 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173002.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence043 <1 1282 gene locus_tag LOCUS_09980 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388861.1:adenylosuccinate synthase 1378 1725 gene locus_tag LOCUS_09990 1378 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1783 3831 gene locus_tag LOCUS_10000 1783 3831 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_10000 3828 4292 gene locus_tag LOCUS_10010 3828 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5127 4300 gene locus_tag LOCUS_10020 5127 4300 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_10020 6311 5139 gene locus_tag LOCUS_10030 6311 5139 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388724.1 protein_id gnl|my_center|LOCUS_10030 7186 6311 gene locus_tag LOCUS_10040 7186 6311 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_10040 9689 7281 gene locus_tag LOCUS_10050 9689 7281 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_10050 10189 9695 gene locus_tag LOCUS_10060 10189 9695 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_10060 11070 10204 gene locus_tag LOCUS_10070 11070 10204 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_10070 12429 11257 gene locus_tag LOCUS_10080 12429 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 12635 13828 gene locus_tag LOCUS_10090 12635 13828 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_10090 14614 13823 gene locus_tag LOCUS_10100 14614 13823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_10100 14745 15449 gene locus_tag LOCUS_10110 14745 15449 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727023.1 protein_id gnl|my_center|LOCUS_10110 15455 17182 gene locus_tag LOCUS_10120 15455 17182 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089991.1 protein_id gnl|my_center|LOCUS_10120 17997 17236 gene locus_tag LOCUS_10130 gene rpoH 17997 17236 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence044 1006 1461 gene locus_tag LOCUS_10140 1006 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1483 2865 gene locus_tag LOCUS_10150 1483 2865 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_10150 3725 2805 gene locus_tag LOCUS_10160 3725 2805 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_10160 3842 4417 gene locus_tag LOCUS_10170 3842 4417 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_10170 4473 5003 gene locus_tag LOCUS_10180 4473 5003 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_10180 5095 6690 gene locus_tag LOCUS_10190 5095 6690 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265667.1 protein_id gnl|my_center|LOCUS_10190 6727 7224 gene locus_tag LOCUS_10200 6727 7224 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992283.1 protein_id gnl|my_center|LOCUS_10200 8437 7229 gene locus_tag LOCUS_10210 8437 7229 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_10210 9273 8440 gene locus_tag LOCUS_10220 9273 8440 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_10220 9272 10972 gene locus_tag LOCUS_10230 9272 10972 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965811.1 protein_id gnl|my_center|LOCUS_10230 11576 11097 gene locus_tag LOCUS_10240 11576 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 13015 11906 gene locus_tag LOCUS_10250 13015 11906 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_10250 13120 13752 gene locus_tag LOCUS_10260 13120 13752 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_10260 17177 13758 gene locus_tag LOCUS_10270 17177 13758 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_10270 <18025 17359 gene locus_tag LOCUS_10280 <18025 17359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035499.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence045 3140 78 gene locus_tag LOCUS_10290 3140 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4961 3168 gene locus_tag LOCUS_10300 4961 3168 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_10300 6458 5007 gene locus_tag LOCUS_10310 6458 5007 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_10310 8754 6463 gene locus_tag LOCUS_10320 8754 6463 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_10320 9016 10218 gene locus_tag LOCUS_10330 9016 10218 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_10330 10233 10751 gene locus_tag LOCUS_10340 10233 10751 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 protein_id gnl|my_center|LOCUS_10340 11047 10703 gene locus_tag LOCUS_10350 11047 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 11111 12082 gene locus_tag LOCUS_10360 11111 12082 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_10360 12079 15564 gene locus_tag LOCUS_10370 gene metH 12079 15564 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_10370 15628 16515 gene locus_tag LOCUS_10380 15628 16515 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 protein_id gnl|my_center|LOCUS_10380 16550 17104 gene locus_tag LOCUS_10390 16550 17104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 17120 17680 gene locus_tag LOCUS_10400 17120 17680 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence046 3 875 gene locus_tag LOCUS_10410 3 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1433 936 gene locus_tag LOCUS_10420 1433 936 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_10420 2418 1582 gene locus_tag LOCUS_10430 2418 1582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104645.1 protein_id gnl|my_center|LOCUS_10430 3195 2512 gene locus_tag LOCUS_10440 3195 2512 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081260.1 protein_id gnl|my_center|LOCUS_10440 3869 3192 gene locus_tag LOCUS_10450 gene tcyL 3869 3192 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160319.1 protein_id gnl|my_center|LOCUS_10450 4699 3866 gene locus_tag LOCUS_10460 4699 3866 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_10460 5695 4736 gene locus_tag LOCUS_10470 5695 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7132 5801 gene locus_tag LOCUS_10480 7132 5801 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973451.1 protein_id gnl|my_center|LOCUS_10480 8897 7524 gene locus_tag LOCUS_10490 8897 7524 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012170558.1 protein_id gnl|my_center|LOCUS_10490 8850 9023 gene locus_tag LOCUS_10500 8850 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 9691 9610 gene locus_tag LOCUS_t00110 9691 9610 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10639 9707 gene locus_tag LOCUS_10510 10639 9707 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085702.1 protein_id gnl|my_center|LOCUS_10510 10715 12577 gene locus_tag LOCUS_10520 10715 12577 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_10520 12589 13395 gene locus_tag LOCUS_10530 12589 13395 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970553.1 protein_id gnl|my_center|LOCUS_10530 14204 13404 gene locus_tag LOCUS_10540 14204 13404 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_10540 14247 16874 gene locus_tag LOCUS_10550 gene clpB 14247 16874 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence047 1242 2351 gene locus_tag LOCUS_10560 1242 2351 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_10560 2344 4080 gene locus_tag LOCUS_10570 2344 4080 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_10570 4077 5192 gene locus_tag LOCUS_10580 4077 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5194 6300 gene locus_tag LOCUS_10590 5194 6300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_10590 7932 6310 gene locus_tag LOCUS_10600 7932 6310 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_10600 8752 7997 gene locus_tag LOCUS_10610 8752 7997 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_10610 9693 8749 gene locus_tag LOCUS_10620 9693 8749 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974328.1 protein_id gnl|my_center|LOCUS_10620 10740 9706 gene locus_tag LOCUS_10630 gene pdxA 10740 9706 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086666.1 protein_id gnl|my_center|LOCUS_10630 11753 10737 gene locus_tag LOCUS_10640 11753 10737 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086665.1 protein_id gnl|my_center|LOCUS_10640 12694 11750 gene locus_tag LOCUS_10650 12694 11750 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112311.1 protein_id gnl|my_center|LOCUS_10650 14001 12691 gene locus_tag LOCUS_10660 gene eno 14001 12691 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083669.1 protein_id gnl|my_center|LOCUS_10660 14990 13977 gene locus_tag LOCUS_10670 14990 13977 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083666.1 protein_id gnl|my_center|LOCUS_10670 15051 16667 gene locus_tag LOCUS_10680 15051 16667 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061781.1 protein_id gnl|my_center|LOCUS_10680 17576 16710 gene locus_tag LOCUS_10690 17576 16710 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence048 1350 532 gene locus_tag LOCUS_10700 1350 532 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_10700 1446 3278 gene locus_tag LOCUS_10710 1446 3278 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_10710 3305 3553 gene locus_tag LOCUS_10720 3305 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4508 3582 gene locus_tag LOCUS_10730 4508 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4648 4722 gene locus_tag LOCUS_t00120 4648 4722 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4891 5859 gene locus_tag LOCUS_10740 4891 5859 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087329.1 protein_id gnl|my_center|LOCUS_10740 5953 7251 gene locus_tag LOCUS_10750 5953 7251 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_10750 8058 7261 gene locus_tag LOCUS_10760 8058 7261 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665641.1 protein_id gnl|my_center|LOCUS_10760 9279 8197 gene locus_tag LOCUS_10770 gene rutA 9279 8197 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704991.1 protein_id gnl|my_center|LOCUS_10770 9535 10707 gene locus_tag LOCUS_10780 gene pobA 9535 10707 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242251.1 protein_id gnl|my_center|LOCUS_10780 10772 12181 gene locus_tag LOCUS_10790 10772 12181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205544.1 protein_id gnl|my_center|LOCUS_10790 12178 13347 gene locus_tag LOCUS_10800 12178 13347 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_10800 13409 14365 gene locus_tag LOCUS_10810 13409 14365 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_10810 14368 15204 gene locus_tag LOCUS_10820 14368 15204 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 protein_id gnl|my_center|LOCUS_10820 16438 15206 gene locus_tag LOCUS_10830 16438 15206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089187.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence049 1397 276 gene locus_tag LOCUS_10840 1397 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1549 2580 gene locus_tag LOCUS_10850 1549 2580 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_10850 3128 2613 gene locus_tag LOCUS_10860 3128 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3753 3196 gene locus_tag LOCUS_10870 3753 3196 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_10870 4088 5425 gene locus_tag LOCUS_10880 4088 5425 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_10880 5422 6798 gene locus_tag LOCUS_10890 5422 6798 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_10890 6776 7474 gene locus_tag LOCUS_10900 6776 7474 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729648.1 protein_id gnl|my_center|LOCUS_10900 7487 8446 gene locus_tag LOCUS_10910 7487 8446 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403237.1 protein_id gnl|my_center|LOCUS_10910 10866 8464 gene locus_tag LOCUS_10920 10866 8464 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615039.1 protein_id gnl|my_center|LOCUS_10920 11881 10877 gene locus_tag LOCUS_10930 gene deoC 11881 10877 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974219.1 protein_id gnl|my_center|LOCUS_10930 12091 12660 gene locus_tag LOCUS_10940 12091 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 14484 12781 gene locus_tag LOCUS_10950 14484 12781 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_10950 14648 15622 gene locus_tag LOCUS_10960 14648 15622 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_10960 <17333 15619 gene locus_tag LOCUS_10970 <17333 15619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870477.1:hydantoinase B/oxoprolinase family protein >Feature sequence050 2 388 gene locus_tag LOCUS_10980 2 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1313 414 gene locus_tag LOCUS_10990 1313 414 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_10990 2241 1363 gene locus_tag LOCUS_11000 2241 1363 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_11000 2452 5109 gene locus_tag LOCUS_11010 2452 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6308 5091 gene locus_tag LOCUS_11020 6308 5091 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_11020 7231 6320 gene locus_tag LOCUS_11030 7231 6320 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975922.1 protein_id gnl|my_center|LOCUS_11030 8284 7253 gene locus_tag LOCUS_11040 8284 7253 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530674.1 protein_id gnl|my_center|LOCUS_11040 8774 8271 gene locus_tag LOCUS_11050 8774 8271 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975920.1 protein_id gnl|my_center|LOCUS_11050 9476 8778 gene locus_tag LOCUS_11060 9476 8778 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 protein_id gnl|my_center|LOCUS_11060 11055 9490 gene locus_tag LOCUS_11070 11055 9490 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_11070 12073 11048 gene locus_tag LOCUS_11080 12073 11048 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199315.1 protein_id gnl|my_center|LOCUS_11080 12285 13190 gene locus_tag LOCUS_11090 12285 13190 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_11090 14546 13194 gene locus_tag LOCUS_11100 14546 13194 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920944.1 protein_id gnl|my_center|LOCUS_11100 15161 14595 gene locus_tag LOCUS_11110 15161 14595 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329815.1 protein_id gnl|my_center|LOCUS_11110 <16894 15154 gene locus_tag LOCUS_11120 <16894 15154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970242.1:sarcosine oxidase subunit alpha >Feature sequence051 <1 981 gene locus_tag LOCUS_11130 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066908.1:2-dehydropantoate 2-reductase N-terminal domain-containing protein 2632 1010 gene locus_tag LOCUS_11140 2632 1010 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 2793 3752 gene locus_tag LOCUS_11150 2793 3752 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898985.1 protein_id gnl|my_center|LOCUS_11150 4085 5374 gene locus_tag LOCUS_11160 4085 5374 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242231.1 protein_id gnl|my_center|LOCUS_11160 5390 6289 gene locus_tag LOCUS_11170 5390 6289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 protein_id gnl|my_center|LOCUS_11170 6299 7147 gene locus_tag LOCUS_11180 6299 7147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972744.1 protein_id gnl|my_center|LOCUS_11180 7156 8307 gene locus_tag LOCUS_11190 7156 8307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391589.1 protein_id gnl|my_center|LOCUS_11190 8338 8829 gene locus_tag LOCUS_11200 8338 8829 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388720.1 protein_id gnl|my_center|LOCUS_11200 8832 11219 gene locus_tag LOCUS_11210 8832 11219 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_11210 11223 12029 gene locus_tag LOCUS_11220 11223 12029 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_11220 12955 12047 gene locus_tag LOCUS_11230 12955 12047 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_11230 13036 13887 gene locus_tag LOCUS_11240 13036 13887 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086143.1 protein_id gnl|my_center|LOCUS_11240 13979 16006 gene locus_tag LOCUS_11250 13979 16006 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_11250 16031 16219 gene locus_tag LOCUS_11260 gene nrdD 16031 16219 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389030.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence052 518 1750 gene locus_tag LOCUS_11270 518 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1912 2448 gene locus_tag LOCUS_11280 1912 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2526 5195 gene locus_tag LOCUS_11290 gene leuS 2526 5195 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_11290 5208 5744 gene locus_tag LOCUS_11300 gene lptE 5208 5744 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 protein_id gnl|my_center|LOCUS_11300 5751 6767 gene locus_tag LOCUS_11310 gene holA 5751 6767 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528740.1 protein_id gnl|my_center|LOCUS_11310 7759 6887 gene locus_tag LOCUS_11320 7759 6887 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_11320 8511 7756 gene locus_tag LOCUS_11330 8511 7756 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_11330 9181 8576 gene locus_tag LOCUS_11340 gene rsmG 9181 8576 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_11340 11049 9178 gene locus_tag LOCUS_11350 gene mnmG 11049 9178 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391372.1 protein_id gnl|my_center|LOCUS_11350 12391 11090 gene locus_tag LOCUS_11360 gene mnmE 12391 11090 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_11360 12736 12398 gene locus_tag LOCUS_11370 12736 12398 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_11370 12876 14927 gene locus_tag LOCUS_11380 12876 14927 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_11380 15012 15485 gene locus_tag LOCUS_11390 15012 15485 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_11390 15554 16525 gene locus_tag LOCUS_11400 15554 16525 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence053 956 189 gene locus_tag LOCUS_11410 956 189 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970110.1 protein_id gnl|my_center|LOCUS_11410 1908 1000 gene locus_tag LOCUS_11420 1908 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2794 1919 gene locus_tag LOCUS_11430 2794 1919 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_11430 3604 2945 gene locus_tag LOCUS_11440 3604 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4824 3601 gene locus_tag LOCUS_11450 4824 3601 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_11450 5599 4835 gene locus_tag LOCUS_11460 5599 4835 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_11460 6963 5596 gene locus_tag LOCUS_11470 6963 5596 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_11470 7082 7927 gene locus_tag LOCUS_11480 7082 7927 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_11480 7924 8952 gene locus_tag LOCUS_11490 7924 8952 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920455.1 protein_id gnl|my_center|LOCUS_11490 8949 9521 gene locus_tag LOCUS_11500 8949 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974208.1 protein_id gnl|my_center|LOCUS_11500 9623 10372 gene locus_tag LOCUS_11510 9623 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 11389 10400 gene locus_tag LOCUS_11520 11389 10400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310918.1 protein_id gnl|my_center|LOCUS_11520 13451 11436 gene locus_tag LOCUS_11530 13451 11436 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533008.1 protein_id gnl|my_center|LOCUS_11530 15571 13451 gene locus_tag LOCUS_11540 15571 13451 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence054 <1 1824 gene locus_tag LOCUS_11550 <1 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387780.1:glutamate synthase large subunit 1973 2641 gene locus_tag LOCUS_11560 1973 2641 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_11560 3476 2652 gene locus_tag LOCUS_11570 3476 2652 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391126.1 protein_id gnl|my_center|LOCUS_11570 3537 4451 gene locus_tag LOCUS_11580 3537 4451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626584.1 protein_id gnl|my_center|LOCUS_11580 5144 4383 gene locus_tag LOCUS_11590 5144 4383 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_11590 5192 6361 gene locus_tag LOCUS_11600 5192 6361 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_11600 7436 6396 gene locus_tag LOCUS_11610 7436 6396 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943439.1 protein_id gnl|my_center|LOCUS_11610 8189 7458 gene locus_tag LOCUS_11620 8189 7458 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_11620 8499 9428 gene locus_tag LOCUS_11630 8499 9428 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_11630 9460 11403 gene locus_tag LOCUS_11640 gene thrS 9460 11403 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_11640 11535 12056 gene locus_tag LOCUS_11650 gene infC 11535 12056 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_11650 12448 12074 gene locus_tag LOCUS_11660 12448 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12642 14033 gene locus_tag LOCUS_11670 gene ffh 12642 14033 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_11670 14069 14410 gene locus_tag LOCUS_11680 gene rpsP 14069 14410 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_11680 14425 14949 gene locus_tag LOCUS_11690 gene rimM 14425 14949 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 protein_id gnl|my_center|LOCUS_11690 14946 15671 gene locus_tag LOCUS_11700 gene trmD 14946 15671 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388942.1 protein_id gnl|my_center|LOCUS_11700 15694 16098 gene locus_tag LOCUS_11710 gene rplS 15694 16098 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388943.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence055 <1 879 gene locus_tag LOCUS_11720 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533052.1:sugar ABC transporter substrate-binding protein 957 2243 gene locus_tag LOCUS_11730 gene hisD 957 2243 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827738.1 protein_id gnl|my_center|LOCUS_11730 2252 3289 gene locus_tag LOCUS_11740 2252 3289 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_11740 3286 3837 gene locus_tag LOCUS_11750 3286 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3843 4721 gene locus_tag LOCUS_11760 3843 4721 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243040.1 protein_id gnl|my_center|LOCUS_11760 5051 4975 gene locus_tag LOCUS_t00130 5051 4975 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5159 6163 gene locus_tag LOCUS_11770 5159 6163 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_11770 6175 7011 gene locus_tag LOCUS_11780 6175 7011 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_11780 7948 7016 gene locus_tag LOCUS_11790 7948 7016 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 protein_id gnl|my_center|LOCUS_11790 8184 9839 gene locus_tag LOCUS_11800 8184 9839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_11800 9906 10916 gene locus_tag LOCUS_11810 9906 10916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 protein_id gnl|my_center|LOCUS_11810 10916 11779 gene locus_tag LOCUS_11820 10916 11779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537951.1 protein_id gnl|my_center|LOCUS_11820 11785 13809 gene locus_tag LOCUS_11830 11785 13809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_11830 13822 15105 gene locus_tag LOCUS_11840 13822 15105 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_11840 15102 15842 gene locus_tag LOCUS_11850 15102 15842 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112294.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence056 90 824 gene locus_tag LOCUS_11860 90 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2086 923 gene locus_tag LOCUS_11870 2086 923 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_11870 3558 2086 gene locus_tag LOCUS_11880 3558 2086 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_11880 3440 3766 gene locus_tag LOCUS_11890 3440 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3833 4579 gene locus_tag LOCUS_11900 3833 4579 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_11900 4937 4584 gene locus_tag LOCUS_11910 4937 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 5494 4934 gene locus_tag LOCUS_11920 5494 4934 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_11920 5849 5607 gene locus_tag LOCUS_11930 5849 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7120 5930 gene locus_tag LOCUS_11940 7120 5930 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 protein_id gnl|my_center|LOCUS_11940 8156 7143 gene locus_tag LOCUS_11950 gene gap 8156 7143 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_11950 10279 8243 gene locus_tag LOCUS_11960 gene tkt 10279 8243 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_11960 10396 11184 gene locus_tag LOCUS_11970 10396 11184 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 protein_id gnl|my_center|LOCUS_11970 11235 11642 gene locus_tag LOCUS_11980 11235 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 11762 12973 gene locus_tag LOCUS_11990 gene hemA 11762 12973 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919232.1 protein_id gnl|my_center|LOCUS_11990 12963 14165 gene locus_tag LOCUS_12000 12963 14165 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_12000 14344 15297 gene locus_tag LOCUS_12010 14344 15297 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174243.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence057 1618 833 gene locus_tag LOCUS_12020 1618 833 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976307.1 protein_id gnl|my_center|LOCUS_12020 3663 1615 gene locus_tag LOCUS_12030 3663 1615 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969805.1 protein_id gnl|my_center|LOCUS_12030 4807 3656 gene locus_tag LOCUS_12040 4807 3656 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242878.1 protein_id gnl|my_center|LOCUS_12040 6298 4811 gene locus_tag LOCUS_12050 6298 4811 CDS product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976304.1 protein_id gnl|my_center|LOCUS_12050 7198 6302 gene locus_tag LOCUS_12060 7198 6302 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974596.1 protein_id gnl|my_center|LOCUS_12060 8240 7308 gene locus_tag LOCUS_12070 8240 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8438 9457 gene locus_tag LOCUS_12080 8438 9457 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 protein_id gnl|my_center|LOCUS_12080 9454 10227 gene locus_tag LOCUS_12090 gene truA 9454 10227 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_12090 10298 11416 gene locus_tag LOCUS_12100 10298 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 11505 12017 gene locus_tag LOCUS_12110 11505 12017 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_12110 12086 12799 gene locus_tag LOCUS_12120 12086 12799 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550570.1 protein_id gnl|my_center|LOCUS_12120 12873 14369 gene locus_tag LOCUS_12130 12873 14369 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence058 644 246 gene locus_tag LOCUS_12140 644 246 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_12140 732 1130 gene locus_tag LOCUS_12150 732 1130 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_12150 1132 1707 gene locus_tag LOCUS_12160 1132 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1830 3035 gene locus_tag LOCUS_12170 1830 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4013 3084 gene locus_tag LOCUS_12180 4013 3084 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_12180 4792 4013 gene locus_tag LOCUS_12190 4792 4013 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389053.1 protein_id gnl|my_center|LOCUS_12190 5448 4789 gene locus_tag LOCUS_12200 5448 4789 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389052.1 protein_id gnl|my_center|LOCUS_12200 6021 5938 gene locus_tag LOCUS_t00140 6021 5938 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6996 6151 gene locus_tag LOCUS_12210 6996 6151 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470652.1 protein_id gnl|my_center|LOCUS_12210 7184 8353 gene locus_tag LOCUS_12220 7184 8353 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538083.1 protein_id gnl|my_center|LOCUS_12220 8350 9279 gene locus_tag LOCUS_12230 8350 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 9802 10836 gene locus_tag LOCUS_12240 9802 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 10890 10966 gene locus_tag LOCUS_t00150 10890 10966 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12026 11004 gene locus_tag LOCUS_12250 12026 11004 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_12250 12871 12107 gene locus_tag LOCUS_12260 12871 12107 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 protein_id gnl|my_center|LOCUS_12260 13868 12864 gene locus_tag LOCUS_12270 13868 12864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223413.1 protein_id gnl|my_center|LOCUS_12270 <15117 13865 gene locus_tag LOCUS_12280 <15117 13865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223414.1:sugar ABC transporter ATP-binding protein >Feature sequence059 372 1268 gene locus_tag LOCUS_12290 372 1268 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_12290 1973 1308 gene locus_tag LOCUS_12300 1973 1308 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_12300 1960 2202 gene locus_tag LOCUS_12310 1960 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3958 2207 gene locus_tag LOCUS_12320 3958 2207 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992392.1 protein_id gnl|my_center|LOCUS_12320 4946 4293 gene locus_tag LOCUS_12330 4946 4293 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975723.1 protein_id gnl|my_center|LOCUS_12330 5063 6388 gene locus_tag LOCUS_12340 gene glmU 5063 6388 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_12340 6388 8211 gene locus_tag LOCUS_12350 gene glmS 6388 8211 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_12350 8302 9780 gene locus_tag LOCUS_12360 gene gabD 8302 9780 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_12360 9777 11207 gene locus_tag LOCUS_12370 gene gorA 9777 11207 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063691.1 protein_id gnl|my_center|LOCUS_12370 11315 12700 gene locus_tag LOCUS_12380 11315 12700 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_12380 12703 13860 gene locus_tag LOCUS_12390 12703 13860 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_12390 14304 13939 gene locus_tag LOCUS_12400 14304 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence060 911 2440 gene locus_tag LOCUS_12410 911 2440 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 protein_id gnl|my_center|LOCUS_12410 2980 2414 gene locus_tag LOCUS_12420 2980 2414 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 protein_id gnl|my_center|LOCUS_12420 3490 4266 gene locus_tag LOCUS_12430 3490 4266 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251864.1 protein_id gnl|my_center|LOCUS_12430 4465 6084 gene locus_tag LOCUS_12440 4465 6084 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967746.1 protein_id gnl|my_center|LOCUS_12440 6204 7445 gene locus_tag LOCUS_12450 6204 7445 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528986.1 protein_id gnl|my_center|LOCUS_12450 7580 8599 gene locus_tag LOCUS_12460 7580 8599 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_12460 8624 9766 gene locus_tag LOCUS_12470 8624 9766 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 protein_id gnl|my_center|LOCUS_12470 9759 10490 gene locus_tag LOCUS_12480 9759 10490 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463747.1 protein_id gnl|my_center|LOCUS_12480 10626 11711 gene locus_tag LOCUS_12490 10626 11711 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528694.1 protein_id gnl|my_center|LOCUS_12490 11722 12759 gene locus_tag LOCUS_12500 11722 12759 CDS product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 protein_id gnl|my_center|LOCUS_12500 12759 14267 gene locus_tag LOCUS_12510 12759 14267 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence061 1157 387 gene locus_tag LOCUS_12520 1157 387 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 protein_id gnl|my_center|LOCUS_12520 1675 1283 gene locus_tag LOCUS_12530 1675 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3472 2672 gene locus_tag LOCUS_12540 3472 2672 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966151.1 protein_id gnl|my_center|LOCUS_12540 3739 3924 gene locus_tag LOCUS_12550 3739 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3921 4484 gene locus_tag LOCUS_12560 3921 4484 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090521.1 protein_id gnl|my_center|LOCUS_12560 4528 5142 gene locus_tag LOCUS_12570 4528 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 5199 13688 gene locus_tag LOCUS_12580 5199 13688 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339463.1 protein_id gnl|my_center|LOCUS_12580 13856 13689 gene locus_tag LOCUS_12590 13856 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence062 1852 593 gene locus_tag LOCUS_12600 1852 593 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508652.1 protein_id gnl|my_center|LOCUS_12600 3529 2324 gene locus_tag LOCUS_12610 3529 2324 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 protein_id gnl|my_center|LOCUS_12610 5891 3534 gene locus_tag LOCUS_12620 5891 3534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_12620 6712 5894 gene locus_tag LOCUS_12630 6712 5894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_12630 6826 7329 gene locus_tag LOCUS_12640 6826 7329 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176305.1 protein_id gnl|my_center|LOCUS_12640 8538 7339 gene locus_tag LOCUS_12650 8538 7339 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_12650 8804 10345 gene locus_tag LOCUS_12660 8804 10345 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_12660 10385 11986 gene locus_tag LOCUS_12670 10385 11986 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085899.1 protein_id gnl|my_center|LOCUS_12670 13769 12030 gene locus_tag LOCUS_12680 gene araD 13769 12030 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973469.