>Feature sequence001 3284 246 gene locus_tag LOCUS_00010 3284 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4599 3616 gene locus_tag LOCUS_00020 4599 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5804 4590 gene locus_tag LOCUS_00030 5804 4590 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_00030 6896 5991 gene locus_tag LOCUS_00040 6896 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7647 6916 gene locus_tag LOCUS_00050 7647 6916 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_00050 8819 7749 gene locus_tag LOCUS_00060 8819 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9872 9066 gene locus_tag LOCUS_00070 9872 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10587 9865 gene locus_tag LOCUS_00080 10587 9865 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546324.1 protein_id gnl|my_center|LOCUS_00080 11582 10584 gene locus_tag LOCUS_00090 11582 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12983 11997 gene locus_tag LOCUS_00100 12983 11997 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_00100 13379 13056 gene locus_tag LOCUS_00110 13379 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13989 13525 gene locus_tag LOCUS_00120 13989 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14762 14085 gene locus_tag LOCUS_00130 gene bioD 14762 14085 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_00130 15783 14905 gene locus_tag LOCUS_00140 gene bioC 15783 14905 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957596.1 protein_id gnl|my_center|LOCUS_00140 16540 15776 gene locus_tag LOCUS_00150 gene bioH 16540 15776 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_00150 17700 16537 gene locus_tag LOCUS_00160 gene bioF 17700 16537 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_00160 18739 17741 gene locus_tag LOCUS_00170 gene bioB 18739 17741 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_00170 19133 18732 gene locus_tag LOCUS_00180 19133 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19769 20149 gene locus_tag LOCUS_00190 19769 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20214 20678 gene locus_tag LOCUS_00200 gene trmL 20214 20678 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_00200 21737 20754 gene locus_tag LOCUS_00210 21737 20754 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_00210 22210 21734 gene locus_tag LOCUS_00220 22210 21734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22676 22215 gene locus_tag LOCUS_00230 gene secB 22676 22215 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_00230 23142 22723 gene locus_tag LOCUS_00240 gene trxC 23142 22723 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816952.1 protein_id gnl|my_center|LOCUS_00240 23416 23159 gene locus_tag LOCUS_00250 gene grxC 23416 23159 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_00250 23826 23419 gene locus_tag LOCUS_00260 23826 23419 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198006.1 protein_id gnl|my_center|LOCUS_00260 23956 24186 gene locus_tag LOCUS_00270 23956 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24450 24229 gene locus_tag LOCUS_00280 24450 24229 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_00280 27968 24501 gene locus_tag LOCUS_00290 27968 24501 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933702.1 protein_id gnl|my_center|LOCUS_00290 29064 27961 gene locus_tag LOCUS_00300 29064 27961 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_00300 30467 29073 gene locus_tag LOCUS_00310 30467 29073 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933704.1 protein_id gnl|my_center|LOCUS_00310 31040 30723 gene locus_tag LOCUS_00320 31040 30723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31157 32695 gene locus_tag LOCUS_00330 gene gpmI 31157 32695 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_00330 32695 33873 gene locus_tag LOCUS_00340 32695 33873 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_00340 33910 35322 gene locus_tag LOCUS_00350 gene cptA 33910 35322 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_00350 35325 36089 gene locus_tag LOCUS_00360 gene moeB 35325 36089 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 protein_id gnl|my_center|LOCUS_00360 36779 36204 gene locus_tag LOCUS_00370 gene slmA 36779 36204 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_00370 38324 36834 gene locus_tag LOCUS_00380 gene lpdA 38324 36834 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880444.1 protein_id gnl|my_center|LOCUS_00380 38814 38458 gene locus_tag LOCUS_00390 38814 38458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40238 38847 gene locus_tag LOCUS_00400 gene cobB 40238 38847 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_00400 41651 40473 gene locus_tag LOCUS_00410 41651 40473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42394 41657 gene locus_tag LOCUS_00420 gene hmeA 42394 41657 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_00420 42903 42391 gene locus_tag LOCUS_00430 42903 42391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44915 42906 gene locus_tag LOCUS_00440 44915 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46527 44977 gene locus_tag LOCUS_00450 46527 44977 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_00450 47315 46575 gene locus_tag LOCUS_00460 gene dsrM 47315 46575 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_00460 47795 47463 gene locus_tag LOCUS_00470 47795 47463 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_00470 48136 47837 gene locus_tag LOCUS_00480 gene tusB 48136 47837 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_00480 48560 48153 gene locus_tag LOCUS_00490 gene tusC 48560 48153 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_00490 48932 48573 gene locus_tag LOCUS_00500 gene tusD 48932 48573 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_00500 50080 49010 gene locus_tag LOCUS_00510 gene dsrB 50080 49010 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_00510 51491 50193 gene locus_tag LOCUS_00520 gene dsrA 51491 50193 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_00520 52004 52234 gene locus_tag LOCUS_00530 52004 52234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52255 52872 gene locus_tag LOCUS_00540 52255 52872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 52924 53253 gene locus_tag LOCUS_00550 gene tusE 52924 53253 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904439.1 protein_id gnl|my_center|LOCUS_00550 53281 54192 gene locus_tag LOCUS_00560 53281 54192 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_00560 54194 54772 gene locus_tag LOCUS_00570 54194 54772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57646 54851 gene locus_tag LOCUS_00580 gene ppdK 57646 54851 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_00580 61522 57824 gene locus_tag LOCUS_00590 gene metH 61522 57824 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_00590 61656 62447 gene locus_tag LOCUS_00600 61656 62447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 63348 62461 gene locus_tag LOCUS_00610 gene cysM 63348 62461 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550116.1 protein_id gnl|my_center|LOCUS_00610 63786 65063 gene locus_tag LOCUS_00620 63786 65063 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545007.1 protein_id gnl|my_center|LOCUS_00620 65090 65479 gene locus_tag LOCUS_00630 65090 65479 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546829.1 protein_id gnl|my_center|LOCUS_00630 65774 65538 gene locus_tag LOCUS_00640 65774 65538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65833 67659 gene locus_tag LOCUS_00650 65833 67659 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545814.1 protein_id gnl|my_center|LOCUS_00650 67676 68188 gene locus_tag LOCUS_00660 67676 68188 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_00660 68881 70146 gene locus_tag LOCUS_00670 68881 70146 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_00670 70258 74022 gene locus_tag LOCUS_00680 70258 74022 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791698.1 protein_id gnl|my_center|LOCUS_00680 74181 75155 gene locus_tag LOCUS_00690 74181 75155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75148 76197 gene locus_tag LOCUS_00700 75148 76197 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 protein_id gnl|my_center|LOCUS_00700 76216 77088 gene locus_tag LOCUS_00710 76216 77088 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_00710 77097 77501 gene locus_tag LOCUS_00720 77097 77501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77504 78652 gene locus_tag LOCUS_00730 77504 78652 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_00730 80299 78806 gene locus_tag LOCUS_00740 80299 78806 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 protein_id gnl|my_center|LOCUS_00740 80625 80341 gene locus_tag LOCUS_00750 80625 80341 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030003521.1 protein_id gnl|my_center|LOCUS_00750 80870 81697 gene locus_tag LOCUS_00760 80870 81697 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_00760 81718 82056 gene locus_tag LOCUS_00770 81718 82056 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_00770 82072 83487 gene locus_tag LOCUS_00780 82072 83487 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526016.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence002 730 344 gene locus_tag LOCUS_00790 730 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 799 1290 gene locus_tag LOCUS_00800 799 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 1578 1751 gene locus_tag LOCUS_00810 1578 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 5126 1815 gene locus_tag LOCUS_00820 gene addA 5126 1815 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982184.1 protein_id gnl|my_center|LOCUS_00820 8128 5270 gene locus_tag LOCUS_00830 8128 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8362 8688 gene locus_tag LOCUS_00840 gene trxA 8362 8688 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_00840 8857 10086 gene locus_tag LOCUS_00850 gene rho 8857 10086 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_00850 10184 10387 gene locus_tag LOCUS_00860 gene rpmE 10184 10387 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946387.1 protein_id gnl|my_center|LOCUS_00860 10618 12234 gene locus_tag LOCUS_00870 10618 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196441.1 protein_id gnl|my_center|LOCUS_00870 13148 12240 gene locus_tag LOCUS_00880 13148 12240 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_00880 13598 13203 gene locus_tag LOCUS_00890 13598 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 14356 14042 gene locus_tag LOCUS_00900 14356 14042 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_00900 14563 14405 gene locus_tag LOCUS_00910 14563 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 14758 14916 gene locus_tag LOCUS_00920 14758 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 15322 15534 gene locus_tag LOCUS_00930 15322 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 16531 15689 gene locus_tag LOCUS_00940 16531 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18282 16528 gene locus_tag LOCUS_00950 18282 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 19205 18375 gene locus_tag LOCUS_00960 19205 18375 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_00960 19865 19332 gene locus_tag LOCUS_00970 19865 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 21237 20380 gene locus_tag LOCUS_00980 21237 20380 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_00980 21398 21853 gene locus_tag LOCUS_00990 21398 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 21972 22631 gene locus_tag LOCUS_01000 21972 22631 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_01000 22568 22807 gene locus_tag LOCUS_01010 22568 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 22911 23225 gene locus_tag LOCUS_01020 22911 23225 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_01020 23327 24274 gene locus_tag LOCUS_01030 23327 24274 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 protein_id gnl|my_center|LOCUS_01030 24567 25637 gene locus_tag LOCUS_01040 24567 25637 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_01040 25838 26197 gene locus_tag LOCUS_01050 25838 26197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 26329 26081 gene locus_tag LOCUS_01060 26329 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 26300 26890 gene locus_tag LOCUS_01070 26300 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 27055 28128 gene locus_tag LOCUS_01080 27055 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 28279 28434 gene locus_tag LOCUS_01090 28279 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 28499 28720 gene locus_tag LOCUS_01100 28499 28720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 29621 28746 gene locus_tag LOCUS_01110 29621 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 31110 29716 gene locus_tag LOCUS_01120 31110 29716 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039558.1 protein_id gnl|my_center|LOCUS_01120 31379 31591 gene locus_tag LOCUS_01130 31379 31591 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_01130 31604 32278 gene locus_tag LOCUS_01140 31604 32278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 32333 32548 gene locus_tag LOCUS_01150 32333 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 32759 33571 gene locus_tag LOCUS_01160 32759 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 33678 34127 gene locus_tag LOCUS_01170 33678 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 34221 34835 gene locus_tag LOCUS_01180 gene mobA 34221 34835 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192903.1 protein_id gnl|my_center|LOCUS_01180 34901 36139 gene locus_tag LOCUS_01190 34901 36139 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_01190 37138 36185 gene locus_tag LOCUS_01200 37138 36185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 37476 37646 gene locus_tag LOCUS_01210 37476 37646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 38963 37725 gene locus_tag LOCUS_01220 gene icd 38963 37725 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_01220 38997 39542 gene locus_tag LOCUS_01230 38997 39542 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_01230 39663 39875 gene locus_tag LOCUS_01240 39663 39875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 40449 39979 gene locus_tag LOCUS_01250 40449 39979 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_01250 42748 40436 gene locus_tag LOCUS_01260 42748 40436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_01260 43183 43380 gene locus_tag LOCUS_01270 43183 43380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 43361 45997 gene locus_tag LOCUS_01280 gene cphA 43361 45997 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_01280 46041 48611 gene locus_tag LOCUS_01290 gene cphA 46041 48611 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_01290 49369 48713 gene locus_tag LOCUS_01300 gene queE 49369 48713 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_01300 50294 49353 gene locus_tag LOCUS_01310 gene ybgF 50294 49353 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_01310 50823 50305 gene locus_tag LOCUS_01320 gene pal 50823 50305 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_01320 52176 50848 gene locus_tag LOCUS_01330 gene tolB 52176 50848 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_01330 52995 52180 gene locus_tag LOCUS_01340 52995 52180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 53408 52992 gene locus_tag LOCUS_01350 gene tolR 53408 52992 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_01350 54088 53408 gene locus_tag LOCUS_01360 gene tolQ 54088 53408 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_01360 54552 54085 gene locus_tag LOCUS_01370 gene ybgC 54552 54085 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_01370 55648 54593 gene locus_tag LOCUS_01380 gene ruvB 55648 54593 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_01380 56452 55868 gene locus_tag LOCUS_01390 gene ruvA 56452 55868 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_01390 57047 56559 gene locus_tag LOCUS_01400 gene ruvC 57047 56559 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_01400 57828 57100 gene locus_tag LOCUS_01410 57828 57100 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_01410 59180 58020 gene locus_tag LOCUS_01420 gene clsB 59180 58020 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_01420 59929 59180 gene locus_tag LOCUS_01430 59929 59180 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704807.1 protein_id gnl|my_center|LOCUS_01430 61132 60038 gene locus_tag LOCUS_01440 gene nadA 61132 60038 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_01440 61778 61329 gene locus_tag LOCUS_01450 gene nudB 61778 61329 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_01450 63603 61807 gene locus_tag LOCUS_01460 gene aspS 63603 61807 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_01460 64446 63823 gene locus_tag LOCUS_01470 64446 63823 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_01470 64638 64447 gene locus_tag LOCUS_01480 64638 64447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 64886 65881 gene locus_tag LOCUS_01490 64886 65881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 protein_id gnl|my_center|LOCUS_01490 65968 66204 gene locus_tag LOCUS_01500 65968 66204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence003 554 1336 gene locus_tag LOCUS_01510 554 1336 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_01510 1521 2465 gene locus_tag LOCUS_01520 gene gshB 1521 2465 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_01520 2453 3625 gene locus_tag LOCUS_01530 2453 3625 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191102.1 protein_id gnl|my_center|LOCUS_01530 3680 4087 gene locus_tag LOCUS_01540 3680 4087 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_01540 4074 4343 gene locus_tag LOCUS_01550 4074 4343 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_01550 4387 6099 gene locus_tag LOCUS_01560 gene ptsP 4387 6099 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_01560 6393 7535 gene locus_tag LOCUS_01570 6393 7535 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_01570 7532 8116 gene locus_tag LOCUS_01580 gene metW 7532 8116 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_01580 8872 8156 gene locus_tag LOCUS_01590 8872 8156 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 protein_id gnl|my_center|LOCUS_01590 8936 10189 gene locus_tag LOCUS_01600 8936 10189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_01600 11030 11209 gene locus_tag LOCUS_01610 11030 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 11503 11267 gene locus_tag LOCUS_01620 11503 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12432 11704 gene locus_tag LOCUS_01630 12432 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 14004 12436 gene locus_tag LOCUS_01640 14004 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 14464 14799 gene locus_tag LOCUS_01650 14464 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14812 15558 gene locus_tag LOCUS_01660 14812 15558 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_01660 16379 15555 gene locus_tag LOCUS_01670 16379 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 20288 16443 gene locus_tag LOCUS_01680 20288 16443 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891879.1 protein_id gnl|my_center|LOCUS_01680 20578 20357 gene locus_tag LOCUS_01690 20578 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 20799 21830 gene locus_tag LOCUS_01700 20799 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 22273 21827 gene locus_tag LOCUS_01710 22273 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 22709 22281 gene locus_tag LOCUS_01720 22709 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 23566 22916 gene locus_tag LOCUS_01730 23566 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 24611 23832 gene locus_tag LOCUS_01740 24611 23832 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_01740 24641 25288 gene locus_tag LOCUS_01750 gene pyrE 24641 25288 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_01750 25304 25924 gene locus_tag LOCUS_01760 25304 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 27481 25967 gene locus_tag LOCUS_01770 gene gatB 27481 25967 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_01770 29085 27559 gene locus_tag LOCUS_01780 gene gatA 29085 27559 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_01780 29386 29099 gene locus_tag LOCUS_01790 gene gatC 29386 29099 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_01790 29523 30569 gene locus_tag LOCUS_01800 29523 30569 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_01800 30665 31567 gene locus_tag LOCUS_01810 gene mreC 30665 31567 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_01810 31572 32105 gene locus_tag LOCUS_01820 gene mreD 31572 32105 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_01820 32221 34122 gene locus_tag LOCUS_01830 gene mrdA 32221 34122 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_01830 34115 35221 gene locus_tag LOCUS_01840 gene rodA 34115 35221 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_01840 35315 36214 gene locus_tag LOCUS_01850 35315 36214 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_01850 36231 37373 gene locus_tag LOCUS_01860 36231 37373 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_01860 37528 38379 gene locus_tag LOCUS_01870 37528 38379 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_01870 38381 38647 gene locus_tag LOCUS_01880 38381 38647 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_01880 38661 39329 gene locus_tag LOCUS_01890 gene lipB 38661 39329 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_01890 39415 40347 gene locus_tag LOCUS_01900 gene lipA 39415 40347 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 protein_id gnl|my_center|LOCUS_01900 40352 42334 gene locus_tag LOCUS_01910 40352 42334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01910 42325 43257 gene locus_tag LOCUS_01920 42325 43257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01920 43616 43374 gene locus_tag LOCUS_01930 43616 43374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 44249 43953 gene locus_tag LOCUS_01940 44249 43953 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_01940 44854 44246 gene locus_tag LOCUS_01950 44854 44246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_01950 45283 45032 gene locus_tag LOCUS_01960 45283 45032 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 protein_id gnl|my_center|LOCUS_01960 46517 45318 gene locus_tag LOCUS_01970 46517 45318 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_01970 47912 46833 gene locus_tag LOCUS_01980 47912 46833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 48705 48157 gene locus_tag LOCUS_01990 48705 48157 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_01990 48777 50825 gene locus_tag LOCUS_02000 48777 50825 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_02000 51120 51647 gene locus_tag LOCUS_02010 51120 51647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 51644 52183 gene locus_tag LOCUS_02020 51644 52183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 52191 52952 gene locus_tag LOCUS_02030 gene xth 52191 52952 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193531.1 protein_id gnl|my_center|LOCUS_02030 54394 52994 gene locus_tag LOCUS_02040 gene ntrC 54394 52994 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_02040 55494 54391 gene locus_tag LOCUS_02050 gene glnL 55494 54391 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_02050 55966 55517 gene locus_tag LOCUS_02060 55966 55517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 57490 56081 gene locus_tag LOCUS_02070 gene glnA 57490 56081 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_02070 58911 57736 gene locus_tag LOCUS_02080 58911 57736 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525685.1 protein_id gnl|my_center|LOCUS_02080 59014 59832 gene locus_tag LOCUS_02090 gene aroE 59014 59832 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089132.1 protein_id gnl|my_center|LOCUS_02090 59938 60636 gene locus_tag LOCUS_02100 gene mtgA 59938 60636 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_02100 61233 62675 gene locus_tag LOCUS_02110 gene mgtE 61233 62675 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_02110 62684 63343 gene locus_tag LOCUS_02120 62684 63343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 63470 63901 gene locus_tag LOCUS_02130 63470 63901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence004 <1 526 gene locus_tag LOCUS_02140 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087828.1:uracil-DNA glycosylase 535 720 gene locus_tag LOCUS_02150 535 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 915 3149 gene locus_tag LOCUS_02160 915 3149 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_02160 3176 4816 gene locus_tag LOCUS_02170 3176 4816 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770005.1 protein_id gnl|my_center|LOCUS_02170 4828 5376 gene locus_tag LOCUS_02180 4828 5376 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_02180 5661 6467 gene locus_tag LOCUS_02190 5661 6467 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 protein_id gnl|my_center|LOCUS_02190 6464 7015 gene locus_tag LOCUS_02200 gene cheD 6464 7015 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_02200 7109 8176 gene locus_tag LOCUS_02210 7109 8176 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_02210 8201 8650 gene locus_tag LOCUS_02220 8201 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 8669 9529 gene locus_tag LOCUS_02230 8669 9529 