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence063 2087 534 gene locus_tag LOCUS_12690 gene hutH 2087 534 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640105.1 protein_id gnl|my_center|LOCUS_12690 3304 2084 gene locus_tag LOCUS_12700 gene hutI 3304 2084 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 protein_id gnl|my_center|LOCUS_12700 3382 4737 gene locus_tag LOCUS_12710 3382 4737 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 protein_id gnl|my_center|LOCUS_12710 5719 4877 gene locus_tag LOCUS_12720 5719 4877 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 protein_id gnl|my_center|LOCUS_12720 5821 7086 gene locus_tag LOCUS_12730 5821 7086 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196258.1 protein_id gnl|my_center|LOCUS_12730 7199 8155 gene locus_tag LOCUS_12740 gene mbfA 7199 8155 CDS product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 protein_id gnl|my_center|LOCUS_12740 9550 8171 gene locus_tag LOCUS_12750 9550 8171 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_12750 9932 10705 gene locus_tag LOCUS_12760 9932 10705 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_12760 11182 10709 gene locus_tag LOCUS_12770 11182 10709 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391168.1 protein_id gnl|my_center|LOCUS_12770 12840 11179 gene locus_tag LOCUS_12780 12840 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 13208 12843 gene locus_tag LOCUS_12790 gene yobA 13208 12843 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042893410.1 protein_id gnl|my_center|LOCUS_12790 13647 13273 gene locus_tag LOCUS_12800 13647 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence064 1333 413 gene locus_tag LOCUS_12810 gene thyX 1333 413 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_12810 3633 1330 gene locus_tag LOCUS_12820 3633 1330 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268538.1 protein_id gnl|my_center|LOCUS_12820 3708 5108 gene locus_tag LOCUS_12830 3708 5108 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_12830 5217 6425 gene locus_tag LOCUS_12840 5217 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7454 6432 gene locus_tag LOCUS_12850 7454 6432 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_12850 7596 7802 gene locus_tag LOCUS_12860 7596 7802 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532831.1 protein_id gnl|my_center|LOCUS_12860 7799 8524 gene locus_tag LOCUS_12870 7799 8524 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_12870 8796 8527 gene locus_tag LOCUS_12880 8796 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9357 9899 gene locus_tag LOCUS_12890 9357 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9896 11740 gene locus_tag LOCUS_12900 9896 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11802 11878 gene locus_tag LOCUS_t00160 11802 11878 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12210 13574 gene locus_tag LOCUS_12910 12210 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence065 409 334 gene locus_tag LOCUS_t00170 409 334 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1117 467 gene locus_tag LOCUS_12920 1117 467 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_12920 1840 1136 gene locus_tag LOCUS_12930 1840 1136 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_12930 2201 1929 gene locus_tag LOCUS_12940 2201 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3752 2445 gene locus_tag LOCUS_12950 gene ahcY 3752 2445 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_12950 3903 4757 gene locus_tag LOCUS_12960 3903 4757 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_12960 5261 4782 gene locus_tag LOCUS_12970 5261 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6719 5445 gene locus_tag LOCUS_12980 gene rho 6719 5445 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_12980 6859 7092 gene locus_tag LOCUS_12990 6859 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 7475 7017 gene locus_tag LOCUS_13000 gene hemJ 7475 7017 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_13000 8155 7457 gene locus_tag LOCUS_13010 8155 7457 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448378.1 protein_id gnl|my_center|LOCUS_13010 9285 8152 gene locus_tag LOCUS_13020 gene hemH 9285 8152 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_13020 10312 9275 gene locus_tag LOCUS_13030 gene hemE 10312 9275 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_13030 10782 10414 gene locus_tag LOCUS_13040 10782 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 10675 11529 gene locus_tag LOCUS_13050 10675 11529 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330370.1 protein_id gnl|my_center|LOCUS_13050 11553 12137 gene locus_tag LOCUS_13060 11553 12137 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_13060 12556 12155 gene locus_tag LOCUS_13070 12556 12155 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391348.1 protein_id gnl|my_center|LOCUS_13070 13086 12553 gene locus_tag LOCUS_13080 13086 12553 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528720.1 protein_id gnl|my_center|LOCUS_13080 13794 13096 gene locus_tag LOCUS_13090 13794 13096 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence066 16 92 gene locus_tag LOCUS_t00180 16 92 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 174 377 gene locus_tag LOCUS_13100 gene secE 174 377 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531408.1 protein_id gnl|my_center|LOCUS_13100 389 919 gene locus_tag LOCUS_13110 gene nusG 389 919 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_13110 1728 976 gene locus_tag LOCUS_13120 1728 976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_13120 2587 1733 gene locus_tag LOCUS_13130 2587 1733 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 protein_id gnl|my_center|LOCUS_13130 3347 2664 gene locus_tag LOCUS_13140 3347 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3458 4705 gene locus_tag LOCUS_13150 3458 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5885 4713 gene locus_tag LOCUS_13160 5885 4713 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972145.1 protein_id gnl|my_center|LOCUS_13160 7005 5944 gene locus_tag LOCUS_13170 7005 5944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061882.1 protein_id gnl|my_center|LOCUS_13170 8195 7002 gene locus_tag LOCUS_13180 8195 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 8536 8207 gene locus_tag LOCUS_13190 8536 8207 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_13190 9651 8536 gene locus_tag LOCUS_13200 9651 8536 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_13200 10522 9665 gene locus_tag LOCUS_13210 10522 9665 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534640.1 protein_id gnl|my_center|LOCUS_13210 11421 10519 gene locus_tag LOCUS_13220 11421 10519 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533025.1 protein_id gnl|my_center|LOCUS_13220 12859 11489 gene locus_tag LOCUS_13230 12859 11489 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533024.1 protein_id gnl|my_center|LOCUS_13230 12959 13756 gene locus_tag LOCUS_13240 12959 13756 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973873.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence067 84 1337 gene locus_tag LOCUS_13250 84 1337 CDS product DUF563 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918517.1 protein_id gnl|my_center|LOCUS_13250 1441 1752 gene locus_tag LOCUS_13260 1441 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1756 2655 gene locus_tag LOCUS_13270 1756 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2714 3775 gene locus_tag LOCUS_13280 2714 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3820 4455 gene locus_tag LOCUS_13290 3820 4455 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_13290 4487 5491 gene locus_tag LOCUS_13300 4487 5491 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_13300 6747 5569 gene locus_tag LOCUS_13310 6747 5569 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194614.1 protein_id gnl|my_center|LOCUS_13310 6899 7855 gene locus_tag LOCUS_13320 6899 7855 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530574.1 protein_id gnl|my_center|LOCUS_13320 7852 9414 gene locus_tag LOCUS_13330 7852 9414 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530575.1 protein_id gnl|my_center|LOCUS_13330 9490 10509 gene locus_tag LOCUS_13340 9490 10509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530576.1 protein_id gnl|my_center|LOCUS_13340 11320 10523 gene locus_tag LOCUS_13350 11320 10523 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_13350 11395 12324 gene locus_tag LOCUS_13360 11395 12324 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203335.1 protein_id gnl|my_center|LOCUS_13360 12408 12677 gene locus_tag LOCUS_13370 12408 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence068 155 847 gene locus_tag LOCUS_13380 gene hisG 155 847 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_13380 844 2157 gene locus_tag LOCUS_13390 gene hisD 844 2157 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_13390 2231 2434 gene locus_tag LOCUS_13400 gene infA 2231 2434 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_13400 2435 3040 gene locus_tag LOCUS_13410 2435 3040 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390578.1 protein_id gnl|my_center|LOCUS_13410 3076 4182 gene locus_tag LOCUS_13420 3076 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 4185 4355 gene locus_tag LOCUS_13430 4185 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4352 5659 gene locus_tag LOCUS_13440 4352 5659 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528806.1 protein_id gnl|my_center|LOCUS_13440 7035 5611 gene locus_tag LOCUS_13450 7035 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 8204 7032 gene locus_tag LOCUS_13460 8204 7032 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_13460 8343 9584 gene locus_tag LOCUS_13470 8343 9584 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_13470 9581 9994 gene locus_tag LOCUS_13480 9581 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 10018 10587 gene locus_tag LOCUS_13490 10018 10587 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456605.1 protein_id gnl|my_center|LOCUS_13490 10617 11252 gene locus_tag LOCUS_13500 10617 11252 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 protein_id gnl|my_center|LOCUS_13500 11310 11741 gene locus_tag LOCUS_13510 11310 11741 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 protein_id gnl|my_center|LOCUS_13510 13012 11738 gene locus_tag LOCUS_13520 13012 11738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704390.1 protein_id gnl|my_center|LOCUS_13520 13737 13084 gene locus_tag LOCUS_13530 13737 13084 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085430.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence069 1591 590 gene locus_tag LOCUS_13540 gene epmA 1591 590 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972397.1 protein_id gnl|my_center|LOCUS_13540 1614 2660 gene locus_tag LOCUS_13550 1614 2660 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651212.1 protein_id gnl|my_center|LOCUS_13550 2697 3263 gene locus_tag LOCUS_13560 gene efp 2697 3263 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_13560 3388 4212 gene locus_tag LOCUS_13570 3388 4212 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_13570 4290 5111 gene locus_tag LOCUS_13580 4290 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5108 6265 gene locus_tag LOCUS_13590 5108 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_13590 6280 7707 gene locus_tag LOCUS_13600 6280 7707 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140137.1 protein_id gnl|my_center|LOCUS_13600 7731 8546 gene locus_tag LOCUS_13610 gene azf 7731 8546 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_13610 9116 8550 gene locus_tag LOCUS_13620 9116 8550 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_13620 10377 9169 gene locus_tag LOCUS_13630 10377 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_13630 10983 10423 gene locus_tag LOCUS_13640 10983 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 12203 11034 gene locus_tag LOCUS_13650 12203 11034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966975.1 protein_id gnl|my_center|LOCUS_13650 12871 12284 gene locus_tag LOCUS_13660 12871 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 13099 13413 gene locus_tag LOCUS_13670 13099 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence070 494 1531 gene locus_tag LOCUS_13680 494 1531 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 protein_id gnl|my_center|LOCUS_13680 2639 3208 gene locus_tag LOCUS_13690 2639 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5212 3260 gene locus_tag LOCUS_13700 5212 3260 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140130.1 protein_id gnl|my_center|LOCUS_13700 5624 5340 gene locus_tag LOCUS_13710 5624 5340 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066896.1 protein_id gnl|my_center|LOCUS_13710 5750 7087 gene locus_tag LOCUS_13720 5750 7087 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530314.1 protein_id gnl|my_center|LOCUS_13720 8560 7097 gene locus_tag LOCUS_13730 gene ccoG 8560 7097 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_13730 11847 8638 gene locus_tag LOCUS_13740 11847 8638 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_13740 12857 11844 gene locus_tag LOCUS_13750 12857 11844 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_13750 13197 12868 gene locus_tag LOCUS_13760 13197 12868 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence071 1667 408 gene locus_tag LOCUS_13770 1667 408 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967043.1 protein_id gnl|my_center|LOCUS_13770 3588 1687 gene locus_tag LOCUS_13780 gene cysN 3588 1687 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_13780 4493 3588 gene locus_tag LOCUS_13790 gene cysD 4493 3588 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 protein_id gnl|my_center|LOCUS_13790 4744 6348 gene locus_tag LOCUS_13800 4744 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6345 7697 gene locus_tag LOCUS_13810 6345 7697 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255466.1 protein_id gnl|my_center|LOCUS_13810 10192 7589 gene locus_tag LOCUS_13820 10192 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11240 10260 gene locus_tag LOCUS_13830 11240 10260 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_13830 12682 11246 gene locus_tag LOCUS_13840 12682 11246 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 protein_id gnl|my_center|LOCUS_13840 13689 12700 gene locus_tag LOCUS_13850 gene gguC 13689 12700 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939218.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence072 <1 1744 gene locus_tag LOCUS_13860 <1 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707752.1:elongation factor G 1820 2449 gene locus_tag LOCUS_13870 1820 2449 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529481.1 protein_id gnl|my_center|LOCUS_13870 3075 2458 gene locus_tag LOCUS_13880 3075 2458 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_13880 3819 3118 gene locus_tag LOCUS_13890 3819 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5619 3826 gene locus_tag LOCUS_13900 gene mutL 5619 3826 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918581.1 protein_id gnl|my_center|LOCUS_13900 7319 5619 gene locus_tag LOCUS_13910 gene pgi 7319 5619 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_13910 7907 7347 gene locus_tag LOCUS_13920 7907 7347 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_13920 8430 7918 gene locus_tag LOCUS_13930 gene lspA 8430 7918 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_13930 11295 8467 gene locus_tag LOCUS_13940 gene ileS 11295 8467 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_13940 11430 11759 gene locus_tag LOCUS_13950 11430 11759 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397041.1 protein_id gnl|my_center|LOCUS_13950 12725 11769 gene locus_tag LOCUS_13960 12725 11769 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_13960 12843 13607 gene locus_tag LOCUS_13970 12843 13607 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533001.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence073 <1 540 gene locus_tag LOCUS_13980 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625856.1:KpsF/GutQ family sugar-phosphate isomerase 537 1259 gene locus_tag LOCUS_13990 537 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1256 2272 gene locus_tag LOCUS_14000 1256 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_14000 2269 3039 gene locus_tag LOCUS_14010 gene lptB 2269 3039 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14010 3156 4670 gene locus_tag LOCUS_14020 gene rpoN 3156 4670 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_14020 4748 5338 gene locus_tag LOCUS_14030 gene raiA 4748 5338 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385412.1 protein_id gnl|my_center|LOCUS_14030 5638 5396 gene locus_tag LOCUS_14040 5638 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6168 5701 gene locus_tag LOCUS_14050 6168 5701 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_14050 6360 6929 gene locus_tag LOCUS_14060 gene def 6360 6929 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_14060 6932 7837 gene locus_tag LOCUS_14070 gene fmt 6932 7837 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391098.1 protein_id gnl|my_center|LOCUS_14070 7880 8560 gene locus_tag LOCUS_14080 7880 8560 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_14080 8797 9597 gene locus_tag LOCUS_14090 8797 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 9594 10664 gene locus_tag LOCUS_14100 gene arsB 9594 10664 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085869.1 protein_id gnl|my_center|LOCUS_14100 11528 10668 gene locus_tag LOCUS_14110 11528 10668 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_14110 12691 11471 gene locus_tag LOCUS_14120 12691 11471 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061426.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence074 1247 459 gene locus_tag LOCUS_14130 1247 459 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809691.1 protein_id gnl|my_center|LOCUS_14130 2064 1285 gene locus_tag LOCUS_14140 2064 1285 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529433.1 protein_id gnl|my_center|LOCUS_14140 2018 2779 gene locus_tag LOCUS_14150 2018 2779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_14150 2806 4146 gene locus_tag LOCUS_14160 2806 4146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_14160 4434 4147 gene locus_tag LOCUS_14170 4434 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_14170 5093 4431 gene locus_tag LOCUS_14180 5093 4431 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_14180 5554 5090 gene locus_tag LOCUS_14190 5554 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5683 6261 gene locus_tag LOCUS_14200 5683 6261 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_14200 6479 7138 gene locus_tag LOCUS_14210 6479 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 7403 7203 gene locus_tag LOCUS_14220 7403 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 7463 8314 gene locus_tag LOCUS_14230 7463 8314 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974553.1 protein_id gnl|my_center|LOCUS_14230 8305 10746 gene locus_tag LOCUS_14240 8305 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 10791 11636 gene locus_tag LOCUS_14250 10791 11636 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_14250 11776 12903 gene locus_tag LOCUS_14260 gene dauA 11776 12903 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence075 <1 989 gene locus_tag LOCUS_14270 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972746.1:PotD/PotF family extracellular solute-binding protein 1050 1910 gene locus_tag LOCUS_14280 1050 1910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 protein_id gnl|my_center|LOCUS_14280 1932 2768 gene locus_tag LOCUS_14290 1932 2768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339220.1 protein_id gnl|my_center|LOCUS_14290 2789 3946 gene locus_tag LOCUS_14300 2789 3946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391589.1 protein_id gnl|my_center|LOCUS_14300 3970 5049 gene locus_tag LOCUS_14310 gene rutA 3970 5049 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097193.1 protein_id gnl|my_center|LOCUS_14310 5064 6362 gene locus_tag LOCUS_14320 5064 6362 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064557.1 protein_id gnl|my_center|LOCUS_14320 6359 7873 gene locus_tag LOCUS_14330 6359 7873 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115723.1 protein_id gnl|my_center|LOCUS_14330 9062 7881 gene locus_tag LOCUS_14340 gene rnd 9062 7881 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_14340 9158 10942 gene locus_tag LOCUS_14350 gene aspS 9158 10942 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_14350 11058 11429 gene locus_tag LOCUS_14360 11058 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_14360 11515 12270 gene locus_tag LOCUS_14370 11515 12270 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_14370 12868 12284 gene locus_tag LOCUS_14380 12868 12284 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence076 <1 816 gene locus_tag LOCUS_14390 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963698.1:dimethylarginine dimethylaminohydrolase family protein 822 2405 gene locus_tag LOCUS_14400 822 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974950.1 protein_id gnl|my_center|LOCUS_14400 2402 3178 gene locus_tag LOCUS_14410 2402 3178 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_14410 3637 3182 gene locus_tag LOCUS_14420 3637 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3824 3645 gene locus_tag LOCUS_14430 3824 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4112 4813 gene locus_tag LOCUS_14440 4112 4813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089146.1 protein_id gnl|my_center|LOCUS_14440 4806 5513 gene locus_tag LOCUS_14450 4806 5513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_14450 5518 6387 gene locus_tag LOCUS_14460 5518 6387 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533093.1 protein_id gnl|my_center|LOCUS_14460 6384 7385 gene locus_tag LOCUS_14470 6384 7385 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533092.1 protein_id gnl|my_center|LOCUS_14470 7451 10138 gene locus_tag LOCUS_14480 7451 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10923 10135 gene locus_tag LOCUS_14490 10923 10135 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_14490 11701 10928 gene locus_tag LOCUS_14500 11701 10928 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_14500 13260 11725 gene locus_tag LOCUS_14510 gene metG 13260 11725 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence077 941 798 gene locus_tag LOCUS_14520 941 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1020 2696 gene locus_tag LOCUS_14530 1020 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3503 2703 gene locus_tag LOCUS_14540 3503 2703 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705470.1 protein_id gnl|my_center|LOCUS_14540 5463 3580 gene locus_tag LOCUS_14550 5463 3580 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_14550 5792 5496 gene locus_tag LOCUS_14560 gene rpmB 5792 5496 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_14560 5963 7486 gene locus_tag LOCUS_14570 gene betC 5963 7486 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_14570 7483 8922 gene locus_tag LOCUS_14580 7483 8922 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_14580 9043 10350 gene locus_tag LOCUS_14590 9043 10350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533096.1 protein_id gnl|my_center|LOCUS_14590 10355 11104 gene locus_tag LOCUS_14600 10355 11104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533095.1 protein_id gnl|my_center|LOCUS_14600 11085 11792 gene locus_tag LOCUS_14610 11085 11792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_14610 11789 12682 gene locus_tag LOCUS_14620 11789 12682 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533093.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence078 229 768 gene locus_tag LOCUS_14630 229 768 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_14630 772 1482 gene locus_tag LOCUS_14640 772 1482 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_14640 1607 2308 gene locus_tag LOCUS_14650 1607 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2316 3170 gene locus_tag LOCUS_14660 2316 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3281 4276 gene locus_tag LOCUS_14670 3281 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5344 4304 gene locus_tag LOCUS_14680 5344 4304 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921139.1 protein_id gnl|my_center|LOCUS_14680 5447 6775 gene locus_tag LOCUS_14690 5447 6775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_14690 6841 7101 gene locus_tag LOCUS_14700 6841 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7101 7406 gene locus_tag LOCUS_14710 7101 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7961 7494 gene locus_tag LOCUS_14720 7961 7494 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 protein_id gnl|my_center|LOCUS_14720 8770 8117 gene locus_tag LOCUS_14730 8770 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 9617 8817 gene locus_tag LOCUS_14740 gene proC 9617 8817 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_14740 10179 9676 gene locus_tag LOCUS_14750 10179 9676 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_14750 10744 10427 gene locus_tag LOCUS_14760 10744 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 10823 11797 gene locus_tag LOCUS_14770 gene rfaD 10823 11797 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_14770 11810 12619 gene locus_tag LOCUS_14780 gene lgt 11810 12619 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence079 1126 602 gene locus_tag LOCUS_14790 1126 602 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_14790 1272 3689 gene locus_tag LOCUS_14800 gene ppsA 1272 3689 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087424.1 protein_id gnl|my_center|LOCUS_14800 3694 4638 gene locus_tag LOCUS_14810 3694 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14810 4701 5147 gene locus_tag LOCUS_14820 4701 5147 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087415.1 protein_id gnl|my_center|LOCUS_14820 5216 6874 gene locus_tag LOCUS_14830 5216 6874 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_14830 6886 10458 gene locus_tag LOCUS_14840 gene nifJ 6886 10458 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_14840 10458 11048 gene locus_tag LOCUS_14850 10458 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 11898 11059 gene locus_tag LOCUS_14860 gene hypE 11898 11059 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_14860 11800 12138 gene locus_tag LOCUS_14870 11800 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <12920 12096 gene locus_tag LOCUS_14880 <12920 12096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933454.1:hydrogenase formation protein HypD >Feature sequence080 343 1029 gene locus_tag LOCUS_14890 343 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1464 1054 gene locus_tag LOCUS_14900 gene hpxZ 1464 1054 CDS product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083862.1 protein_id gnl|my_center|LOCUS_14900 2861 1464 gene locus_tag LOCUS_14910 2861 1464 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_14910 3055 2861 gene locus_tag LOCUS_14920 3055 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3396 5105 gene locus_tag LOCUS_14930 gene kdpA 3396 5105 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089518.1 protein_id gnl|my_center|LOCUS_14930 5116 7182 gene locus_tag LOCUS_14940 gene kdpB 5116 7182 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391516.1 protein_id gnl|my_center|LOCUS_14940 7194 7796 gene locus_tag LOCUS_14950 7194 7796 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_14950 8917 10503 gene locus_tag LOCUS_14960 8917 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14960 10500 11192 gene locus_tag LOCUS_14970 10500 11192 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089514.1 protein_id gnl|my_center|LOCUS_14970 11197 11667 gene locus_tag LOCUS_14980 gene ptsN 11197 11667 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_14980 12774 11674 gene locus_tag LOCUS_14990 12774 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence081 <1 538 gene locus_tag LOCUS_15000 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625945.1:rod shape-determining protein 612 1496 gene locus_tag LOCUS_15010 gene mreC 612 1496 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_15010 1519 2064 gene locus_tag LOCUS_15020 1519 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2084 3964 gene locus_tag LOCUS_15030 gene mrdA 2084 3964 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_15030 3961 5109 gene locus_tag LOCUS_15040 gene rodA 3961 5109 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_15040 5194 5268 gene locus_tag LOCUS_t00190 5194 5268 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7430 5292 gene locus_tag LOCUS_15050 7430 5292 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_15050 7699 8244 gene locus_tag LOCUS_15060 7699 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 9304 8255 gene locus_tag LOCUS_15070 9304 8255 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 protein_id gnl|my_center|LOCUS_15070 10907 9327 gene locus_tag LOCUS_15080 10907 9327 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_15080 11592 11278 gene locus_tag LOCUS_15090 11592 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11785 12096 gene locus_tag LOCUS_15100 11785 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 12628 12200 gene locus_tag LOCUS_15110 12628 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15110 >Feature sequence082 1505 519 gene locus_tag LOCUS_15120 1505 519 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223415.1 protein_id gnl|my_center|LOCUS_15120 2584 1763 gene locus_tag LOCUS_15130 2584 1763 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_15130 3013 2588 gene locus_tag LOCUS_15140 gene crcB 3013 2588 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085425.1 protein_id gnl|my_center|LOCUS_15140 4247 3036 gene locus_tag LOCUS_15150 gene metC 4247 3036 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_15150 5106 4252 gene locus_tag LOCUS_15160 gene sseA 5106 4252 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_15160 5832 5116 gene locus_tag LOCUS_15170 5832 5116 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_15170 6470 5829 gene locus_tag LOCUS_15180 gene nudF 6470 5829 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174101.1 protein_id gnl|my_center|LOCUS_15180 6606 8627 gene locus_tag LOCUS_15190 6606 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8716 9939 gene locus_tag LOCUS_15200 8716 9939 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_15200 9939 10778 gene locus_tag LOCUS_15210 9939 10778 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_15210 10958 11194 gene locus_tag LOCUS_15220 10958 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 <12830 11205 gene locus_tag LOCUS_15230 <12830 11205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930276.1:Na/Pi cotransporter family protein >Feature sequence083 194 1627 gene locus_tag LOCUS_15240 gene atpD 194 1627 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_15240 1653 2060 gene locus_tag LOCUS_15250 1653 2060 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_15250 2241 3086 gene locus_tag LOCUS_15260 2241 3086 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_15260 3199 4203 gene locus_tag LOCUS_15270 gene galE 3199 4203 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_15270 4265 5518 gene locus_tag LOCUS_15280 4265 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5936 5574 gene locus_tag LOCUS_15290 5936 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6441 6094 gene locus_tag LOCUS_15300 6441 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7732 6680 gene locus_tag LOCUS_15310 7732 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10065 7729 gene locus_tag LOCUS_15320 10065 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11498 10062 gene locus_tag LOCUS_15330 11498 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11916 11533 gene locus_tag LOCUS_15340 11916 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 12278 11913 gene locus_tag LOCUS_15350 12278 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence084 294 839 gene locus_tag LOCUS_15360 gene mobB 294 839 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_15360 836 1462 gene locus_tag LOCUS_15370 gene mobA 836 1462 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_15370 1552 2724 gene locus_tag LOCUS_15380 1552 2724 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_15380 2721 3182 gene locus_tag LOCUS_15390 2721 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3179 4006 gene locus_tag LOCUS_15400 3179 4006 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_15400 4009 4785 gene locus_tag LOCUS_15410 4009 4785 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_15410 4775 6070 gene locus_tag LOCUS_15420 4775 6070 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_15420 6067 6531 gene locus_tag LOCUS_15430 6067 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6513 6773 gene locus_tag LOCUS_15440 6513 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6770 9025 gene locus_tag LOCUS_15450 gene hypF 6770 9025 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933457.1 protein_id gnl|my_center|LOCUS_15450 9031 9264 gene locus_tag LOCUS_15460 9031 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 9261 10349 gene locus_tag LOCUS_15470 gene hypD 9261 10349 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_15470 10346 11401 gene locus_tag LOCUS_15480 gene hypE 10346 11401 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence085 345 905 gene locus_tag LOCUS_15490 345 905 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_15490 971 1690 gene locus_tag LOCUS_15500 971 1690 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970529.1 protein_id gnl|my_center|LOCUS_15500 2903 1653 gene locus_tag LOCUS_15510 2903 1653 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367003.1 protein_id gnl|my_center|LOCUS_15510 3868 3005 gene locus_tag LOCUS_15520 3868 3005 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112680.1 protein_id gnl|my_center|LOCUS_15520 4055 5911 gene locus_tag LOCUS_15530 4055 5911 CDS product bifunctional sugar phosphate isomerase/epimerase/4-hydroxyphenylpyruvate dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267451.1 protein_id gnl|my_center|LOCUS_15530 7502 5856 gene locus_tag LOCUS_15540 7502 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8441 7599 gene locus_tag LOCUS_15550 8441 7599 CDS product p-hydroxycinnamoyl CoA hydratase/lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920259.1 protein_id gnl|my_center|LOCUS_15550 10056 8479 gene locus_tag LOCUS_15560 10056 8479 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920258.1 protein_id gnl|my_center|LOCUS_15560 10028 11176 gene locus_tag LOCUS_15570 10028 11176 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_15570 12302 11190 gene locus_tag LOCUS_15580 12302 11190 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence086 838 2499 gene locus_tag LOCUS_15590 gene cydD 838 2499 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040597.1 protein_id gnl|my_center|LOCUS_15590 2496 4124 gene locus_tag LOCUS_15600 gene cydC 2496 4124 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933482.1 protein_id gnl|my_center|LOCUS_15600 4197 4577 gene locus_tag LOCUS_15610 4197 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4582 6444 gene locus_tag LOCUS_15620 gene recQ 4582 6444 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_15620 7209 6475 gene locus_tag LOCUS_15630 7209 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8682 7366 gene locus_tag LOCUS_15640 8682 7366 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_15640 10136 8667 gene locus_tag LOCUS_15650 10136 8667 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993961.1 protein_id gnl|my_center|LOCUS_15650 10278 11576 gene locus_tag LOCUS_15660 10278 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 12352 11588 gene locus_tag LOCUS_15670 12352 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence087 <1 780 gene locus_tag LOCUS_15680 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050518129.1:glycosyltransferase 794 5116 gene locus_tag LOCUS_15690 794 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5109 5798 gene locus_tag LOCUS_15700 5109 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5858 6604 gene locus_tag LOCUS_15710 5858 6604 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_15710 7922 6621 gene locus_tag LOCUS_15720 7922 6621 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173806.1 protein_id gnl|my_center|LOCUS_15720 8043 8915 gene locus_tag LOCUS_15730 8043 8915 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_15730 8912 10069 gene locus_tag LOCUS_15740 8912 10069 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_15740 10104 10775 gene locus_tag LOCUS_15750 10104 10775 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_15750 <12622 10772 gene locus_tag LOCUS_15760 <12622 10772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034858004.1:Hint domain-containing protein >Feature sequence088 1302 1493 gene locus_tag LOCUS_15770 1302 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2861 1509 gene locus_tag LOCUS_15780 2861 1509 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975683.1 protein_id gnl|my_center|LOCUS_15780 3876 2950 gene locus_tag LOCUS_15790 3876 2950 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085989.1 protein_id gnl|my_center|LOCUS_15790 3982 4821 gene locus_tag LOCUS_15800 gene legD1 3982 4821 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_15800 4920 6050 gene locus_tag LOCUS_15810 4920 6050 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533013.1 protein_id gnl|my_center|LOCUS_15810 7094 6090 gene locus_tag LOCUS_15820 gene cobD 7094 6090 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 protein_id gnl|my_center|LOCUS_15820 7187 8119 gene locus_tag LOCUS_15830 gene cbiB 7187 8119 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531121.1 protein_id gnl|my_center|LOCUS_15830 9563 8103 gene locus_tag LOCUS_15840 9563 8103 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972581.1 protein_id gnl|my_center|LOCUS_15840 10168 9560 gene locus_tag LOCUS_15850 gene cobO 10168 9560 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_15850 10662 10165 gene locus_tag LOCUS_15860 gene cobU 10662 10165 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_15860 11041 11397 gene locus_tag LOCUS_15870 11041 11397 CDS product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 protein_id gnl|my_center|LOCUS_15870 11394 12422 gene locus_tag LOCUS_15880 gene cobW 11394 12422 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531087.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence089 <1 609 gene locus_tag LOCUS_15890 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082976.1:ABC transporter substrate-binding protein 765 1370 gene locus_tag LOCUS_15900 765 1370 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071751.1 protein_id gnl|my_center|LOCUS_15900 2364 1375 gene locus_tag LOCUS_15910 gene iolG 2364 1375 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919173.1 protein_id gnl|my_center|LOCUS_15910 2474 3334 gene locus_tag LOCUS_15920 2474 3334 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502014.1 protein_id gnl|my_center|LOCUS_15920 3424 5349 gene locus_tag LOCUS_15930 gene iolC 3424 5349 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527786.1 protein_id gnl|my_center|LOCUS_15930 5370 7217 gene locus_tag LOCUS_15940 gene iolD 5370 7217 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968521.1 protein_id gnl|my_center|LOCUS_15940 7240 8127 gene locus_tag LOCUS_15950 gene iolE 7240 8127 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919177.1 protein_id gnl|my_center|LOCUS_15950 8124 8921 gene locus_tag LOCUS_15960 gene iolB 8124 8921 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_15960 8942 10438 gene locus_tag LOCUS_15970 8942 10438 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_15970 11158 10529 gene locus_tag LOCUS_15980 11158 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 12257 11466 gene locus_tag LOCUS_15990 12257 11466 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence090 2643 277 gene locus_tag LOCUS_16000 2643 277 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_16000 4114 2633 gene locus_tag LOCUS_16010 4114 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 6154 4667 gene locus_tag LOCUS_16020 6154 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6405 7355 gene locus_tag LOCUS_16030 6405 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8655 7294 gene locus_tag LOCUS_16040 8655 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967756.1 protein_id gnl|my_center|LOCUS_16040 8790 9362 gene locus_tag LOCUS_16050 8790 9362 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389241.1 protein_id gnl|my_center|LOCUS_16050 9552 10913 gene locus_tag LOCUS_16060 9552 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 11445 10921 gene locus_tag LOCUS_16070 11445 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 11511 11870 gene locus_tag LOCUS_16080 11511 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11991 12317 gene locus_tag LOCUS_16090 11991 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence091 3232 653 gene locus_tag LOCUS_16100 3232 653 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_16100 3605 3282 gene locus_tag LOCUS_16110 3605 3282 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219685598.1 protein_id gnl|my_center|LOCUS_16110 3832 4866 gene locus_tag LOCUS_16120 3832 4866 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082146117.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16120 5132 5314 gene locus_tag LOCUS_16130 5132 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5522 5343 gene locus_tag LOCUS_16140 5522 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6971 6102 gene locus_tag LOCUS_16150 6971 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 8279 6975 gene locus_tag LOCUS_16160 8279 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16160 9752 8367 gene locus_tag LOCUS_16170 gene ppsR 9752 8367 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_16170 9897 10586 gene locus_tag LOCUS_16180 9897 10586 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140413.1 protein_id gnl|my_center|LOCUS_16180 10611 11654 gene locus_tag LOCUS_16190 gene bchI 10611 11654 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence092 1559 897 gene locus_tag LOCUS_16200 1559 897 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_16200 2512 1562 gene locus_tag LOCUS_16210 2512 1562 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_16210 4503 2509 gene locus_tag LOCUS_16220 gene hyfB 4503 2509 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_16220 4751 4503 gene locus_tag LOCUS_16230 4751 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 4889 6184 gene locus_tag LOCUS_16240 4889 6184 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_16240 6189 6974 gene locus_tag LOCUS_16250 6189 6974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_16250 7695 7117 gene locus_tag LOCUS_16260 7695 7117 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_16260 8559 7837 gene locus_tag LOCUS_16270 8559 7837 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_16270 8558 9412 gene locus_tag LOCUS_16280 gene gluQRS 8558 9412 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_16280 10313 9375 gene locus_tag LOCUS_16290 10313 9375 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724282.1 protein_id gnl|my_center|LOCUS_16290 11147 10383 gene locus_tag LOCUS_16300 11147 10383 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_16300 11679 11239 gene locus_tag LOCUS_16310 11679 11239 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965897.1 protein_id gnl|my_center|LOCUS_16310 12163 11714 gene locus_tag LOCUS_16320 12163 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence093 547 4146 gene locus_tag LOCUS_16330 547 4146 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_16330 4214 7141 gene locus_tag LOCUS_16340 4214 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7313 7110 gene locus_tag LOCUS_16350 7313 7110 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 protein_id gnl|my_center|LOCUS_16350 8372 7317 gene locus_tag LOCUS_16360 gene queG 8372 7317 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_16360 8506 8880 gene locus_tag LOCUS_16370 8506 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 9344 8883 gene locus_tag LOCUS_16380 gene queF 9344 8883 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920506.1 protein_id gnl|my_center|LOCUS_16380 10459 9341 gene locus_tag LOCUS_16390 gene tgt 10459 9341 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_16390 11493 10456 gene locus_tag LOCUS_16400 gene queA 11493 10456 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919461.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence094 734 1708 gene locus_tag LOCUS_16410 gene lpxC 734 1708 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 protein_id gnl|my_center|LOCUS_16410 1881 2723 gene locus_tag LOCUS_16420 1881 2723 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_16420 2746 4425 gene locus_tag LOCUS_16430 gene recN 2746 4425 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_16430 4556 6616 gene locus_tag LOCUS_16440 gene ligA 4556 6616 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_16440 6741 7550 gene locus_tag LOCUS_16450 6741 7550 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971915.1 protein_id gnl|my_center|LOCUS_16450 8122 7562 gene locus_tag LOCUS_16460 8122 7562 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_16460 9065 8115 gene locus_tag LOCUS_16470 gene argC 9065 8115 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_16470 9708 9220 gene locus_tag LOCUS_16480 gene rpsI 9708 9220 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_16480 10180 9713 gene locus_tag LOCUS_16490 gene rplM 10180 9713 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087726.1 protein_id gnl|my_center|LOCUS_16490 10294 11205 gene locus_tag LOCUS_16500 10294 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence095 278 4135 gene locus_tag LOCUS_16510 gene putA 278 4135 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524499.1 protein_id gnl|my_center|LOCUS_16510 4193 5440 gene locus_tag LOCUS_16520 4193 5440 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 protein_id gnl|my_center|LOCUS_16520 5455 6231 gene locus_tag LOCUS_16530 5455 6231 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_16530 6650 6240 gene locus_tag LOCUS_16540 6650 6240 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_16540 6756 7772 gene locus_tag LOCUS_16550 6756 7772 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389306.1 protein_id gnl|my_center|LOCUS_16550 7787 9133 gene locus_tag LOCUS_16560 7787 9133 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213222.1 protein_id gnl|my_center|LOCUS_16560 9934 9140 gene locus_tag LOCUS_16570 9934 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11058 9967 gene locus_tag LOCUS_16580 gene mtnA 11058 9967 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence096 <1 611 gene locus_tag LOCUS_16590 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086065.1:amidase 625 1803 gene locus_tag LOCUS_16600 625 1803 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040670.1 protein_id gnl|my_center|LOCUS_16600 2253 1807 gene locus_tag LOCUS_16610 2253 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2337 2780 gene locus_tag LOCUS_16620 2337 2780 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 protein_id gnl|my_center|LOCUS_16620 2827 3870 gene locus_tag LOCUS_16630 2827 3870 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084020.1 protein_id gnl|my_center|LOCUS_16630 5225 3897 gene locus_tag LOCUS_16640 5225 3897 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_16640 5381 5632 gene locus_tag LOCUS_16650 5381 5632 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_16650 5636 6052 gene locus_tag LOCUS_16660 5636 6052 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 protein_id gnl|my_center|LOCUS_16660 6130 6948 gene locus_tag LOCUS_16670 6130 6948 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464042.1 protein_id gnl|my_center|LOCUS_16670 7012 8046 gene locus_tag LOCUS_16680 7012 8046 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_16680 8013 9212 gene locus_tag LOCUS_16690 8013 9212 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_16690 10209 9214 gene locus_tag LOCUS_16700 10209 9214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087653.1 protein_id gnl|my_center|LOCUS_16700 <11366 10223 gene locus_tag LOCUS_16710 <11366 10223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087652.1:sugar ABC transporter ATP-binding protein >Feature sequence097 161 1324 gene locus_tag LOCUS_16720 161 1324 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391942.1 protein_id gnl|my_center|LOCUS_16720 1686 2048 gene locus_tag LOCUS_16730 1686 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2098 2550 gene locus_tag LOCUS_16740 2098 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3855 2584 gene locus_tag LOCUS_16750 3855 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5309 3852 gene locus_tag LOCUS_16760 5309 3852 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_16760 5473 6309 gene locus_tag LOCUS_16770 gene dapD 5473 6309 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_16770 6306 7445 gene locus_tag LOCUS_16780 gene dapE 6306 7445 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918164.1 protein_id gnl|my_center|LOCUS_16780 7442 8002 gene locus_tag LOCUS_16790 7442 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 7999 8592 gene locus_tag LOCUS_16800 7999 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391228.1 protein_id gnl|my_center|LOCUS_16800 8597 9637 gene locus_tag LOCUS_16810 8597 9637 CDS product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975160.1 protein_id gnl|my_center|LOCUS_16810 9960 9649 gene locus_tag LOCUS_16820 9960 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 10940 10332 gene locus_tag LOCUS_16830 10940 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence098 1735 626 gene locus_tag LOCUS_16840 gene modC 1735 626 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836198.1 protein_id gnl|my_center|LOCUS_16840 2375 1749 gene locus_tag LOCUS_16850 gene modB 2375 1749 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_16850 3191 2442 gene locus_tag LOCUS_16860 gene modA 3191 2442 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388462.1 protein_id gnl|my_center|LOCUS_16860 4458 3253 gene locus_tag LOCUS_16870 gene chrA 4458 3253 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186611.1 protein_id gnl|my_center|LOCUS_16870 5220 4579 gene locus_tag LOCUS_16880 5220 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 5858 5217 gene locus_tag LOCUS_16890 5858 5217 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651091.1 protein_id gnl|my_center|LOCUS_16890 5967 6446 gene locus_tag LOCUS_16900 5967 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 6450 6911 gene locus_tag LOCUS_16910 6450 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 6918 7646 gene locus_tag LOCUS_16920 6918 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 9092 7911 gene locus_tag LOCUS_16930 9092 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 <11270 9123 gene locus_tag LOCUS_16940 <11270 9123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389601.1:DNA topoisomerase IV subunit A >Feature sequence099 1877 957 gene locus_tag LOCUS_16950 1877 957 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_16950 2626 1985 gene locus_tag LOCUS_16960 2626 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3296 2640 gene locus_tag LOCUS_16970 gene fsa 3296 2640 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529031.1 protein_id gnl|my_center|LOCUS_16970 3394 5577 gene locus_tag LOCUS_16980 3394 5577 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970369.1 protein_id gnl|my_center|LOCUS_16980 6253 5579 gene locus_tag LOCUS_16990 gene dhaL 6253 5579 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 protein_id gnl|my_center|LOCUS_16990 6391 8577 gene locus_tag LOCUS_17000 gene uvrB 6391 8577 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_17000 9539 8622 gene locus_tag LOCUS_17010 gene puuE 9539 8622 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976001.1 protein_id gnl|my_center|LOCUS_17010 9626 10615 gene locus_tag LOCUS_17020 gene araD1 9626 10615 CDS product 2-keto-3-deoxy-L-arabinonate dehydratase AraD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696283.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence100 457 780 gene locus_tag LOCUS_17030 457 780 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309920.1 protein_id gnl|my_center|LOCUS_17030 794 1387 gene locus_tag LOCUS_17040 gene recR 794 1387 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_17040 1387 2775 gene locus_tag LOCUS_17050 1387 2775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267579.1 protein_id gnl|my_center|LOCUS_17050 2843 4084 gene locus_tag LOCUS_17060 2843 4084 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_17060 4166 5035 gene locus_tag LOCUS_17070 4166 5035 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_17070 5039 5962 gene locus_tag LOCUS_17080 5039 5962 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089184.1 protein_id gnl|my_center|LOCUS_17080 5959 7425 gene locus_tag LOCUS_17090 5959 7425 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966495.1 protein_id gnl|my_center|LOCUS_17090 8633 7416 gene locus_tag LOCUS_17100 8633 7416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528456.1 protein_id gnl|my_center|LOCUS_17100 10176 8611 gene locus_tag LOCUS_17110 10176 8611 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061255.1 protein_id gnl|my_center|LOCUS_17110 <11130 10199 gene locus_tag LOCUS_17120 <11130 10199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976195.1:substrate-binding domain-containing protein >Feature sequence101 <1 814 gene locus_tag LOCUS_17130 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531908.1:ATP-dependent DNA helicase RecG 834 1265 gene locus_tag LOCUS_17140 834 1265 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_17140 1278 1853 gene locus_tag LOCUS_17150 1278 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2174 1863 gene locus_tag LOCUS_17160 2174 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3148 2171 gene locus_tag LOCUS_17170 gene msrP 3148 2171 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_17170 4120 3206 gene locus_tag LOCUS_17180 4120 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6629 4146 gene locus_tag LOCUS_17190 6629 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 6763 7368 gene locus_tag LOCUS_17200 6763 7368 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_17200 7386 8396 gene locus_tag LOCUS_17210 gene trpD 7386 8396 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 protein_id gnl|my_center|LOCUS_17210 8393 9238 gene locus_tag LOCUS_17220 gene trpC 8393 9238 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328328.1 protein_id gnl|my_center|LOCUS_17220 9235 9708 gene locus_tag LOCUS_17230 gene moaC 9235 9708 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341741.1 protein_id gnl|my_center|LOCUS_17230 9713 10918 gene locus_tag LOCUS_17240 9713 10918 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence102 1805 1092 gene locus_tag LOCUS_17250 1805 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17250 2143 1802 gene locus_tag LOCUS_17260 2143 1802 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_17260 3327 2125 gene locus_tag LOCUS_17270 3327 2125 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967595.1 protein_id gnl|my_center|LOCUS_17270 4360 3446 gene locus_tag LOCUS_17280 4360 3446 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337088.1 protein_id gnl|my_center|LOCUS_17280 4974 4360 gene locus_tag LOCUS_17290 4974 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5496 5110 gene locus_tag LOCUS_17300 5496 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5889 6776 gene locus_tag LOCUS_17310 5889 6776 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_17310 6857 8050 gene locus_tag LOCUS_17320 6857 8050 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396043.1 protein_id gnl|my_center|LOCUS_17320 8047 8409 gene locus_tag LOCUS_17330 gene uraH 8047 8409 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 protein_id gnl|my_center|LOCUS_17330 8416 9156 gene locus_tag LOCUS_17340 8416 9156 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810391.1 protein_id gnl|my_center|LOCUS_17340 9547 9146 gene locus_tag LOCUS_17350 9547 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9675 9917 gene locus_tag LOCUS_17360 9675 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence103 1125 388 gene locus_tag LOCUS_17370 gene fabG 1125 388 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_17370 2094 1135 gene locus_tag LOCUS_17380 gene fabD 2094 1135 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_17380 2671 2186 gene locus_tag LOCUS_17390 2671 2186 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_17390 2701 3849 gene locus_tag LOCUS_17400 gene hemW 2701 3849 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_17400 4540 3851 gene locus_tag LOCUS_17410 4540 3851 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927085.1 protein_id gnl|my_center|LOCUS_17410 4600 5727 gene locus_tag LOCUS_17420 4600 5727 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_17420 5807 6298 gene locus_tag LOCUS_17430 5807 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 6689 6270 gene locus_tag LOCUS_17440 6689 6270 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530810.1 protein_id gnl|my_center|LOCUS_17440 7933 6686 gene locus_tag LOCUS_17450 7933 6686 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_17450 9822 7927 gene locus_tag LOCUS_17460 9822 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 9985 10746 gene locus_tag LOCUS_17470 9985 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence104 1029 448 gene locus_tag LOCUS_17480 1029 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1067 2251 gene locus_tag LOCUS_17490 1067 2251 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 protein_id gnl|my_center|LOCUS_17490 2248 3600 gene locus_tag LOCUS_17500 2248 3600 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028150869.1 protein_id gnl|my_center|LOCUS_17500 3660 3735 gene locus_tag LOCUS_t00200 3660 3735 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4078 3752 gene locus_tag LOCUS_17510 4078 3752 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_17510 4213 4989 gene locus_tag LOCUS_17520 4213 4989 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_17520 4994 6334 gene locus_tag LOCUS_17530 4994 6334 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_17530 6366 7061 gene locus_tag LOCUS_17540 6366 7061 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_17540 7139 7864 gene locus_tag LOCUS_17550 7139 7864 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871129.1 protein_id gnl|my_center|LOCUS_17550 8777 7911 gene locus_tag LOCUS_17560 8777 7911 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530080.1 protein_id gnl|my_center|LOCUS_17560 9122 8784 gene locus_tag LOCUS_17570 9122 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 10692 9370 gene locus_tag LOCUS_17580 10692 9370 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040264.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence105 1341 565 gene locus_tag LOCUS_17590 1341 565 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_17590 1444 2823 gene locus_tag LOCUS_17600 1444 2823 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_17600 2931 4112 gene locus_tag LOCUS_17610 2931 4112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_17610 5029 4109 gene locus_tag LOCUS_17620 5029 4109 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808120.1 protein_id gnl|my_center|LOCUS_17620 5173 6336 gene locus_tag LOCUS_17630 5173 6336 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090064.1 protein_id gnl|my_center|LOCUS_17630 6341 9538 gene locus_tag LOCUS_17640 6341 9538 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090065.