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_02230 9522 12254 gene locus_tag LOCUS_02240 9522 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13163 12852 gene locus_tag LOCUS_02250 13163 12852 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814611.1 protein_id gnl|my_center|LOCUS_02250 13360 13160 gene locus_tag LOCUS_02260 13360 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14901 13465 gene locus_tag LOCUS_02270 14901 13465 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_02270 16011 15034 gene locus_tag LOCUS_02280 gene cobD 16011 15034 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_02280 16915 16004 gene locus_tag LOCUS_02290 gene cbiB 16915 16004 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_02290 17727 16933 gene locus_tag LOCUS_02300 17727 16933 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_02300 18510 17899 gene locus_tag LOCUS_02310 18510 17899 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_02310 19561 18503 gene locus_tag LOCUS_02320 gene cobT 19561 18503 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_02320 20073 19558 gene locus_tag LOCUS_02330 gene cobU 20073 19558 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_02330 21782 20154 gene locus_tag LOCUS_02340 21782 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22173 21775 gene locus_tag LOCUS_02350 22173 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02350 22916 22170 gene locus_tag LOCUS_02360 22916 22170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 23844 23068 gene locus_tag LOCUS_02370 gene cobI 23844 23068 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_02370 25211 23847 gene locus_tag LOCUS_02380 25211 23847 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_02380 25470 25213 gene locus_tag LOCUS_02390 25470 25213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 26609 25467 gene locus_tag LOCUS_02400 26609 25467 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_02400 27775 27101 gene locus_tag LOCUS_02410 gene cbiC 27775 27101 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_02410 28640 27786 gene locus_tag LOCUS_02420 28640 27786 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_02420 30039 28687 gene locus_tag LOCUS_02430 gene cbpB 30039 28687 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_02430 30185 30036 gene locus_tag LOCUS_02440 30185 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 31016 30231 gene locus_tag LOCUS_02450 gene cobM 31016 30231 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_02450 31675 31019 gene locus_tag LOCUS_02460 31675 31019 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086058.1 protein_id gnl|my_center|LOCUS_02460 33178 31892 gene locus_tag LOCUS_02470 33178 31892 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 protein_id gnl|my_center|LOCUS_02470 33780 33178 gene locus_tag LOCUS_02480 gene cobO 33780 33178 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_02480 34415 33846 gene locus_tag LOCUS_02490 34415 33846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_02490 36430 34505 gene locus_tag LOCUS_02500 36430 34505 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_02500 36961 38046 gene locus_tag LOCUS_02510 gene rfaQ 36961 38046 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_02510 38039 39238 gene locus_tag LOCUS_02520 38039 39238 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094900.1 protein_id gnl|my_center|LOCUS_02520 39249 41066 gene locus_tag LOCUS_02530 gene msbA 39249 41066 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_02530 41071 42180 gene locus_tag LOCUS_02540 41071 42180 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_02540 42768 44789 gene locus_tag LOCUS_02550 gene ligA 42768 44789 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_02550 44786 45658 gene locus_tag LOCUS_02560 gene galU 44786 45658 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_02560 45655 46203 gene locus_tag LOCUS_02570 45655 46203 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194377.1 protein_id gnl|my_center|LOCUS_02570 46243 46608 gene locus_tag LOCUS_02580 46243 46608 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_02580 46677 47423 gene locus_tag LOCUS_02590 46677 47423 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268329.1 protein_id gnl|my_center|LOCUS_02590 47404 47946 gene locus_tag LOCUS_02600 gene def 47404 47946 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_02600 48203 49678 gene locus_tag LOCUS_02610 48203 49678 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_02610 49765 50145 gene locus_tag LOCUS_02620 49765 50145 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_02620 50253 52250 gene locus_tag LOCUS_02630 50253 52250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 52342 52755 gene locus_tag LOCUS_02640 gene fliS 52342 52755 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_02640 52759 53085 gene locus_tag LOCUS_02650 52759 53085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 53669 53169 gene locus_tag LOCUS_02660 53669 53169 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_02660 54601 53705 gene locus_tag LOCUS_02670 54601 53705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 55172 54660 gene locus_tag LOCUS_02680 55172 54660 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_02680 55408 55857 gene locus_tag LOCUS_02690 55408 55857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 55869 56405 gene locus_tag LOCUS_02700 55869 56405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 58066 56606 gene locus_tag LOCUS_02710 gene prpD 58066 56606 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275859.1 protein_id gnl|my_center|LOCUS_02710 59305 58157 gene locus_tag LOCUS_02720 gene prpC 59305 58157 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_02720 <60080 59302 gene locus_tag LOCUS_02730 <60080 59302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103044.1:methylisocitrate lyase >Feature sequence005 <1 633 gene locus_tag LOCUS_02740 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087945.1:IS701-like element ISBj9 family transposase 754 1524 gene locus_tag LOCUS_02750 754 1524 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_02750 1574 2326 gene locus_tag LOCUS_02760 1574 2326 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_02760 3074 2247 gene locus_tag LOCUS_02770 3074 2247 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_02770 3259 3705 gene locus_tag LOCUS_02780 3259 3705 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_02780 3789 5774 gene locus_tag LOCUS_02790 3789 5774 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_02790 7444 5849 gene locus_tag LOCUS_02800 7444 5849 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_02800 8409 7450 gene locus_tag LOCUS_02810 8409 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 9168 8683 gene locus_tag LOCUS_02820 9168 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 9295 9371 gene locus_tag LOCUS_t00010 9295 9371 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9806 10123 gene locus_tag LOCUS_02830 9806 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 10120 10383 gene locus_tag LOCUS_02840 10120 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10601 10930 gene locus_tag LOCUS_02850 10601 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 11654 11082 gene locus_tag LOCUS_02860 11654 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11842 12156 gene locus_tag LOCUS_02870 11842 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12153 12920 gene locus_tag LOCUS_02880 12153 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12907 13782 gene locus_tag LOCUS_02890 12907 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13805 14113 gene locus_tag LOCUS_02900 13805 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14126 14311 gene locus_tag LOCUS_02910 14126 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14313 14690 gene locus_tag LOCUS_02920 14313 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 14687 16318 gene locus_tag LOCUS_02930 14687 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 16341 16571 gene locus_tag LOCUS_02940 16341 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 16582 16881 gene locus_tag LOCUS_02950 16582 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 16885 17619 gene locus_tag LOCUS_02960 gene mobC 16885 17619 CDS product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 protein_id gnl|my_center|LOCUS_02960 17619 17831 gene locus_tag LOCUS_02970 17619 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 19039 19293 gene locus_tag LOCUS_02980 19039 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 19934 20170 gene locus_tag LOCUS_02990 19934 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 20294 20470 gene locus_tag LOCUS_03000 20294 20470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 20536 20871 gene locus_tag LOCUS_03010 20536 20871 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_03010 20868 21179 gene locus_tag LOCUS_03020 20868 21179 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_03020 22204 21176 gene locus_tag LOCUS_03030 22204 21176 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815836.1 protein_id gnl|my_center|LOCUS_03030 22913 24310 gene locus_tag LOCUS_03040 22913 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 24399 25127 gene locus_tag LOCUS_03050 24399 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 25124 25591 gene locus_tag LOCUS_03060 25124 25591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 26075 25632 gene locus_tag LOCUS_03070 26075 25632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 26411 26106 gene locus_tag LOCUS_03080 26411 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 26583 26918 gene locus_tag LOCUS_03090 26583 26918 CDS product DUF5335 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880739.1 protein_id gnl|my_center|LOCUS_03090 26979 27185 gene locus_tag LOCUS_03100 26979 27185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 27337 27606 gene locus_tag LOCUS_03110 27337 27606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 27746 28189 gene locus_tag LOCUS_03120 27746 28189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 29610 28432 gene locus_tag LOCUS_03130 29610 28432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 31257 30208 gene locus_tag LOCUS_03140 31257 30208 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_03140 31618 31860 gene locus_tag LOCUS_03150 31618 31860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 31910 32872 gene locus_tag LOCUS_03160 31910 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 33108 32869 gene locus_tag LOCUS_03170 33108 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 33007 33348 gene locus_tag LOCUS_03180 33007 33348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 33323 33616 gene locus_tag LOCUS_03190 33323 33616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 34424 34158 gene locus_tag LOCUS_03200 34424 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 34572 34703 gene locus_tag LOCUS_03210 34572 34703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 34722 35501 gene locus_tag LOCUS_03220 34722 35501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 35494 39003 gene locus_tag LOCUS_03230 35494 39003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 39249 40646 gene locus_tag LOCUS_03240 39249 40646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 40643 41425 gene locus_tag LOCUS_03250 40643 41425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 41425 46428 gene locus_tag LOCUS_03260 41425 46428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 46421 47536 gene locus_tag LOCUS_03270 46421 47536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 48519 47992 gene locus_tag LOCUS_03280 48519 47992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 51061 48512 gene locus_tag LOCUS_03290 51061 48512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 51534 51067 gene locus_tag LOCUS_03300 51534 51067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 51628 51810 gene locus_tag LOCUS_03310 51628 51810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 52564 51860 gene locus_tag LOCUS_03320 52564 51860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 53090 54652 gene locus_tag LOCUS_03330 53090 54652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence006 681 208 gene locus_tag LOCUS_03340 681 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 718 1272 gene locus_tag LOCUS_03350 718 1272 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_03350 1544 2053 gene locus_tag LOCUS_03360 1544 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2058 2981 gene locus_tag LOCUS_03370 2058 2981 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_03370 3171 3779 gene locus_tag LOCUS_03380 3171 3779 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_03380 3757 4656 gene locus_tag LOCUS_03390 3757 4656 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_03390 6728 4815 gene locus_tag LOCUS_03400 6728 4815 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406174.1 protein_id gnl|my_center|LOCUS_03400 8101 6830 gene locus_tag LOCUS_03410 8101 6830 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_03410 10225 8102 gene locus_tag LOCUS_03420 10225 8102 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_03420 10826 10254 gene locus_tag LOCUS_03430 10826 10254 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_03430 12075 10804 gene locus_tag LOCUS_03440 gene rsmB 12075 10804 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224763.1 protein_id gnl|my_center|LOCUS_03440 12922 12080 gene locus_tag LOCUS_03450 gene htpX 12922 12080 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_03450 13911 12982 gene locus_tag LOCUS_03460 gene fmt 13911 12982 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_03460 14414 13911 gene locus_tag LOCUS_03470 gene def 14414 13911 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_03470 14532 15569 gene locus_tag LOCUS_03480 14532 15569 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_03480 15601 16701 gene locus_tag LOCUS_03490 gene dprA 15601 16701 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935893.1 protein_id gnl|my_center|LOCUS_03490 16735 17193 gene locus_tag LOCUS_03500 16735 17193 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_03500 17275 19557 gene locus_tag LOCUS_03510 gene topA 17275 19557 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705339.1 protein_id gnl|my_center|LOCUS_03510 20144 19623 gene locus_tag LOCUS_03520 gene efp 20144 19623 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_03520 21142 20228 gene locus_tag LOCUS_03530 21142 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 23765 21375 gene locus_tag LOCUS_03540 gene gyrB 23765 21375 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_03540 24917 23796 gene locus_tag LOCUS_03550 gene dnaN 24917 23796 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 protein_id gnl|my_center|LOCUS_03550 25559 25104 gene locus_tag LOCUS_03560 25559 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 25827 26006 gene locus_tag LOCUS_03570 25827 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 27378 29018 gene locus_tag LOCUS_03580 gene yidC 27378 29018 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_03580 29005 30345 gene locus_tag LOCUS_03590 gene mnmE 29005 30345 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_03590 30433 32331 gene locus_tag LOCUS_03600 gene mnmG 30433 32331 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_03600 32328 32969 gene locus_tag LOCUS_03610 gene rsmG 32328 32969 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_03610 32979 33737 gene locus_tag LOCUS_03620 32979 33737 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_03620 33745 34590 gene locus_tag LOCUS_03630 33745 34590 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_03630 34983 35330 gene locus_tag LOCUS_03640 34983 35330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 35353 36195 gene locus_tag LOCUS_03650 gene atpB 35353 36195 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_03650 36238 36477 gene locus_tag LOCUS_03660 gene atpE 36238 36477 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_03660 36510 36980 gene locus_tag LOCUS_03670 36510 36980 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 protein_id gnl|my_center|LOCUS_03670 36996 37532 gene locus_tag LOCUS_03680 gene atpH 36996 37532 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 protein_id gnl|my_center|LOCUS_03680 37541 39076 gene locus_tag LOCUS_03690 gene atpA 37541 39076 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225830.1 protein_id gnl|my_center|LOCUS_03690 39107 39970 gene locus_tag LOCUS_03700 gene atpG 39107 39970 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_03700 40074 41453 gene locus_tag LOCUS_03710 gene atpD 40074 41453 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 protein_id gnl|my_center|LOCUS_03710 41471 41893 gene locus_tag LOCUS_03720 41471 41893 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 protein_id gnl|my_center|LOCUS_03720 41933 43339 gene locus_tag LOCUS_03730 gene glmU 41933 43339 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_03730 43347 45179 gene locus_tag LOCUS_03740 gene glmS 43347 45179 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_03740 45186 45950 gene locus_tag LOCUS_03750 45186 45950 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_03750 46667 46023 gene locus_tag LOCUS_03760 gene narP 46667 46023 CDS product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113641.1 protein_id gnl|my_center|LOCUS_03760 47346 46690 gene locus_tag LOCUS_03770 gene dsbA 47346 46690 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_03770 47997 47383 gene locus_tag LOCUS_03780 47997 47383 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_03780 49750 48029 gene locus_tag LOCUS_03790 gene argS 49750 48029 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_03790 51997 49814 gene locus_tag LOCUS_03800 51997 49814 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195838.1 protein_id gnl|my_center|LOCUS_03800 52185 51994 gene locus_tag LOCUS_03810 52185 51994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 53388 53173 gene locus_tag LOCUS_03820 53388 53173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 53621 53448 gene locus_tag LOCUS_03830 53621 53448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 53869 53603 gene locus_tag LOCUS_03840 53869 53603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 54116 53889 gene locus_tag LOCUS_03850 54116 53889 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence007 184 1086 gene locus_tag LOCUS_03860 184 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1347 2108 gene locus_tag LOCUS_03870 1347 2108 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_03870 2186 3811 gene locus_tag LOCUS_03880 2186 3811 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_03880 6339 4141 gene locus_tag LOCUS_03890 6339 4141 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_03890 7001 10989 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgtcccgaaggacgggcgctac 11458 11168 gene locus_tag LOCUS_03900 gene cas2 11458 11168 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_03900 12498 11461 gene locus_tag LOCUS_03910 gene cas1c 12498 11461 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_03910 13127 12501 gene locus_tag LOCUS_03920 gene cas4 13127 12501 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_03920 13179 13427 gene locus_tag LOCUS_03930 13179 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 13968 13762 gene locus_tag LOCUS_03940 13968 13762 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391951.1 protein_id gnl|my_center|LOCUS_03940 14863 13982 gene locus_tag LOCUS_03950 gene cas7c 14863 13982 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_03950 16583 14850 gene locus_tag LOCUS_03960 gene cas8c 16583 14850 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_03960 17245 16580 gene locus_tag LOCUS_03970 gene cas5c 17245 16580 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_03970 19636 17549 gene locus_tag LOCUS_03980 gene cas3 19636 17549 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_03980 20354 19950 gene locus_tag LOCUS_03990 20354 19950 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 protein_id gnl|my_center|LOCUS_03990 22487 20556 gene locus_tag LOCUS_04000 22487 20556 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_04000 23141 22653 gene locus_tag LOCUS_04010 23141 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 24619 23138 gene locus_tag LOCUS_04020 24619 23138 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_04020 25406 24723 gene locus_tag LOCUS_04030 25406 24723 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_04030 26106 25399 gene locus_tag LOCUS_04040 gene hoxU 26106 25399 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_04040 27887 26103 gene locus_tag LOCUS_04050 27887 26103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 28517 28131 gene locus_tag LOCUS_04060 28517 28131 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_04060 32000 28689 gene locus_tag LOCUS_04070 32000 28689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 33056 32004 gene locus_tag LOCUS_04080 gene cheB 33056 32004 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_04080 35327 33090 gene locus_tag LOCUS_04090 35327 33090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 36490 35324 gene locus_tag LOCUS_04100 36490 35324 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705655.1 protein_id gnl|my_center|LOCUS_04100 38215 36596 gene locus_tag LOCUS_04110 38215 36596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 40438 38234 gene locus_tag LOCUS_04120 40438 38234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 42937 40559 gene locus_tag LOCUS_04130 42937 40559 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015337756.1 protein_id gnl|my_center|LOCUS_04130 45879 43102 gene locus_tag LOCUS_04140 45879 43102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 47560 45923 gene locus_tag LOCUS_04150 47560 45923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 48225 47605 gene locus_tag LOCUS_04160 48225 47605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence008 695 279 gene locus_tag LOCUS_04170 695 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1789 713 gene locus_tag LOCUS_04180 1789 713 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192197.1 protein_id gnl|my_center|LOCUS_04180 2924 1800 gene locus_tag LOCUS_04190 2924 1800 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_04190 4138 3776 gene locus_tag LOCUS_04200 4138 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5423 4317 gene locus_tag LOCUS_04210 5423 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6106 5504 gene locus_tag LOCUS_04220 6106 5504 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_04220 6534 6169 gene locus_tag LOCUS_04230 6534 6169 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_04230 6948 6607 gene locus_tag LOCUS_04240 6948 6607 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_04240 7188 8174 gene locus_tag LOCUS_04250 7188 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 8753 8678 gene locus_tag LOCUS_t00020 8753 8678 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10031 8847 gene locus_tag LOCUS_04260 10031 8847 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_04260 11136 10459 gene locus_tag LOCUS_04270 gene queC 11136 10459 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_04270 11236 11682 gene locus_tag LOCUS_04280 11236 11682 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_04280 11682 12221 gene locus_tag LOCUS_04290 11682 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12232 13299 gene locus_tag LOCUS_04300 gene mnmA 12232 13299 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_04300 14046 13435 gene locus_tag LOCUS_04310 14046 13435 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_04310 16609 14051 gene locus_tag LOCUS_04320 gene acnB 16609 14051 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_04320 17143 16871 gene locus_tag LOCUS_04330 17143 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 17319 17140 gene locus_tag LOCUS_04340 17319 17140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 18826 17504 gene locus_tag LOCUS_04350 18826 17504 CDS product AGCS family amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447623.1 protein_id gnl|my_center|LOCUS_04350 20176 19001 gene locus_tag LOCUS_04360 20176 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 20733 20188 gene locus_tag LOCUS_04370 gene purE 20733 20188 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942943.1 protein_id gnl|my_center|LOCUS_04370 21451 20807 gene locus_tag LOCUS_04380 21451 20807 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942944.1 protein_id gnl|my_center|LOCUS_04380 22338 21451 gene locus_tag LOCUS_04390 22338 21451 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_04390 22362 22763 gene locus_tag LOCUS_04400 22362 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 23133 22831 gene locus_tag LOCUS_04410 23133 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 25532 23130 gene locus_tag LOCUS_04420 25532 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 26520 25717 gene locus_tag LOCUS_04430 26520 25717 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_04430 27010 26654 gene locus_tag LOCUS_04440 27010 26654 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_04440 28501 27080 gene locus_tag LOCUS_04450 28501 27080 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_04450 28796 29767 gene locus_tag LOCUS_04460 28796 29767 