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence106 <1 755 gene locus_tag LOCUS_17650 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967749.1:ABC transporter permease 894 1325 gene locus_tag LOCUS_17660 894 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1339 2631 gene locus_tag LOCUS_17670 1339 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2628 4094 gene locus_tag LOCUS_17680 2628 4094 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494115.1 protein_id gnl|my_center|LOCUS_17680 5254 4091 gene locus_tag LOCUS_17690 5254 4091 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_17690 7095 5251 gene locus_tag LOCUS_17700 7095 5251 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529479.1 protein_id gnl|my_center|LOCUS_17700 9540 7102 gene locus_tag LOCUS_17710 9540 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9918 9595 gene locus_tag LOCUS_17720 9918 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence107 32 1675 gene locus_tag LOCUS_17730 32 1675 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_17730 1675 5238 gene locus_tag LOCUS_17740 gene nifJ 1675 5238 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_17740 5248 6243 gene locus_tag LOCUS_17750 5248 6243 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_17750 6293 7477 gene locus_tag LOCUS_17760 6293 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_17760 9004 7487 gene locus_tag LOCUS_17770 9004 7487 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089493.1 protein_id gnl|my_center|LOCUS_17770 10306 9008 gene locus_tag LOCUS_17780 10306 9008 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328095.1 protein_id gnl|my_center|LOCUS_17780 <10847 10320 gene locus_tag LOCUS_17790 <10847 10320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089495.1:PrkA family serine protein kinase >Feature sequence108 183 746 gene locus_tag LOCUS_17800 183 746 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_17800 1902 757 gene locus_tag LOCUS_17810 1902 757 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_17810 2926 1919 gene locus_tag LOCUS_17820 2926 1919 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_17820 3672 3043 gene locus_tag LOCUS_17830 3672 3043 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_17830 5387 3699 gene locus_tag LOCUS_17840 5387 3699 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_17840 6529 5417 gene locus_tag LOCUS_17850 6529 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17850 7588 6593 gene locus_tag LOCUS_17860 7588 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7995 8660 gene locus_tag LOCUS_17870 7995 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8776 10107 gene locus_tag LOCUS_17880 8776 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence109 500 1198 gene locus_tag LOCUS_17890 500 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2505 1222 gene locus_tag LOCUS_17900 2505 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2722 3153 gene locus_tag LOCUS_17910 2722 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3282 3662 gene locus_tag LOCUS_17920 3282 3662 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880209.1 protein_id gnl|my_center|LOCUS_17920 3674 4429 gene locus_tag LOCUS_17930 3674 4429 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_17930 4456 5829 gene locus_tag LOCUS_17940 4456 5829 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_17940 5826 6878 gene locus_tag LOCUS_17950 5826 6878 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_17950 6878 7765 gene locus_tag LOCUS_17960 6878 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7752 8501 gene locus_tag LOCUS_17970 7752 8501 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880215.1 protein_id gnl|my_center|LOCUS_17970 8498 9421 gene locus_tag LOCUS_17980 8498 9421 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880216.1 protein_id gnl|my_center|LOCUS_17980 9430 9879 gene locus_tag LOCUS_17990 9430 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9903 10343 gene locus_tag LOCUS_18000 9903 10343 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence110 238 936 gene locus_tag LOCUS_18010 gene phoB 238 936 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_18010 2604 985 gene locus_tag LOCUS_18020 2604 985 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811087.1 protein_id gnl|my_center|LOCUS_18020 3377 2772 gene locus_tag LOCUS_18030 3377 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174699.1 protein_id gnl|my_center|LOCUS_18030 4438 3437 gene locus_tag LOCUS_18040 4438 3437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968301.1 protein_id gnl|my_center|LOCUS_18040 6046 4487 gene locus_tag LOCUS_18050 6046 4487 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529528.1 protein_id gnl|my_center|LOCUS_18050 7109 6147 gene locus_tag LOCUS_18060 7109 6147 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 protein_id gnl|my_center|LOCUS_18060 7624 7259 gene locus_tag LOCUS_18070 7624 7259 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_18070 8589 7834 gene locus_tag LOCUS_18080 8589 7834 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391108.1 protein_id gnl|my_center|LOCUS_18080 8744 8950 gene locus_tag LOCUS_18090 8744 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 8947 10410 gene locus_tag LOCUS_18100 gene ccoN 8947 10410 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence111 <1 789 gene locus_tag LOCUS_18110 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389632.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase 820 1302 gene locus_tag LOCUS_18120 820 1302 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_18120 1320 2717 gene locus_tag LOCUS_18130 gene lpdA 1320 2717 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_18130 2788 3735 gene locus_tag LOCUS_18140 gene lipA 2788 3735 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_18140 3740 4231 gene locus_tag LOCUS_18150 3740 4231 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_18150 6038 4188 gene locus_tag LOCUS_18160 6038 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 6262 7329 gene locus_tag LOCUS_18170 6262 7329 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_18170 7501 7917 gene locus_tag LOCUS_18180 7501 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 9069 7972 gene locus_tag LOCUS_18190 gene rutA 9069 7972 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097193.1 protein_id gnl|my_center|LOCUS_18190 9869 9228 gene locus_tag LOCUS_18200 9869 9228 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence112 1258 26 gene locus_tag LOCUS_18210 1258 26 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_18210 2302 1367 gene locus_tag LOCUS_18220 2302 1367 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204291.1 protein_id gnl|my_center|LOCUS_18220 2427 3776 gene locus_tag LOCUS_18230 gene benA 2427 3776 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529144.1 protein_id gnl|my_center|LOCUS_18230 3788 4312 gene locus_tag LOCUS_18240 gene benB 3788 4312 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727999.1 protein_id gnl|my_center|LOCUS_18240 4339 5379 gene locus_tag LOCUS_18250 gene benC 4339 5379 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_18250 5387 6166 gene locus_tag LOCUS_18260 5387 6166 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 protein_id gnl|my_center|LOCUS_18260 6217 7146 gene locus_tag LOCUS_18270 gene catA 6217 7146 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_18270 7230 8387 gene locus_tag LOCUS_18280 7230 8387 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_18280 8398 8724 gene locus_tag LOCUS_18290 gene catC 8398 8724 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807674.1 protein_id gnl|my_center|LOCUS_18290 8815 9495 gene locus_tag LOCUS_18300 8815 9495 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_18300 9510 10172 gene locus_tag LOCUS_18310 9510 10172 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence113 549 52 gene locus_tag LOCUS_18320 549 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1933 569 gene locus_tag LOCUS_18330 1933 569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966276.1 protein_id gnl|my_center|LOCUS_18330 2539 2021 gene locus_tag LOCUS_18340 gene ripB 2539 2021 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_18340 2620 3441 gene locus_tag LOCUS_18350 2620 3441 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 protein_id gnl|my_center|LOCUS_18350 3438 4874 gene locus_tag LOCUS_18360 3438 4874 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_18360 4876 6030 gene locus_tag LOCUS_18370 4876 6030 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_18370 6035 7222 gene locus_tag LOCUS_18380 6035 7222 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_18380 7240 8085 gene locus_tag LOCUS_18390 7240 8085 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_18390 9146 8922 gene locus_tag LOCUS_18400 9146 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 10193 9231 gene locus_tag LOCUS_18410 10193 9231 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385696.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence114 466 1131 gene locus_tag LOCUS_18420 466 1131 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530318.1 protein_id gnl|my_center|LOCUS_18420 1128 2450 gene locus_tag LOCUS_18430 1128 2450 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530317.1 protein_id gnl|my_center|LOCUS_18430 2462 3232 gene locus_tag LOCUS_18440 2462 3232 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530316.1 protein_id gnl|my_center|LOCUS_18440 3236 4555 gene locus_tag LOCUS_18450 3236 4555 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530208.1 protein_id gnl|my_center|LOCUS_18450 5476 4559 gene locus_tag LOCUS_18460 5476 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 6699 5476 gene locus_tag LOCUS_18470 gene mtaB 6699 5476 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_18470 7511 6696 gene locus_tag LOCUS_18480 gene dapF 7511 6696 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_18480 7665 7937 gene locus_tag LOCUS_18490 7665 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7952 8308 gene locus_tag LOCUS_18500 gene rplT 7952 8308 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391269.1 protein_id gnl|my_center|LOCUS_18500 8389 9459 gene locus_tag LOCUS_18510 gene pheS 8389 9459 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence115 1238 987 gene locus_tag LOCUS_18520 1238 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3429 1297 gene locus_tag LOCUS_18530 3429 1297 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392879.1 protein_id gnl|my_center|LOCUS_18530 4696 3443 gene locus_tag LOCUS_18540 4696 3443 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185398.1 protein_id gnl|my_center|LOCUS_18540 5708 4761 gene locus_tag LOCUS_18550 5708 4761 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532537.1 protein_id gnl|my_center|LOCUS_18550 5888 6391 gene locus_tag LOCUS_18560 5888 6391 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966016.1 protein_id gnl|my_center|LOCUS_18560 7580 6474 gene locus_tag LOCUS_18570 7580 6474 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_18570 7739 8626 gene locus_tag LOCUS_18580 7739 8626 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730867.1 protein_id gnl|my_center|LOCUS_18580 <10497 8745 gene locus_tag LOCUS_18590 <10497 8745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387909.1:translational GTPase TypA >Feature sequence116 2224 1307 gene locus_tag LOCUS_18600 2224 1307 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 protein_id gnl|my_center|LOCUS_18600 2393 3382 gene locus_tag LOCUS_18610 2393 3382 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 protein_id gnl|my_center|LOCUS_18610 4957 3428 gene locus_tag LOCUS_18620 4957 3428 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_18620 5693 4971 gene locus_tag LOCUS_18630 gene urtE 5693 4971 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_18630 6406 5690 gene locus_tag LOCUS_18640 gene urtD 6406 5690 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_18640 7401 6403 gene locus_tag LOCUS_18650 7401 6403 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_18650 8264 7398 gene locus_tag LOCUS_18660 gene urtB 8264 7398 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889580.1 protein_id gnl|my_center|LOCUS_18660 9530 8283 gene locus_tag LOCUS_18670 gene urtA 9530 8283 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246896.1 protein_id gnl|my_center|LOCUS_18670 9869 10351 gene locus_tag LOCUS_18680 9869 10351 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965172.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence117 1418 2353 gene locus_tag LOCUS_18690 gene oxyR 1418 2353 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368909.1 protein_id gnl|my_center|LOCUS_18690 2671 2405 gene locus_tag LOCUS_18700 2671 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2790 3695 gene locus_tag LOCUS_18710 2790 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3692 4162 gene locus_tag LOCUS_18720 3692 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5142 4186 gene locus_tag LOCUS_18730 5142 4186 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975589.1 protein_id gnl|my_center|LOCUS_18730 5213 5743 gene locus_tag LOCUS_18740 5213 5743 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_18740 7449 5740 gene locus_tag LOCUS_18750 gene ade 7449 5740 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 protein_id gnl|my_center|LOCUS_18750 8709 7498 gene locus_tag LOCUS_18760 8709 7498 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_18760 9957 9067 gene locus_tag LOCUS_18770 gene speB 9957 9067 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263658.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence118 1879 620 gene locus_tag LOCUS_18780 1879 620 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_18780 3147 1876 gene locus_tag LOCUS_18790 3147 1876 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_18790 3273 3701 gene locus_tag LOCUS_18800 3273 3701 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_18800 4423 3710 gene locus_tag LOCUS_18810 4423 3710 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563863.1 protein_id gnl|my_center|LOCUS_18810 6285 4696 gene locus_tag LOCUS_18820 6285 4696 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385655.1 protein_id gnl|my_center|LOCUS_18820 6446 7396 gene locus_tag LOCUS_18830 6446 7396 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974602.1 protein_id gnl|my_center|LOCUS_18830 8555 7404 gene locus_tag LOCUS_18840 8555 7404 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_18840 9403 8555 gene locus_tag LOCUS_18850 9403 8555 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_18850 9884 9417 gene locus_tag LOCUS_18860 9884 9417 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_18860 <10452 9897 gene locus_tag LOCUS_18870 <10452 9897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259633.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme >Feature sequence119 367 149 gene locus_tag LOCUS_18880 367 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1452 505 gene locus_tag LOCUS_18890 1452 505 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_18890 1702 1457 gene locus_tag LOCUS_18900 1702 1457 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_18900 1804 2730 gene locus_tag LOCUS_18910 1804 2730 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_18910 2745 4013 gene locus_tag LOCUS_18920 2745 4013 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975115.1 protein_id gnl|my_center|LOCUS_18920 4733 4020 gene locus_tag LOCUS_18930 4733 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4660 5529 gene locus_tag LOCUS_18940 4660 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 6295 5600 gene locus_tag LOCUS_18950 6295 5600 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626297.1 protein_id gnl|my_center|LOCUS_18950 8284 6650 gene locus_tag LOCUS_18960 8284 6650 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_18960 8620 8411 gene locus_tag LOCUS_18970 8620 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 10052 8955 gene locus_tag LOCUS_18980 gene hrcA 10052 8955 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence120 1766 195 gene locus_tag LOCUS_18990 1766 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2639 1806 gene locus_tag LOCUS_19000 2639 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 3316 2639 gene locus_tag LOCUS_19010 3316 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3711 3316 gene locus_tag LOCUS_19020 3711 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5101 3779 gene locus_tag LOCUS_19030 5101 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5597 5208 gene locus_tag LOCUS_19040 5597 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 6991 5594 gene locus_tag LOCUS_19050 6991 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 7556 7017 gene locus_tag LOCUS_19060 7556 7017 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_19060 8986 7625 gene locus_tag LOCUS_19070 gene terL 8986 7625 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_19070 9183 9527 gene locus_tag LOCUS_19080 9183 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence121 148 1503 gene locus_tag LOCUS_19090 gene purB 148 1503 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532121.1 protein_id gnl|my_center|LOCUS_19090 1673 1927 gene locus_tag LOCUS_19100 1673 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19100 1931 3466 gene locus_tag LOCUS_19110 1931 3466 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19110 3456 5303 gene locus_tag LOCUS_19120 3456 5303 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_19120 5300 6355 gene locus_tag LOCUS_19130 5300 6355 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_19130 6788 6357 gene locus_tag LOCUS_19140 6788 6357 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275140.1 protein_id gnl|my_center|LOCUS_19140 6940 7197 gene locus_tag LOCUS_19150 6940 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085813.1 protein_id gnl|my_center|LOCUS_19150 7638 7216 gene locus_tag LOCUS_19160 7638 7216 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_19160 7874 7635 gene locus_tag LOCUS_19170 7874 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 7984 9162 gene locus_tag LOCUS_19180 7984 9162 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978505.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence122 1430 528 gene locus_tag LOCUS_19190 1430 528 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390838.1 protein_id gnl|my_center|LOCUS_19190 1505 2086 gene locus_tag LOCUS_19200 1505 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3051 2095 gene locus_tag LOCUS_19210 3051 2095 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_19210 4802 3303 gene locus_tag LOCUS_19220 gene xrtA 4802 3303 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_19220 6031 4799 gene locus_tag LOCUS_19230 6031 4799 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_19230 7080 6031 gene locus_tag LOCUS_19240 7080 6031 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_19240 8218 7295 gene locus_tag LOCUS_19250 8218 7295 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390856.1 protein_id gnl|my_center|LOCUS_19250 9368 8307 gene locus_tag LOCUS_19260 9368 8307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390874.1 protein_id gnl|my_center|LOCUS_19260 10111 9365 gene locus_tag LOCUS_19270 10111 9365 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105187.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence123 417 91 gene locus_tag LOCUS_19280 417 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 589 1071 gene locus_tag LOCUS_19290 589 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2398 1121 gene locus_tag LOCUS_19300 gene eno 2398 1121 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_19300 3369 2395 gene locus_tag LOCUS_19310 3369 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4858 3449 gene locus_tag LOCUS_19320 4858 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6476 4983 gene locus_tag LOCUS_19330 6476 4983 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_19330 7493 6495 gene locus_tag LOCUS_19340 7493 6495 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255196.1 protein_id gnl|my_center|LOCUS_19340 9140 7542 gene locus_tag LOCUS_19350 gene ggt 9140 7542 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_19350 9248 9580 gene locus_tag LOCUS_19360 9248 9580 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_19360 9580 10059 gene locus_tag LOCUS_19370 gene gpt 9580 10059 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence124 1842 772 gene locus_tag LOCUS_19380 1842 772 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_19380 2937 1909 gene locus_tag LOCUS_19390 2937 1909 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031357.1 protein_id gnl|my_center|LOCUS_19390 3032 4225 gene locus_tag LOCUS_19400 3032 4225 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969510.1 protein_id gnl|my_center|LOCUS_19400 4320 5516 gene locus_tag LOCUS_19410 4320 5516 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_19410 6078 5563 gene locus_tag LOCUS_19420 6078 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 6819 6190 gene locus_tag LOCUS_19430 6819 6190 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153584.1 protein_id gnl|my_center|LOCUS_19430 7202 6816 gene locus_tag LOCUS_19440 7202 6816 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316399.1 protein_id gnl|my_center|LOCUS_19440 8095 7199 gene locus_tag LOCUS_19450 gene era 8095 7199 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389604.1 protein_id gnl|my_center|LOCUS_19450 8847 8092 gene locus_tag LOCUS_19460 gene rnc 8847 8092 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_19460 9536 8799 gene locus_tag LOCUS_19470 gene lepB 9536 8799 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_19470 10059 9637 gene locus_tag LOCUS_19480 gene acpS 10059 9637 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence125 923 369 gene locus_tag LOCUS_19490 923 369 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_19490 1156 1578 gene locus_tag LOCUS_19500 1156 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1644 3869 gene locus_tag LOCUS_19510 1644 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3886 5073 gene locus_tag LOCUS_19520 gene larC 3886 5073 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015146.1 protein_id gnl|my_center|LOCUS_19520 5066 5848 gene locus_tag LOCUS_19530 5066 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5845 6513 gene locus_tag LOCUS_19540 gene larB 5845 6513 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_19540 7298 6510 gene locus_tag LOCUS_19550 7298 6510 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_19550 7425 7790 gene locus_tag LOCUS_19560 7425 7790 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965266.1 protein_id gnl|my_center|LOCUS_19560 8802 7813 gene locus_tag LOCUS_19570 gene moaA 8802 7813 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_19570 9094 8909 gene locus_tag LOCUS_19580 9094 8909 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723397.1 protein_id gnl|my_center|LOCUS_19580 9221 9895 gene locus_tag LOCUS_19590 9221 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence126 <1 842 gene locus_tag LOCUS_19600 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241142.1:cytochrome c oxidase subunit I 868 1830 gene locus_tag LOCUS_19610 868 1830 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_19610 1835 1999 gene locus_tag LOCUS_19620 1835 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1996 2586 gene locus_tag LOCUS_19630 1996 2586 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337013.1 protein_id gnl|my_center|LOCUS_19630 2677 3528 gene locus_tag LOCUS_19640 2677 3528 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_19640 3545 3910 gene locus_tag LOCUS_19650 3545 3910 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_19650 3907 4596 gene locus_tag LOCUS_19660 3907 4596 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992415.1 protein_id gnl|my_center|LOCUS_19660 4593 6083 gene locus_tag LOCUS_19670 4593 6083 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_19670 6087 6689 gene locus_tag LOCUS_19680 6087 6689 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792222.1 protein_id gnl|my_center|LOCUS_19680 7410 6697 gene locus_tag LOCUS_19690 7410 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 8600 7407 gene locus_tag LOCUS_19700 8600 7407 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528986.1 protein_id gnl|my_center|LOCUS_19700 8713 10116 gene locus_tag LOCUS_19710 gene thrC 8713 10116 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence127 <1 1093 gene locus_tag LOCUS_19720 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391418.1:protein translocase subunit SecD note possible pseudo, internal stop codon 1106 2062 gene locus_tag LOCUS_19730 1106 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19730 2393 3187 gene locus_tag LOCUS_19740 2393 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3314 4327 gene locus_tag LOCUS_19750 3314 4327 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067618.1 protein_id gnl|my_center|LOCUS_19750 4339 5883 gene locus_tag LOCUS_19760 4339 5883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_19760 5880 6983 gene locus_tag LOCUS_19770 5880 6983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968370.1 protein_id gnl|my_center|LOCUS_19770 6985 7956 gene locus_tag LOCUS_19780 6985 7956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255101.1 protein_id gnl|my_center|LOCUS_19780 7959 9272 gene locus_tag LOCUS_19790 gene deoA 7959 9272 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815519.1 protein_id gnl|my_center|LOCUS_19790 9651 9382 gene locus_tag LOCUS_19800 9651 9382 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence128 1234 257 gene locus_tag LOCUS_19810 1234 257 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_19810 1995 1231 gene locus_tag LOCUS_19820 gene cysQ 1995 1231 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_19820 2120 3622 gene locus_tag LOCUS_19830 2120 3622 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_19830 3627 4073 gene locus_tag LOCUS_19840 3627 4073 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_19840 4401 4180 gene locus_tag LOCUS_19850 4401 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5361 4486 gene locus_tag LOCUS_19860 5361 4486 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_19860 5654 5433 gene locus_tag LOCUS_19870 5654 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5761 6642 gene locus_tag LOCUS_19880 5761 6642 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_19880 6706 7464 gene locus_tag LOCUS_19890 6706 7464 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036871.1 protein_id gnl|my_center|LOCUS_19890 8127 7468 gene locus_tag LOCUS_19900 8127 7468 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_19900 8835 8191 gene locus_tag LOCUS_19910 8835 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 9728 8970 gene locus_tag LOCUS_19920 9728 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence129 1954 992 gene locus_tag LOCUS_19930 1954 992 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639871.1 protein_id gnl|my_center|LOCUS_19930 2765 1947 gene locus_tag LOCUS_19940 2765 1947 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 protein_id gnl|my_center|LOCUS_19940 3751 2762 gene locus_tag LOCUS_19950 gene tsaD 3751 2762 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_19950 3857 4852 gene locus_tag LOCUS_19960 gene hemC 3857 4852 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_19960 4845 5540 gene locus_tag LOCUS_19970 4845 5540 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 protein_id gnl|my_center|LOCUS_19970 5537 6637 gene locus_tag LOCUS_19980 5537 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6637 7905 gene locus_tag LOCUS_19990 6637 7905 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972469.1 protein_id gnl|my_center|LOCUS_19990 8886 7999 gene locus_tag LOCUS_20000 8886 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 9341 8883 gene locus_tag LOCUS_20010 9341 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 <9891 9342 gene locus_tag LOCUS_20020 <9891 9342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527906.1:PhoH family protein >Feature sequence130 1140 367 gene locus_tag LOCUS_20030 1140 367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_20030 2127 1144 gene locus_tag LOCUS_20040 2127 1144 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_20040 3011 2124 gene locus_tag LOCUS_20050 3011 2124 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_20050 4281 3028 gene locus_tag LOCUS_20060 4281 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4608 5306 gene locus_tag LOCUS_20070 4608 5306 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086406.1 protein_id gnl|my_center|LOCUS_20070 5870 5331 gene locus_tag LOCUS_20080 5870 5331 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387852.1 protein_id gnl|my_center|LOCUS_20080 7184 5961 gene locus_tag LOCUS_20090 7184 5961 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_20090 7915 7460 gene locus_tag LOCUS_20100 7915 7460 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090095.1 protein_id gnl|my_center|LOCUS_20100 8231 7908 gene locus_tag LOCUS_20110 8231 7908 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_20110 <9889 8524 gene locus_tag LOCUS_20120 <9889 8524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388108.1:glutamine-hydrolyzing GMP synthase >Feature sequence131 831 2024 gene locus_tag LOCUS_20130 831 2024 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086611.1 protein_id gnl|my_center|LOCUS_20130 2021 2722 gene locus_tag LOCUS_20140 2021 2722 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 protein_id gnl|my_center|LOCUS_20140 2857 4530 gene locus_tag LOCUS_20150 2857 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4715 5419 gene locus_tag LOCUS_20160 4715 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6130 5429 gene locus_tag LOCUS_20170 6130 5429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 protein_id gnl|my_center|LOCUS_20170 6888 6130 gene locus_tag LOCUS_20180 6888 6130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_20180 8726 6897 gene locus_tag LOCUS_20190 8726 6897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930654.1 protein_id gnl|my_center|LOCUS_20190 <9872 8761 gene locus_tag LOCUS_20200 <9872 8761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919767.1:class I SAM-dependent methyltransferase >Feature sequence132 1362 790 gene locus_tag LOCUS_20210 1362 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3352 1385 gene locus_tag LOCUS_20220 gene rpoD 3352 1385 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387243.1 protein_id gnl|my_center|LOCUS_20220 5214 3430 gene locus_tag LOCUS_20230 gene dnaG 5214 3430 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_20230 5672 5214 gene locus_tag LOCUS_20240 5672 5214 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_20240 5796 7160 gene locus_tag LOCUS_20250 gene carA 5796 7160 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_20250 7157 7429 gene locus_tag LOCUS_20260 7157 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence133 218 2875 gene locus_tag LOCUS_20270 gene tssH 218 2875 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_20270 2931 6215 gene locus_tag LOCUS_20280 2931 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6231 6914 gene locus_tag LOCUS_20290 6231 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8111 7014 gene locus_tag LOCUS_20300 8111 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence134 1642 749 gene locus_tag LOCUS_20310 1642 749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_20310 2703 1639 gene locus_tag LOCUS_20320 2703 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3610 2693 gene locus_tag LOCUS_20330 3610 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3863 4588 gene locus_tag LOCUS_20340 3863 4588 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088320.1 protein_id gnl|my_center|LOCUS_20340 4659 6203 gene locus_tag LOCUS_20350 4659 6203 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_20350 8270 6309 gene locus_tag LOCUS_20360 8270 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 9258 8371 gene locus_tag LOCUS_20370 9258 8371 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089101.1 protein_id gnl|my_center|LOCUS_20370 <9807 9280 gene locus_tag LOCUS_20380 <9807 9280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388186.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence135 930 217 gene locus_tag LOCUS_20390 930 217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_20390 977 1573 gene locus_tag LOCUS_20400 977 1573 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_20400 1573 2106 gene locus_tag LOCUS_20410 gene thpR 1573 2106 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 protein_id gnl|my_center|LOCUS_20410 2828 2169 gene locus_tag LOCUS_20420 2828 2169 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532419.1 protein_id gnl|my_center|LOCUS_20420 3506 2889 gene locus_tag LOCUS_20430 3506 2889 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966025.1 protein_id gnl|my_center|LOCUS_20430 4325 3516 gene locus_tag LOCUS_20440 4325 3516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_20440 5068 4322 gene locus_tag LOCUS_20450 5068 4322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_20450 5168 5569 gene locus_tag LOCUS_20460 5168 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897900.1 protein_id gnl|my_center|LOCUS_20460 7482 5650 gene locus_tag LOCUS_20470 gene ptsP 7482 5650 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_20470 7789 7469 gene locus_tag LOCUS_20480 7789 7469 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626594.1 protein_id gnl|my_center|LOCUS_20480 8286 7786 gene locus_tag LOCUS_20490 8286 7786 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_20490 9282 8296 gene locus_tag LOCUS_20500 gene rapZ 9282 8296 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_20500 9653 9279 gene locus_tag LOCUS_20510 9653 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence136 1768 1067 gene locus_tag LOCUS_20520 1768 1067 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532905.1 protein_id gnl|my_center|LOCUS_20520 2661 1765 gene locus_tag LOCUS_20530 2661 1765 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536328.1 protein_id gnl|my_center|LOCUS_20530 3450 2746 gene locus_tag LOCUS_20540 3450 2746 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772562.1 protein_id gnl|my_center|LOCUS_20540 4582 3461 gene locus_tag LOCUS_20550 4582 3461 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_20550 5761 4616 gene locus_tag LOCUS_20560 5761 4616 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815495.1 protein_id gnl|my_center|LOCUS_20560 5919 6524 gene locus_tag LOCUS_20570 5919 6524 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_20570 6602 7186 gene locus_tag LOCUS_20580 6602 7186 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_20580 7232 7900 gene locus_tag LOCUS_20590 gene tsaB 7232 7900 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_20590 7942 8352 gene locus_tag LOCUS_20600 7942 8352 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_20600 8593 8324 gene locus_tag LOCUS_20610 8593 8324 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_20610 8687 9097 gene locus_tag LOCUS_20620 8687 9097 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence137 2322 1435 gene locus_tag LOCUS_20630 2322 1435 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089101.1 protein_id gnl|my_center|LOCUS_20630 3132 2344 gene locus_tag LOCUS_20640 3132 2344 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_20640 3196 4086 gene locus_tag LOCUS_20650 3196 4086 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_20650 4095 4724 gene locus_tag LOCUS_20660 gene gmk 4095 4724 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 protein_id gnl|my_center|LOCUS_20660 5551 4748 gene locus_tag LOCUS_20670 gene rsmA 5551 4748 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388190.1 protein_id gnl|my_center|LOCUS_20670 6888 5602 gene locus_tag LOCUS_20680 6888 5602 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_20680 9238 6968 gene locus_tag LOCUS_20690 9238 6968 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919559.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence138 1036 5 gene locus_tag LOCUS_20700 1036 5 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258151.1 protein_id gnl|my_center|LOCUS_20700 2586 1042 gene locus_tag LOCUS_20710 2586 1042 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258152.1 protein_id gnl|my_center|LOCUS_20710 2990 4525 gene locus_tag LOCUS_20720 2990 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4791 6392 gene locus_tag LOCUS_20730 4791 6392 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_20730 6516 7517 gene locus_tag LOCUS_20740 6516 7517 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329274.1 protein_id gnl|my_center|LOCUS_20740 7571 8872 gene locus_tag LOCUS_20750 7571 8872 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257469.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence139 1388 174 gene locus_tag LOCUS_20760 1388 174 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_20760 1681 4623 gene locus_tag LOCUS_20770 1681 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4692 5267 gene locus_tag LOCUS_20780 4692 5267 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992434.1 protein_id gnl|my_center|LOCUS_20780 6416 5271 gene locus_tag LOCUS_20790 6416 5271 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_20790 6904 6413 gene locus_tag LOCUS_20800 gene purE 6904 6413 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_20800 7104 6901 gene locus_tag LOCUS_20810 7104 6901 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_20810 7270 7446 gene locus_tag LOCUS_20820 7270 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 8189 7608 gene locus_tag LOCUS_20830 8189 7608 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_20830 8362 8550 gene locus_tag LOCUS_20840 8362 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 9070 8609 gene locus_tag LOCUS_20850 9070 8609 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence140 2048 996 gene locus_tag LOCUS_20860 2048 996 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 protein_id gnl|my_center|LOCUS_20860 2520 2290 gene locus_tag LOCUS_20870 2520 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2684 3166 gene locus_tag LOCUS_20880 2684 3166 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089945.1 protein_id gnl|my_center|LOCUS_20880 3877 3176 gene locus_tag LOCUS_20890 3877 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3999 4517 gene locus_tag LOCUS_20900 3999 4517 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_20900 6035 4584 gene locus_tag LOCUS_20910 gene gatB 6035 4584 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_20910 6624 6247 gene locus_tag LOCUS_20920 6624 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8136 6664 gene locus_tag LOCUS_20930 gene gatA 8136 6664 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920295.1 protein_id gnl|my_center|LOCUS_20930 8423 8136 gene locus_tag LOCUS_20940 gene gatC 8423 8136 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_20940 8470 8934 gene locus_tag LOCUS_20950 gene ruvX 8470 8934 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence141 <1 748 gene locus_tag LOCUS_20960 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389064.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 765 2555 gene locus_tag LOCUS_20970 765 2555 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_20970 4015 2552 gene locus_tag LOCUS_20980 4015 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4809 4066 gene locus_tag LOCUS_20990 4809 4066 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184768134.1 protein_id gnl|my_center|LOCUS_20990 5833 4802 gene locus_tag LOCUS_21000 5833 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080607.1 protein_id gnl|my_center|LOCUS_21000 6930 5959 gene locus_tag LOCUS_21010 6930 5959 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_21010 8614 7073 gene locus_tag LOCUS_21020 gene xylB 8614 7073 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_21020 <9346 8641 gene locus_tag LOCUS_21030 <9346 8641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020491.1:2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase >Feature sequence142 435 1355 gene locus_tag LOCUS_21040 435 1355 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085712.1 protein_id gnl|my_center|LOCUS_21040 1352 2347 gene locus_tag LOCUS_21050 1352 2347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584013.1 protein_id gnl|my_center|LOCUS_21050 2392 3372 gene locus_tag LOCUS_21060 2392 3372 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584015.1 protein_id gnl|my_center|LOCUS_21060 3448 4950 gene locus_tag LOCUS_21070 gene gguA 3448 4950 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583992.1 protein_id gnl|my_center|LOCUS_21070 4994 5890 gene locus_tag LOCUS_21080 4994 5890 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_21080 7094 5922 gene locus_tag LOCUS_21090 7094 5922 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_21090 8295 7099 gene locus_tag LOCUS_21100 8295 7099 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_21100 8766 8305 gene locus_tag LOCUS_21110 gene greA 8766 8305 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence143 2343 316 gene locus_tag LOCUS_21120 2343 316 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_21120 4073 2520 gene locus_tag LOCUS_21130 4073 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 5121 4366 gene locus_tag LOCUS_21140 5121 4366 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 protein_id gnl|my_center|LOCUS_21140 5271 6932 gene locus_tag LOCUS_21150 gene betA 5271 6932 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532681.1 protein_id gnl|my_center|LOCUS_21150 7054 8307 gene locus_tag LOCUS_21160 7054 8307 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_21160 8319 8606 gene locus_tag LOCUS_21170 8319 8606 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973738.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence144 49 471 gene locus_tag LOCUS_21180 49 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 567 902 gene locus_tag LOCUS_21190 567 902 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 protein_id gnl|my_center|LOCUS_21190 966 1781 gene locus_tag LOCUS_21200 966 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1778 2953 gene locus_tag LOCUS_21210 1778 2953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114048.1 protein_id gnl|my_center|LOCUS_21210 4022 2967 gene locus_tag LOCUS_21220 4022 2967 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_21220 5854 4019 gene locus_tag LOCUS_21230 5854 4019 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_21230 7662 5860 gene locus_tag LOCUS_21240 7662 5860 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_21240 8943 7795 gene locus_tag LOCUS_21250 8943 7795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence145 4131 2773 gene locus_tag LOCUS_21260 gene carA 4131 2773 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_21260 4255 4710 gene locus_tag LOCUS_21270 4255 4710 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_21270 4710 6512 gene locus_tag LOCUS_21280 gene dnaG 4710 6512 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_21280 6599 8545 gene locus_tag LOCUS_21290 gene rpoD 6599 8545 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976352.1 protein_id gnl|my_center|LOCUS_21290 8583 9155 gene locus_tag LOCUS_21300 8583 9155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328360.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence146 1021 2823 gene locus_tag LOCUS_21310 1021 2823 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_21310 2820 2990 gene locus_tag LOCUS_21320 2820 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3567 2995 gene locus_tag LOCUS_21330 3567 2995 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404172.1 protein_id gnl|my_center|LOCUS_21330 3693 4241 gene locus_tag LOCUS_21340 gene msrA 3693 4241 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931268.1 protein_id gnl|my_center|LOCUS_21340 6223 4256 gene locus_tag LOCUS_21350 6223 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6342 7316 gene locus_tag LOCUS_21360 6342 7316 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence147 1870 893 gene locus_tag LOCUS_21370 1870 893 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_21370 2896 1889 gene locus_tag LOCUS_21380 gene speB 2896 1889 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_21380 3363 2884 gene locus_tag LOCUS_21390 3363 2884 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085839.1 protein_id gnl|my_center|LOCUS_21390 3421 4218 gene locus_tag LOCUS_21400 gene mazG 3421 4218 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_21400 5817 5173 gene locus_tag LOCUS_21410 5817 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6055 7548 gene locus_tag LOCUS_21420 6055 7548 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_21420 8444 7614 gene locus_tag LOCUS_21430 8444 7614 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446872.1 protein_id gnl|my_center|LOCUS_21430 <9092 8522 gene locus_tag LOCUS_21440 <9092 8522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389375.1:GTPase HflX >Feature sequence148 305 1543 gene locus_tag LOCUS_21450 305 1543 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399682.1 protein_id gnl|my_center|LOCUS_21450 1540 2583 gene locus_tag LOCUS_21460 1540 2583 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331302.1 protein_id gnl|my_center|LOCUS_21460 2707 4488 gene locus_tag LOCUS_21470 2707 4488 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_21470 4554 6071 gene locus_tag LOCUS_21480 4554 6071 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_21480 6068 7048 gene locus_tag LOCUS_21490 6068 7048 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_21490 7249 7572 gene locus_tag LOCUS_21500 7249 7572 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083216.1 protein_id gnl|my_center|LOCUS_21500 7917 7609 gene locus_tag LOCUS_21510 7917 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8312 8007 gene locus_tag LOCUS_21520 gene minE 8312 8007 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887983.1 protein_id gnl|my_center|LOCUS_21520 <9014 8309 gene locus_tag LOCUS_21530 <9014 8309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976171.1:septum site-determining protein MinD >Feature sequence149 2 283 gene locus_tag LOCUS_21540 2 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1585 524 gene locus_tag LOCUS_21550 1585 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2182 1772 gene locus_tag LOCUS_21560 2182 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2726 2280 gene locus_tag LOCUS_21570 2726 2280 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_21570 2818 3378 gene locus_tag LOCUS_21580 2818 3378 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533014.1 protein_id gnl|my_center|LOCUS_21580 3378 4529 gene locus_tag LOCUS_21590 3378 4529 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533015.1 protein_id gnl|my_center|LOCUS_21590 4526 5656 gene locus_tag LOCUS_21600 4526 5656 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533016.1 protein_id gnl|my_center|LOCUS_21600 5748 6410 gene locus_tag LOCUS_21610 5748 6410 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720630.1 protein_id gnl|my_center|LOCUS_21610 6407 7399 gene locus_tag LOCUS_21620 6407 7399 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 protein_id gnl|my_center|LOCUS_21620 7396 8298 gene locus_tag LOCUS_21630 7396 8298 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967330.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence150 1892 1206 gene locus_tag LOCUS_21640 1892 1206 CDS product [alpha-L-fucopyranosyl-(1->3)-alpha-L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899556.1 protein_id gnl|my_center|LOCUS_21640 3041 2124 gene locus_tag LOCUS_21650 3041 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4022 3051 gene locus_tag LOCUS_21660 4022 3051 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391000.1 protein_id gnl|my_center|LOCUS_21660 4144 5040 gene locus_tag LOCUS_21670 4144 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5042 6760 gene locus_tag LOCUS_21680 5042 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 7838 6768 gene locus_tag LOCUS_21690 7838 6768 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031728.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence151 433 1011 gene locus_tag LOCUS_21700 433 1011 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_21700 1008 2171 gene locus_tag LOCUS_21710 1008 2171 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_21710 2168 2905 gene locus_tag LOCUS_21720 gene hdaA 2168 2905 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_21720 2941 5160 gene locus_tag LOCUS_21730 2941 5160 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_21730 5186 6676 gene locus_tag LOCUS_21740 gene ppx 5186 6676 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_21740 6779 7816 gene locus_tag LOCUS_21750 6779 7816 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529867.1 protein_id gnl|my_center|LOCUS_21750 8948 7833 gene locus_tag LOCUS_21760 8948 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence152 263 1255 gene locus_tag LOCUS_21770 gene bmt 263 1255 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173709.1 protein_id gnl|my_center|LOCUS_21770 1297 1896 gene locus_tag LOCUS_21780 1297 1896 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_21780 1961 4216 gene locus_tag LOCUS_21790 1961 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4537 5763 gene locus_tag LOCUS_21800 4537 5763 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390571.1 protein_id gnl|my_center|LOCUS_21800 6474 5806 gene locus_tag LOCUS_21810 6474 5806 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535280.1 protein_id gnl|my_center|LOCUS_21810 6553 8445 gene locus_tag LOCUS_21820 6553 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 8610 8455 gene locus_tag LOCUS_21830 8610 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence153 2512 1049 gene locus_tag LOCUS_21840 2512 1049 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966495.1 protein_id gnl|my_center|LOCUS_21840 3426 2509 gene locus_tag LOCUS_21850 3426 2509 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089184.1 protein_id gnl|my_center|LOCUS_21850 4301 3423 gene locus_tag LOCUS_21860 4301 3423 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_21860 5598 4345 gene locus_tag LOCUS_21870 5598 4345 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_21870 5714 6472 gene locus_tag LOCUS_21880 5714 6472 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086235.1 protein_id gnl|my_center|LOCUS_21880 6955 6497 gene locus_tag LOCUS_21890 6955 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence154 2194 1601 gene locus_tag LOCUS_21900 2194 1601 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626628.1 protein_id gnl|my_center|LOCUS_21900 2193 2906 gene locus_tag LOCUS_21910 2193 2906 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398678.1 protein_id gnl|my_center|LOCUS_21910 3032 4924 gene locus_tag LOCUS_21920 3032 4924 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_21920 5638 5033 gene locus_tag LOCUS_21930 5638 5033 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_21930 5811 5736 gene locus_tag LOCUS_t00210 5811 5736 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5914 6429 gene locus_tag LOCUS_21940 5914 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 7085 6435 gene locus_tag LOCUS_21950 7085 6435 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_21950 7805 7101 gene locus_tag LOCUS_21960 7805 7101 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_21960 8152 7880 gene locus_tag LOCUS_21970 8152 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence155 <1 1115 gene locus_tag LOCUS_21980 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390732.1:phytoene desaturase family protein 1163 1963 gene locus_tag LOCUS_21990 1163 1963 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_21990 2088 1966 gene locus_tag LOCUS_22000 2088 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2741 2112 gene locus_tag LOCUS_22010 gene bchJ 2741 2112 CDS product bacteriochlorophyll 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388371.1 protein_id gnl|my_center|LOCUS_22010 4377 2728 gene locus_tag LOCUS_22020 gene bchE 4377 2728 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259511.1 protein_id gnl|my_center|LOCUS_22020 5450 4458 gene locus_tag LOCUS_22030 5450 4458 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_22030 6954 5485 gene locus_tag LOCUS_22040 6954 5485 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_22040 7283 7044 gene locus_tag LOCUS_22050 7283 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 8203 7286 gene locus_tag LOCUS_22060 8203 7286 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_22060 <8828 8200 gene locus_tag LOCUS_22070 <8828 8200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388245.1:magnesium chelatase subunit D >Feature sequence156 544 2256 gene locus_tag LOCUS_22080 544 2256 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_22080 2256 3347 gene locus_tag LOCUS_22090 2256 3347 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967450.1 protein_id gnl|my_center|LOCUS_22090 3608 4000 gene locus_tag LOCUS_22100 3608 4000 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085175.1 protein_id gnl|my_center|LOCUS_22100 4098 4991 gene locus_tag LOCUS_22110 4098 4991 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_22110 4988 5617 gene locus_tag LOCUS_22120 4988 5617 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968923.1 protein_id gnl|my_center|LOCUS_22120 5680 5754 gene locus_tag LOCUS_t00220 5680 5754 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6962 5904 gene locus_tag LOCUS_22130 6962 5904 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_22130 7969 7043 gene locus_tag LOCUS_22140 7969 7043 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 protein_id gnl|my_center|LOCUS_22140 <8820 8016 gene locus_tag LOCUS_22150 <8820 8016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976191.1:LacI family DNA-binding transcriptional regulator >Feature sequence157 177 953 gene locus_tag LOCUS_22160 177 953 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106098.1 protein_id gnl|my_center|LOCUS_22160 958 1278 gene locus_tag LOCUS_22170 958 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1287 2411 gene locus_tag LOCUS_22180 1287 2411 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401700.1 protein_id gnl|my_center|LOCUS_22180 3581 2517 gene locus_tag LOCUS_22190 3581 2517 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_22190 5589 3907 gene locus_tag LOCUS_22200 5589 3907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385658.1 protein_id gnl|my_center|LOCUS_22200 6413 5586 gene locus_tag LOCUS_22210 6413 5586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 protein_id gnl|my_center|LOCUS_22210 7379 6432 gene locus_tag LOCUS_22220 7379 6432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_22220 <8708 7442 gene locus_tag LOCUS_22230 <8708 7442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385655.1:ABC transporter substrate-binding protein >Feature sequence158 <1 711 gene locus_tag LOCUS_22240 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390218.1:pyruvate kinase 802 2460 gene locus_tag LOCUS_22250 802 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22250 2343 3227 gene locus_tag LOCUS_22260 2343 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22260 4296 3169 gene locus_tag LOCUS_22270 gene ada 4296 3169 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_22270 4340 4702 gene locus_tag LOCUS_22280 4340 4702 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 protein_id gnl|my_center|LOCUS_22280 4702 5424 gene locus_tag LOCUS_22290 4702 5424 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 protein_id gnl|my_center|LOCUS_22290 6639 5431 gene locus_tag LOCUS_22300 6639 5431 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397121.1 protein_id gnl|my_center|LOCUS_22300 6756 7580 gene locus_tag LOCUS_22310 6756 7580 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence159 1047 415 gene locus_tag LOCUS_22320 1047 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1158 2075 gene locus_tag LOCUS_22330 1158 2075 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_22330 2217 3053 gene locus_tag LOCUS_22340 2217 3053 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 protein_id gnl|my_center|LOCUS_22340 3143 3922 gene locus_tag LOCUS_22350 3143 3922 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172971.1 protein_id gnl|my_center|LOCUS_22350 3919 4695 gene locus_tag LOCUS_22360 3919 4695 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089939.1 protein_id gnl|my_center|LOCUS_22360 4791 5675 gene locus_tag LOCUS_22370 4791 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6471 5680 gene locus_tag LOCUS_22380 6471 5680 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence160 2518 1583 gene locus_tag LOCUS_22390 2518 1583 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_22390 3407 2520 gene locus_tag LOCUS_22400 3407 2520 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 protein_id gnl|my_center|LOCUS_22400 4635 3418 gene locus_tag LOCUS_22410 4635 3418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_22410 5945 4722 gene locus_tag LOCUS_22420 5945 4722 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_22420 6731 6024 gene locus_tag LOCUS_22430 6731 6024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_22430 7476 6724 gene locus_tag LOCUS_22440 7476 6724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_22440 8164 8081 gene locus_tag LOCUS_t00230 8164 8081 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence161 937 203 gene locus_tag LOCUS_22450 gene recO 937 203 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_22450 2046 1015 gene locus_tag LOCUS_22460 2046 1015 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_22460 2346 2152 gene locus_tag LOCUS_22470 2346 2152 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_22470 2479 4689 gene locus_tag LOCUS_22480 gene copA1 2479 4689 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_22480 4686 5159 gene locus_tag LOCUS_22490 gene cueR 4686 5159 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 protein_id gnl|my_center|LOCUS_22490 5147 6121 gene locus_tag LOCUS_22500 5147 6121 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_22500 6742 6140 gene locus_tag LOCUS_22510 6742 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8183 6852 gene locus_tag LOCUS_22520 8183 6852 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085694.1 protein_id gnl|my_center|LOCUS_22520 8318 8653 gene locus_tag LOCUS_22530 8318 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence162 724 428 gene locus_tag LOCUS_22540 724 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2159 747 gene locus_tag LOCUS_22550 2159 747 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_22550 4447 2270 gene locus_tag LOCUS_22560 gene pnp 4447 2270 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_22560 5042 4773 gene locus_tag LOCUS_22570 gene rpsO 5042 4773 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309908.1 protein_id gnl|my_center|LOCUS_22570 6009 5083 gene locus_tag LOCUS_22580 gene truB 6009 5083 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_22580 6554 6111 gene locus_tag LOCUS_22590 6554 6111 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_22590 7032 6640 gene locus_tag LOCUS_22600 7032 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 <8656 7029 gene locus_tag LOCUS_22610 <8656 7029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626661.1:translation initiation factor IF-2 >Feature sequence163 467 384 gene locus_tag LOCUS_t00240 467 384 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 568 2199 gene locus_tag LOCUS_22620 568 2199 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067082.1 protein_id gnl|my_center|LOCUS_22620 2683 2231 gene locus_tag LOCUS_22630 gene tsaA 2683 2231 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 protein_id gnl|my_center|LOCUS_22630 4355 2703 gene locus_tag LOCUS_22640 4355 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5664 4498 gene locus_tag LOCUS_22650 5664 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 6403 5651 gene locus_tag LOCUS_22660 6403 5651 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390301.1 protein_id gnl|my_center|LOCUS_22660 7350 6400 gene locus_tag LOCUS_22670 7350 6400 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330511.1 protein_id gnl|my_center|LOCUS_22670 8332 7370 gene locus_tag LOCUS_22680 8332 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence164 527 1204 gene locus_tag LOCUS_22690 527 1204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975726.1 protein_id gnl|my_center|LOCUS_22690 1201 2697 gene locus_tag LOCUS_22700 1201 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3853 2846 gene locus_tag LOCUS_22710 3853 2846 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_22710 4593 3946 gene locus_tag LOCUS_22720 4593 3946 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 protein_id gnl|my_center|LOCUS_22720 4835 5848 gene locus_tag LOCUS_22730 4835 5848 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994030.1 protein_id gnl|my_center|LOCUS_22730 6155 5916 gene locus_tag LOCUS_22740 6155 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 7883 6315 gene locus_tag LOCUS_22750 7883 6315 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528494.1 protein_id gnl|my_center|LOCUS_22750 <8630 7890 gene locus_tag LOCUS_22760 <8630 7890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704335.1:HlyD family secretion protein >Feature sequence165 1109 294 gene locus_tag LOCUS_22770 1109 294 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_22770 1289 3214 gene locus_tag LOCUS_22780 1289 3214 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087045357.1 protein_id gnl|my_center|LOCUS_22780 3972 3274 gene locus_tag LOCUS_22790 3972 3274 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_22790 5107 4052 gene locus_tag LOCUS_22800 5107 4052 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440409.1 protein_id gnl|my_center|LOCUS_22800 6454 5468 gene locus_tag LOCUS_22810 6454 5468 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 protein_id gnl|my_center|LOCUS_22810 7775 6573 gene locus_tag LOCUS_22820 7775 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence166 351 1625 gene locus_tag LOCUS_22830 351 1625 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_22830 1622 2524 gene locus_tag LOCUS_22840 1622 2524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689241.1 protein_id gnl|my_center|LOCUS_22840 2521 3348 gene locus_tag LOCUS_22850 2521 3348 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 protein_id gnl|my_center|LOCUS_22850 3345 3857 gene locus_tag LOCUS_22860 3345 3857 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_22860 3854 4873 gene locus_tag LOCUS_22870 3854 4873 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_22870 4905 5357 gene locus_tag LOCUS_22880 4905 5357 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 protein_id gnl|my_center|LOCUS_22880 5623 5354 gene locus_tag LOCUS_22890 5623 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 6109 5630 gene locus_tag LOCUS_22900 6109 5630 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_22900 6780 6106 gene locus_tag LOCUS_22910 gene ric 6780 6106 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967631.1 protein_id gnl|my_center|LOCUS_22910 6885 7328 gene locus_tag LOCUS_22920 6885 7328 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 protein_id gnl|my_center|LOCUS_22920 7378 8442 gene locus_tag LOCUS_22930 7378 8442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037275.