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_04460 30853 30266 gene locus_tag LOCUS_04470 30853 30266 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_04470 31149 30856 gene locus_tag LOCUS_04480 31149 30856 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_04480 32742 31414 gene locus_tag LOCUS_04490 32742 31414 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_04490 33426 33007 gene locus_tag LOCUS_04500 33426 33007 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_04500 33953 33657 gene locus_tag LOCUS_04510 33953 33657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 36180 34561 gene locus_tag LOCUS_04520 36180 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 36617 36195 gene locus_tag LOCUS_04530 36617 36195 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550872.1 protein_id gnl|my_center|LOCUS_04530 40557 36706 gene locus_tag LOCUS_04540 40557 36706 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_04540 41033 40638 gene locus_tag LOCUS_04550 41033 40638 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370062.1 protein_id gnl|my_center|LOCUS_04550 41114 41614 gene locus_tag LOCUS_04560 41114 41614 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_04560 42319 43896 gene locus_tag LOCUS_04570 42319 43896 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391981.1 protein_id gnl|my_center|LOCUS_04570 44077 44694 gene locus_tag LOCUS_04580 44077 44694 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_04580 44822 45256 gene locus_tag LOCUS_04590 44822 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 45854 45375 gene locus_tag LOCUS_04600 45854 45375 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766044.1 protein_id gnl|my_center|LOCUS_04600 46038 46514 gene locus_tag LOCUS_04610 46038 46514 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence009 733 185 gene locus_tag LOCUS_04620 gene ampD 733 185 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_04620 849 1853 gene locus_tag LOCUS_04630 849 1853 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_04630 1928 4417 gene locus_tag LOCUS_04640 1928 4417 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_04640 5898 4519 gene locus_tag LOCUS_04650 gene pilR 5898 4519 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_04650 7204 6221 gene locus_tag LOCUS_04660 7204 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 9276 7219 gene locus_tag LOCUS_04670 9276 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 10104 9301 gene locus_tag LOCUS_04680 10104 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 10916 10101 gene locus_tag LOCUS_04690 10916 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11255 10917 gene locus_tag LOCUS_04700 11255 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13222 11519 gene locus_tag LOCUS_04710 gene ilvG 13222 11519 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925791.1 protein_id gnl|my_center|LOCUS_04710 14145 13507 gene locus_tag LOCUS_04720 14145 13507 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968906.1 protein_id gnl|my_center|LOCUS_04720 14433 15956 gene locus_tag LOCUS_04730 14433 15956 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_04730 15953 17002 gene locus_tag LOCUS_04740 gene mtnA 15953 17002 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_04740 17706 17065 gene locus_tag LOCUS_04750 17706 17065 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_04750 18759 17713 gene locus_tag LOCUS_04760 18759 17713 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_04760 20093 18957 gene locus_tag LOCUS_04770 20093 18957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_04770 21012 20086 gene locus_tag LOCUS_04780 21012 20086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_04780 21964 21017 gene locus_tag LOCUS_04790 21964 21017 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_04790 25139 21975 gene locus_tag LOCUS_04800 25139 21975 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_04800 26232 25150 gene locus_tag LOCUS_04810 26232 25150 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_04810 26891 26253 gene locus_tag LOCUS_04820 26891 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 27625 27071 gene locus_tag LOCUS_04830 27625 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 29245 28001 gene locus_tag LOCUS_04840 gene lysA 29245 28001 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_04840 29446 29757 gene locus_tag LOCUS_04850 gene cyaY 29446 29757 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211469.1 protein_id gnl|my_center|LOCUS_04850 30498 29806 gene locus_tag LOCUS_04860 30498 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 30912 30715 gene locus_tag LOCUS_04870 30912 30715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 32008 31418 gene locus_tag LOCUS_04880 32008 31418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 33448 32105 gene locus_tag LOCUS_04890 gene hslU 33448 32105 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523084.1 protein_id gnl|my_center|LOCUS_04890 34068 33532 gene locus_tag LOCUS_04900 gene hslV 34068 33532 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_04900 34126 34629 gene locus_tag LOCUS_04910 34126 34629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 35661 34654 gene locus_tag LOCUS_04920 35661 34654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 36707 35943 gene locus_tag LOCUS_04930 36707 35943 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_04930 37717 36809 gene locus_tag LOCUS_04940 37717 36809 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_04940 39112 37727 gene locus_tag LOCUS_04950 39112 37727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_04950 39560 39246 gene locus_tag LOCUS_04960 39560 39246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 40491 39601 gene locus_tag LOCUS_04970 gene xerC 40491 39601 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_04970 41306 40659 gene locus_tag LOCUS_04980 41306 40659 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_04980 42315 41470 gene locus_tag LOCUS_04990 gene dapF 42315 41470 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_04990 42734 42306 gene locus_tag LOCUS_05000 42734 42306 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_05000 43712 42840 gene locus_tag LOCUS_05010 43712 42840 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244166.1 protein_id gnl|my_center|LOCUS_05010 44672 43812 gene locus_tag LOCUS_05020 44672 43812 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence010 1050 196 gene locus_tag LOCUS_05030 1050 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2175 1156 gene locus_tag LOCUS_05040 2175 1156 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_05040 2892 2365 gene locus_tag LOCUS_05050 2892 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3409 2993 gene locus_tag LOCUS_05060 3409 2993 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_05060 3654 3409 gene locus_tag LOCUS_05070 3654 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5533 3794 gene locus_tag LOCUS_05080 gene recJ 5533 3794 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_05080 5617 6603 gene locus_tag LOCUS_05090 5617 6603 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_05090 6572 7927 gene locus_tag LOCUS_05100 gene tilS 6572 7927 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_05100 8019 9035 gene locus_tag LOCUS_05110 8019 9035 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_05110 9117 9656 gene locus_tag LOCUS_05120 9117 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 9653 10942 gene locus_tag LOCUS_05130 9653 10942 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338587.1 protein_id gnl|my_center|LOCUS_05130 11026 11922 gene locus_tag LOCUS_05140 11026 11922 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 protein_id gnl|my_center|LOCUS_05140 12659 11928 gene locus_tag LOCUS_05150 12659 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 12820 13245 gene locus_tag LOCUS_05160 gene ndk 12820 13245 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_05160 13245 14324 gene locus_tag LOCUS_05170 gene rlmN 13245 14324 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_05170 14321 15091 gene locus_tag LOCUS_05180 gene pilW 14321 15091 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_05180 15117 15983 gene locus_tag LOCUS_05190 15117 15983 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261365.1 protein_id gnl|my_center|LOCUS_05190 15987 17084 gene locus_tag LOCUS_05200 gene ispG 15987 17084 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_05200 17176 18438 gene locus_tag LOCUS_05210 gene hisS 17176 18438 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_05210 18461 19096 gene locus_tag LOCUS_05220 18461 19096 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_05220 19093 20280 gene locus_tag LOCUS_05230 gene bamB 19093 20280 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_05230 20474 21877 gene locus_tag LOCUS_05240 gene der 20474 21877 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_05240 22042 23211 gene locus_tag LOCUS_05250 22042 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 23524 23763 gene locus_tag LOCUS_05260 gene hfq 23524 23763 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_05260 23763 24947 gene locus_tag LOCUS_05270 gene hflX 23763 24947 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_05270 24934 26109 gene locus_tag LOCUS_05280 gene hflK 24934 26109 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_05280 26106 26972 gene locus_tag LOCUS_05290 gene hflC 26106 26972 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_05290 26996 27181 gene locus_tag LOCUS_05300 26996 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 27184 28338 gene locus_tag LOCUS_05310 27184 28338 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_05310 28379 29674 gene locus_tag LOCUS_05320 28379 29674 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_05320 29799 29715 gene locus_tag LOCUS_t00030 29799 29715 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29838 32153 gene locus_tag LOCUS_05330 gene rnr 29838 32153 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225208.1 protein_id gnl|my_center|LOCUS_05330 32153 32890 gene locus_tag LOCUS_05340 gene rlmB 32153 32890 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231513.1 protein_id gnl|my_center|LOCUS_05340 32982 33371 gene locus_tag LOCUS_05350 gene rpsF 32982 33371 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_05350 33372 33677 gene locus_tag LOCUS_05360 gene priB 33372 33677 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_05360 33730 33945 gene locus_tag LOCUS_05370 gene rpsR 33730 33945 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_05370 33957 34406 gene locus_tag LOCUS_05380 gene rplI 33957 34406 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232586.1 protein_id gnl|my_center|LOCUS_05380 34534 35907 gene locus_tag LOCUS_05390 34534 35907 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_05390 35989 37074 gene locus_tag LOCUS_05400 gene dadX 35989 37074 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_05400 37078 38433 gene locus_tag LOCUS_05410 gene radA 37078 38433 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_05410 38480 39298 gene locus_tag LOCUS_05420 38480 39298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 39758 39348 gene locus_tag LOCUS_05430 39758 39348 CDS product TssQ family T6SS-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190377.1 protein_id gnl|my_center|LOCUS_05430 41164 39755 gene locus_tag LOCUS_05440 41164 39755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 41397 42221 gene locus_tag LOCUS_05450 gene prpC 41397 42221 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_05450 42229 42915 gene locus_tag LOCUS_05460 42229 42915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence011 1599 247 gene locus_tag LOCUS_05470 1599 247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615703.1 protein_id gnl|my_center|LOCUS_05470 2345 1617 gene locus_tag LOCUS_05480 2345 1617 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096597.1 protein_id gnl|my_center|LOCUS_05480 2567 3022 gene locus_tag LOCUS_05490 2567 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3441 3106 gene locus_tag LOCUS_05500 3441 3106 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_05500 4758 3508 gene locus_tag LOCUS_05510 4758 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 5365 4808 gene locus_tag LOCUS_05520 gene mog 5365 4808 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926148.1 protein_id gnl|my_center|LOCUS_05520 5919 5362 gene locus_tag LOCUS_05530 gene yjgA 5919 5362 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_05530 5996 7333 gene locus_tag LOCUS_05540 gene pmbA 5996 7333 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_05540 7374 8144 gene locus_tag LOCUS_05550 7374 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9128 8199 gene locus_tag LOCUS_05560 9128 8199 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686949.1 protein_id gnl|my_center|LOCUS_05560 9218 11599 gene locus_tag LOCUS_05570 gene metE 9218 11599 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_05570 11760 13007 gene locus_tag LOCUS_05580 11760 13007 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225269.1 protein_id gnl|my_center|LOCUS_05580 13095 13544 gene locus_tag LOCUS_05590 gene nrdR 13095 13544 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_05590 13666 14754 gene locus_tag LOCUS_05600 gene ribD 13666 14754 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_05600 14845 15438 gene locus_tag LOCUS_05610 14845 15438 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_05610 15554 16651 gene locus_tag LOCUS_05620 gene ribBA 15554 16651 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_05620 16789 17262 gene locus_tag LOCUS_05630 gene ribH 16789 17262 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_05630 17259 17729 gene locus_tag LOCUS_05640 gene nusB 17259 17729 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039075.1 protein_id gnl|my_center|LOCUS_05640 17810 18883 gene locus_tag LOCUS_05650 gene thiL 17810 18883 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_05650 18910 19389 gene locus_tag LOCUS_05660 18910 19389 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_05660 19386 19886 gene locus_tag LOCUS_05670 gene pncC 19386 19886 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_05670 19883 20266 gene locus_tag LOCUS_05680 19883 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 20337 21368 gene locus_tag LOCUS_05690 gene recA 20337 21368 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_05690 21361 21810 gene locus_tag LOCUS_05700 gene recX 21361 21810 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930990.1 protein_id gnl|my_center|LOCUS_05700 21807 22190 gene locus_tag LOCUS_05710 21807 22190 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_05710 22183 22476 gene locus_tag LOCUS_05720 22183 22476 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258929.1 protein_id gnl|my_center|LOCUS_05720 22540 23013 gene locus_tag LOCUS_05730 22540 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 23031 23315 gene locus_tag LOCUS_05740 23031 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 23318 23578 gene locus_tag LOCUS_05750 23318 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 23664 24011 gene locus_tag LOCUS_05760 23664 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 24067 26691 gene locus_tag LOCUS_05770 gene alaS 24067 26691 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_05770 26740 26931 gene locus_tag LOCUS_05780 26740 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 27106 27468 gene locus_tag LOCUS_05790 27106 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 27551 28114 gene locus_tag LOCUS_05800 27551 28114 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_05800 28111 28794 gene locus_tag LOCUS_05810 28111 28794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 28806 29759 gene locus_tag LOCUS_05820 28806 29759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 29869 30651 gene locus_tag LOCUS_05830 29869 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 30706 31089 gene locus_tag LOCUS_05840 30706 31089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 31404 32063 gene locus_tag LOCUS_05850 31404 32063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 31951 32160 gene locus_tag LOCUS_05860 31951 32160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 33646 32408 gene locus_tag LOCUS_05870 33646 32408 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_05870 35424 33694 gene locus_tag LOCUS_05880 gene lpdA 35424 33694 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527370.1 protein_id gnl|my_center|LOCUS_05880 36846 35542 gene locus_tag LOCUS_05890 gene aceF 36846 35542 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039836.1 protein_id gnl|my_center|LOCUS_05890 39617 36960 gene locus_tag LOCUS_05900 gene aceE 39617 36960 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_05900 39808 41259 gene locus_tag LOCUS_05910 39808 41259 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706228.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence012 <1 748 gene locus_tag LOCUS_05920 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546101.1:methyl-accepting chemotaxis protein 2153 981 gene locus_tag LOCUS_05930 gene hemW 2153 981 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_05930 2749 2153 gene locus_tag LOCUS_05940 gene rdgB 2749 2153 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687551.1 protein_id gnl|my_center|LOCUS_05940 2940 5918 gene locus_tag LOCUS_05950 2940 5918 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_05950 6060 6743 gene locus_tag LOCUS_05960 6060 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6725 7693 gene locus_tag LOCUS_05970 6725 7693 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_05970 7645 8700 gene locus_tag LOCUS_05980 7645 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_05980 8812 11208 gene locus_tag LOCUS_05990 8812 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11217 12659 gene locus_tag LOCUS_06000 11217 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 13533 12814 gene locus_tag LOCUS_06010 gene rph 13533 12814 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_06010 14664 13747 gene locus_tag LOCUS_06020 14664 13747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 15647 14661 gene locus_tag LOCUS_06030 15647 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15868 16734 gene locus_tag LOCUS_06040 15868 16734 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_06040 16934 17545 gene locus_tag LOCUS_06050 gene gmk 16934 17545 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_06050 17564 17770 gene locus_tag LOCUS_06060 gene rpoZ 17564 17770 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_06060 17848 19965 gene locus_tag LOCUS_06070 17848 19965 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_06070 20776 21513 gene locus_tag LOCUS_06080 20776 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 21815 22195 gene locus_tag LOCUS_06090 21815 22195 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_06090 22192 24240 gene locus_tag LOCUS_06100 gene recG 22192 24240 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_06100 24506 25045 gene locus_tag LOCUS_06110 24506 25045 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926548.1 protein_id gnl|my_center|LOCUS_06110 25042 25932 gene locus_tag LOCUS_06120 gene ubiA 25042 25932 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_06120 25943 26563 gene locus_tag LOCUS_06130 25943 26563 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_06130 26907 26623 gene locus_tag LOCUS_06140 26907 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 27127 27474 gene locus_tag LOCUS_06150 27127 27474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_06150 27471 28934 gene locus_tag LOCUS_06160 gene ubiD 27471 28934 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_06160 29047 29610 gene locus_tag LOCUS_06170 29047 29610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 29671 30117 gene locus_tag LOCUS_06180 gene fliW 29671 30117 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_06180 31571 30114 gene locus_tag LOCUS_06190 gene dacB 31571 30114 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_06190 32979 31588 gene locus_tag LOCUS_06200 32979 31588 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_06200 34383 33349 gene locus_tag LOCUS_06210 34383 33349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 34573 34809 gene locus_tag LOCUS_06220 34573 34809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 34947 34810 gene locus_tag LOCUS_06230 34947 34810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 36088 35237 gene locus_tag LOCUS_06240 36088 35237 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832082.1 protein_id gnl|my_center|LOCUS_06240 36280 37380 gene locus_tag LOCUS_06250 gene fbp 36280 37380 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_06250 37435 38067 gene locus_tag LOCUS_06260 gene nth 37435 38067 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814299.1 protein_id gnl|my_center|LOCUS_06260 38186 39340 gene locus_tag LOCUS_06270 38186 39340 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_06270 39443 40174 gene locus_tag LOCUS_06280 39443 40174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence013 1642 242 gene locus_tag LOCUS_06290 gene argH 1642 242 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225520.1 protein_id gnl|my_center|LOCUS_06290 1738 2724 gene locus_tag LOCUS_06300 1738 2724 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_06300 2717 3484 gene locus_tag LOCUS_06310 2717 3484 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_06310 4083 3598 gene locus_tag LOCUS_06320 4083 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4117 5064 gene locus_tag LOCUS_06330 gene hemC 4117 5064 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_06330 5061 5846 gene locus_tag LOCUS_06340 5061 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5965 7041 gene locus_tag LOCUS_06350 5965 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7296 8480 gene locus_tag LOCUS_06360 7296 8480 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_06360 8664 10964 gene locus_tag LOCUS_06370 8664 10964 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_06370 10961 12118 gene locus_tag LOCUS_06380 10961 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 12115 13077 gene locus_tag LOCUS_06390 gene rhuM 12115 13077 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_06390 13081 15000 gene locus_tag LOCUS_06400 13081 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 16037 15012 gene locus_tag LOCUS_06410 16037 15012 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_06410 16575 16174 gene locus_tag LOCUS_06420 16575 16174 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124704474.1 protein_id gnl|my_center|LOCUS_06420 16574 16921 gene locus_tag LOCUS_06430 16574 16921 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806936.1 protein_id gnl|my_center|LOCUS_06430 16924 19188 gene locus_tag LOCUS_06440 gene dsbD 16924 19188 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_06440 19215 19760 gene locus_tag LOCUS_06450 19215 19760 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_06450 19844 20338 gene locus_tag LOCUS_06460 gene aroQ 19844 20338 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_06460 20341 20796 gene locus_tag LOCUS_06470 gene accB 20341 20796 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_06470 20933 22288 gene locus_tag LOCUS_06480 gene accC 20933 22288 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 protein_id gnl|my_center|LOCUS_06480 22300 23190 gene locus_tag LOCUS_06490 gene prmA 22300 23190 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_06490 23195 24337 gene locus_tag LOCUS_06500 23195 24337 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391001.1 protein_id gnl|my_center|LOCUS_06500 24423 25199 gene locus_tag LOCUS_06510 24423 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 27186 25333 gene locus_tag LOCUS_06520 27186 25333 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 protein_id gnl|my_center|LOCUS_06520 27963 27232 gene locus_tag LOCUS_06530 27963 27232 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_06530 28044 28598 gene locus_tag LOCUS_06540 28044 28598 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_06540 28664 29446 gene locus_tag LOCUS_06550 28664 29446 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_06550 29616 31601 gene locus_tag LOCUS_06560 gene tkt 29616 31601 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098596.1 protein_id gnl|my_center|LOCUS_06560 31716 32714 gene locus_tag LOCUS_06570 gene gap 31716 32714 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_06570 32870 34048 gene locus_tag LOCUS_06580 32870 34048 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_06580 34162 35604 gene locus_tag LOCUS_06590 gene pyk 34162 35604 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_06590 35662 36726 gene locus_tag LOCUS_06600 gene fba 35662 36726 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_06600 37692 36772 gene locus_tag LOCUS_06610 37692 36772 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_06610 37822 38703 gene locus_tag LOCUS_06620 37822 38703 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence014 552 19 gene locus_tag LOCUS_06630 552 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_06630 1308 802 gene locus_tag LOCUS_06640 1308 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2789 1365 gene locus_tag LOCUS_06650 2789 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4024 