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence167 <1 2300 gene locus_tag LOCUS_22940 <1 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391271.1:phenylalanine--tRNA ligase subunit beta 2382 2309 gene locus_tag LOCUS_t00250 2382 2309 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2984 2424 gene locus_tag LOCUS_22950 2984 2424 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973541.1 protein_id gnl|my_center|LOCUS_22950 5943 2977 gene locus_tag LOCUS_22960 5943 2977 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_22960 6200 5940 gene locus_tag LOCUS_22970 6200 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7470 6214 gene locus_tag LOCUS_22980 7470 6214 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 protein_id gnl|my_center|LOCUS_22980 <8480 7464 gene locus_tag LOCUS_22990 <8480 7464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532906.1:type III glutamate--ammonia ligase >Feature sequence168 305 706 gene locus_tag LOCUS_23000 305 706 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_23000 708 1742 gene locus_tag LOCUS_23010 708 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1739 2608 gene locus_tag LOCUS_23020 1739 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2622 3896 gene locus_tag LOCUS_23030 2622 3896 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390890.1 protein_id gnl|my_center|LOCUS_23030 3893 4525 gene locus_tag LOCUS_23040 3893 4525 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390891.1 protein_id gnl|my_center|LOCUS_23040 5351 4587 gene locus_tag LOCUS_23050 5351 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5709 7070 gene locus_tag LOCUS_23060 5709 7070 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_23060 7186 7383 gene locus_tag LOCUS_23070 7186 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 7752 8114 gene locus_tag LOCUS_23080 7752 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence169 3241 1460 gene locus_tag LOCUS_23090 3241 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4520 3291 gene locus_tag LOCUS_23100 4520 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4762 5265 gene locus_tag LOCUS_23110 4762 5265 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385395.1 protein_id gnl|my_center|LOCUS_23110 5465 5860 gene locus_tag LOCUS_23120 5465 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 7784 5943 gene locus_tag LOCUS_23130 7784 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence170 1632 643 gene locus_tag LOCUS_23140 1632 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1841 2347 gene locus_tag LOCUS_23150 1841 2347 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 protein_id gnl|my_center|LOCUS_23150 2370 4892 gene locus_tag LOCUS_23160 2370 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4967 6523 gene locus_tag LOCUS_23170 4967 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 7601 6501 gene locus_tag LOCUS_23180 7601 6501 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_23180 <8327 7614 gene locus_tag LOCUS_23190 <8327 7614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533092.1:branched-chain amino acid ABC transporter permease >Feature sequence171 285 13 gene locus_tag LOCUS_23200 gene rpsR 285 13 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_23200 806 291 gene locus_tag LOCUS_23210 806 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2279 954 gene locus_tag LOCUS_23220 2279 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3562 2276 gene locus_tag LOCUS_23230 gene paaF 3562 2276 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_23230 5015 3567 gene locus_tag LOCUS_23240 gene boxB 5015 3567 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_23240 6689 5043 gene locus_tag LOCUS_23250 gene boxC 6689 5043 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_23250 7523 6744 gene locus_tag LOCUS_23260 7523 6744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_23260 8320 7523 gene locus_tag LOCUS_23270 8320 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence172 <1 514 gene locus_tag LOCUS_23280 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385427.1:DNA repair protein RadC 1027 515 gene locus_tag LOCUS_23290 1027 515 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328752.1 protein_id gnl|my_center|LOCUS_23290 1539 1135 gene locus_tag LOCUS_23300 1539 1135 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088625.1 protein_id gnl|my_center|LOCUS_23300 2349 1546 gene locus_tag LOCUS_23310 gene map 2349 1546 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 protein_id gnl|my_center|LOCUS_23310 3667 2471 gene locus_tag LOCUS_23320 3667 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 4031 4549 gene locus_tag LOCUS_23330 4031 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 4816 5163 gene locus_tag LOCUS_23340 gene clpS 4816 5163 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_23340 5455 7785 gene locus_tag LOCUS_23350 gene clpA 5455 7785 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence173 865 164 gene locus_tag LOCUS_23360 865 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1670 960 gene locus_tag LOCUS_23370 1670 960 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_23370 2285 1680 gene locus_tag LOCUS_23380 2285 1680 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_23380 2386 3288 gene locus_tag LOCUS_23390 2386 3288 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_23390 3331 3621 gene locus_tag LOCUS_23400 3331 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3608 4417 gene locus_tag LOCUS_23410 3608 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4886 4431 gene locus_tag LOCUS_23420 gene moaE 4886 4431 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191688.1 protein_id gnl|my_center|LOCUS_23420 5175 4897 gene locus_tag LOCUS_23430 gene moaD 5175 4897 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_23430 5519 5172 gene locus_tag LOCUS_23440 5519 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6242 5619 gene locus_tag LOCUS_23450 gene pgsA 6242 5619 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_23450 7107 6367 gene locus_tag LOCUS_23460 7107 6367 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence174 1350 181 gene locus_tag LOCUS_23470 1350 181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_23470 1509 1357 gene locus_tag LOCUS_23480 1509 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1689 2618 gene locus_tag LOCUS_23490 1689 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2691 3497 gene locus_tag LOCUS_23500 2691 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229827.1 protein_id gnl|my_center|LOCUS_23500 4157 3510 gene locus_tag LOCUS_23510 4157 3510 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_23510 4354 5226 gene locus_tag LOCUS_23520 4354 5226 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_23520 5223 6011 gene locus_tag LOCUS_23530 5223 6011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522663.1 protein_id gnl|my_center|LOCUS_23530 6004 6804 gene locus_tag LOCUS_23540 6004 6804 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_23540 7308 6811 gene locus_tag LOCUS_23550 7308 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 <8224 7381 gene locus_tag LOCUS_23560 <8224 7381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028170938.1:dihydrodipicolinate synthase family protein >Feature sequence175 1857 46 gene locus_tag LOCUS_23570 1857 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1973 2986 gene locus_tag LOCUS_23580 1973 2986 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083666.1 protein_id gnl|my_center|LOCUS_23580 2983 4272 gene locus_tag LOCUS_23590 gene eno 2983 4272 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083669.1 protein_id gnl|my_center|LOCUS_23590 4300 5256 gene locus_tag LOCUS_23600 4300 5256 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_23600 5253 6008 gene locus_tag LOCUS_23610 5253 6008 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_23610 6111 6187 gene locus_tag LOCUS_t00260 6111 6187 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6232 6438 gene locus_tag LOCUS_23620 gene secE 6232 6438 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531408.1 protein_id gnl|my_center|LOCUS_23620 6449 6979 gene locus_tag LOCUS_23630 gene nusG 6449 6979 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_23630 8151 6994 gene locus_tag LOCUS_23640 8151 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence176 1213 200 gene locus_tag LOCUS_23650 1213 200 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 protein_id gnl|my_center|LOCUS_23650 1989 1285 gene locus_tag LOCUS_23660 1989 1285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_23660 2774 1992 gene locus_tag LOCUS_23670 2774 1992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_23670 3613 2771 gene locus_tag LOCUS_23680 3613 2771 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_23680 4494 3616 gene locus_tag LOCUS_23690 4494 3616 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_23690 5629 4514 gene locus_tag LOCUS_23700 5629 4514 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_23700 5740 6549 gene locus_tag LOCUS_23710 5740 6549 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393770.1 protein_id gnl|my_center|LOCUS_23710 6996 6562 gene locus_tag LOCUS_23720 6996 6562 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_23720 7454 7122 gene locus_tag LOCUS_23730 7454 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence177 1485 460 gene locus_tag LOCUS_23740 1485 460 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_23740 2984 1521 gene locus_tag LOCUS_23750 gene dhaS 2984 1521 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_23750 4033 2999 gene locus_tag LOCUS_23760 4033 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4553 4053 gene locus_tag LOCUS_23770 4553 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 5528 4683 gene locus_tag LOCUS_23780 5528 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 6865 5525 gene locus_tag LOCUS_23790 6865 5525 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537795.1 protein_id gnl|my_center|LOCUS_23790 7266 6871 gene locus_tag LOCUS_23800 gene gloA 7266 6871 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_23800 <8084 7263 gene locus_tag LOCUS_23810 <8084 7263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389473.1:UDP-2,3-diacylglucosamine diphosphatase LpxI >Feature sequence178 181 1332 gene locus_tag LOCUS_23820 gene dprA 181 1332 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_23820 1354 4053 gene locus_tag LOCUS_23830 gene topA 1354 4053 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_23830 4055 6268 gene locus_tag LOCUS_23840 gene rnr 4055 6268 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_23840 6265 7848 gene locus_tag LOCUS_23850 6265 7848 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence179 600 752 gene locus_tag LOCUS_23860 600 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1648 749 gene locus_tag LOCUS_23870 1648 749 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_23870 2423 1650 gene locus_tag LOCUS_23880 2423 1650 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_23880 3694 2423 gene locus_tag LOCUS_23890 3694 2423 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_23890 4288 3722 gene locus_tag LOCUS_23900 gene petA 4288 3722 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597339.1 protein_id gnl|my_center|LOCUS_23900 4470 5363 gene locus_tag LOCUS_23910 gene hemF 4470 5363 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_23910 6941 5373 gene locus_tag LOCUS_23920 6941 5373 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521735.1 protein_id gnl|my_center|LOCUS_23920 <7964 6938 gene locus_tag LOCUS_23930 <7964 6938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191546.1:HlyD family secretion protein >Feature sequence180 1666 1274 gene locus_tag LOCUS_23940 1666 1274 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066973.1 protein_id gnl|my_center|LOCUS_23940 2843 1704 gene locus_tag LOCUS_23950 2843 1704 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_23950 3010 4668 gene locus_tag LOCUS_23960 3010 4668 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_23960 4847 6496 gene locus_tag LOCUS_23970 gene pgm 4847 6496 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_23970 6581 6671 gene locus_tag LOCUS_t00270 6581 6671 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence181 219 1043 gene locus_tag LOCUS_23980 219 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1569 1045 gene locus_tag LOCUS_23990 gene rfbC 1569 1045 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_23990 1666 2745 gene locus_tag LOCUS_24000 1666 2745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 protein_id gnl|my_center|LOCUS_24000 3171 2767 gene locus_tag LOCUS_24010 3171 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4404 3316 gene locus_tag LOCUS_24020 4404 3316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528759.1 protein_id gnl|my_center|LOCUS_24020 4492 5604 gene locus_tag LOCUS_24030 4492 5604 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528758.1 protein_id gnl|my_center|LOCUS_24030 5641 7083 gene locus_tag LOCUS_24040 5641 7083 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence182 <1 1009 gene locus_tag LOCUS_24050 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391186.1:NAD(P)/FAD-dependent oxidoreductase 1495 1010 gene locus_tag LOCUS_24060 1495 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1582 2088 gene locus_tag LOCUS_24070 1582 2088 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212053.1 protein_id gnl|my_center|LOCUS_24070 2095 2787 gene locus_tag LOCUS_24080 2095 2787 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_24080 2859 3632 gene locus_tag LOCUS_24090 2859 3632 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533989.1 protein_id gnl|my_center|LOCUS_24090 4282 3761 gene locus_tag LOCUS_24100 4282 3761 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284399.1 protein_id gnl|my_center|LOCUS_24100 4961 4326 gene locus_tag LOCUS_24110 gene folE 4961 4326 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 protein_id gnl|my_center|LOCUS_24110 5477 5058 gene locus_tag LOCUS_24120 gene apaG 5477 5058 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388023.1 protein_id gnl|my_center|LOCUS_24120 6734 5535 gene locus_tag LOCUS_24130 6734 5535 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965254.1 protein_id gnl|my_center|LOCUS_24130 6982 7055 gene locus_tag LOCUS_t00280 6982 7055 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence183 401 673 gene locus_tag LOCUS_24140 401 673 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387921.1 protein_id gnl|my_center|LOCUS_24140 720 1793 gene locus_tag LOCUS_24150 720 1793 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919251.1 protein_id gnl|my_center|LOCUS_24150 1790 2884 gene locus_tag LOCUS_24160 1790 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2881 4356 gene locus_tag LOCUS_24170 gene tldD 2881 4356 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_24170 4817 5101 gene locus_tag LOCUS_24180 4817 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 5222 6025 gene locus_tag LOCUS_24190 5222 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 <7758 6033 gene locus_tag LOCUS_24200 <7758 6033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037402524.1:winged helix-turn-helix domain-containing tetratricopeptide repeat protein >Feature sequence184 290 577 gene locus_tag LOCUS_24210 290 577 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_24210 613 1095 gene locus_tag LOCUS_24220 gene mmcB 613 1095 CDS product DNA repair putative endonuclease MmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_24220 2577 1099 gene locus_tag LOCUS_24230 gene rfaE1 2577 1099 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_24230 3198 2629 gene locus_tag LOCUS_24240 3198 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3079 3333 gene locus_tag LOCUS_24250 3079 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3511 4893 gene locus_tag LOCUS_24260 3511 4893 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_24260 4890 6092 gene locus_tag LOCUS_24270 4890 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 7554 6097 gene locus_tag LOCUS_24280 7554 6097 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815057.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence185 1145 42 gene locus_tag LOCUS_24290 gene murG 1145 42 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_24290 2224 1157 gene locus_tag LOCUS_24300 2224 1157 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_24300 3615 2278 gene locus_tag LOCUS_24310 gene murD 3615 2278 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_24310 4745 3657 gene locus_tag LOCUS_24320 gene mraY 4745 3657 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_24320 6136 4745 gene locus_tag LOCUS_24330 gene murF 6136 4745 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_24330 7596 6133 gene locus_tag LOCUS_24340 7596 6133 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388710.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence186 607 296 gene locus_tag LOCUS_24350 607 296 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217002.1 protein_id gnl|my_center|LOCUS_24350 1670 741 gene locus_tag LOCUS_24360 1670 741 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147093500.1 protein_id gnl|my_center|LOCUS_24360 2477 1722 gene locus_tag LOCUS_24370 2477 1722 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_24370 2567 2806 gene locus_tag LOCUS_24380 2567 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2803 4122 gene locus_tag LOCUS_24390 2803 4122 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_24390 4276 5262 gene locus_tag LOCUS_24400 4276 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 6394 5279 gene locus_tag LOCUS_24410 6394 5279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529698.1 protein_id gnl|my_center|LOCUS_24410 7283 6399 gene locus_tag LOCUS_24420 7283 6399 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529699.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence187 463 1329 gene locus_tag LOCUS_24430 463 1329 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_24430 1805 1389 gene locus_tag LOCUS_24440 gene dksA 1805 1389 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_24440 2446 1997 gene locus_tag LOCUS_24450 2446 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2637 3752 gene locus_tag LOCUS_24460 2637 3752 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_24460 3752 4036 gene locus_tag LOCUS_24470 3752 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 4033 4446 gene locus_tag LOCUS_24480 4033 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4504 5289 gene locus_tag LOCUS_24490 4504 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5280 6233 gene locus_tag LOCUS_24500 5280 6233 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_24500 <7712 6230 gene locus_tag LOCUS_24510 <7712 6230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973601.1:aldehyde dehydrogenase family protein >Feature sequence188 <1 1066 gene locus_tag LOCUS_24520 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793001.1:sugar transferase 1216 4002 gene locus_tag LOCUS_24530 1216 4002 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_24530 4017 5843 gene locus_tag LOCUS_24540 4017 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 5843 6601 gene locus_tag LOCUS_24550 gene pheC 5843 6601 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092003.1 protein_id gnl|my_center|LOCUS_24550 <7684 6611 gene locus_tag LOCUS_24560 <7684 6611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626578.1:lipopolysaccharide biosynthesis protein >Feature sequence189 348 1277 gene locus_tag LOCUS_24570 gene ispH 348 1277 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470638.1 protein_id gnl|my_center|LOCUS_24570 1288 2436 gene locus_tag LOCUS_24580 gene hpnH 1288 2436 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_24580 3060 2386 gene locus_tag LOCUS_24590 3060 2386 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_24590 3148 3930 gene locus_tag LOCUS_24600 3148 3930 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090612.1 protein_id gnl|my_center|LOCUS_24600 3927 5462 gene locus_tag LOCUS_24610 3927 5462 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_24610 6895 5516 gene locus_tag LOCUS_24620 6895 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 7385 7017 gene locus_tag LOCUS_24630 7385 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence190 <1 628 gene locus_tag LOCUS_24640 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183209478.1:PQQ-dependent sugar dehydrogenase 655 1017 gene locus_tag LOCUS_24650 655 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1188 2834 gene locus_tag LOCUS_24660 1188 2834 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085102.1 protein_id gnl|my_center|LOCUS_24660 3701 2847 gene locus_tag LOCUS_24670 3701 2847 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_24670 4642 3707 gene locus_tag LOCUS_24680 4642 3707 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_24680 4777 5604 gene locus_tag LOCUS_24690 4777 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 7663 5618 gene locus_tag LOCUS_24700 7663 5618 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975924.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence191 321 1388 gene locus_tag LOCUS_24710 321 1388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969403.1 protein_id gnl|my_center|LOCUS_24710 1422 2762 gene locus_tag LOCUS_24720 1422 2762 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_24720 2764 3090 gene locus_tag LOCUS_24730 2764 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_24730 3215 4879 gene locus_tag LOCUS_24740 3215 4879 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_24740 4935 5342 gene locus_tag LOCUS_24750 4935 5342 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389066.1 protein_id gnl|my_center|LOCUS_24750 5360 6502 gene locus_tag LOCUS_24760 5360 6502 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence192 1751 726 gene locus_tag LOCUS_24770 1751 726 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007610940.1 protein_id gnl|my_center|LOCUS_24770 2422 1886 gene locus_tag LOCUS_24780 2422 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3895 2525 gene locus_tag LOCUS_24790 3895 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252523.1 protein_id gnl|my_center|LOCUS_24790 5151 3892 gene locus_tag LOCUS_24800 5151 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 6290 5148 gene locus_tag LOCUS_24810 6290 5148 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396845.1 protein_id gnl|my_center|LOCUS_24810 <7594 6287 gene locus_tag LOCUS_24820 <7594 6287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014526933.1:AAA family ATPase >Feature sequence193 159 2555 gene locus_tag LOCUS_24830 159 2555 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_24830 2548 2889 gene locus_tag LOCUS_24840 2548 2889 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140494.1 protein_id gnl|my_center|LOCUS_24840 3797 2904 gene locus_tag LOCUS_24850 3797 2904 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198203.1 protein_id gnl|my_center|LOCUS_24850 4592 3801 gene locus_tag LOCUS_24860 4592 3801 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530716.1 protein_id gnl|my_center|LOCUS_24860 4715 5014 gene locus_tag LOCUS_24870 4715 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 6738 5023 gene locus_tag LOCUS_24880 6738 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence194 <1 729 gene locus_tag LOCUS_24890 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532784.1:class I SAM-dependent RNA methyltransferase 1146 775 gene locus_tag LOCUS_24900 1146 775 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_24900 1537 1166 gene locus_tag LOCUS_24910 1537 1166 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_24910 1982 1530 gene locus_tag LOCUS_24920 1982 1530 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_24920 3226 1982 gene locus_tag LOCUS_24930 3226 1982 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_24930 4512 3223 gene locus_tag LOCUS_24940 gene sufD 4512 3223 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_24940 5258 4509 gene locus_tag LOCUS_24950 gene sufC 5258 4509 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_24950 6753 5269 gene locus_tag LOCUS_24960 gene sufB 6753 5269 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_24960 7257 6763 gene locus_tag LOCUS_24970 7257 6763 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence195 <1 675 gene locus_tag LOCUS_24980 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089082.1:hydrogenase 4 subunit F 684 2150 gene locus_tag LOCUS_24990 684 2150 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_24990 2157 2672 gene locus_tag LOCUS_25000 2157 2672 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_25000 3416 2826 gene locus_tag LOCUS_25010 3416 2826 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_25010 4779 3436 gene locus_tag LOCUS_25020 4779 3436 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_25020 5263 4844 gene locus_tag LOCUS_25030 5263 4844 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_25030 5580 5260 gene locus_tag LOCUS_25040 5580 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence196 423 1727 gene locus_tag LOCUS_25050 423 1727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_25050 1925 1734 gene locus_tag LOCUS_25060 1925 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 3413 2127 gene locus_tag LOCUS_25070 gene gltX 3413 2127 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338496.1 protein_id gnl|my_center|LOCUS_25070 3778 3410 gene locus_tag LOCUS_25080 3778 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 5442 3775 gene locus_tag LOCUS_25090 5442 3775 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_25090 6329 5451 gene locus_tag LOCUS_25100 6329 5451 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086191.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence197 632 195 gene locus_tag LOCUS_25110 632 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2379 691 gene locus_tag LOCUS_25120 2379 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2500 3786 gene locus_tag LOCUS_25130 gene kynU 2500 3786 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_25130 3847 4179 gene locus_tag LOCUS_25140 3847 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4482 4186 gene locus_tag LOCUS_25150 4482 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 5933 4521 gene locus_tag LOCUS_25160 5933 4521 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_25160 <7393 6069 gene locus_tag LOCUS_25170 <7393 6069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391532.1:polyribonucleotide nucleotidyltransferase >Feature sequence198 462 1388 gene locus_tag LOCUS_25180 462 1388 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 protein_id gnl|my_center|LOCUS_25180 1547 1395 gene locus_tag LOCUS_25190 1547 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1937 3067 gene locus_tag LOCUS_25200 1937 3067 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530863.1 protein_id gnl|my_center|LOCUS_25200 3143 4684 gene locus_tag LOCUS_25210 3143 4684 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 protein_id gnl|my_center|LOCUS_25210 4681 5748 gene locus_tag LOCUS_25220 4681 5748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530865.1 protein_id gnl|my_center|LOCUS_25220 5745 6695 gene locus_tag LOCUS_25230 5745 6695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530866.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence199 <1 524 gene locus_tag LOCUS_25240 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390958.1:site-specific DNA-methyltransferase 597 2285 gene locus_tag LOCUS_25250 597 2285 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089799.1 protein_id gnl|my_center|LOCUS_25250 2351 3211 gene locus_tag LOCUS_25260 2351 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 4365 3235 gene locus_tag LOCUS_25270 4365 3235 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_25270 5302 4370 gene locus_tag LOCUS_25280 5302 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 7282 5306 gene locus_tag LOCUS_25290 7282 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25290 >Feature sequence200 503 964 gene locus_tag LOCUS_25300 503 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 964 1845 gene locus_tag LOCUS_25310 gene speE 964 1845 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389381.1 protein_id gnl|my_center|LOCUS_25310 1955 2242 gene locus_tag LOCUS_25320 1955 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3409 2255 gene locus_tag LOCUS_25330 gene pimD 3409 2255 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_25330 4616 3420 gene locus_tag LOCUS_25340 gene pimC 4616 3420 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_25340 6302 4629 gene locus_tag LOCUS_25350 gene pimA 6302 4629 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090544.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence201 2279 1113 gene locus_tag LOCUS_25360 2279 1113 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_25360 3073 2276 gene locus_tag LOCUS_25370 3073 2276 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545781.1 protein_id gnl|my_center|LOCUS_25370 3833 3057 gene locus_tag LOCUS_25380 3833 3057 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531758.1 protein_id gnl|my_center|LOCUS_25380 4407 3841 gene locus_tag LOCUS_25390 gene frr 4407 3841 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_25390 5202 4462 gene locus_tag LOCUS_25400 gene pyrH 5202 4462 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_25400 6229 5312 gene locus_tag LOCUS_25410 gene tsf 6229 5312 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_25410 7059 6283 gene locus_tag LOCUS_25420 gene rpsB 7059 6283 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence202 2051 582 gene locus_tag LOCUS_25430 2051 582 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267581.1 protein_id gnl|my_center|LOCUS_25430 3611 2088 gene locus_tag LOCUS_25440 3611 2088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_25440 4747 3644 gene locus_tag LOCUS_25450 4747 3644 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_25450 4817 5044 gene locus_tag LOCUS_25460 4817 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 5041 5658 gene locus_tag LOCUS_25470 gene rpsD 5041 5658 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 protein_id gnl|my_center|LOCUS_25470 5676 6659 gene locus_tag LOCUS_25480 5676 6659 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence203 <1 1560 gene locus_tag LOCUS_25490 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090509.1:long-chain-acyl-CoA synthetase 2039 1734 gene locus_tag LOCUS_25500 2039 1734 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771155.1 protein_id gnl|my_center|LOCUS_25500 2281 2054 gene locus_tag LOCUS_25510 2281 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2614 2285 gene locus_tag LOCUS_25520 2614 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3257 2751 gene locus_tag LOCUS_25530 3257 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_25530 3544 3254 gene locus_tag LOCUS_25540 3544 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3866 3609 gene locus_tag LOCUS_25550 3866 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 4902 4630 gene locus_tag LOCUS_25560 4902 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 4935 5357 gene locus_tag LOCUS_25570 4935 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25570 <7156 5286 gene locus_tag LOCUS_25580 <7156 5286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153437548.1:Hint domain-containing protein >Feature sequence204 322 41 gene locus_tag LOCUS_25590 322 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1268 816 gene locus_tag LOCUS_25600 gene rnhA 1268 816 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 protein_id gnl|my_center|LOCUS_25600 2229 1258 gene locus_tag LOCUS_25610 2229 1258 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_25610 3256 2246 gene locus_tag LOCUS_25620 gene ispH 3256 2246 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537458.1 protein_id gnl|my_center|LOCUS_25620 3369 3941 gene locus_tag LOCUS_25630 3369 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 4015 4707 gene locus_tag LOCUS_25640 gene aat 4015 4707 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_25640 4755 5642 gene locus_tag LOCUS_25650 4755 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 6308 5673 gene locus_tag LOCUS_25660 6308 5673 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_25660 <7128 6328 gene locus_tag LOCUS_25670 <7128 6328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275305.1:glycosyltransferase >Feature sequence205 1136 1585 gene locus_tag LOCUS_25680 gene cynS 1136 1585 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_25680 3168 1582 gene locus_tag LOCUS_25690 3168 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4213 3197 gene locus_tag LOCUS_25700 gene rbsC 4213 3197 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_25700 5750 4218 gene locus_tag LOCUS_25710 5750 4218 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976197.1 protein_id gnl|my_center|LOCUS_25710 6883 5810 gene locus_tag LOCUS_25720 6883 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence206 1494 118 gene locus_tag LOCUS_25730 1494 118 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_25730 1707 2330 gene locus_tag LOCUS_25740 1707 2330 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 protein_id gnl|my_center|LOCUS_25740 3048 2353 gene locus_tag LOCUS_25750 3048 2353 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_25750 3126 5969 gene locus_tag LOCUS_25760 3126 5969 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 protein_id gnl|my_center|LOCUS_25760 6957 5956 gene locus_tag LOCUS_25770 6957 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence207 1401 235 gene locus_tag LOCUS_25780 1401 235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966126.1 protein_id gnl|my_center|LOCUS_25780 2138 1398 gene locus_tag LOCUS_25790 2138 1398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393736.1 protein_id gnl|my_center|LOCUS_25790 2225 3625 gene locus_tag LOCUS_25800 2225 3625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_25800 3725 5056 gene locus_tag LOCUS_25810 3725 5056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088030.1 protein_id gnl|my_center|LOCUS_25810 5197 6210 gene locus_tag LOCUS_25820 5197 6210 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence208 2 673 gene locus_tag LOCUS_25830 2 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 704 2698 gene locus_tag LOCUS_25840 gene tssI 704 2698 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143801.1 protein_id gnl|my_center|LOCUS_25840 2700 4202 gene locus_tag LOCUS_25850 gene tssC 2700 4202 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_25850 4230 4883 gene locus_tag LOCUS_25860 4230 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 6070 4946 gene locus_tag LOCUS_25870 6070 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6217 6603 gene locus_tag LOCUS_25880 6217 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence209 217 927 gene locus_tag LOCUS_25890 gene rpiA 217 927 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_25890 927 1625 gene locus_tag LOCUS_25900 927 1625 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_25900 3069 1633 gene locus_tag LOCUS_25910 3069 1633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088893.1 protein_id gnl|my_center|LOCUS_25910 3821 3144 gene locus_tag LOCUS_25920 3821 3144 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088892.1 protein_id gnl|my_center|LOCUS_25920 3985 3818 gene locus_tag LOCUS_25930 3985 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4911 3997 gene locus_tag LOCUS_25940 4911 3997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406591.1 protein_id gnl|my_center|LOCUS_25940 6031 4916 gene locus_tag LOCUS_25950 6031 4916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243181.1 protein_id gnl|my_center|LOCUS_25950 <6825 6028 gene locus_tag LOCUS_25960 <6825 6028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243182.1:BMP family ABC transporter substrate-binding protein >Feature sequence210 1754 2686 gene locus_tag LOCUS_25970 gene nudC 1754 2686 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_25970 2693 3127 gene locus_tag LOCUS_25980 2693 3127 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_25980 3230 4777 gene locus_tag LOCUS_25990 3230 4777 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395758.1 protein_id gnl|my_center|LOCUS_25990 6046 4823 gene locus_tag LOCUS_26000 6046 4823 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_26000 6272 6610 gene locus_tag LOCUS_26010 gene glnK 6272 6610 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence211 1128 3416 gene locus_tag LOCUS_26020 1128 3416 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_26020 3421 4860 gene locus_tag LOCUS_26030 3421 4860 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence212 <1 744 gene locus_tag LOCUS_26040 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144408.1:S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase 1855 749 gene locus_tag LOCUS_26050 gene pqqE 1855 749 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038063.1 protein_id gnl|my_center|LOCUS_26050 2130 1849 gene locus_tag LOCUS_26060 gene pqqD 2130 1849 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089477.1 protein_id gnl|my_center|LOCUS_26060 2870 2127 gene locus_tag LOCUS_26070 gene pqqC 2870 2127 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089476.1 protein_id gnl|my_center|LOCUS_26070 3634 2867 gene locus_tag LOCUS_26080 gene pqqB 3634 2867 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720978.1 protein_id gnl|my_center|LOCUS_26080 4397 3969 gene locus_tag LOCUS_26090 4397 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 4519 5772 gene locus_tag LOCUS_26100 4519 5772 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183209478.1 protein_id gnl|my_center|LOCUS_26100 5769 6161 gene locus_tag LOCUS_26110 5769 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence213 281 694 gene locus_tag LOCUS_26120 281 694 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808835.1 protein_id gnl|my_center|LOCUS_26120 1501 707 gene locus_tag LOCUS_26130 1501 707 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967474.1 protein_id gnl|my_center|LOCUS_26130 1585 2355 gene locus_tag LOCUS_26140 1585 2355 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815086.1 protein_id gnl|my_center|LOCUS_26140 3261 2380 gene locus_tag LOCUS_26150 3261 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4347 3472 gene locus_tag LOCUS_26160 4347 3472 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521294.1 protein_id gnl|my_center|LOCUS_26160 5139 4363 gene locus_tag LOCUS_26170 5139 4363 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_26170 5298 6386 gene locus_tag LOCUS_26180 5298 6386 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169951.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence214 1144 140 gene locus_tag LOCUS_26190 1144 140 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 protein_id gnl|my_center|LOCUS_26190 1960 1181 gene locus_tag LOCUS_26200 1960 1181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808030.1 protein_id gnl|my_center|LOCUS_26200 2754 1957 gene locus_tag LOCUS_26210 2754 1957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_26210 3833 2751 gene locus_tag LOCUS_26220 3833 2751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807533.1 protein_id gnl|my_center|LOCUS_26220 5199 4327 gene locus_tag LOCUS_26230 gene ephM 5199 4327 CDS product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 protein_id gnl|my_center|LOCUS_26230 5794 5186 gene locus_tag LOCUS_26240 5794 5186 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079730.1 protein_id gnl|my_center|LOCUS_26240 5872 6384 gene locus_tag LOCUS_26250 5872 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence215 2190 1273 gene locus_tag LOCUS_26260 gene hflC 2190 1273 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_26260 3296 2187 gene locus_tag LOCUS_26270 gene hflK 3296 2187 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_26270 3670 4806 gene locus_tag LOCUS_26280 3670 4806 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392735.1 protein_id gnl|my_center|LOCUS_26280 5879 4854 gene locus_tag LOCUS_26290 5879 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 <6526 5876 gene locus_tag LOCUS_26300 <6526 5876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086408.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence216 <1 2832 gene locus_tag LOCUS_26310 <1 2832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387780.1:glutamate synthase large subunit 2909 3577 gene locus_tag LOCUS_26320 2909 3577 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_26320 4024 3596 gene locus_tag LOCUS_26330 4024 3596 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_26330 4956 4024 gene locus_tag LOCUS_26340 gene nudC 4956 4024 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence217 391 3012 gene locus_tag LOCUS_26350 gene mutS 391 3012 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_26350 3009 5852 gene locus_tag LOCUS_26360 3009 5852 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence218 <1 573 gene locus_tag LOCUS_26370 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088815.1:CBS domain-containing protein 753 1955 gene locus_tag LOCUS_26380 753 1955 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965179.1 protein_id gnl|my_center|LOCUS_26380 1960 2721 gene locus_tag LOCUS_26390 1960 2721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 protein_id gnl|my_center|LOCUS_26390 2714 3442 gene locus_tag LOCUS_26400 2714 3442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083707.1 protein_id gnl|my_center|LOCUS_26400 3439 4410 gene locus_tag LOCUS_26410 3439 4410 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 protein_id gnl|my_center|LOCUS_26410 4413 5477 gene locus_tag LOCUS_26420 4413 5477 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463731.1 protein_id gnl|my_center|LOCUS_26420 5727 5485 gene locus_tag LOCUS_26430 5727 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence219 996 424 gene locus_tag LOCUS_26440 996 424 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_26440 1114 2352 gene locus_tag LOCUS_26450 1114 2352 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_26450 2363 3295 gene locus_tag LOCUS_26460 2363 3295 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_26460 3292 4134 gene locus_tag LOCUS_26470 3292 4134 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_26470 4439 4696 gene locus_tag LOCUS_26480 4439 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 5265 4762 gene locus_tag LOCUS_26490 5265 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6402 5368 gene locus_tag LOCUS_26500 6402 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence220 1079 1741 gene locus_tag LOCUS_26510 1079 1741 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_26510 1842 2105 gene locus_tag LOCUS_26520 1842 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2102 2692 gene locus_tag LOCUS_26530 2102 2692 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399156.1 protein_id gnl|my_center|LOCUS_26530 3600 2689 gene locus_tag LOCUS_26540 3600 2689 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_26540 5320 3665 gene locus_tag LOCUS_26550 gene mdoH 5320 3665 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038607.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence221 14 166 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgggggccatccccgcgtgggcgggggaacc 505 218 gene locus_tag LOCUS_26560 gene cas2e 505 218 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_26560 1386 511 gene locus_tag LOCUS_26570 gene cas1e 1386 511 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_26570 2116 1391 gene locus_tag LOCUS_26580 2116 1391 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_26580 2820 2113 gene locus_tag LOCUS_26590 gene cas5e 2820 2113 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_26590 3967 2822 gene locus_tag LOCUS_26600 gene cas7e 3967 2822 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_26600 4517 3996 gene locus_tag LOCUS_26610 4517 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 6069 4504 gene locus_tag LOCUS_26620 6069 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence222 278 1114 gene locus_tag LOCUS_26630 278 1114 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_26630 1234 2292 gene locus_tag LOCUS_26640 1234 2292 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393077.1 protein_id gnl|my_center|LOCUS_26640 2319 2636 gene locus_tag LOCUS_26650 2319 2636 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393075.1 protein_id gnl|my_center|LOCUS_26650 3649 2672 gene locus_tag LOCUS_26660 3649 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266244.1 protein_id gnl|my_center|LOCUS_26660 4192 3689 gene locus_tag LOCUS_26670 gene zur 4192 3689 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_26670 4258 4659 gene locus_tag LOCUS_26680 gene hisI 4258 4659 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_26680 4757 5338 gene locus_tag LOCUS_26690 4757 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 5474 6046 gene locus_tag LOCUS_26700 5474 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence223 1019 519 gene locus_tag LOCUS_26710 1019 519 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393487.1 protein_id gnl|my_center|LOCUS_26710 1509 1048 gene locus_tag LOCUS_26720 gene pgpA 1509 1048 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 protein_id gnl|my_center|LOCUS_26720 3458 1506 gene locus_tag LOCUS_26730 3458 1506 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 protein_id gnl|my_center|LOCUS_26730 3558 4436 gene locus_tag LOCUS_26740 gene dapA 3558 4436 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_26740 4496 4984 gene locus_tag LOCUS_26750 gene smpB 4496 4984 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_26750 5005 5679 gene locus_tag LOCUS_26760 5005 5679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence224 1333 353 gene locus_tag LOCUS_26770 1333 353 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704493.1 protein_id gnl|my_center|LOCUS_26770 1767 1330 gene locus_tag LOCUS_26780 1767 1330 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532706.1 protein_id gnl|my_center|LOCUS_26780 1921 3462 gene locus_tag LOCUS_26790 1921 3462 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_26790 3730 4173 gene locus_tag LOCUS_26800 3730 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 4230 4814 gene locus_tag LOCUS_26810 4230 4814 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_26810 4844 6037 gene locus_tag LOCUS_26820 4844 6037 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence225 2053 506 gene locus_tag LOCUS_26830 2053 506 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_26830 2580 2155 gene locus_tag LOCUS_26840 2580 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4031 2580 gene locus_tag LOCUS_26850 4031 2580 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26850 5254 4028 gene locus_tag LOCUS_26860 5254 4028 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_26860 <6250 5271 gene locus_tag LOCUS_26870 <6250 5271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085718.1:efflux RND transporter permease subunit >Feature sequence226 389 2257 gene locus_tag LOCUS_26880 389 2257 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_26880 4802 2271 gene locus_tag LOCUS_26890 4802 2271 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_26890 5248 4799 gene locus_tag LOCUS_26900 5248 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 <6241 5668 gene locus_tag LOCUS_26910 <6241 5668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391322.1:acetate--CoA ligase >Feature sequence227 3377 2553 gene locus_tag LOCUS_26920 3377 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3703 4074 gene locus_tag LOCUS_26930 3703 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence228 240 1721 gene locus_tag LOCUS_26940 gene xylB 240 1721 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 protein_id gnl|my_center|LOCUS_26940 1841 4807 gene locus_tag LOCUS_26950 1841 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 5932 4817 gene locus_tag LOCUS_26960 5932 4817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence229 661 137 gene locus_tag LOCUS_26970 gene fabZ 661 137 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_26970 1737 667 gene locus_tag LOCUS_26980 gene lpxD 1737 667 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919779.1 protein_id gnl|my_center|LOCUS_26980 2637 1741 gene locus_tag LOCUS_26990 2637 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 4976 2637 gene locus_tag LOCUS_27000 gene bamA 4976 2637 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_27000 <6197 5100 gene locus_tag LOCUS_27010 <6197 5100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389468.1:RIP metalloprotease RseP >Feature sequence230 <1 2155 gene locus_tag LOCUS_27020 <1 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391289.1:NADP-dependent malic enzyme 2225 3544 gene locus_tag LOCUS_27030 2225 3544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 protein_id gnl|my_center|LOCUS_27030 4017 3580 gene locus_tag LOCUS_27040 4017 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4153 4824 gene locus_tag LOCUS_27050 gene ftsE 4153 4824 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 protein_id gnl|my_center|LOCUS_27050 4817 5773 gene locus_tag LOCUS_27060 4817 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence231 <1 1048 gene locus_tag LOCUS_27070 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528087.1:phosphoenolpyruvate--protein phosphotransferase 1074 2060 gene locus_tag LOCUS_27080 gene dhaK 1074 2060 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 protein_id gnl|my_center|LOCUS_27080 2132 2335 gene locus_tag LOCUS_27090 2132 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2381 2668 gene locus_tag LOCUS_27100 2381 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3874 2672 gene locus_tag LOCUS_27110 3874 2672 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088989.1 protein_id gnl|my_center|LOCUS_27110 4891 3887 gene locus_tag LOCUS_27120 gene cysK 4891 3887 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_27120 4988 5413 gene locus_tag LOCUS_27130 4988 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 5624 5427 gene locus_tag LOCUS_27140 5624 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence232 728 12 gene locus_tag LOCUS_27150 728 12 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_27150 901 1806 gene locus_tag LOCUS_27160 901 1806 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385239.1 protein_id gnl|my_center|LOCUS_27160 2359 1814 gene locus_tag LOCUS_27170 2359 1814 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_27170 2973 2365 gene locus_tag LOCUS_27180 gene gstA 2973 2365 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 protein_id gnl|my_center|LOCUS_27180 3927 2995 gene locus_tag LOCUS_27190 3927 2995 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_27190 3824 4036 gene locus_tag LOCUS_27200 3824 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 4999 4085 gene locus_tag LOCUS_27210 4999 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 5884 5120 gene locus_tag LOCUS_27220 gene pgeF 5884 5120 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence233 3568 1286 gene locus_tag LOCUS_27230 3568 1286 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_27230 5137 3662 gene locus_tag LOCUS_27240 gene ntrC 5137 3662 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_27240 <6018 5141 gene locus_tag LOCUS_27250 <6018 5141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087259.1:ATP-binding protein >Feature sequence234 69 1151 gene locus_tag LOCUS_27260 gene mnmA 69 1151 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_27260 1214 1288 gene locus_tag LOCUS_t00290 1214 1288 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2459 1371 gene locus_tag LOCUS_27270 2459 1371 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112642.1 protein_id gnl|my_center|LOCUS_27270 3463 2486 gene locus_tag LOCUS_27280 3463 2486 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_27280 4152 3472 gene locus_tag LOCUS_27290 4152 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 5150 4356 gene locus_tag LOCUS_27300 5150 4356 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980321.1 protein_id gnl|my_center|LOCUS_27300 5459 5232 gene locus_tag LOCUS_27310 gene tusA 5459 5232 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence235 3359 921 gene locus_tag LOCUS_27320 3359 921 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329022.1 protein_id gnl|my_center|LOCUS_27320 3979 3437 gene locus_tag LOCUS_27330 3979 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 4905 4015 gene locus_tag LOCUS_27340 4905 4015 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971315.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence236 2056 656 gene locus_tag LOCUS_27350 gene miaB 2056 656 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_27350 3213 2242 gene locus_tag LOCUS_27360 3213 2242 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_27360 4612 3335 gene locus_tag LOCUS_27370 4612 3335 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389191.1 protein_id gnl|my_center|LOCUS_27370 5299 4700 gene locus_tag LOCUS_27380 gene rdgB 5299 4700 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_27380 <5913 5299 gene locus_tag LOCUS_27390 <5913 5299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918041.1:ribonuclease PH >Feature sequence237 1602 97 gene locus_tag LOCUS_27400 1602 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2027 1611 gene locus_tag LOCUS_27410 2027 1611 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_27410 2347 2535 gene locus_tag LOCUS_27420 2347 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2626 3525 gene locus_tag LOCUS_27430 2626 3525 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 protein_id gnl|my_center|LOCUS_27430 3522 3971 gene locus_tag LOCUS_27440 3522 3971 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_27440 4802 3981 gene locus_tag LOCUS_27450 4802 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 5532 4831 gene locus_tag LOCUS_27460 5532 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence238 <1 1468 gene locus_tag LOCUS_27470 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389839.1:type I glutamate--ammonia ligase 2346 1528 gene locus_tag LOCUS_27480 2346 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3736 2513 gene locus_tag LOCUS_27490 gene phaZ 3736 2513 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 protein_id gnl|my_center|LOCUS_27490 3797 4459 gene locus_tag LOCUS_27500 3797 4459 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 protein_id gnl|my_center|LOCUS_27500 5629 4487 gene locus_tag LOCUS_27510 5629 4487 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence239 1082 15 gene locus_tag LOCUS_27520 gene rffG 1082 15 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_27520 1354 2166 gene locus_tag LOCUS_27530 1354 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2204 2701 gene locus_tag LOCUS_27540 2204 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2754 5519 gene locus_tag LOCUS_27550 2754 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence240 20 106 gene locus_tag LOCUS_t00300 20 106 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1053 184 gene locus_tag LOCUS_27560 1053 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2263 1433 gene locus_tag LOCUS_27570 2263 1433 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530443.1 protein_id gnl|my_center|LOCUS_27570 3123 2260 gene locus_tag LOCUS_27580 3123 2260 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530442.1 protein_id gnl|my_center|LOCUS_27580 4512 3190 gene locus_tag LOCUS_27590 4512 3190 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136619324.1 protein_id gnl|my_center|LOCUS_27590 5393 4509 gene locus_tag LOCUS_27600 5393 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27600 5698 5390 gene locus_tag LOCUS_27610 5698 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27610 >Feature sequence241 293 1555 gene locus_tag LOCUS_27620 gene fabF 293 1555 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_27620 1683 2555 gene locus_tag LOCUS_27630 1683 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3736 2564 gene locus_tag LOCUS_27640 gene zapE 3736 2564 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_27640 3856 4488 gene locus_tag LOCUS_27650 3856 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 4485 4901 gene locus_tag LOCUS_27660 4485 4901 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_27660 5611 4898 gene locus_tag LOCUS_27670 5611 4898 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391167.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence242 406 1476 gene locus_tag LOCUS_27680 406 1476 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037275.1 protein_id gnl|my_center|LOCUS_27680 1499 1783 gene locus_tag LOCUS_27690 1499 1783 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085458.1 protein_id gnl|my_center|LOCUS_27690 1780 2790 gene locus_tag LOCUS_27700 1780 2790 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_27700 2819 3799 gene locus_tag LOCUS_27710 2819 3799 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_27710 3837 4898 gene locus_tag LOCUS_27720 gene rbsC 3837 4898 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612396.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence243 438 1469 gene locus_tag LOCUS_27730 438 1469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258151.1 protein_id gnl|my_center|LOCUS_27730 1466 2431 gene locus_tag LOCUS_27740 1466 2431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258150.1 protein_id gnl|my_center|LOCUS_27740 2428 3471 gene locus_tag LOCUS_27750 2428 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3855 3511 gene locus_tag LOCUS_27760 3855 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088943.1 protein_id gnl|my_center|LOCUS_27760 5081 3867 gene locus_tag LOCUS_27770 5081 3867 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 protein_id gnl|my_center|LOCUS_27770 <5613 5074 gene locus_tag LOCUS_27780 <5613 5074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084110.1:CoA transferase >Feature sequence244 130 1671 gene locus_tag LOCUS_27790 130 1671 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 protein_id gnl|my_center|LOCUS_27790 1682 2689 gene locus_tag LOCUS_27800 1682 2689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_27800 2756 4837 gene locus_tag LOCUS_27810 2756 4837 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_27810 4050 4131 gene locus_tag LOCUS_t00310 4050 4131 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence245 <1 1398 gene locus_tag LOCUS_27820 <1 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390166.1:class I poly(R)-hydroxyalkanoic acid synthase 3315 1411 gene locus_tag LOCUS_27830 gene uvrC 3315 1411 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_27830 4046 3633 gene locus_tag LOCUS_27840 4046 3633 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_27840 4829 4050 gene locus_tag LOCUS_27850 4829 4050 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_27850 <5558 4882 gene locus_tag LOCUS_27860 <5558 4882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061790.1:2-aminoethylphosphonate--pyruvate transaminase >Feature sequence246 1754 480 gene locus_tag LOCUS_27870 1754 480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085208.1 protein_id gnl|my_center|LOCUS_27870 2082 1903 gene locus_tag LOCUS_27880 2082 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3278 2139 gene locus_tag LOCUS_27890 3278 2139 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 protein_id gnl|my_center|LOCUS_27890 3507 4664 gene locus_tag LOCUS_27900 gene lptF 3507 4664 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence247 1052 534 gene locus_tag LOCUS_27910 gene ilvN 1052 534 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_27910 2919 1111 gene locus_tag LOCUS_27920 2919 1111 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_27920 3926 2952 gene locus_tag LOCUS_27930 gene miaA 3926 2952 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_27930 3965 4843 gene locus_tag LOCUS_27940 gene serB 3965 4843 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_27940 <5529 4905 gene locus_tag LOCUS_27950 <5529 4905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089246.1:Do family serine endopeptidase >Feature sequence248 1 330 gene locus_tag LOCUS_27960 1 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 371 868 gene locus_tag LOCUS_27970 371 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1664 888 gene locus_tag LOCUS_27980 gene hisN 1664 888 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_27980 2236 1673 gene locus_tag LOCUS_27990 2236 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3939 2236 gene locus_tag LOCUS_28000 3939 2236 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207185.1 protein_id gnl|my_center|LOCUS_28000 5210 3936 gene locus_tag LOCUS_28010 5210 3936 CDS product PqiA/YebS family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820402.1 protein_id gnl|my_center|LOCUS_28010 5403 5479 gene locus_tag LOCUS_t00320 5403 5479 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence249 392 1225 gene locus_tag LOCUS_28020 392 1225 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174758.1 protein_id gnl|my_center|LOCUS_28020 3450 1234 gene locus_tag LOCUS_28030 gene parC 3450 1234 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_28030 4183 3440 gene locus_tag LOCUS_28040 gene recO 4183 3440 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389602.1 protein_id gnl|my_center|LOCUS_28040 4780 4319 gene locus_tag LOCUS_28050 4780 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 <5490 4894 gene locus_tag LOCUS_28060 <5490 4894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000153584.1:NUDIX hydrolase >Feature sequence250 65 1051 gene locus_tag LOCUS_28070 65 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1122 2342 gene locus_tag LOCUS_28080 1122 2342 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_28080 4511 2418 gene locus_tag LOCUS_28090 4511 2418 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087787.1 protein_id gnl|my_center|LOCUS_28090 4878 4954 gene locus_tag LOCUS_t00330 4878 4954 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence251 2 622 gene locus_tag LOCUS_28100 2 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 1354 635 gene locus_tag LOCUS_28110 1354 635 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_28110 1559 2023 gene locus_tag LOCUS_28120 1559 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2717 2052 gene locus_tag LOCUS_28130 2717 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3370 2714 gene locus_tag LOCUS_28140 3370 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 4810 3407 gene locus_tag LOCUS_28150 gene hemN 4810 3407 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089823.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence252 868 275 gene locus_tag LOCUS_28160 868 275 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 protein_id gnl|my_center|LOCUS_28160 1148 873 gene locus_tag LOCUS_28170 1148 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1334 2065 gene locus_tag LOCUS_28180 1334 2065 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537174.1 protein_id gnl|my_center|LOCUS_28180 2118 2996 gene locus_tag LOCUS_28190 2118 2996 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086254.1 protein_id gnl|my_center|LOCUS_28190 3075 3740 gene locus_tag LOCUS_28200 3075 3740 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969827.1 protein_id gnl|my_center|LOCUS_28200 3733 4281 gene locus_tag LOCUS_28210 3733 4281 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_28210 5150 4290 gene locus_tag LOCUS_28220 5150 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence253 2696 2013 gene locus_tag LOCUS_28230 2696 2013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919795.1 protein_id gnl|my_center|LOCUS_28230 3942 2689 gene locus_tag LOCUS_28240 3942 2689 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_28240 5248 3944 gene locus_tag LOCUS_28250 5248 3944 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087644.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence254 449 1597 gene locus_tag LOCUS_28260 gene argE 449 1597 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530453.1 protein_id gnl|my_center|LOCUS_28260 2633 1602 gene locus_tag LOCUS_28270 2633 1602 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_28270 2835 2760 gene locus_tag LOCUS_t00340 2835 2760 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2990 3589 gene locus_tag LOCUS_28280 2990 3589 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080406.1 protein_id gnl|my_center|LOCUS_28280 3804 4496 gene locus_tag LOCUS_28290 3804 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence255 1670 1236 gene locus_tag LOCUS_28300 1670 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1895 2689 gene locus_tag LOCUS_28310 1895 2689 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088364.1 protein_id gnl|my_center|LOCUS_28310 4111 2831 gene locus_tag LOCUS_28320 4111 2831 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909598.1 protein_id gnl|my_center|LOCUS_28320 4962 4186 gene locus_tag LOCUS_28330 gene rfbF 4962 4186 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976066.