2786 gene locus_tag LOCUS_06660 4024 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200386714.1 protein_id gnl|my_center|LOCUS_06660 4575 4297 gene locus_tag LOCUS_06670 4575 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4844 4572 gene locus_tag LOCUS_06680 4844 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5328 4996 gene locus_tag LOCUS_06690 5328 4996 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_06690 8242 5384 gene locus_tag LOCUS_06700 8242 5384 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_06700 9267 8647 gene locus_tag LOCUS_06710 9267 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 10063 9290 gene locus_tag LOCUS_06720 10063 9290 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930598.1 protein_id gnl|my_center|LOCUS_06720 10464 10102 gene locus_tag LOCUS_06730 10464 10102 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381088.1 protein_id gnl|my_center|LOCUS_06730 11491 10457 gene locus_tag LOCUS_06740 11491 10457 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_06740 11958 11497 gene locus_tag LOCUS_06750 11958 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 11938 12096 gene locus_tag LOCUS_06760 11938 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 13108 12131 gene locus_tag LOCUS_06770 gene mltG 13108 12131 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_06770 13943 13128 gene locus_tag LOCUS_06780 gene pabC 13943 13128 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_06780 15283 13943 gene locus_tag LOCUS_06790 15283 13943 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_06790 16580 15342 gene locus_tag LOCUS_06800 gene fabF 16580 15342 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_06800 16860 16624 gene locus_tag LOCUS_06810 gene acpP 16860 16624 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_06810 17688 16948 gene locus_tag LOCUS_06820 gene fabG 17688 16948 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_06820 18633 17704 gene locus_tag LOCUS_06830 gene fabD 18633 17704 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 protein_id gnl|my_center|LOCUS_06830 19605 18646 gene locus_tag LOCUS_06840 19605 18646 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_06840 20622 19606 gene locus_tag LOCUS_06850 gene plsX 20622 19606 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_06850 20858 20679 gene locus_tag LOCUS_06860 gene rpmF 20858 20679 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_06860 21382 20870 gene locus_tag LOCUS_06870 21382 20870 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_06870 21494 22912 gene locus_tag LOCUS_06880 21494 22912 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_06880 22944 24806 gene locus_tag LOCUS_06890 gene oadA 22944 24806 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269402.1 protein_id gnl|my_center|LOCUS_06890 24859 25434 gene locus_tag LOCUS_06900 24859 25434 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_06900 25435 26154 gene locus_tag LOCUS_06910 25435 26154 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_06910 26385 26146 gene locus_tag LOCUS_06920 26385 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 27327 26386 gene locus_tag LOCUS_06930 27327 26386 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_06930 28023 27367 gene locus_tag LOCUS_06940 28023 27367 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_06940 28982 28032 gene locus_tag LOCUS_06950 28982 28032 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_06950 29359 31878 gene locus_tag LOCUS_06960 29359 31878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 31946 32200 gene locus_tag LOCUS_06970 31946 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 32575 33711 gene locus_tag LOCUS_06980 gene nifV 32575 33711 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_06980 33730 34071 gene locus_tag LOCUS_06990 33730 34071 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_06990 34248 35096 gene locus_tag LOCUS_07000 34248 35096 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389922.1 protein_id gnl|my_center|LOCUS_07000 35269 36351 gene locus_tag LOCUS_07010 35269 36351 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 protein_id gnl|my_center|LOCUS_07010 36460 37761 gene locus_tag LOCUS_07020 36460 37761 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389920.1 protein_id gnl|my_center|LOCUS_07020 37758 38048 gene locus_tag LOCUS_07030 37758 38048 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 protein_id gnl|my_center|LOCUS_07030 38178 38504 gene locus_tag LOCUS_07040 38178 38504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence015 162 1100 gene locus_tag LOCUS_07050 gene nhaR 162 1100 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_07050 1234 2520 gene locus_tag LOCUS_07060 gene serS 1234 2520 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_07060 3995 2562 gene locus_tag LOCUS_07070 gene mltF 3995 2562 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266923.1 protein_id gnl|my_center|LOCUS_07070 4223 4312 gene locus_tag LOCUS_t00040 4223 4312 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4554 7442 gene locus_tag LOCUS_07080 4554 7442 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_07080 7439 8170 gene locus_tag LOCUS_07090 7439 8170 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_07090 8264 9244 gene locus_tag LOCUS_07100 8264 9244 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_07100 10160 9447 gene locus_tag LOCUS_07110 10160 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 10288 11133 gene locus_tag LOCUS_07120 10288 11133 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_07120 11245 11631 gene locus_tag LOCUS_07130 11245 11631 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_07130 12891 11674 gene locus_tag LOCUS_07140 12891 11674 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_07140 14753 12906 gene locus_tag LOCUS_07150 14753 12906 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_07150 15551 14793 gene locus_tag LOCUS_07160 gene cheZ 15551 14793 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367337.1 protein_id gnl|my_center|LOCUS_07160 15975 15571 gene locus_tag LOCUS_07170 gene cheY 15975 15571 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_07170 17062 16130 gene locus_tag LOCUS_07180 17062 16130 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315817.1 protein_id gnl|my_center|LOCUS_07180 18031 17075 gene locus_tag LOCUS_07190 18031 17075 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098100.1 protein_id gnl|my_center|LOCUS_07190 18108 18341 gene locus_tag LOCUS_07200 18108 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 18334 19506 gene locus_tag LOCUS_07210 gene fleS 18334 19506 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_07210 19524 20855 gene locus_tag LOCUS_07220 19524 20855 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_07220 20979 21296 gene locus_tag LOCUS_07230 gene fliE 20979 21296 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185219.1 protein_id gnl|my_center|LOCUS_07230 21407 23020 gene locus_tag LOCUS_07240 gene fliF 21407 23020 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_07240 23013 24008 gene locus_tag LOCUS_07250 gene fliG 23013 24008 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_07250 24001 24621 gene locus_tag LOCUS_07260 gene fliH 24001 24621 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063740.1 protein_id gnl|my_center|LOCUS_07260 24702 26072 gene locus_tag LOCUS_07270 gene fliI 24702 26072 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811843.1 protein_id gnl|my_center|LOCUS_07270 26092 26553 gene locus_tag LOCUS_07280 gene fliJ 26092 26553 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926566.1 protein_id gnl|my_center|LOCUS_07280 26617 27678 gene locus_tag LOCUS_07290 26617 27678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 27940 28437 gene locus_tag LOCUS_07300 gene fliL 27940 28437 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196785.1 protein_id gnl|my_center|LOCUS_07300 28473 29477 gene locus_tag LOCUS_07310 gene fliM 28473 29477 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524547.1 protein_id gnl|my_center|LOCUS_07310 29470 29976 gene locus_tag LOCUS_07320 gene fliN 29470 29976 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_07320 30005 30436 gene locus_tag LOCUS_07330 30005 30436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 30429 31211 gene locus_tag LOCUS_07340 gene fliP 30429 31211 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_07340 31208 31477 gene locus_tag LOCUS_07350 gene fliQ 31208 31477 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 protein_id gnl|my_center|LOCUS_07350 31661 32452 gene locus_tag LOCUS_07360 gene fliR 31661 32452 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_07360 32452 32979 gene locus_tag LOCUS_07370 32452 32979 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_07370 33072 33299 gene locus_tag LOCUS_07380 33072 33299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 33400 35223 gene locus_tag LOCUS_07390 33400 35223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence016 795 226 gene locus_tag LOCUS_07400 795 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1530 940 gene locus_tag LOCUS_07410 1530 940 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_07410 2048 1698 gene locus_tag LOCUS_07420 2048 1698 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_07420 3276 2035 gene locus_tag LOCUS_07430 3276 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 3352 4137 gene locus_tag LOCUS_07440 gene rsmI 3352 4137 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_07440 4675 4220 gene locus_tag LOCUS_07450 4675 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5745 4672 gene locus_tag LOCUS_07460 5745 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5864 6898 gene locus_tag LOCUS_07470 gene pyrC 5864 6898 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_07470 8199 7021 gene locus_tag LOCUS_07480 8199 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8802 8590 gene locus_tag LOCUS_07490 8802 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9026 9469 gene locus_tag LOCUS_07500 gene mraZ 9026 9469 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_07500 9496 10401 gene locus_tag LOCUS_07510 gene rsmH 9496 10401 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697441.1 protein_id gnl|my_center|LOCUS_07510 10398 10682 gene locus_tag LOCUS_07520 gene ftsL 10398 10682 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_07520 10679 12427 gene locus_tag LOCUS_07530 10679 12427 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_07530 12424 13890 gene locus_tag LOCUS_07540 12424 13890 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224920.1 protein_id gnl|my_center|LOCUS_07540 13878 15377 gene locus_tag LOCUS_07550 gene murF 13878 15377 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_07550 15362 16447 gene locus_tag LOCUS_07560 gene mraY 15362 16447 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_07560 16703 18082 gene locus_tag LOCUS_07570 gene murD 16703 18082 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705695.1 protein_id gnl|my_center|LOCUS_07570 18079 19242 gene locus_tag LOCUS_07580 gene ftsW 18079 19242 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_07580 19239 20336 gene locus_tag LOCUS_07590 gene murG 19239 20336 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_07590 20444 21958 gene locus_tag LOCUS_07600 gene murC 20444 21958 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194319.1 protein_id gnl|my_center|LOCUS_07600 21959 22918 gene locus_tag LOCUS_07610 gene murB 21959 22918 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_07610 23019 23939 gene locus_tag LOCUS_07620 gene ddlB 23019 23939 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130042.1 protein_id gnl|my_center|LOCUS_07620 24058 24759 gene locus_tag LOCUS_07630 24058 24759 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_07630 24868 26106 gene locus_tag LOCUS_07640 gene ftsA 24868 26106 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_07640 26154 27302 gene locus_tag LOCUS_07650 gene ftsZ 26154 27302 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_07650 27442 28356 gene locus_tag LOCUS_07660 gene lpxC 27442 28356 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_07660 28361 28543 gene locus_tag LOCUS_07670 28361 28543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 30382 28784 gene locus_tag LOCUS_07680 30382 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 31089 30523 gene locus_tag LOCUS_07690 31089 30523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 31970 31578 gene locus_tag LOCUS_07700 31970 31578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 32042 32956 gene locus_tag LOCUS_07710 32042 32956 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_07710 33203 35929 gene locus_tag LOCUS_07720 gene secA 33203 35929 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814564.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence017 3064 1307 gene locus_tag LOCUS_07730 gene dnaG 3064 1307 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225052.1 protein_id gnl|my_center|LOCUS_07730 3595 3149 gene locus_tag LOCUS_07740 3595 3149 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_07740 3812 3600 gene locus_tag LOCUS_07750 gene rpsU 3812 3600 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_07750 3998 5017 gene locus_tag LOCUS_07760 gene tsaD 3998 5017 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_07760 5804 5010 gene locus_tag LOCUS_07770 5804 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6458 5835 gene locus_tag LOCUS_07780 gene plsY 6458 5835 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_07780 6685 7056 gene locus_tag LOCUS_07790 gene folB 6685 7056 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212199.1 protein_id gnl|my_center|LOCUS_07790 7137 7772 gene locus_tag LOCUS_07800 7137 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8749 7847 gene locus_tag LOCUS_07810 gene xerD 8749 7847 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930415.1 protein_id gnl|my_center|LOCUS_07810 9360 8887 gene locus_tag LOCUS_07820 9360 8887 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 protein_id gnl|my_center|LOCUS_07820 10260 9883 gene locus_tag LOCUS_07830 gene rplS 10260 9883 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_07830 11047 10277 gene locus_tag LOCUS_07840 gene trmD 11047 10277 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_07840 11550 11044 gene locus_tag LOCUS_07850 gene rimM 11550 11044 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 protein_id gnl|my_center|LOCUS_07850 11779 11537 gene locus_tag LOCUS_07860 gene rpsP 11779 11537 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 protein_id gnl|my_center|LOCUS_07860 13204 11858 gene locus_tag LOCUS_07870 gene ffh 13204 11858 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_07870 13298 14125 gene locus_tag LOCUS_07880 gene ccsA 13298 14125 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_07880 14242 15510 gene locus_tag LOCUS_07890 14242 15510 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_07890 15594 17309 gene locus_tag LOCUS_07900 gene pilB 15594 17309 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_07900 17322 18542 gene locus_tag LOCUS_07910 17322 18542 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_07910 18626 19492 gene locus_tag LOCUS_07920 18626 19492 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_07920 19650 20252 gene locus_tag LOCUS_07930 gene coaE 19650 20252 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_07930 20362 21138 gene locus_tag LOCUS_07940 gene zapD 20362 21138 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_07940 21292 21498 gene locus_tag LOCUS_07950 21292 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 21926 21495 gene locus_tag LOCUS_07960 21926 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 22870 21929 gene locus_tag LOCUS_07970 22870 21929 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_07970 23754 22867 gene locus_tag LOCUS_07980 23754 22867 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_07980 24964 23735 gene locus_tag LOCUS_07990 gene argJ 24964 23735 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_07990 25297 25109 gene locus_tag LOCUS_08000 25297 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 25593 25297 gene locus_tag LOCUS_08010 25593 25297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 26544 25795 gene locus_tag LOCUS_08020 26544 25795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 28273 26912 gene locus_tag LOCUS_08030 28273 26912 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_08030 28890 28423 gene locus_tag LOCUS_08040 28890 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 <34679 28967 gene locus_tag LOCUS_08050 <34679 28967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975001.1:calcium-binding protein >Feature sequence018 2052 271 gene locus_tag LOCUS_08060 gene ftsH 2052 271 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528329.1 protein_id gnl|my_center|LOCUS_08060 2465 2199 gene locus_tag LOCUS_08070 2465 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2745 2930 gene locus_tag LOCUS_08080 2745 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4726 2978 gene locus_tag LOCUS_08090 gene polX 4726 2978 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_08090 5137 5427 gene locus_tag LOCUS_08100 gene groES 5137 5427 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235240.1 protein_id gnl|my_center|LOCUS_08100 5562 7208 gene locus_tag LOCUS_08110 gene groL 5562 7208 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_08110 7857 10022 gene locus_tag LOCUS_08120 7857 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10015 11280 gene locus_tag LOCUS_08130 10015 11280 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_08130 11292 11996 gene locus_tag LOCUS_08140 11292 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12141 13349 gene locus_tag LOCUS_08150 12141 13349 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_08150 13399 14481 gene locus_tag LOCUS_08160 13399 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 15178 14651 gene locus_tag LOCUS_08170 15178 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 15394 17154 gene locus_tag LOCUS_08180 15394 17154 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 protein_id gnl|my_center|LOCUS_08180 17151 17780 gene locus_tag LOCUS_08190 17151 17780 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_08190 18784 18017 gene locus_tag LOCUS_08200 gene dsbG 18784 18017 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 protein_id gnl|my_center|LOCUS_08200 19619 18792 gene locus_tag LOCUS_08210 19619 18792 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_08210 21409 19622 gene locus_tag LOCUS_08220 gene dsbD 21409 19622 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103572.1 protein_id gnl|my_center|LOCUS_08220 21519 22184 gene locus_tag LOCUS_08230 21519 22184 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_08230 22181 23509 gene locus_tag LOCUS_08240 22181 23509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_08240 27059 23808 gene locus_tag LOCUS_08250 27059 23808 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707057.1 protein_id gnl|my_center|LOCUS_08250 28209 27070 gene locus_tag LOCUS_08260 gene nrfD 28209 27070 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707058.1 protein_id gnl|my_center|LOCUS_08260 28929 28213 gene locus_tag LOCUS_08270 28929 28213 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 protein_id gnl|my_center|LOCUS_08270 29319 31232 gene locus_tag LOCUS_08280 29319 31232 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 protein_id gnl|my_center|LOCUS_08280 32599 31229 gene locus_tag LOCUS_08290 32599 31229 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_08290 33428 32763 gene locus_tag LOCUS_08300 33428 32763 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_08300 33563 33868 gene locus_tag LOCUS_08310 33563 33868 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942988.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence019 1363 218 gene locus_tag LOCUS_08320 gene ccsB 1363 218 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197914.1 protein_id gnl|my_center|LOCUS_08320 3667 1568 gene locus_tag LOCUS_08330 3667 1568 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 protein_id gnl|my_center|LOCUS_08330 4411 3788 gene locus_tag LOCUS_08340 4411 3788 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_08340 4508 5134 gene locus_tag LOCUS_08350 gene yihA 4508 5134 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_08350 5419 6423 gene locus_tag LOCUS_08360 gene hemB 5419 6423 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027069842.1 protein_id gnl|my_center|LOCUS_08360 7425 6652 gene locus_tag LOCUS_08370 7425 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8289 7639 gene locus_tag LOCUS_08380 8289 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942371.1 protein_id gnl|my_center|LOCUS_08380 10604 8298 gene locus_tag LOCUS_08390 10604 8298 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_08390 10809 11903 gene locus_tag LOCUS_08400 10809 11903 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_08400 11900 12481 gene locus_tag LOCUS_08410 gene pilN 11900 12481 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_08410 12478 13113 gene locus_tag LOCUS_08420 gene pilO 12478 13113 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 protein_id gnl|my_center|LOCUS_08420 13110 13634 gene locus_tag LOCUS_08430 gene pilP 13110 13634 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378849.1 protein_id gnl|my_center|LOCUS_08430 13643 15787 gene locus_tag LOCUS_08440 gene pilQ 13643 15787 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_08440 15999 16520 gene locus_tag LOCUS_08450 15999 16520 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_08450 16786 17874 gene locus_tag LOCUS_08460 gene aroB 16786 17874 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_08460 17867 18991 gene locus_tag LOCUS_08470 17867 18991 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_08470 19162 20646 gene locus_tag LOCUS_08480 19162 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 20947 21225 gene locus_tag LOCUS_08490 20947 21225 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213585.1 protein_id gnl|my_center|LOCUS_08490 21200 21475 gene locus_tag LOCUS_08500 21200 21475 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 protein_id gnl|my_center|LOCUS_08500 21581 21901 gene locus_tag LOCUS_08510 21581 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530500.1 protein_id gnl|my_center|LOCUS_08510 22037 22249 gene locus_tag LOCUS_08520 22037 22249 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_08520 22562 26995 gene locus_tag LOCUS_08530 gene gltB 22562 26995 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_08530 27009 28418 gene locus_tag LOCUS_08540 27009 28418 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_08540 28426 29490 gene locus_tag LOCUS_08550 gene hemE 28426 29490 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence020 973 119 gene locus_tag LOCUS_08560 gene motD 973 119 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_08560 1737 997 gene locus_tag LOCUS_08570 1737 997 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_08570 2503 1790 gene locus_tag LOCUS_08580 2503 1790 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_08580 3415 2513 gene locus_tag LOCUS_08590 3415 2513 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 protein_id gnl|my_center|LOCUS_08590 4718 3393 gene locus_tag LOCUS_08600 4718 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6799 4715 gene locus_tag LOCUS_08610 gene flhA 6799 4715 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_08610 7938 6796 gene locus_tag LOCUS_08620 gene flhB 7938 6796 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_08620 8278 8084 gene locus_tag LOCUS_08630 gene iscX 8278 8084 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872176.1 protein_id gnl|my_center|LOCUS_08630 8627 8289 gene locus_tag LOCUS_08640 gene fdx 8627 8289 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_08640 10497 8629 gene locus_tag LOCUS_08650 gene hscA 10497 8629 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193590.1 protein_id gnl|my_center|LOCUS_08650 11143 10610 gene locus_tag LOCUS_08660 gene hscB 11143 10610 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_08660 11486 11163 gene locus_tag LOCUS_08670 gene iscA 11486 11163 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_08670 11924 11514 gene locus_tag LOCUS_08680 gene iscU 11924 11514 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_08680 13174 11948 gene locus_tag LOCUS_08690 13174 11948 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_08690 14410 13205 gene locus_tag LOCUS_08700 14410 13205 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_08700 14879 14391 gene locus_tag LOCUS_08710 gene iscR 14879 14391 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_08710 15683 14931 gene locus_tag LOCUS_08720 gene cysE 15683 14931 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_08720 16487 15750 gene locus_tag LOCUS_08730 gene trmJ 16487 15750 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_08730 16558 17352 gene locus_tag LOCUS_08740 16558 17352 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_08740 17857 21267 gene locus_tag LOCUS_08750 17857 21267 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_08750 21281 21526 gene locus_tag LOCUS_08760 21281 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 21523 21873 gene locus_tag LOCUS_08770 21523 21873 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_08770 21870 25253 gene locus_tag LOCUS_08780 21870 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 25250 25771 gene locus_tag LOCUS_08790 25250 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 26746 27669 gene locus_tag LOCUS_08800 26746 27669 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_08800 27662 27811 gene locus_tag LOCUS_08810 27662 27811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence021 1173 136 gene locus_tag LOCUS_08820 1173 136 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_08820 1813 1253 gene locus_tag LOCUS_08830 1813 1253 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_08830 2394 1909 gene locus_tag LOCUS_08840 2394 1909 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_08840 2752 2420 gene locus_tag LOCUS_08850 2752 2420 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_08850 4079 2856 gene locus_tag LOCUS_08860 4079 2856 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 protein_id gnl|my_center|LOCUS_08860 5111 4188 gene locus_tag LOCUS_08870 gene argF 5111 4188 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_08870 6295 5132 gene locus_tag LOCUS_08880 6295 5132 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931526.1 protein_id gnl|my_center|LOCUS_08880 6899 6636 gene locus_tag LOCUS_08890 gene rpsT 6899 6636 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_08890 7200 7913 gene locus_tag LOCUS_08900 7200 7913 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_08900 7944 9248 gene locus_tag LOCUS_08910 7944 9248 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_08910 9235 10356 gene locus_tag LOCUS_08920 9235 10356 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_08920 10573 11049 gene locus_tag LOCUS_08930 10573 11049 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_08930 12029 11046 gene locus_tag LOCUS_08940 12029 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_08940 12719 12507 gene locus_tag LOCUS_08950 12719 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13533 12823 gene locus_tag LOCUS_08960 13533 12823 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_08960 13551 14204 gene locus_tag LOCUS_08970 13551 14204 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_08970 14260 14511 gene locus_tag LOCUS_08980 14260 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15597 14761 gene locus_tag LOCUS_08990 gene folE2 15597 14761 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_08990 17496 15655 gene locus_tag LOCUS_09000 gene dxs 17496 15655 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_09000 18471 17623 gene locus_tag LOCUS_09010 18471 17623 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_09010 18757 18506 gene locus_tag LOCUS_09020 18757 18506 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813109.1 protein_id gnl|my_center|LOCUS_09020 18939 19787 gene locus_tag LOCUS_09030 18939 19787 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 protein_id gnl|my_center|LOCUS_09030 20012 20359 gene locus_tag LOCUS_09040 20012 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 20364 20741 gene locus_tag LOCUS_09050 20364 20741 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_09050 20824 22122 gene locus_tag LOCUS_09060 20824 22122 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243792.1 protein_id gnl|my_center|LOCUS_09060 22798 22094 gene locus_tag LOCUS_09070 gene nfi 22798 22094 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_09070 23118 24488 gene locus_tag LOCUS_09080 gene purB 23118 24488 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_09080 24969 24643 gene locus_tag LOCUS_09090 24969 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 25608 24973 gene locus_tag LOCUS_09100 25608 24973 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093241.1 protein_id gnl|my_center|LOCUS_09100 26651 25710 gene locus_tag LOCUS_09110 gene secF 26651 25710 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_09110 28436 26751 gene locus_tag LOCUS_09120 gene secD 28436 26751 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930154.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence022 648 1361 gene locus_tag LOCUS_09130 648 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1407 3311 gene locus_tag LOCUS_09140 1407 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3548 4402 gene locus_tag LOCUS_09150 3548 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4377 4604 gene locus_tag LOCUS_09160 4377 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5198 4638 gene locus_tag LOCUS_09170 5198 4638 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_09170 6911 5364 gene locus_tag LOCUS_09180 6911 5364 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_09180 8519 7071 gene locus_tag LOCUS_09190 8519 7071 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_09190 9180 8521 gene locus_tag LOCUS_09200 9180 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_09200 10129 9182 gene locus_tag LOCUS_09210 10129 9182 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_09210 12138 10126 gene locus_tag LOCUS_09220 gene hyfB 12138 10126 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_09220 14320 12173 gene locus_tag LOCUS_09230 14320 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 18005 14877 gene locus_tag LOCUS_09240 18005 14877 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_09240 19673 18018 gene locus_tag LOCUS_09250 19673 18018 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_09250 20965 19670 gene locus_tag LOCUS_09260 20965 19670 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_09260 21760 21416 gene locus_tag LOCUS_09270 21760 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 22222 21782 gene locus_tag LOCUS_09280 22222 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 22854 22327 gene locus_tag LOCUS_09290 22854 22327 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968682.1 protein_id gnl|my_center|LOCUS_09290 23056 23727 gene locus_tag LOCUS_09300 23056 23727 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_09300 23724 25130 gene locus_tag LOCUS_09310 gene irlS 23724 25130 CDS product heavy metal sensor histidine kinase IrlS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971776.1 protein_id gnl|my_center|LOCUS_09310 25250 26728 gene locus_tag LOCUS_09320 25250 26728 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence023 143 328 gene locus_tag LOCUS_09330 143 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1436 573 gene locus_tag LOCUS_09340 gene rpoH 1436 573 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_09340 2409 1729 gene locus_tag LOCUS_09350 2409 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3032 3535 gene locus_tag LOCUS_09360 3032 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4051 3626 gene locus_tag LOCUS_09370 4051 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5231 4323 gene locus_tag LOCUS_09380 gene ftsX 5231 4323 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_09380 5902 5228 gene locus_tag LOCUS_09390 gene ftsE 5902 5228 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225752.1 protein_id gnl|my_center|LOCUS_09390 6308 8467 gene locus_tag LOCUS_09400 6308 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 8748 8539 gene locus_tag LOCUS_09410 8748 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8728 10719 gene locus_tag LOCUS_09420 8728 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11734 10766 gene locus_tag LOCUS_09430 11734 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 11801 13177 gene locus_tag LOCUS_09440 11801 13177 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_09440 13167 14552 gene locus_tag LOCUS_09450 13167 14552 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_09450 14718 15260 gene locus_tag LOCUS_09460 gene rsmD 14718 15260 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195251.1 protein_id gnl|my_center|LOCUS_09460 15268 15750 gene locus_tag LOCUS_09470 gene coaD 15268 15750 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_09470 15771 16022 gene locus_tag LOCUS_09480 15771 16022 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_09480 18065 16101 gene locus_tag LOCUS_09490 18065 16101 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_09490 19011 18196 gene locus_tag LOCUS_09500 gene mutM 19011 18196 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_09500 19845 19015 gene locus_tag LOCUS_09510 19845 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 21209 19842 gene locus_tag LOCUS_09520 21209 19842 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_09520 21943 21206 gene locus_tag LOCUS_09530 21943 21206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557338.1 protein_id gnl|my_center|LOCUS_09530 24126 22126 gene locus_tag LOCUS_09540 24126 22126 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_09540 25112 24120 gene locus_tag LOCUS_09550 25112 24120 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_09550 25557 25778 gene locus_tag LOCUS_09560 25557 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 25771 25995 gene locus_tag LOCUS_09570 25771 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 25992 26282 gene locus_tag LOCUS_09580 25992 26282 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 protein_id gnl|my_center|LOCUS_09580 26279 26632 gene locus_tag LOCUS_09590 26279 26632 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence024 2069 135 gene locus_tag LOCUS_09600 2069 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4094 2184 gene locus_tag LOCUS_09610 4094 2184 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_09610 5196 4213 gene locus_tag LOCUS_09620 5196 4213 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_09620 6006 5206 gene locus_tag LOCUS_09630 6006 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5893 6330 gene locus_tag LOCUS_09640 5893 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7769 6342 gene locus_tag LOCUS_09650 gene lpdA 7769 6342 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065168.1 protein_id gnl|my_center|LOCUS_09650 9005 7785 gene locus_tag LOCUS_09660 gene odhB 9005 7785 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_09660 11866 9032 gene locus_tag LOCUS_09670 11866 9032 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_09670 13203 11911 gene locus_tag LOCUS_09680 13203 11911 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455487.1 protein_id gnl|my_center|LOCUS_09680 13546 13241 gene locus_tag LOCUS_09690 13546 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 14288 13593 gene locus_tag LOCUS_09700 14288 13593 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221124.1 protein_id gnl|my_center|LOCUS_09700 16117 14357 gene locus_tag LOCUS_09710 gene sdhA 16117 14357 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065156.1 protein_id gnl|my_center|LOCUS_09710 16613 16263 gene locus_tag LOCUS_09720 gene sdhD 16613 16263 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_09720 16981 16607 gene locus_tag LOCUS_09730 gene sdhC 16981 16607 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_09730 18190 16994 gene locus_tag LOCUS_09740 18190 16994 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378855.1 protein_id gnl|my_center|LOCUS_09740 19027 18293 gene locus_tag LOCUS_09750 19027 18293 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_09750 19203 20093 gene locus_tag LOCUS_09760 gene prpB 19203 20093 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_09760 20090 21241 gene locus_tag LOCUS_09770 gene prpC 20090 21241 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_09770 21365 22825 gene locus_tag LOCUS_09780 gene prpD 21365 22825 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275893.1 protein_id gnl|my_center|LOCUS_09780 23381 22845 gene locus_tag LOCUS_09790 23381 22845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 23932 23393 gene locus_tag LOCUS_09800 23932 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 24079 24591 gene locus_tag LOCUS_09810 24079 24591 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_09810 24650 25546 gene locus_tag LOCUS_09820 24650 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 25582 26082 gene locus_tag LOCUS_09830 25582 26082 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_09830 <26629 26108 gene locus_tag LOCUS_09840 <26629 26108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_131641787.1:IS5 family transposase >Feature sequence025 514 2184 gene locus_tag LOCUS_09850 gene recN 514 2184 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_09850 2645 2181 gene locus_tag LOCUS_09860 2645 2181 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_09860 3037 2612 gene locus_tag LOCUS_09870 gene fur 3037 2612 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_09870 3348 3848 gene locus_tag LOCUS_09880 3348 3848 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113904.1 protein_id gnl|my_center|LOCUS_09880 3845 4651 gene locus_tag LOCUS_09890 gene dapB 3845 4651 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236618.1 protein_id gnl|my_center|LOCUS_09890 4751 5959 gene locus_tag LOCUS_09900 gene carA 4751 5959 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_09900 6093 9296 gene locus_tag LOCUS_09910 gene carB 6093 9296 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193866.1 protein_id gnl|my_center|LOCUS_09910 9356 9832 gene locus_tag LOCUS_09920 gene greA 9356 9832 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_09920 9894 10349 gene locus_tag LOCUS_09930 9894 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 10887 10588 gene locus_tag LOCUS_09940 10887 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10923 11552 gene locus_tag LOCUS_09950 10923 11552 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_09950 11612 13501 gene locus_tag LOCUS_09960 gene ftsH 11612 13501 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_09960 13608 14435 gene locus_tag LOCUS_09970 gene folP 13608 14435 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_09970 14432 15787 gene locus_tag LOCUS_09980 gene glmM 14432 15787 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_09980 15862 15996 gene locus_tag LOCUS_09990 15862 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 16189 16413 gene locus_tag LOCUS_10000 16189 16413 CDS product PP0621 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807805.1 protein_id gnl|my_center|LOCUS_10000 16465 18066 gene locus_tag LOCUS_10010 16465 18066 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_10010 18386 18610 gene locus_tag LOCUS_10020 18386 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 18617 23071 gene locus_tag LOCUS_10030 18617 23071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 23295 23930 gene locus_tag LOCUS_10040 23295 23930 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_10040 23988 24521 gene locus_tag LOCUS_10050 23988 24521 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369089.1 protein_id gnl|my_center|LOCUS_10050 24562 25167 gene locus_tag LOCUS_10060 24562 25167 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_10060 25787 25164 gene locus_tag LOCUS_10070 gene trmB 25787 25164 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527577.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence026 346 188 gene locus_tag LOCUS_10080 346 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 610 359 gene locus_tag LOCUS_10090 610 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2065 638 gene locus_tag LOCUS_10100 2065 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3785 2097 gene locus_tag LOCUS_10110 3785 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4067 3897 gene locus_tag LOCUS_10120 4067 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4417 4115 gene locus_tag LOCUS_10130 4417 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5060 4788 gene locus_tag LOCUS_10140 5060 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5729 5118 gene locus_tag LOCUS_10150 5729 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6021 6725 gene locus_tag LOCUS_10160 6021 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6788 8122 gene locus_tag LOCUS_10170 6788 8122 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_10170 8119 8826 gene locus_tag LOCUS_10180 gene ubiG 8119 8826 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_10180 9014 9664 gene locus_tag LOCUS_10190 gene gph 9014 9664 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_10190 9783 10241 gene locus_tag LOCUS_10200 9783 10241 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398951.1 protein_id gnl|my_center|LOCUS_10200 10245 12440 gene locus_tag LOCUS_10210 10245 12440 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_10210 12440 13441 gene locus_tag LOCUS_10220 12440 13441 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_10220 13438 14013 gene locus_tag LOCUS_10230 13438 14013 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_10230 14075 14447 gene locus_tag LOCUS_tm00010 14075 14447 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14617 14997 gene locus_tag LOCUS_10240 14617 14997 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 protein_id gnl|my_center|LOCUS_10240 14990 15298 gene locus_tag LOCUS_10250 14990 15298 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141642.1 protein_id gnl|my_center|LOCUS_10250 15608 17839 gene locus_tag LOCUS_10260 15608 17839 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_10260 17839 19179 gene locus_tag LOCUS_10270 17839 19179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 19181 20014 gene locus_tag LOCUS_10280 19181 20014 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228623.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 20011 20286 gene locus_tag LOCUS_10290 20011 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 20329 20874 gene locus_tag LOCUS_10300 20329 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 20772 21023 gene locus_tag LOCUS_10310 20772 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 22184 21039 gene locus_tag LOCUS_10320 22184 21039 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889012.1 protein_id gnl|my_center|LOCUS_10320 22345 22722 gene locus_tag LOCUS_10330 22345 22722 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_10330 22706 23041 gene locus_tag LOCUS_10340 22706 23041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 24179 23391 gene locus_tag LOCUS_10350 gene istB 24179 23391 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_10350 25708 24188 gene locus_tag LOCUS_10360 gene istA 25708 24188 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence027 505 945 gene locus_tag LOCUS_10370 gene crcB 505 945 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_10370 950 1273 gene locus_tag LOCUS_10380 950 1273 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554203.1 protein_id gnl|my_center|LOCUS_10380 1382 2974 gene locus_tag LOCUS_10390 1382 2974 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_10390 4600 3104 gene locus_tag LOCUS_10400 4600 3104 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_10400 4875 5291 gene locus_tag LOCUS_10410 4875 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5351 9337 gene locus_tag LOCUS_10420 gene purL 5351 9337 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_10420 9375 9596 gene locus_tag LOCUS_10430 9375 9596 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_10430 11632 9692 gene locus_tag LOCUS_10440 11632 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 11748 11939 gene locus_tag LOCUS_10450 11748 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 11936 12685 gene locus_tag LOCUS_10460 11936 12685 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_10460 12713 14134 gene locus_tag LOCUS_10470 12713 14134 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038211423.1 protein_id gnl|my_center|LOCUS_10470 14266 14397 gene locus_tag LOCUS_10480 14266 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 14411 16789 gene locus_tag LOCUS_10490 14411 16789 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_10490 16786 17571 gene locus_tag LOCUS_10500 16786 17571 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_10500 17573 17923 gene locus_tag LOCUS_10510 17573 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 17920 19068 gene locus_tag LOCUS_10520 17920 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 19250 20416 gene locus_tag LOCUS_10530 19250 20416 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 protein_id gnl|my_center|LOCUS_10530 20413 21963 gene locus_tag LOCUS_10540 20413 21963 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 protein_id gnl|my_center|LOCUS_10540 22127 22264 gene locus_tag LOCUS_10550 22127 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 22374 23081 gene locus_tag LOCUS_10560 22374 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 23479 24021 gene locus_tag LOCUS_10570 23479 24021 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950645.1 protein_id gnl|my_center|LOCUS_10570 24110 25216 gene locus_tag LOCUS_10580 24110 25216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 25306 25611 gene locus_tag LOCUS_10590 25306 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence028 608 1642 gene locus_tag LOCUS_10600 gene pheS 608 1642 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_10600 1711 4140 gene locus_tag LOCUS_10610 gene pheT 1711 4140 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_10610 4150 4476 gene locus_tag LOCUS_10620 4150 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 4451 4831 gene locus_tag LOCUS_10630 4451 4831 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_10630 4867 4943 gene locus_tag LOCUS_t00050 4867 4943 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5022 5765 gene locus_tag LOCUS_10640 gene surE 5022 5765 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527164.1 protein_id gnl|my_center|LOCUS_10640 5762 6418 gene locus_tag LOCUS_10650 5762 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6415 7458 gene locus_tag LOCUS_10660 6415 7458 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597567.1 protein_id gnl|my_center|LOCUS_10660 7515 8456 gene locus_tag LOCUS_10670 gene rpoS 7515 8456 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_10670 9126 8461 gene locus_tag LOCUS_10680 9126 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10029 9163 gene locus_tag LOCUS_10690 10029 9163 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_10690 10521 14750 gene locus_tag LOCUS_10700 10521 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 14743 15069 gene locus_tag LOCUS_10710 14743 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 15245 16087 gene locus_tag LOCUS_10720 15245 16087 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_10720 16096 17505 gene locus_tag LOCUS_10730 16096 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 17505 17807 gene locus_tag LOCUS_10740 17505 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 17804 19855 gene locus_tag LOCUS_10750 17804 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 19915 20301 gene locus_tag LOCUS_10760 19915 20301 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_10760 20375 21715 gene locus_tag LOCUS_10770 20375 21715 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188702.1 protein_id gnl|my_center|LOCUS_10770 21717 22322 gene locus_tag LOCUS_10780 21717 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 22301 22954 gene locus_tag LOCUS_10790 22301 22954 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_10790 22956 24176 gene locus_tag LOCUS_10800 22956 24176 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544542.