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence256 1399 734 gene locus_tag LOCUS_28340 1399 734 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 protein_id gnl|my_center|LOCUS_28340 1661 1464 gene locus_tag LOCUS_28350 1661 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1847 1698 gene locus_tag LOCUS_28360 1847 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2963 1923 gene locus_tag LOCUS_28370 2963 1923 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402582.1 protein_id gnl|my_center|LOCUS_28370 3044 3775 gene locus_tag LOCUS_28380 3044 3775 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170044.1 protein_id gnl|my_center|LOCUS_28380 4681 3791 gene locus_tag LOCUS_28390 4681 3791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_28390 <5272 4758 gene locus_tag LOCUS_28400 <5272 4758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390648.1:thioredoxin-disulfide reductase >Feature sequence257 1419 217 gene locus_tag LOCUS_28410 1419 217 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969860.1 protein_id gnl|my_center|LOCUS_28410 2665 1505 gene locus_tag LOCUS_28420 2665 1505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_28420 3157 2693 gene locus_tag LOCUS_28430 3157 2693 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_28430 4726 3182 gene locus_tag LOCUS_28440 4726 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4827 5192 gene locus_tag LOCUS_28450 4827 5192 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence258 1022 399 gene locus_tag LOCUS_28460 1022 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1307 2551 gene locus_tag LOCUS_28470 1307 2551 CDS product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 protein_id gnl|my_center|LOCUS_28470 3731 2625 gene locus_tag LOCUS_28480 3731 2625 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_28480 4837 3800 gene locus_tag LOCUS_28490 4837 3800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence259 1063 2022 gene locus_tag LOCUS_28500 1063 2022 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533625.1 protein_id gnl|my_center|LOCUS_28500 3427 2033 gene locus_tag LOCUS_28510 3427 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 4234 3443 gene locus_tag LOCUS_28520 4234 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 5175 4234 gene locus_tag LOCUS_28530 5175 4234 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence260 14 1546 gene locus_tag LOCUS_28540 14 1546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527971.1 protein_id gnl|my_center|LOCUS_28540 1675 2682 gene locus_tag LOCUS_28550 1675 2682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527972.1 protein_id gnl|my_center|LOCUS_28550 2675 3523 gene locus_tag LOCUS_28560 2675 3523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527973.1 protein_id gnl|my_center|LOCUS_28560 3520 4350 gene locus_tag LOCUS_28570 3520 4350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527974.1 protein_id gnl|my_center|LOCUS_28570 4347 5186 gene locus_tag LOCUS_28580 4347 5186 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527975.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence261 <1 570 gene locus_tag LOCUS_28590 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262765.1:response regulator transcription factor 1949 540 gene locus_tag LOCUS_28600 1949 540 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531263.1 protein_id gnl|my_center|LOCUS_28600 3094 1946 gene locus_tag LOCUS_28610 3094 1946 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence262 1093 509 gene locus_tag LOCUS_28620 1093 509 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_28620 1685 1128 gene locus_tag LOCUS_28630 1685 1128 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_28630 2163 1783 gene locus_tag LOCUS_28640 2163 1783 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_28640 2384 2160 gene locus_tag LOCUS_28650 2384 2160 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_28650 3754 2435 gene locus_tag LOCUS_28660 gene hslU 3754 2435 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_28660 4334 3765 gene locus_tag LOCUS_28670 gene hslV 4334 3765 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 protein_id gnl|my_center|LOCUS_28670 4473 5063 gene locus_tag LOCUS_28680 gene hisB 4473 5063 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence263 215 793 gene locus_tag LOCUS_28690 gene pth 215 793 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_28690 796 1890 gene locus_tag LOCUS_28700 gene ychF 796 1890 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_28700 2163 2405 gene locus_tag LOCUS_28710 2163 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389256.1 protein_id gnl|my_center|LOCUS_28710 2477 2932 gene locus_tag LOCUS_28720 2477 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3009 3218 gene locus_tag LOCUS_28730 3009 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3292 3447 gene locus_tag LOCUS_28740 3292 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 4036 3455 gene locus_tag LOCUS_28750 4036 3455 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_28750 4804 4115 gene locus_tag LOCUS_28760 4804 4115 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039869.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence264 <1 1026 gene locus_tag LOCUS_28770 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105263.1:glycosyltransferase 2144 951 gene locus_tag LOCUS_28780 gene waaL 2144 951 CDS product O-antigen ligase WaaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114546.1 protein_id gnl|my_center|LOCUS_28780 3973 2297 gene locus_tag LOCUS_28790 3973 2297 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_28790 5172 4045 gene locus_tag LOCUS_28800 5172 4045 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538788.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence265 1261 119 gene locus_tag LOCUS_28810 1261 119 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_28810 2785 1325 gene locus_tag LOCUS_28820 2785 1325 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_28820 4041 2782 gene locus_tag LOCUS_28830 4041 2782 CDS product autotransporter strand-loop-strand O-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200982.1 protein_id gnl|my_center|LOCUS_28830 4908 4144 gene locus_tag LOCUS_28840 4908 4144 CDS product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence266 244 1122 gene locus_tag LOCUS_28850 244 1122 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_28850 1410 2327 gene locus_tag LOCUS_28860 1410 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2530 2249 gene locus_tag LOCUS_28870 2530 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2511 3644 gene locus_tag LOCUS_28880 2511 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence267 973 698 gene locus_tag LOCUS_28890 973 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1620 1072 gene locus_tag LOCUS_28900 1620 1072 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390006.1 protein_id gnl|my_center|LOCUS_28900 2839 1652 gene locus_tag LOCUS_28910 2839 1652 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191282.1 protein_id gnl|my_center|LOCUS_28910 3651 3070 gene locus_tag LOCUS_28920 3651 3070 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_28920 4005 3724 gene locus_tag LOCUS_28930 4005 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence268 988 677 gene locus_tag LOCUS_28940 988 677 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528086.1 protein_id gnl|my_center|LOCUS_28940 1368 985 gene locus_tag LOCUS_28950 gene dhaM 1368 985 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528085.1 protein_id gnl|my_center|LOCUS_28950 1970 1365 gene locus_tag LOCUS_28960 gene dhaL 1970 1365 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528084.1 protein_id gnl|my_center|LOCUS_28960 2111 2827 gene locus_tag LOCUS_28970 2111 2827 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_28970 3655 2831 gene locus_tag LOCUS_28980 3655 2831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855566.1 protein_id gnl|my_center|LOCUS_28980 4584 3655 gene locus_tag LOCUS_28990 4584 3655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391586.1 protein_id gnl|my_center|LOCUS_28990 <5098 4574 gene locus_tag LOCUS_29000 <5098 4574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064242231.1:PotD/PotF family extracellular solute-binding protein >Feature sequence269 1364 588 gene locus_tag LOCUS_29010 gene phnK 1364 588 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 protein_id gnl|my_center|LOCUS_29010 2188 1361 gene locus_tag LOCUS_29020 2188 1361 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113123.1 protein_id gnl|my_center|LOCUS_29020 3249 2185 gene locus_tag LOCUS_29030 3249 2185 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084041.1 protein_id gnl|my_center|LOCUS_29030 3824 3249 gene locus_tag LOCUS_29040 gene phnH 3824 3249 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392105.1 protein_id gnl|my_center|LOCUS_29040 4267 3821 gene locus_tag LOCUS_29050 gene phnG 4267 3821 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence270 34 126 gene locus_tag LOCUS_t00350 34 126 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 247 417 gene locus_tag LOCUS_29060 247 417 CDS product DUF2256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058110.1 protein_id gnl|my_center|LOCUS_29060 414 1934 gene locus_tag LOCUS_29070 414 1934 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_29070 2113 3681 gene locus_tag LOCUS_29080 2113 3681 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_29080 3681 4460 gene locus_tag LOCUS_29090 3681 4460 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence271 <1 910 gene locus_tag LOCUS_29100 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066917.1:sn-glycerol-1-phosphate dehydrogenase 915 1721 gene locus_tag LOCUS_29110 915 1721 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_29110 1718 3235 gene locus_tag LOCUS_29120 gene glpD 1718 3235 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066915.1 protein_id gnl|my_center|LOCUS_29120 3433 4803 gene locus_tag LOCUS_29130 3433 4803 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556162.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence272 1741 1460 gene locus_tag LOCUS_29140 gene yidD 1741 1460 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721423.1 protein_id gnl|my_center|LOCUS_29140 2127 1738 gene locus_tag LOCUS_29150 gene rnpA 2127 1738 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721421.1 protein_id gnl|my_center|LOCUS_29150 2379 2185 gene locus_tag LOCUS_29160 2379 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2547 3239 gene locus_tag LOCUS_29170 2547 3239 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338687.1 protein_id gnl|my_center|LOCUS_29170 3239 4702 gene locus_tag LOCUS_29180 3239 4702 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence273 <1 655 gene locus_tag LOCUS_29190 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390591.1:Tm-1-like ATP-binding domain-containing protein 660 1493 gene locus_tag LOCUS_29200 660 1493 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390590.1 protein_id gnl|my_center|LOCUS_29200 1490 1957 gene locus_tag LOCUS_29210 1490 1957 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_29210 1989 2903 gene locus_tag LOCUS_29220 1989 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3332 2910 gene locus_tag LOCUS_29230 3332 2910 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130469.1 protein_id gnl|my_center|LOCUS_29230 <4874 3347 gene locus_tag LOCUS_29240 <4874 3347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389457.1:DNA polymerase III subunit alpha >Feature sequence274 <1 1129 gene locus_tag LOCUS_29250 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973447.1:DSD1 family PLP-dependent enzyme 1142 1846 gene locus_tag LOCUS_29260 1142 1846 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919529.1 protein_id gnl|my_center|LOCUS_29260 2751 1843 gene locus_tag LOCUS_29270 2751 1843 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 protein_id gnl|my_center|LOCUS_29270 2845 4341 gene locus_tag LOCUS_29280 2845 4341 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086731.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence275 <1 1529 gene locus_tag LOCUS_29290 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262523.1:cytochrome-c peroxidase 1645 2826 gene locus_tag LOCUS_29300 1645 2826 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_29300 2918 4501 gene locus_tag LOCUS_29310 gene serA 2918 4501 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence276 89 1261 gene locus_tag LOCUS_29320 89 1261 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_29320 1939 1331 gene locus_tag LOCUS_29330 1939 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2592 2062 gene locus_tag LOCUS_29340 2592 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3512 2721 gene locus_tag LOCUS_29350 3512 2721 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_29350 <4803 3528 gene locus_tag LOCUS_29360 <4803 3528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence277 102 599 gene locus_tag LOCUS_29370 102 599 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_29370 1090 617 gene locus_tag LOCUS_29380 1090 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2749 1202 gene locus_tag LOCUS_29390 gene lnt 2749 1202 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_29390 3708 2743 gene locus_tag LOCUS_29400 3708 2743 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207240953.1 protein_id gnl|my_center|LOCUS_29400 4563 3715 gene locus_tag LOCUS_29410 4563 3715 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence278 1307 2623 gene locus_tag LOCUS_29420 1307 2623 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410113.1 protein_id gnl|my_center|LOCUS_29420 3328 2627 gene locus_tag LOCUS_29430 3328 2627 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528376.1 protein_id gnl|my_center|LOCUS_29430 4461 3325 gene locus_tag LOCUS_29440 4461 3325 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence279 <1 1424 gene locus_tag LOCUS_29450 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083135.1:HAMP domain-containing histidine kinase 3135 1447 gene locus_tag LOCUS_29460 3135 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence280 1512 721 gene locus_tag LOCUS_29470 1512 721 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142830.1 protein_id gnl|my_center|LOCUS_29470 2075 2830 gene locus_tag LOCUS_29480 2075 2830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175307.1 protein_id gnl|my_center|LOCUS_29480 2817 4241 gene locus_tag LOCUS_29490 2817 4241 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083135.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence281 1243 461 gene locus_tag LOCUS_29500 1243 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2073 1240 gene locus_tag LOCUS_29510 2073 1240 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_29510 2227 2646 gene locus_tag LOCUS_29520 gene arfB 2227 2646 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_29520 2759 3121 gene locus_tag LOCUS_29530 2759 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3236 4012 gene locus_tag LOCUS_29540 3236 4012 CDS product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence282 1072 2223 gene locus_tag LOCUS_29550 1072 2223 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_29550 2254 3843 gene locus_tag LOCUS_29560 2254 3843 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_29560 3884 4204 gene locus_tag LOCUS_29570 3884 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence283 1893 298 gene locus_tag LOCUS_29580 1893 298 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086825.1 protein_id gnl|my_center|LOCUS_29580 2919 2170 gene locus_tag LOCUS_29590 2919 2170 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397749.1 protein_id gnl|my_center|LOCUS_29590 3837 2998 gene locus_tag LOCUS_29600 3837 2998 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040692.1 protein_id gnl|my_center|LOCUS_29600 <4607 3834 gene locus_tag LOCUS_29610 <4607 3834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391118.1:NADPH:quinone oxidoreductase family protein >Feature sequence284 <1 1552 gene locus_tag LOCUS_29620 <1 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003533499.1:preprotein translocase subunit SecA 3531 1657 gene locus_tag LOCUS_29630 3531 1657 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_29630 3642 4550 gene locus_tag LOCUS_29640 3642 4550 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089553.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence285 228 1646 gene locus_tag LOCUS_29650 228 1646 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088903.1 protein_id gnl|my_center|LOCUS_29650 4320 1651 gene locus_tag LOCUS_29660 gene ppdK 4320 1651 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence286 825 268 gene locus_tag LOCUS_29670 825 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3264 853 gene locus_tag LOCUS_29680 3264 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 <4593 3408 gene locus_tag LOCUS_29690 <4593 3408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198019.1:ammonium transporter >Feature sequence287 <1 908 gene locus_tag LOCUS_29700 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994102.1:cellulose biosynthesis protein BcsC 1579 914 gene locus_tag LOCUS_29710 gene ccmB 1579 914 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_29710 2163 1576 gene locus_tag LOCUS_29720 gene ccmA 2163 1576 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence288 145 906 gene locus_tag LOCUS_29730 145 906 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_29730 965 1531 gene locus_tag LOCUS_29740 965 1531 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189415.1 protein_id gnl|my_center|LOCUS_29740 1785 1489 gene locus_tag LOCUS_29750 1785 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 2308 2021 gene locus_tag LOCUS_29760 2308 2021 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199503.1 protein_id gnl|my_center|LOCUS_29760 2455 2982 gene locus_tag LOCUS_29770 2455 2982 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29770 3077 4093 gene locus_tag LOCUS_29780 gene cobS 3077 4093 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence289 4281 2731 gene locus_tag LOCUS_29790 4281 2731 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398027.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence290 1315 518 gene locus_tag LOCUS_29800 1315 518 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_29800 2529 1312 gene locus_tag LOCUS_29810 2529 1312 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727455.1 protein_id gnl|my_center|LOCUS_29810 3857 2526 gene locus_tag LOCUS_29820 3857 2526 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_29820 4284 3892 gene locus_tag LOCUS_29830 4284 3892 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence291 <1 1157 gene locus_tag LOCUS_29840 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085426.1:MFS transporter 2344 1130 gene locus_tag LOCUS_29850 2344 1130 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926799.1 protein_id gnl|my_center|LOCUS_29850 2516 3142 gene locus_tag LOCUS_29860 2516 3142 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529467.1 protein_id gnl|my_center|LOCUS_29860 3459 3163 gene locus_tag LOCUS_29870 3459 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3946 4191 gene locus_tag LOCUS_29880 3946 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence292 27 2291 gene locus_tag LOCUS_29890 27 2291 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244080.1 protein_id gnl|my_center|LOCUS_29890 2312 3067 gene locus_tag LOCUS_29900 2312 3067 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392147.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence293 336 25 gene locus_tag LOCUS_29910 gene nuoK 336 25 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_29910 1036 338 gene locus_tag LOCUS_29920 1036 338 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_29920 1580 1092 gene locus_tag LOCUS_29930 gene nuoI 1580 1092 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_29930 2638 1622 gene locus_tag LOCUS_29940 gene nuoH 2638 1622 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_29940 <4387 2643 gene locus_tag LOCUS_29950 <4387 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389436.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence294 250 1359 gene locus_tag LOCUS_29960 250 1359 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331258.1 protein_id gnl|my_center|LOCUS_29960 2608 1445 gene locus_tag LOCUS_29970 2608 1445 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_29970 2692 3924 gene locus_tag LOCUS_29980 2692 3924 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence295 165 920 gene locus_tag LOCUS_29990 165 920 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385012.1 protein_id gnl|my_center|LOCUS_29990 980 1789 gene locus_tag LOCUS_30000 980 1789 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_30000 1867 3513 gene locus_tag LOCUS_30010 1867 3513 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_30010 3529 3789 gene locus_tag LOCUS_30020 3529 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence296 <1 1000 gene locus_tag LOCUS_30030 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390687.1:asparagine synthase (glutamine-hydrolyzing) 1796 1065 gene locus_tag LOCUS_30040 gene lexA 1796 1065 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528303.1 protein_id gnl|my_center|LOCUS_30040 2315 3760 gene locus_tag LOCUS_30050 2315 3760 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence297 1415 594 gene locus_tag LOCUS_30060 1415 594 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382858.1 protein_id gnl|my_center|LOCUS_30060 2263 1412 gene locus_tag LOCUS_30070 2263 1412 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550807.1 protein_id gnl|my_center|LOCUS_30070 2229 2408 gene locus_tag LOCUS_30080 2229 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3670 2396 gene locus_tag LOCUS_30090 3670 2396 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257469.1 protein_id gnl|my_center|LOCUS_30090 <4337 3764 gene locus_tag LOCUS_30100 <4337 3764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528410.1:sugar-binding transcriptional regulator >Feature sequence298 <1 1191 gene locus_tag LOCUS_30110 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase 1191 1775 gene locus_tag LOCUS_30120 1191 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1772 1975 gene locus_tag LOCUS_30130 1772 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 2022 2969 gene locus_tag LOCUS_30140 2022 2969 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_30140 4207 2966 gene locus_tag LOCUS_30150 4207 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence299 162 905 gene locus_tag LOCUS_30160 162 905 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_30160 1051 902 gene locus_tag LOCUS_30170 1051 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2340 1144 gene locus_tag LOCUS_30180 2340 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3528 2425 gene locus_tag LOCUS_30190 gene aroC 3528 2425 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_30190 <4314 3531 gene locus_tag LOCUS_30200 <4314 3531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383908.1:enoyl-ACP reductase FabI >Feature sequence300 1267 146 gene locus_tag LOCUS_30210 1267 146 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_30210 1368 2177 gene locus_tag LOCUS_30220 1368 2177 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393770.1 protein_id gnl|my_center|LOCUS_30220 3125 2190 gene locus_tag LOCUS_30230 3125 2190 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_30230 <4286 3168 gene locus_tag LOCUS_30240 <4286 3168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086815.1:ABC transporter substrate-binding protein >Feature sequence301 699 1598 gene locus_tag LOCUS_30250 699 1598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_30250 1926 1636 gene locus_tag LOCUS_30260 1926 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2121 3884 gene locus_tag LOCUS_30270 2121 3884 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence302 375 1862 gene locus_tag LOCUS_30280 375 1862 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338248.1 protein_id gnl|my_center|LOCUS_30280 1895 2761 gene locus_tag LOCUS_30290 1895 2761 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_30290 2773 3252 gene locus_tag LOCUS_30300 2773 3252 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366740.1 protein_id gnl|my_center|LOCUS_30300 3298 3999 gene locus_tag LOCUS_30310 3298 3999 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086661.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence303 2077 1250 gene locus_tag LOCUS_30320 gene coxB 2077 1250 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_30320 2907 2236 gene locus_tag LOCUS_30330 2907 2236 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_30330 3224 3018 gene locus_tag LOCUS_30340 3224 3018 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383667.1 protein_id gnl|my_center|LOCUS_30340 4038 3484 gene locus_tag LOCUS_30350 4038 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence304 101 1525 gene locus_tag LOCUS_30360 101 1525 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398926.1 protein_id gnl|my_center|LOCUS_30360 1584 2528 gene locus_tag LOCUS_30370 1584 2528 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975228.1 protein_id gnl|my_center|LOCUS_30370 2539 3240 gene locus_tag LOCUS_30380 2539 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence305 <1 821 gene locus_tag LOCUS_30390 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112997.1:acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit 1997 831 gene locus_tag LOCUS_30400 1997 831 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_30400 2152 3084 gene locus_tag LOCUS_30410 gene puuE 2152 3084 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_30410 <3963 3290 gene locus_tag LOCUS_30420 <3963 3290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969919.1:SDR family oxidoreductase >Feature sequence306 <1 828 gene locus_tag LOCUS_30430 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533064.1:four-carbon acid sugar kinase family protein 921 1862 gene locus_tag LOCUS_30440 921 1862 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969406.1 protein_id gnl|my_center|LOCUS_30440 1877 2584 gene locus_tag LOCUS_30450 1877 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence307 325 158 gene locus_tag LOCUS_30460 325 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 252 1790 gene locus_tag LOCUS_30470 252 1790 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809544.1 protein_id gnl|my_center|LOCUS_30470 1811 2497 gene locus_tag LOCUS_30480 1811 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3222 2464 gene locus_tag LOCUS_30490 gene eutC 3222 2464 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195860.1 protein_id gnl|my_center|LOCUS_30490 3902 3219 gene locus_tag LOCUS_30500 3902 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence308 1019 537 gene locus_tag LOCUS_30510 1019 537 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_30510 1212 1838 gene locus_tag LOCUS_30520 1212 1838 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_30520 2691 1843 gene locus_tag LOCUS_30530 2691 1843 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_30530 3815 2694 gene locus_tag LOCUS_30540 3815 2694 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence309 <1 687 gene locus_tag LOCUS_30550 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390050.1:DegQ family serine endoprotease 716 2137 gene locus_tag LOCUS_30560 716 2137 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 protein_id gnl|my_center|LOCUS_30560 2256 3698 gene locus_tag LOCUS_30570 2256 3698 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976144.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence310 229 831 gene locus_tag LOCUS_30580 229 831 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_30580 1679 840 gene locus_tag LOCUS_30590 1679 840 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_30590 2457 1735 gene locus_tag LOCUS_30600 gene phbB 2457 1735 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_30600 2993 2601 gene locus_tag LOCUS_30610 2993 2601 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_30610 3214 2990 gene locus_tag LOCUS_30620 3214 2990 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_30620 <3844 3263 gene locus_tag LOCUS_30630 <3844 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083473.1:ATP-dependent protease ATPase subunit HslU >Feature sequence311 1570 782 gene locus_tag LOCUS_30640 1570 782 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_30640 2361 1567 gene locus_tag LOCUS_30650 2361 1567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_30650 3455 2349 gene locus_tag LOCUS_30660 gene alr 3455 2349 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_30660 3801 3433 gene locus_tag LOCUS_30670 3801 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence312 <1 1083 gene locus_tag LOCUS_30680 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394575.1:type II secretion system secretin GspD 1080 1913 gene locus_tag LOCUS_30690 1080 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2386 1937 gene locus_tag LOCUS_30700 gene gspG 2386 1937 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_30700 2534 2938 gene locus_tag LOCUS_30710 2534 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3590 2982 gene locus_tag LOCUS_30720 3590 2982 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence313 <1 627 gene locus_tag LOCUS_30730 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388966.1:ADP-forming succinate--CoA ligase subunit beta 627 1502 gene locus_tag LOCUS_30740 gene sucD 627 1502 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence314 461 2605 gene locus_tag LOCUS_30750 461 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 <3695 2616 gene locus_tag LOCUS_30760 <3695 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921467.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence315 1840 668 gene locus_tag LOCUS_30770 gene dgoD 1840 668 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_30770 1958 2830 gene locus_tag LOCUS_30780 1958 2830 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence316 527 69 gene locus_tag LOCUS_30790 527 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 820 524 gene locus_tag LOCUS_30800 820 524 CDS product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 protein_id gnl|my_center|LOCUS_30800 1636 956 gene locus_tag LOCUS_30810 1636 956 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_30810 2241 1636 gene locus_tag LOCUS_30820 2241 1636 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_30820 2427 2915 gene locus_tag LOCUS_30830 gene folK 2427 2915 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence317 507 884 gene locus_tag LOCUS_30840 gene gcvH 507 884 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence318 >Feature sequence319 1313 849 gene locus_tag LOCUS_30850 1313 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2792 1344 gene locus_tag LOCUS_30860 2792 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence320 <1 530 gene locus_tag LOCUS_30870 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388844.1:Holliday junction branch migration DNA helicase RuvB 548 976 gene locus_tag LOCUS_30880 548 976 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_30880 998 1714 gene locus_tag LOCUS_30890 gene tolQ 998 1714 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388846.1 protein_id gnl|my_center|LOCUS_30890 1741 2244 gene locus_tag LOCUS_30900 gene tolR 1741 2244 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence321 1718 1643 gene locus_tag LOCUS_t00360 1718 1643 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1902 2234 gene locus_tag LOCUS_30910 1902 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2234 2533 gene locus_tag LOCUS_30920 2234 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence322 862 608 gene locus_tag LOCUS_30930 862 608 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626599.1 protein_id gnl|my_center|LOCUS_30930 1063 2142 gene locus_tag LOCUS_30940 1063 2142 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331274.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence323 <1647 1084 gene locus_tag LOCUS_30950 <1647 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975498.1:thermonuclease family protein