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence029 2862 751 gene locus_tag LOCUS_10810 2862 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3934 3011 gene locus_tag LOCUS_10820 3934 3011 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_10820 4247 5623 gene locus_tag LOCUS_10830 4247 5623 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_10830 5821 6195 gene locus_tag LOCUS_10840 5821 6195 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_10840 6579 7352 gene locus_tag LOCUS_10850 6579 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7584 8624 gene locus_tag LOCUS_10860 7584 8624 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_10860 8635 9747 gene locus_tag LOCUS_10870 gene ald 8635 9747 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_10870 9942 10520 gene locus_tag LOCUS_10880 gene rsxA 9942 10520 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 protein_id gnl|my_center|LOCUS_10880 10611 11165 gene locus_tag LOCUS_10890 gene rsxB 10611 11165 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 protein_id gnl|my_center|LOCUS_10890 11126 12829 gene locus_tag LOCUS_10900 11126 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 12829 13854 gene locus_tag LOCUS_10910 gene rsxD 12829 13854 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 protein_id gnl|my_center|LOCUS_10910 13859 14503 gene locus_tag LOCUS_10920 gene rsxG 13859 14503 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261585.1 protein_id gnl|my_center|LOCUS_10920 14577 15278 gene locus_tag LOCUS_10930 14577 15278 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261584.1 protein_id gnl|my_center|LOCUS_10930 15610 16242 gene locus_tag LOCUS_10940 gene nth 15610 16242 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_10940 16378 17469 gene locus_tag LOCUS_10950 16378 17469 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_10950 17462 17884 gene locus_tag LOCUS_10960 17462 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 20014 18323 gene locus_tag LOCUS_10970 gene sulP 20014 18323 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_10970 20423 20223 gene locus_tag LOCUS_10980 20423 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 20694 22166 gene locus_tag LOCUS_10990 20694 22166 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_10990 22182 23585 gene locus_tag LOCUS_11000 22182 23585 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_11000 24337 23636 gene locus_tag LOCUS_11010 24337 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence030 642 1211 gene locus_tag LOCUS_11020 gene lolA 642 1211 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_11020 1204 2529 gene locus_tag LOCUS_11030 1204 2529 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 protein_id gnl|my_center|LOCUS_11030 2815 3603 gene locus_tag LOCUS_11040 2815 3603 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_11040 6495 3775 gene locus_tag LOCUS_11050 6495 3775 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 protein_id gnl|my_center|LOCUS_11050 9394 6743 gene locus_tag LOCUS_11060 9394 6743 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016714.1 protein_id gnl|my_center|LOCUS_11060 10375 9665 gene locus_tag LOCUS_11070 10375 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 11494 10490 gene locus_tag LOCUS_11080 11494 10490 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975792.1 protein_id gnl|my_center|LOCUS_11080 12843 11635 gene locus_tag LOCUS_11090 12843 11635 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_11090 13692 12988 gene locus_tag LOCUS_11100 13692 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_11100 14969 13704 gene locus_tag LOCUS_11110 14969 13704 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_11110 17208 14962 gene locus_tag LOCUS_11120 17208 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 17627 17283 gene locus_tag LOCUS_11130 17627 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11130 17922 17524 gene locus_tag LOCUS_11140 17922 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 19441 18101 gene locus_tag LOCUS_11150 19441 18101 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_11150 19904 19443 gene locus_tag LOCUS_11160 19904 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 20586 19939 gene locus_tag LOCUS_11170 20586 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 21675 20611 gene locus_tag LOCUS_11180 21675 20611 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_11180 22634 21684 gene locus_tag LOCUS_11190 22634 21684 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947898.1 protein_id gnl|my_center|LOCUS_11190 23617 22739 gene locus_tag LOCUS_11200 gene htpX 23617 22739 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence031 1254 88 gene locus_tag LOCUS_11210 1254 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2511 1261 gene locus_tag LOCUS_11220 2511 1261 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_11220 3708 2662 gene locus_tag LOCUS_11230 3708 2662 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_11230 5052 3772 gene locus_tag LOCUS_11240 gene hemL 5052 3772 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_11240 5890 5279 gene locus_tag LOCUS_11250 gene thiE 5890 5279 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_11250 6800 5967 gene locus_tag LOCUS_11260 6800 5967 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_11260 7181 7582 gene locus_tag LOCUS_11270 gene pilG 7181 7582 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_11270 7600 7965 gene locus_tag LOCUS_11280 gene pilH 7600 7965 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_11280 8009 8533 gene locus_tag LOCUS_11290 8009 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8576 10726 gene locus_tag LOCUS_11300 gene pilJ 8576 10726 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_11300 10740 16289 gene locus_tag LOCUS_11310 10740 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17109 16282 gene locus_tag LOCUS_11320 17109 16282 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_11320 18983 17112 gene locus_tag LOCUS_11330 gene thiC 18983 17112 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_11330 19176 19841 gene locus_tag LOCUS_11340 19176 19841 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_11340 19930 21258 gene locus_tag LOCUS_11350 19930 21258 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_11350 22598 21336 gene locus_tag LOCUS_11360 gene waaA 22598 21336 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_11360 <23590 22595 gene locus_tag LOCUS_11370 <23590 22595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530067.1:lipopolysaccharide heptosyltransferase I >Feature sequence032 1083 19 gene locus_tag LOCUS_11380 1083 19 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_11380 2032 1085 gene locus_tag LOCUS_11390 2032 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2502 2071 gene locus_tag LOCUS_11400 2502 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3087 2503 gene locus_tag LOCUS_11410 3087 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3975 3097 gene locus_tag LOCUS_11420 3975 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4867 4181 gene locus_tag LOCUS_11430 4867 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5268 4876 gene locus_tag LOCUS_11440 5268 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 7672 5348 gene locus_tag LOCUS_11450 7672 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8895 7867 gene locus_tag LOCUS_11460 8895 7867 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_11460 9980 9066 gene locus_tag LOCUS_11470 9980 9066 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_11470 11405 10257 gene locus_tag LOCUS_11480 11405 10257 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_11480 11858 13696 gene locus_tag LOCUS_11490 11858 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 13792 15036 gene locus_tag LOCUS_11500 13792 15036 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_11500 15329 16609 gene locus_tag LOCUS_11510 15329 16609 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_11510 16606 17574 gene locus_tag LOCUS_11520 16606 17574 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_11520 17571 18386 gene locus_tag LOCUS_11530 gene lolD 17571 18386 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_11530 18442 20796 gene locus_tag LOCUS_11540 18442 20796 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 protein_id gnl|my_center|LOCUS_11540 20980 23184 gene locus_tag LOCUS_11550 20980 23184 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695653.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence033 467 1807 gene locus_tag LOCUS_11560 467 1807 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_11560 2880 1984 gene locus_tag LOCUS_11570 gene prmB 2880 1984 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_11570 4013 2877 gene locus_tag LOCUS_11580 gene dapE 4013 2877 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 protein_id gnl|my_center|LOCUS_11580 4417 4013 gene locus_tag LOCUS_11590 4417 4013 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_11590 4786 8004 gene locus_tag LOCUS_11600 4786 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 9791 8007 gene locus_tag LOCUS_11610 9791 8007 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_11610 10285 9926 gene locus_tag LOCUS_11620 10285 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 13482 10441 gene locus_tag LOCUS_11630 13482 10441 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_11630 14794 13973 gene locus_tag LOCUS_11640 gene dapD 14794 13973 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 protein_id gnl|my_center|LOCUS_11640 16087 14894 gene locus_tag LOCUS_11650 gene dapC 16087 14894 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_11650 16284 17192 gene locus_tag LOCUS_11660 16284 17192 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_11660 17709 17149 gene locus_tag LOCUS_11670 17709 17149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 19012 17711 gene locus_tag LOCUS_11680 19012 17711 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_11680 19495 19079 gene locus_tag LOCUS_11690 gene queF 19495 19079 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918896.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence034 191 499 gene locus_tag LOCUS_11700 gene rpsJ 191 499 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_11700 685 1329 gene locus_tag LOCUS_11710 gene rplC 685 1329 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_11710 1329 1949 gene locus_tag LOCUS_11720 gene rplD 1329 1949 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 protein_id gnl|my_center|LOCUS_11720 1946 2257 gene locus_tag LOCUS_11730 gene rplW 1946 2257 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_11730 2268 3101 gene locus_tag LOCUS_11740 gene rplB 2268 3101 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_11740 3107 3382 gene locus_tag LOCUS_11750 gene rpsS 3107 3382 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_11750 3391 3723 gene locus_tag LOCUS_11760 gene rplV 3391 3723 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199272.1 protein_id gnl|my_center|LOCUS_11760 3734 4444 gene locus_tag LOCUS_11770 gene rpsC 3734 4444 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_11770 4428 4844 gene locus_tag LOCUS_11780 gene rplP 4428 4844 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_11780 4848 5042 gene locus_tag LOCUS_11790 gene rpmC 4848 5042 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_11790 5039 5302 gene locus_tag LOCUS_11800 gene rpsQ 5039 5302 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 protein_id gnl|my_center|LOCUS_11800 5450 5818 gene locus_tag LOCUS_11810 gene rplN 5450 5818 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_11810 5830 6147 gene locus_tag LOCUS_11820 gene rplX 5830 6147 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021594.1 protein_id gnl|my_center|LOCUS_11820 6157 6696 gene locus_tag LOCUS_11830 gene rplE 6157 6696 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_11830 6704 7009 gene locus_tag LOCUS_11840 gene rpsN 6704 7009 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 protein_id gnl|my_center|LOCUS_11840 7028 7417 gene locus_tag LOCUS_11850 gene rpsH 7028 7417 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_11850 7429 7962 gene locus_tag LOCUS_11860 gene rplF 7429 7962 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064757.1 protein_id gnl|my_center|LOCUS_11860 7978 8331 gene locus_tag LOCUS_11870 gene rplR 7978 8331 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_11870 8341 8853 gene locus_tag LOCUS_11880 gene rpsE 8341 8853 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 protein_id gnl|my_center|LOCUS_11880 8857 9051 gene locus_tag LOCUS_11890 gene rpmD 8857 9051 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_11890 9053 9493 gene locus_tag LOCUS_11900 gene rplO 9053 9493 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_11900 9522 10826 gene locus_tag LOCUS_11910 gene secY 9522 10826 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_11910 10851 11069 gene locus_tag LOCUS_11920 gene infA 10851 11069 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 protein_id gnl|my_center|LOCUS_11920 11275 11637 gene locus_tag LOCUS_11930 gene rpsM 11275 11637 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_11930 11664 12053 gene locus_tag LOCUS_11940 gene rpsK 11664 12053 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_11940 12090 12716 gene locus_tag LOCUS_11950 gene rpsD 12090 12716 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_11950 12747 13733 gene locus_tag LOCUS_11960 gene rpoA 12747 13733 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_11960 13861 14250 gene locus_tag LOCUS_11970 gene rplQ 13861 14250 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_11970 17156 14313 gene locus_tag LOCUS_11980 gene uvrA 17156 14313 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_11980 17198 18577 gene locus_tag LOCUS_11990 17198 18577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951164.1 protein_id gnl|my_center|LOCUS_11990 18579 19028 gene locus_tag LOCUS_12000 gene ssb 18579 19028 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_12000 20739 19117 gene locus_tag LOCUS_12010 20739 19117 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_12010 20916 21872 gene locus_tag LOCUS_12020 gene ylqF 20916 21872 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_12020 21869 22087 gene locus_tag LOCUS_12030 21869 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence035 <1 1170 gene locus_tag LOCUS_12040 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813700.1:phosphopyruvate hydratase 1173 1499 gene locus_tag LOCUS_12050 1173 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2484 1543 gene locus_tag LOCUS_12060 2484 1543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226288.1 protein_id gnl|my_center|LOCUS_12060 2658 4079 gene locus_tag LOCUS_12070 2658 4079 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_12070 4134 4224 gene locus_tag LOCUS_t00060 4134 4224 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4384 5982 gene locus_tag LOCUS_12080 gene dnaX 4384 5982 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957718.1 protein_id gnl|my_center|LOCUS_12080 5992 6318 gene locus_tag LOCUS_12090 5992 6318 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_12090 6342 6980 gene locus_tag LOCUS_12100 gene recR 6342 6980 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_12100 7252 8388 gene locus_tag LOCUS_12110 7252 8388 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_12110 8385 9170 gene locus_tag LOCUS_12120 8385 9170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_12120 9155 10057 gene locus_tag LOCUS_12130 9155 10057 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771786.1 protein_id gnl|my_center|LOCUS_12130 10068 10727 gene locus_tag LOCUS_12140 10068 10727 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947760.1 protein_id gnl|my_center|LOCUS_12140 10929 14090 gene locus_tag LOCUS_12150 10929 14090 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764794.1 protein_id gnl|my_center|LOCUS_12150 14077 14427 gene locus_tag LOCUS_12160 14077 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 17977 14513 gene locus_tag LOCUS_12170 17977 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_12170 18304 18459 gene locus_tag LOCUS_12180 18304 18459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 19380 18670 gene locus_tag LOCUS_12190 19380 18670 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 protein_id gnl|my_center|LOCUS_12190 20433 19552 gene locus_tag LOCUS_12200 20433 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 <21831 20643 gene locus_tag LOCUS_12210 <21831 20643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943146.1:tetratricopeptide repeat protein >Feature sequence036 3308 987 gene locus_tag LOCUS_12220 3308 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3210 3437 gene locus_tag LOCUS_12230 3210 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3581 4807 gene locus_tag LOCUS_12240 3581 4807 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_12240 5759 4842 gene locus_tag LOCUS_12250 5759 4842 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_12250 7276 5996 gene locus_tag LOCUS_12260 gene ccmI 7276 5996 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_12260 7737 7273 gene locus_tag LOCUS_12270 7737 7273 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811409.1 protein_id gnl|my_center|LOCUS_12270 8258 7734 gene locus_tag LOCUS_12280 8258 7734 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_12280 10180 8255 gene locus_tag LOCUS_12290 10180 8255 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_12290 10638 10180 gene locus_tag LOCUS_12300 gene ccmE 10638 10180 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_12300 10816 10622 gene locus_tag LOCUS_12310 10816 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 11559 10813 gene locus_tag LOCUS_12320 gene ccmC 11559 10813 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_12320 12230 11556 gene locus_tag LOCUS_12330 gene ccmB 12230 11556 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928682.1 protein_id gnl|my_center|LOCUS_12330 12844 12227 gene locus_tag LOCUS_12340 gene ccmA 12844 12227 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 protein_id gnl|my_center|LOCUS_12340 13715 13119 gene locus_tag LOCUS_12350 13715 13119 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818147.1 protein_id gnl|my_center|LOCUS_12350 16075 13940 gene locus_tag LOCUS_12360 16075 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 16971 16096 gene locus_tag LOCUS_12370 16971 16096 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_12370 17188 18603 gene locus_tag LOCUS_12380 17188 18603 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401097.1 protein_id gnl|my_center|LOCUS_12380 18596 19318 gene locus_tag LOCUS_12390 18596 19318 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528674.1 protein_id gnl|my_center|LOCUS_12390 20552 19680 gene locus_tag LOCUS_12400 20552 19680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_12400 <21612 20746 gene locus_tag LOCUS_12410 <21612 20746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810478.1:ATP-binding cassette domain-containing protein >Feature sequence037 394 2001 gene locus_tag LOCUS_12420 394 2001 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526341.1 protein_id gnl|my_center|LOCUS_12420 2025 2363 gene locus_tag LOCUS_12430 2025 2363 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_12430 3281 2454 gene locus_tag LOCUS_12440 3281 2454 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_12440 3280 4323 gene locus_tag LOCUS_12450 gene rluD 3280 4323 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247551.1 protein_id gnl|my_center|LOCUS_12450 4365 4808 gene locus_tag LOCUS_12460 4365 4808 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 protein_id gnl|my_center|LOCUS_12460 4861 5469 gene locus_tag LOCUS_12470 4861 5469 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_12470 5483 6289 gene locus_tag LOCUS_12480 gene pgeF 5483 6289 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_12480 6312 7094 gene locus_tag LOCUS_12490 6312 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 7250 7029 gene locus_tag LOCUS_12500 7250 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 9806 7482 gene locus_tag LOCUS_12510 9806 7482 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_12510 10309 9860 gene locus_tag LOCUS_12520 10309 9860 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244191.1 protein_id gnl|my_center|LOCUS_12520 11729 10560 gene locus_tag LOCUS_12530 11729 10560 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_12530 12274 13563 gene locus_tag LOCUS_12540 gene rimO 12274 13563 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_12540 13780 14238 gene locus_tag LOCUS_12550 13780 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 15675 14560 gene locus_tag LOCUS_12560 15675 14560 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_12560 15848 16573 gene locus_tag LOCUS_12570 15848 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 16642 17457 gene locus_tag LOCUS_12580 16642 17457 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_12580 19847 17493 gene locus_tag LOCUS_12590 19847 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 20873 20070 gene locus_tag LOCUS_12600 gene nirQ 20873 20070 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_12600 21356 21000 gene locus_tag LOCUS_12610 21356 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence038 637 281 gene locus_tag LOCUS_12620 637 281 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_12620 1859 609 gene locus_tag LOCUS_12630 1859 609 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_12630 1896 2864 gene locus_tag LOCUS_12640 1896 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_12640 3179 3613 gene locus_tag LOCUS_12650 3179 3613 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_12650 3986 4846 gene locus_tag LOCUS_12660 3986 4846 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_12660 5135 4866 gene locus_tag LOCUS_12670 5135 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5862 5137 gene locus_tag LOCUS_12680 5862 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7400 5889 gene locus_tag LOCUS_12690 7400 5889 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_12690 9927 7420 gene locus_tag LOCUS_12700 9927 7420 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_12700 10090 12801 gene locus_tag LOCUS_12710 10090 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 13001 14872 gene locus_tag LOCUS_12720 13001 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 16442 14898 gene locus_tag LOCUS_12730 gene ubiB 16442 14898 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_12730 17147 16488 gene locus_tag LOCUS_12740 17147 16488 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853232.1 protein_id gnl|my_center|LOCUS_12740 18099 17275 gene locus_tag LOCUS_12750 18099 17275 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064917.1 protein_id gnl|my_center|LOCUS_12750 18945 18118 gene locus_tag LOCUS_12760 gene ubiE 18945 18118 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 protein_id gnl|my_center|LOCUS_12760 18944 19639 gene locus_tag LOCUS_12770 gene phoB 18944 19639 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_12770 19824 21152 gene locus_tag LOCUS_12780 gene phoR 19824 21152 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence039 1041 1649 gene locus_tag LOCUS_12790 1041 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_12790 1654 2199 gene locus_tag LOCUS_12800 1654 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2596 3213 gene locus_tag LOCUS_12810 2596 3213 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_12810 3210 4550 gene locus_tag LOCUS_12820 3210 4550 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_12820 4987 5469 gene locus_tag LOCUS_12830 4987 5469 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_12830 5790 5981 gene locus_tag LOCUS_12840 5790 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7427 6126 gene locus_tag LOCUS_12850 7427 6126 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_12850 9301 7439 gene locus_tag LOCUS_12860 9301 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10990 9320 gene locus_tag LOCUS_12870 gene ilvB 10990 9320 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272051.1 protein_id gnl|my_center|LOCUS_12870 11285 11136 gene locus_tag LOCUS_12880 11285 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11565 12398 gene locus_tag LOCUS_12890 11565 12398 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 protein_id gnl|my_center|LOCUS_12890 12519 12785 gene locus_tag LOCUS_12900 12519 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 13172 12960 gene locus_tag LOCUS_12910 13172 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 13998 13270 gene locus_tag LOCUS_12920 13998 13270 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_12920 15425 13995 gene locus_tag LOCUS_12930 15425 13995 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_12930 15855 15433 gene locus_tag LOCUS_12940 15855 15433 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_12940 16436 16233 gene locus_tag LOCUS_12950 16436 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 16995 17948 gene locus_tag LOCUS_12960 gene rpoS 16995 17948 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_12960 19053 18280 gene locus_tag LOCUS_12970 19053 18280 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705470.1 protein_id gnl|my_center|LOCUS_12970 20265 19096 gene locus_tag LOCUS_12980 20265 19096 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921970.1 protein_id gnl|my_center|LOCUS_12980 20582 20262 gene locus_tag LOCUS_12990 20582 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence040 264 710 gene locus_tag LOCUS_13000 264 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1769 1041 gene locus_tag LOCUS_13010 1769 1041 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_13010 1768 1938 gene locus_tag LOCUS_13020 1768 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2221 1955 gene locus_tag LOCUS_13030 2221 1955 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040245.1 protein_id gnl|my_center|LOCUS_13030 2520 2218 gene locus_tag LOCUS_13040 2520 2218 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_13040 3077 2520 gene locus_tag LOCUS_13050 3077 2520 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_13050 3147 4064 gene locus_tag LOCUS_13060 3147 4064 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_13060 4067 4699 gene locus_tag LOCUS_13070 4067 4699 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_13070 4700 5344 gene locus_tag LOCUS_13080 4700 5344 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_13080 5363 6565 gene locus_tag LOCUS_13090 5363 6565 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_13090 6589 9003 gene locus_tag LOCUS_13100 gene lon 6589 9003 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_13100 9121 9918 gene locus_tag LOCUS_13110 9121 9918 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_13110 9905 10456 gene locus_tag LOCUS_13120 9905 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 10740 11588 gene locus_tag LOCUS_13130 10740 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11827 12528 gene locus_tag LOCUS_13140 11827 12528 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 protein_id gnl|my_center|LOCUS_13140 16891 12848 gene locus_tag LOCUS_13150 16891 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 20474 18297 gene locus_tag LOCUS_13160 gene katG 20474 18297 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence041 434 18 gene locus_tag LOCUS_13170 434 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1538 567 gene locus_tag LOCUS_13180 gene moaA 1538 567 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_13180 2289 1558 gene locus_tag LOCUS_13190 2289 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2864 2304 gene locus_tag LOCUS_13200 2864 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3835 2861 gene locus_tag LOCUS_13210 3835 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6591 3847 gene locus_tag LOCUS_13220 6591 3847 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_13220 6922 6740 gene locus_tag LOCUS_13230 6922 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7895 6912 gene locus_tag LOCUS_13240 7895 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8232 7876 gene locus_tag LOCUS_13250 8232 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 10076 8235 gene locus_tag LOCUS_13260 10076 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 10719 10156 gene locus_tag LOCUS_13270 10719 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 11393 10701 gene locus_tag LOCUS_13280 11393 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 12561 11380 gene locus_tag LOCUS_13290 12561 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 13212 12586 gene locus_tag LOCUS_13300 13212 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 16147 13223 gene locus_tag LOCUS_13310 16147 13223 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255936.1 protein_id gnl|my_center|LOCUS_13310 16788 17615 gene locus_tag LOCUS_13320 gene phnD 16788 17615 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272622.1 protein_id gnl|my_center|LOCUS_13320 17612 19063 gene locus_tag LOCUS_13330 17612 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 19060 20412 gene locus_tag LOCUS_13340 gene pilR 19060 20412 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence042 841 548 gene locus_tag LOCUS_13350 841 548 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_13350 1185 838 gene locus_tag LOCUS_13360 1185 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3183 1765 gene locus_tag LOCUS_13370 3183 1765 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948197.1 protein_id gnl|my_center|LOCUS_13370 3642 3193 gene locus_tag LOCUS_13380 3642 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3623 3997 gene locus_tag LOCUS_13390 3623 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5024 4518 gene locus_tag LOCUS_13400 5024 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5692 5072 gene locus_tag LOCUS_13410 5692 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6020 9169 gene locus_tag LOCUS_13420 6020 9169 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_13420 9571 10032 gene locus_tag LOCUS_13430 9571 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 10216 10488 gene locus_tag LOCUS_13440 10216 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10729 11379 gene locus_tag LOCUS_13450 10729 11379 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022582.1 protein_id gnl|my_center|LOCUS_13450 11333 11755 gene locus_tag LOCUS_13460 11333 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12164 12409 gene locus_tag LOCUS_13470 12164 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 12399 13670 gene locus_tag LOCUS_13480 12399 13670 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_13480 14034 14255 gene locus_tag LOCUS_13490 14034 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 14255 14533 gene locus_tag LOCUS_13500 14255 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 14560 15093 gene locus_tag LOCUS_13510 14560 15093 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_13510 15199 15471 gene locus_tag LOCUS_13520 15199 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 15907 15722 gene locus_tag LOCUS_13530 15907 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 15966 17705 gene locus_tag LOCUS_13540 15966 17705 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_13540 18076 18765 gene locus_tag LOCUS_13550 18076 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence043 261 2612 gene locus_tag LOCUS_13560 261 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2615 3415 gene locus_tag LOCUS_13570 2615 3415 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_13570 4009 3716 gene locus_tag LOCUS_13580 4009 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4623 4006 gene locus_tag LOCUS_13590 4623 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 5047 4775 gene locus_tag LOCUS_13600 gene copZ 5047 4775 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_13600 7454 5070 gene locus_tag LOCUS_13610 gene copA1 7454 5070 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_13610 8202 7969 gene locus_tag LOCUS_13620 8202 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 8122 8721 gene locus_tag LOCUS_13630 gene phnF 8122 8721 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 protein_id gnl|my_center|LOCUS_13630 8759 9628 gene locus_tag LOCUS_13640 8759 9628 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_13640 9684 10463 gene locus_tag LOCUS_13650 gene phnC 9684 10463 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_13650 10516 11241 gene locus_tag LOCUS_13660 10516 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 11238 12044 gene locus_tag LOCUS_13670 gene phnE 11238 12044 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938614.1 protein_id gnl|my_center|LOCUS_13670 12044 12511 gene locus_tag LOCUS_13680 12044 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 12501 13064 gene locus_tag LOCUS_13690 gene phnH 12501 13064 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171604.1 protein_id gnl|my_center|LOCUS_13690 13066 14175 gene locus_tag LOCUS_13700 13066 14175 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 protein_id gnl|my_center|LOCUS_13700 14172 15059 gene locus_tag LOCUS_13710 14172 15059 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_13710 15056 15886 gene locus_tag LOCUS_13720 15056 15886 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_13720 15896 16618 gene locus_tag LOCUS_13730 gene phnL 15896 16618 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976256.1 protein_id gnl|my_center|LOCUS_13730 16615 17769 gene locus_tag LOCUS_13740 16615 17769 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_13740 17762 18334 gene locus_tag LOCUS_13750 gene phnN 17762 18334 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527702.1 protein_id gnl|my_center|LOCUS_13750 18338 19111 gene locus_tag LOCUS_13760 gene phnP 18338 19111 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104089.1 protein_id gnl|my_center|LOCUS_13760 19117 19974 gene locus_tag LOCUS_13770 19117 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence044 546 223 gene locus_tag LOCUS_13780 546 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1026 553 gene locus_tag LOCUS_13790 gene fliS 1026 553 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_13790 3052 1058 gene locus_tag LOCUS_13800 3052 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3529 3149 gene locus_tag LOCUS_13810 3529 3149 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_13810 5157 3613 gene locus_tag LOCUS_13820 5157 3613 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_13820 5674 8010 gene locus_tag LOCUS_13830 5674 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 9020 8007 gene locus_tag LOCUS_13840 9020 8007 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940158.1 protein_id gnl|my_center|LOCUS_13840 10355 9081 gene locus_tag LOCUS_13850 10355 9081 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_13850 11475 10369 gene locus_tag LOCUS_13860 11475 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11828 11529 gene locus_tag LOCUS_13870 11828 11529 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971862.1 protein_id gnl|my_center|LOCUS_13870 12048 11794 gene locus_tag LOCUS_13880 12048 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 13134 12139 gene locus_tag LOCUS_13890 gene iolG 13134 12139 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_13890 13869 13135 gene locus_tag LOCUS_13900 13869 13135 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_13900 14955 13903 gene locus_tag LOCUS_13910 gene pseI 14955 13903 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_13910 15431 14952 gene locus_tag LOCUS_13920 15431 14952 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867771.1 protein_id gnl|my_center|LOCUS_13920 16497 15445 gene locus_tag LOCUS_13930 gene pseG 16497 15445 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_13930 17126 16497 gene locus_tag LOCUS_13940 17126 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 17873 17136 gene locus_tag LOCUS_13950 17873 17136 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_13950 19027 17870 gene locus_tag LOCUS_13960 gene pseC 19027 17870 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_13960 20022 19024 gene locus_tag LOCUS_13970 gene pseB 20022 19024 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence045 236 162 gene locus_tag LOCUS_t00070 236 162 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 392 1783 gene locus_tag LOCUS_13980 gene gltX 392 1783 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532170.1 protein_id gnl|my_center|LOCUS_13980 1851 1926 gene locus_tag LOCUS_t00080 1851 1926 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1932 2007 gene locus_tag LOCUS_t00090 1932 2007 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2083 2159 gene locus_tag LOCUS_t00100 2083 2159 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2919 2203 gene locus_tag LOCUS_13990 2919 2203 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_13990 4163 2919 gene locus_tag LOCUS_14000 4163 2919 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_14000 5632 4160 gene locus_tag LOCUS_14010 5632 4160 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_14010 6350 5610 gene locus_tag LOCUS_14020 6350 5610 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_14020 7078 6425 gene locus_tag LOCUS_14030 7078 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7196 7393 gene locus_tag LOCUS_14040 7196 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7455 7709 gene locus_tag LOCUS_14050 7455 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8532 7825 gene locus_tag LOCUS_14060 gene dnaQ 8532 7825 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_14060 9168 8701 gene locus_tag LOCUS_14070 gene rnhA 9168 8701 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_14070 9936 9175 gene locus_tag LOCUS_14080 9936 9175 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_14080 9943 10704 gene locus_tag LOCUS_14090 gene gloB 9943 10704 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814736.1 protein_id gnl|my_center|LOCUS_14090 10896 12461 gene locus_tag LOCUS_14100 10896 12461 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192263.1 protein_id gnl|my_center|LOCUS_14100 14526 12481 gene locus_tag LOCUS_14110 14526 12481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_14110 15941 14535 gene locus_tag LOCUS_14120 15941 14535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_14120 17040 16063 gene locus_tag LOCUS_14130 17040 16063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_14130 19193 17037 gene locus_tag LOCUS_14140 19193 17037 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence046 499 221 gene locus_tag LOCUS_14150 499 221 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_14150 2189 534 gene locus_tag LOCUS_14160 gene rpsA 2189 534 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_14160 3069 2395 gene locus_tag LOCUS_14170 gene cmK 3069 2395 CDS product cytidylate kinase CmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189396.1 protein_id gnl|my_center|LOCUS_14170 4442 3081 gene locus_tag LOCUS_14180 4442 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14180 5316 4435 gene locus_tag LOCUS_14190 5316 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14190 6418 5402 gene locus_tag LOCUS_14200 gene aroF 6418 5402 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_14200 7524 6415 gene locus_tag LOCUS_14210 gene hisC 7524 6415 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_14210 8669 7599 gene locus_tag LOCUS_14220 gene pheA 8669 7599 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_14220 9744 8662 gene locus_tag LOCUS_14230 gene serC 9744 8662 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_14230 12417 9865 gene locus_tag LOCUS_14240 gene gyrA 12417 9865 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_14240 13985 12960 gene locus_tag LOCUS_14250 13985 12960 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_14250 14397 15401 gene locus_tag LOCUS_14260 14397 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15401 16480 gene locus_tag LOCUS_14270 15401 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 17944 16427 gene locus_tag LOCUS_14280 17944 16427 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_14280 19311 17941 gene locus_tag LOCUS_14290 19311 17941 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence047 161 589 gene locus_tag LOCUS_14300 161 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 586 1596 gene locus_tag LOCUS_14310 586 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1695 2576 gene locus_tag LOCUS_14320 gene glyQ 1695 2576 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_14320 2662 4725 gene locus_tag LOCUS_14330 gene glyS 2662 4725 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244319.1 protein_id gnl|my_center|LOCUS_14330 4738 5289 gene locus_tag LOCUS_14340 gene gmhB 4738 5289 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064982.1 protein_id gnl|my_center|LOCUS_14340 5471 6187 gene locus_tag LOCUS_14350 5471 6187 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_14350 6190 6930 gene locus_tag LOCUS_14360 6190 6930 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_14360 6941 7318 gene locus_tag LOCUS_14370 gene gloA 6941 7318 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_14370 7964 7449 gene locus_tag LOCUS_14380 7964 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 9581 9171 gene locus_tag LOCUS_14390 9581 9171 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_14390 9829 9581 gene locus_tag LOCUS_14400 9829 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 10699 9926 gene locus_tag LOCUS_14410 gene rsmA 10699 9926 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 protein_id gnl|my_center|LOCUS_14410 11696 10743 gene locus_tag LOCUS_14420 gene pdxA 11696 10743 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_14420 13136 11799 gene locus_tag LOCUS_14430 13136 11799 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_14430 15786 13231 gene locus_tag LOCUS_14440 15786 13231 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_14440 16096 17061 gene locus_tag LOCUS_14450 16096 17061 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_14450 17164 17823 gene locus_tag LOCUS_14460 17164 17823 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931409.1 protein_id gnl|my_center|LOCUS_14460 18138 19445 gene locus_tag LOCUS_14470 18138 19445 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence048 2820 1372 gene locus_tag LOCUS_14480 gene nifD 2820 1372 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_14480 3828 2953 gene locus_tag LOCUS_14490 gene nifH 3828 2953 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_14490 4282 5097 gene locus_tag LOCUS_14500 4282 5097 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 protein_id gnl|my_center|LOCUS_14500 5263 6159 gene locus_tag LOCUS_14510 gene draG 5263 6159 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_14510 6364 7116 gene locus_tag LOCUS_14520 gene modA 6364 7116 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_14520 7435 8118 gene locus_tag LOCUS_14530 gene modB 7435 8118 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_14530 8115 9191 gene locus_tag LOCUS_14540 gene modC 8115 9191 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_14540 10160 9324 gene locus_tag LOCUS_14550 10160 9324 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388754.1 protein_id gnl|my_center|LOCUS_14550 10372 10157 gene locus_tag LOCUS_14560 gene nifT 10372 10157 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_14560 10665 10369 gene locus_tag LOCUS_14570 10665 10369 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_14570 11038 10673 gene locus_tag LOCUS_14580 11038 10673 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533503.1 protein_id gnl|my_center|LOCUS_14580 11261 11049 gene locus_tag LOCUS_14590 11261 11049 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084569.1 protein_id gnl|my_center|LOCUS_14590 12934 11459 gene locus_tag LOCUS_14600 gene nifB 12934 11459 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_14600 14722 13091 gene locus_tag LOCUS_14610 gene nifA 14722 13091 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 protein_id gnl|my_center|LOCUS_14610 17484 15067 gene locus_tag LOCUS_14620 17484 15067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_14620 18760 17705 gene locus_tag LOCUS_14630 gene nagZ 18760 17705 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_14630 19424 19047 gene locus_tag LOCUS_14640 gene acpS 19424 19047 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence049 734 135 gene locus_tag LOCUS_14650 734 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 975 1538 gene locus_tag LOCUS_14660 975 1538 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_14660 3511 1601 gene locus_tag LOCUS_14670 gene htpG 3511 1601 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_14670 4501 3752 gene locus_tag LOCUS_14680 gene yecA 4501 3752 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 protein_id gnl|my_center|LOCUS_14680 5682 4498 gene locus_tag LOCUS_14690 5682 4498 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_14690 7676 5679 gene locus_tag LOCUS_14700 7676 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 10400 8256 gene locus_tag LOCUS_14710 10400 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 10999 10442 gene locus_tag LOCUS_14720 10999 10442 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526464.1 protein_id gnl|my_center|LOCUS_14720 11131 11586 gene locus_tag LOCUS_14730 11131 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 11886 11587 gene locus_tag LOCUS_14740 11886 11587 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359269.1 protein_id gnl|my_center|LOCUS_14740 13331 11883 gene locus_tag LOCUS_14750 gene nuoN 13331 11883 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_14750 14987 13506 gene locus_tag LOCUS_14760 14987 13506 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_14760 16985 14997 gene locus_tag LOCUS_14770 gene nuoL 16985 14997 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185765.1 protein_id gnl|my_center|LOCUS_14770 17381 17076 gene locus_tag LOCUS_14780 gene nuoK 17381 17076 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_14780 18027 17383 gene locus_tag LOCUS_14790 18027 17383 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689941.1 protein_id gnl|my_center|LOCUS_14790 18634 18146 gene locus_tag LOCUS_14800 gene nuoI 18634 18146 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_14800 18899 18636 gene locus_tag LOCUS_14810 18899 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence050 961 299 gene locus_tag LOCUS_14820 961 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2058 964 gene locus_tag LOCUS_14830 gene amrS 2058 964 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_14830 2712 2158 gene locus_tag LOCUS_14840 2712 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3517 2702 gene locus_tag LOCUS_14850 gene amrB 3517 2702 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_14850 3583 4275 gene locus_tag LOCUS_14860 gene ispD 3583 4275 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_14860 4272 4754 gene locus_tag LOCUS_14870 gene ispF 4272 4754 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_14870 4769 5803 gene locus_tag LOCUS_14880 4769 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 6276 5809 gene locus_tag LOCUS_14890 6276 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6352 6711 gene locus_tag LOCUS_14900 6352 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 7848 7054 gene locus_tag LOCUS_14910 7848 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 8016 9650 gene locus_tag LOCUS_14920 8016 9650 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_14920 9691 10248 gene locus_tag LOCUS_14930 gene lolB 9691 10248 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_14930 10245 11081 gene locus_tag LOCUS_14940 gene ispE 10245 11081 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768868.1 protein_id gnl|my_center|LOCUS_14940 11082 11156 gene locus_tag LOCUS_t00110 11082 11156 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11265 12215 gene locus_tag LOCUS_14950 11265 12215 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_14950 12302 12919 gene locus_tag LOCUS_14960 12302 12919 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_14960 13156 13752 gene locus_tag LOCUS_14970 gene pth 13156 13752 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_14970 13942 14658 gene locus_tag LOCUS_14980 13942 14658 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207102.1 protein_id gnl|my_center|LOCUS_14980 14706 15797 gene locus_tag LOCUS_14990 gene ychF 14706 15797 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_14990 15877 16239 gene locus_tag LOCUS_15000 15877 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 16457 16533 gene locus_tag LOCUS_t00120 16457 16533 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16856 17092 gene locus_tag LOCUS_15010 16856 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 17104 18453 gene locus_tag LOCUS_15020 gene miaB 17104 18453 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809403.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence051 308 1933 gene locus_tag LOCUS_15030 308 1933 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_15030 2293 3558 gene locus_tag LOCUS_15040 2293 3558 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_15040 3596 5206 gene locus_tag LOCUS_15050 3596 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 5327 9082 gene locus_tag LOCUS_15060 5327 9082 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193149.1 protein_id gnl|my_center|LOCUS_15060 9163 10713 gene locus_tag LOCUS_15070 gene narH 9163 10713 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_15070 10726 11244 gene locus_tag LOCUS_15080 10726 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11255 11950 gene locus_tag LOCUS_15090 gene narI 11255 11950 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 protein_id gnl|my_center|LOCUS_15090 12225 13382 gene locus_tag LOCUS_15100 12225 13382 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 protein_id gnl|my_center|LOCUS_15100 13503 14258 gene locus_tag LOCUS_15110 13503 14258 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_15110 14379 14867 gene locus_tag LOCUS_15120 14379 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 14934 17120 gene locus_tag LOCUS_15130 14934 17120 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_15130 17282 17674 gene locus_tag LOCUS_15140 17282 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence052 367 1620 gene locus_tag LOCUS_15150 367 1620 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_15150 2127 1885 gene locus_tag LOCUS_15160 2127 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2873 2166 gene locus_tag LOCUS_15170 gene phoB 2873 2166 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_15170 3329 3075 gene locus_tag LOCUS_15180 3329 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3652 4440 gene locus_tag LOCUS_15190 3652 4440 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_15190 5866 4655 gene locus_tag LOCUS_15200 5866 4655 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_15200 7662 5863 gene locus_tag LOCUS_15210 7662 5863 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550684.1 protein_id gnl|my_center|LOCUS_15210 13174 7820 gene locus_tag LOCUS_15220 13174 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 14041 13205 gene locus_tag LOCUS_15230 14041 13205 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_15230 15699 14053 gene locus_tag LOCUS_15240 gene tpsB1 15699 14053 CDS product two-partner secretion system transporter TpsB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115686.1 protein_id gnl|my_center|LOCUS_15240 16657 16571 gene locus_tag LOCUS_t00130 16657 16571 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16713 17741 gene locus_tag LOCUS_15250 gene queA 16713 17741 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence053 432 1331 gene locus_tag LOCUS_15260 432 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1356 1835 gene locus_tag LOCUS_15270 1356 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1840 3003 gene locus_tag LOCUS_15280 1840 3003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_15280 2996 3685 gene locus_tag LOCUS_15290 2996 3685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941338.1 protein_id gnl|my_center|LOCUS_15290 3678 4157 gene locus_tag LOCUS_15300 3678 4157 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_15300 4796 4197 gene locus_tag LOCUS_15310 4796 4197 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_15310 5469 4801 gene locus_tag LOCUS_15320 5469 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15320 6476 5466 gene locus_tag LOCUS_15330 6476 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 7073 6528 gene locus_tag LOCUS_15340 7073 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 7275 8462 gene locus_tag LOCUS_15350 7275 8462 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_15350 9146 8544 gene locus_tag LOCUS_15360 9146 8544 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_15360 11359 9233 gene locus_tag LOCUS_15370 11359 9233 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_15370 12192 11380 gene locus_tag LOCUS_15380 12192 11380 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_15380 13112 12201 gene locus_tag LOCUS_15390 13112 12201 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_15390 15245 13302 gene locus_tag LOCUS_15400 gene aprA 15245 13302 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_15400 15765 15361 gene locus_tag LOCUS_15410 gene aprB 15765 15361 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_15410 17132 15912 gene locus_tag LOCUS_15420 gene sat 17132 15912 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_15420 17560 17636 gene locus_tag LOCUS_t00140 17560 17636 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 199 603 gene locus_tag LOCUS_15430 gene flgB 199 603 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 protein_id gnl|my_center|LOCUS_15430 603 1013 gene locus_tag LOCUS_15440 gene flgC 603 1013 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 protein_id gnl|my_center|LOCUS_15440 1036 1695 gene locus_tag LOCUS_15450 gene flgD 1036 1695 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_15450 1708 3009 gene locus_tag LOCUS_15460 gene flgE 1708 3009 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_15460 3080 3823 gene locus_tag LOCUS_15470 gene flgF 3080 3823 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_15470 3837 4619 gene locus_tag LOCUS_15480 gene flgG 3837 4619 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367325.1 protein_id gnl|my_center|LOCUS_15480 4644 5357 gene locus_tag LOCUS_15490 gene flgH 4644 5357 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523041.1 protein_id gnl|my_center|LOCUS_15490 5744 6847 gene locus_tag LOCUS_15500 5744 6847 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_15500 6857 7747 gene locus_tag LOCUS_15510 gene flgJ 6857 7747 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 protein_id gnl|my_center|LOCUS_15510 7840 9795 gene locus_tag LOCUS_15520 gene flgK 7840 9795 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_15520 9805 11013 gene locus_tag LOCUS_15530 gene flgL 9805 11013 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200262.1 protein_id gnl|my_center|LOCUS_15530 11375 11151 gene locus_tag LOCUS_15540 11375 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 12616 11375 gene locus_tag LOCUS_15550 12616 11375 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_15550 14178 12709 gene locus_tag LOCUS_15560 gene adeC 14178 12709 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 protein_id gnl|my_center|LOCUS_15560 17296 14171 gene locus_tag LOCUS_15570 17296 14171 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence055 327 251 gene locus_tag LOCUS_t00150 327 251 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 463 371 gene locus_tag LOCUS_t00160 463 371 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1734 508 gene locus_tag LOCUS_15580 1734 508 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225078.1 protein_id gnl|my_center|LOCUS_15580 1935 2234 gene locus_tag LOCUS_15590 1935 2234 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 protein_id gnl|my_center|LOCUS_15590 3099 2248 gene locus_tag LOCUS_15600 3099 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3200 3667 gene locus_tag LOCUS_15610 gene queD 3200 3667 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_15610 3742 3653 gene locus_tag LOCUS_t00170 3742 3653 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3850 4539 gene locus_tag LOCUS_15620 3850 4539 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_15620 5887 4598 gene locus_tag LOCUS_15630 gene rlmD 5887 4598 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_15630 6846 6004 gene locus_tag LOCUS_15640 6846 6004 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_15640 7226 6804 gene locus_tag LOCUS_15650 7226 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7421 7236 gene locus_tag LOCUS_15660 7421 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9637 7619 gene locus_tag LOCUS_15670 9637 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10706 9717 gene locus_tag LOCUS_15680 10706 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11389 11018 gene locus_tag LOCUS_15690 11389 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12448 11453 gene locus_tag LOCUS_15700 gene rfaD 12448 11453 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544120.1 protein_id gnl|my_center|LOCUS_15700 13504 12575 gene locus_tag LOCUS_15710 gene rfaE1 13504 12575 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_15710 14932 13610 gene locus_tag LOCUS_15720 14932 13610 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_15720 15630 14929 gene locus_tag LOCUS_15730 gene pyrF 15630 14929 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687835.1 protein_id gnl|my_center|LOCUS_15730 16909 15710 gene locus_tag LOCUS_15740 gene lapB 16909 15710 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_15740 17322 17047 gene locus_tag LOCUS_15750 17322 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence056 275 535 gene locus_tag LOCUS_15760 275 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15760 1128 1439 gene locus_tag LOCUS_15770 1128 1439 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426919.1 protein_id gnl|my_center|LOCUS_15770 1460 3583 gene locus_tag LOCUS_15780 gene aas 1460 3583 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209843.1 protein_id gnl|my_center|LOCUS_15780 3580 4815 gene locus_tag LOCUS_15790 3580 4815 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_15790 4812 6044 gene locus_tag LOCUS_15800 gene lplT 4812 6044 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 protein_id gnl|my_center|LOCUS_15800 6100 6717 gene locus_tag LOCUS_15810 6100 6717 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_15810 6730 8484 gene locus_tag LOCUS_15820 6730 8484 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_15820 8484 9836 gene locus_tag LOCUS_15830 8484 9836 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_15830 9829 10323 gene locus_tag LOCUS_15840 9829 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 10337 10960 gene locus_tag LOCUS_15850 10337 10960 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 protein_id gnl|my_center|LOCUS_15850 10968 11912 gene locus_tag LOCUS_15860 10968 11912 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 protein_id gnl|my_center|LOCUS_15860 11956 13494 gene locus_tag LOCUS_15870 11956 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 13505 15007 gene locus_tag LOCUS_15880 13505 15007 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044930.1 protein_id gnl|my_center|LOCUS_15880 15571 17052 gene locus_tag LOCUS_15890 15571 17052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence057 1510 1112 gene locus_tag LOCUS_15900 gene apaG 1510 1112 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_15900 1598 2284 gene locus_tag LOCUS_15910 gene rpe 1598 2284 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_15910 2384 3073 gene locus_tag LOCUS_15920 2384 3073 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_15920 3213 4688 gene locus_tag LOCUS_15930 gene trpE 3213 4688 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_15930 4785 5357 gene locus_tag LOCUS_15940 4785 5357 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_15940 5836 6864 gene locus_tag LOCUS_15950 gene trpD 5836 6864 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217365.1 protein_id gnl|my_center|LOCUS_15950 6895 7278 gene locus_tag LOCUS_15960 6895 7278 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_15960 7355 8236 gene locus_tag LOCUS_15970 gene trpC 7355 8236 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 protein_id gnl|my_center|LOCUS_15970 8303 8593 gene locus_tag LOCUS_15980 8303 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 8656 8871 gene locus_tag LOCUS_15990 8656 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 9183 10313 gene locus_tag LOCUS_16000 9183 10313 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939921.1 protein_id gnl|my_center|LOCUS_16000 10743 11021 gene locus_tag LOCUS_16010 10743 11021 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_16010 11018 11395 gene locus_tag LOCUS_16020 11018 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 11684 11938 gene locus_tag LOCUS_16030 11684 11938 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_16030 12222 12347 gene locus_tag LOCUS_16040 12222 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 12350 12640 gene locus_tag LOCUS_16050 gene nadS 12350 12640 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_16050 12733 13434 gene locus_tag LOCUS_16060 12733 13434 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_16060 13674 13916 gene locus_tag LOCUS_16070 13674 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258616.1 protein_id gnl|my_center|LOCUS_16070 13913 14299 gene locus_tag LOCUS_16080 13913 14299 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_16080 15251 14379 gene locus_tag LOCUS_16090 15251 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 15891 15352 gene locus_tag LOCUS_16100 15891 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 16686 15931 gene locus_tag LOCUS_16110 16686 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence058 363 1499 gene locus_tag LOCUS_16120 363 1499 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_16120 1492 3195 gene locus_tag LOCUS_16130 1492 3195 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_16130 3595 3182 gene locus_tag LOCUS_16140 gene hemJ 3595 3182 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_16140 3826 4368 gene locus_tag LOCUS_16150 3826 4368 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_16150 5980 4373 gene locus_tag LOCUS_16160 5980 4373 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951119.1 protein_id gnl|my_center|LOCUS_16160 6131 7402 gene locus_tag LOCUS_16170 gene gshA 6131 7402 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_16170 8002 7571 gene locus_tag LOCUS_16180 8002 7571 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_16180 8205 9542 gene locus_tag LOCUS_16190 gene argA 8205 9542 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_16190 9562 10434 gene locus_tag LOCUS_16200 9562 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 10431 12887 gene locus_tag LOCUS_16210 10431 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 13109 13381 gene locus_tag LOCUS_16220 13109 13381 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_16220 13391 15469 gene locus_tag LOCUS_16230 gene ppk1 13391 15469 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence059 1202 933 gene locus_tag LOCUS_16240 1202 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2728 1238 gene locus_tag LOCUS_16250 2728 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3904 2852 gene locus_tag LOCUS_16260 3904 2852 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_16260 6307 3956 gene locus_tag LOCUS_16270 6307 3956 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_16270 6815 6375 gene locus_tag LOCUS_16280 6815 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 7562 6840 gene locus_tag LOCUS_16290 7562 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7935 7606 gene locus_tag LOCUS_16300 7935 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 8383 8033 gene locus_tag LOCUS_16310 8383 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11526 8440 gene locus_tag LOCUS_16320 11526 8440 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_16320 12774 11539 gene locus_tag LOCUS_16330 12774 11539 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_16330 14099 12804 gene locus_tag LOCUS_16340 14099 12804 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_16340 14538 14185 gene locus_tag LOCUS_16350 14538 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14651 15115 gene locus_tag LOCUS_16360 gene cadR 14651 15115 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_16360 15112 15453 gene locus_tag LOCUS_16370 15112 15453 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193459.1 protein_id gnl|my_center|LOCUS_16370 15750 15499 gene locus_tag LOCUS_16380 15750 15499 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272729.1 protein_id gnl|my_center|LOCUS_16380 16283 15888 gene locus_tag LOCUS_16390 16283 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 16675 16496 gene locus_tag LOCUS_16400 16675 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence060 1966 155 gene locus_tag LOCUS_16410 gene typA 1966 155 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688609.1 protein_id gnl|my_center|LOCUS_16410 2392 3699 gene locus_tag LOCUS_16420 2392 3699 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_16420 4091 3768 gene locus_tag LOCUS_16430 4091 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4570 4193 gene locus_tag LOCUS_16440 4570 4193 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_16440 5772 4573 gene locus_tag LOCUS_16450 gene purT 5772 4573 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_16450 8301 5806 gene locus_tag LOCUS_16460 8301 5806 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_16460 9159 8467 gene locus_tag LOCUS_16470 9159 8467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_16470 9158 9775 gene locus_tag LOCUS_16480 9158 9775 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247882.1 protein_id gnl|my_center|LOCUS_16480 10535 9723 gene locus_tag LOCUS_16490 10535 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 11226 10543 gene locus_tag LOCUS_16500 11226 10543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 protein_id gnl|my_center|LOCUS_16500 12151 11228 gene locus_tag LOCUS_16510 gene selD 12151 11228 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_16510 12305 13420 gene locus_tag LOCUS_16520 gene mnmH 12305 13420 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_16520 13470 13910 gene locus_tag LOCUS_16530 13470 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14475 13897 gene locus_tag LOCUS_16540 gene thpR 14475 13897 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_16540 14560 15018 gene locus_tag LOCUS_16550 14560 15018 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_16550 15032 16429 gene locus_tag LOCUS_16560 15032 16429 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence061 991 146 gene locus_tag LOCUS_16570 gene pstA 991 146 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_16570 1955 996 gene locus_tag LOCUS_16580 gene pstC 1955 996 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_16580 3103 2048 gene locus_tag LOCUS_16590 gene pstS 3103 2048 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_16590 3250 4095 gene locus_tag LOCUS_16600 gene tpiA 3250 4095 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_16600 4120 4491 gene locus_tag LOCUS_16610 gene secG 4120 4491 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_16610 4508 4592 gene locus_tag LOCUS_t00180 4508 4592 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4813 5103 gene locus_tag LOCUS_16620 4813 5103 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_16620 5333 5809 gene locus_tag LOCUS_16630 5333 5809 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215610.1 protein_id gnl|my_center|LOCUS_16630 5816 6403 gene locus_tag LOCUS_16640 5816 6403 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_16640 6396 7655 gene locus_tag LOCUS_16650 6396 7655 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_16650 7776 8249 gene locus_tag LOCUS_16660 gene nuoE 7776 8249 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_16660 8253 9536 gene locus_tag LOCUS_16670 gene nuoF 8253 9536 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_16670 9541 11883 gene locus_tag LOCUS_16680 gene nuoG 9541 11883 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_16680 11889 12926 gene locus_tag LOCUS_16690 gene nuoH 11889 12926 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_16690 13101 13589 gene locus_tag LOCUS_16700 gene nuoI 13101 13589 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_16700 13697 14341 gene locus_tag LOCUS_16710 13697 14341 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689941.1 protein_id gnl|my_center|LOCUS_16710 14343 14648 gene locus_tag LOCUS_16720 gene nuoK 14343 14648 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence062 23 1162 gene locus_tag LOCUS_16730 23 1162 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_16730 1559 1212 gene locus_tag LOCUS_16740 1559 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1920 1552 gene locus_tag LOCUS_16750 1920 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3652 1913 gene locus_tag LOCUS_16760 3652 1913 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461230.1 protein_id gnl|my_center|LOCUS_16760 4439 3828 gene locus_tag LOCUS_16770 4439 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5708 4491 gene locus_tag LOCUS_16780 5708 4491 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_16780 6655 5708 gene locus_tag LOCUS_16790 6655 5708 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_16790 8676 6664 gene locus_tag LOCUS_16800 8676 6664 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197235.1 protein_id gnl|my_center|LOCUS_16800 8720 10084 gene locus_tag LOCUS_16810 8720 10084 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_16810 11730 10219 gene locus_tag LOCUS_16820 gene ilvA 11730 10219 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_16820 11983 12381 gene locus_tag LOCUS_16830 11983 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 12558 13217 gene locus_tag LOCUS_16840 gene rpiA 12558 13217 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_16840 13301 14002 gene locus_tag LOCUS_16850 gene phoU 13301 14002 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 protein_id gnl|my_center|LOCUS_16850 14005 15489 gene locus_tag LOCUS_16860 gene ppx 14005 15489 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_16860 <16483 15743 gene locus_tag LOCUS_16870 <16483 15743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201217495.1:EAL domain-containing protein >Feature sequence063 741 154 gene locus_tag LOCUS_16880 gene sodB 741 154 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_16880 911 2449 gene locus_tag LOCUS_16890 gene murJ 911 2449 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211214.1 protein_id gnl|my_center|LOCUS_16890 2654 3577 gene locus_tag LOCUS_16900 2654 3577 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_16900 3656 6442 gene locus_tag LOCUS_16910 gene ileS 3656 6442 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812558.1 protein_id gnl|my_center|LOCUS_16910 6544 7020 gene locus_tag LOCUS_16920 gene lspA 6544 7020 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_16920 7030 7470 gene locus_tag LOCUS_16930 7030 7470 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_16930 7516 7872 gene locus_tag LOCUS_16940 7516 7872 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214610.1 protein_id gnl|my_center|LOCUS_16940 7909 8829 gene locus_tag LOCUS_16950 gene ispH 7909 8829 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_16950 9111 8866 gene locus_tag LOCUS_16960 9111 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 9225 9794 gene locus_tag LOCUS_16970 9225 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 13212 9865 gene locus_tag LOCUS_16980 gene pilY1 13212 9865 CDS product type 4a pilus biogenesis protein PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115287.1 protein_id gnl|my_center|LOCUS_16980 13944 13240 gene locus_tag LOCUS_16990 13944 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 15056 13941 gene locus_tag LOCUS_17000 15056 13941 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941725.1 protein_id gnl|my_center|LOCUS_17000 15487 15074 gene locus_tag LOCUS_17010 15487 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 16105 15503 gene locus_tag LOCUS_17020 16105 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence064 421 1965 gene locus_tag LOCUS_17030 421 1965 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_17030 1962 2786 gene locus_tag LOCUS_17040 1962 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2811 4580 gene locus_tag LOCUS_17050 2811 4580 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_17050 4577 4948 gene locus_tag LOCUS_17060 4577 4948 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_17060 5082 6206 gene locus_tag LOCUS_17070 5082 6206 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_17070 6203 7147 gene locus_tag LOCUS_17080 6203 7147 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_17080 7456 7716 gene locus_tag LOCUS_17090 7456 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7710 8156 gene locus_tag LOCUS_17100 7710 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 8434 8359 gene locus_tag LOCUS_t00190 8434 8359 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8715 8443 gene locus_tag LOCUS_17110 8715 8443 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_17110 11364 8953 gene locus_tag LOCUS_17120 gene lon 11364 8953 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_17120 12774 11506 gene locus_tag LOCUS_17130 gene clpX 12774 11506 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_17130 13432 12803 gene locus_tag LOCUS_17140 gene clpP 13432 12803 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_17140 14736 13432 gene locus_tag LOCUS_17150 gene tig 14736 13432 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence065 637 963 gene locus_tag LOCUS_17160 gene rplU 637 963 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_17160 976 1236 gene locus_tag LOCUS_17170 gene rpmA 976 1236 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_17170 1299 2366 gene locus_tag LOCUS_17180 gene obgE 1299 2366 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_17180 2439 3557 gene locus_tag LOCUS_17190 gene proB 2439 3557 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_17190 4182 3688 gene locus_tag LOCUS_17200 4182 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5474 4266 gene locus_tag LOCUS_17210 gene cfaB 5474 4266 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 protein_id gnl|my_center|LOCUS_17210 6118 5639 gene locus_tag LOCUS_17220 6118 5639 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047949975.1 protein_id gnl|my_center|LOCUS_17220 7079 6282 gene locus_tag LOCUS_17230 7079 6282 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 protein_id gnl|my_center|LOCUS_17230 7174 8889 gene locus_tag LOCUS_17240 7174 8889 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_17240 8932 9600 gene locus_tag LOCUS_17250 8932 9600 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_17250 10496 9729 gene locus_tag LOCUS_17260 10496 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 11785 10493 gene locus_tag LOCUS_17270 11785 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 12294 11782 gene locus_tag LOCUS_17280 12294 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 12737 12309 gene locus_tag LOCUS_17290 12737 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 13036 14595 gene locus_tag LOCUS_17300 13036 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 15557 14640 gene locus_tag LOCUS_17310 15557 14640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence066 315 1004 gene locus_tag LOCUS_17320 315 1004 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 protein_id gnl|my_center|LOCUS_17320 1240 1007 gene locus_tag LOCUS_17330 1240 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1327 2304 gene locus_tag LOCUS_17340 1327 2304 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_17340 3600 2653 gene locus_tag LOCUS_17350 gene aitP 3600 2653 CDS product CDF family iron/cobalt efflux transporter AitP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112362.1 protein_id gnl|my_center|LOCUS_17350 3881 3612 gene locus_tag LOCUS_17360 3881 3612 CDS product nickel-sensing transcriptional repressor NcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196355.1 protein_id gnl|my_center|LOCUS_17360 4168 4494 gene locus_tag LOCUS_17370 4168 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4491 7256 gene locus_tag LOCUS_17380 gene mgtA 4491 7256 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808882.1 protein_id gnl|my_center|LOCUS_17380 7747 7478 gene locus_tag LOCUS_17390 7747 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 8053 7787 gene locus_tag LOCUS_17400 8053 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17400 9241 8453 gene locus_tag LOCUS_17410 9241 8453 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_17410 9725 9267 gene locus_tag LOCUS_17420 9725 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 10246 11661 gene locus_tag LOCUS_17430 gene ahcY 10246 11661 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_17430 11757 12596 gene locus_tag LOCUS_17440 gene metF 11757 12596 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_17440 12623 13084 gene locus_tag LOCUS_17450 12623 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 13913 13155 gene locus_tag LOCUS_17460 gene ttcA 13913 13155 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_17460 14970 14230 gene locus_tag LOCUS_17470 14970 14230 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence067 159 1457 gene locus_tag LOCUS_17480 159 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1703 2257 gene locus_tag LOCUS_17490 1703 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2374 2772 gene locus_tag LOCUS_17500 2374 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17500 2871 3212 gene locus_tag LOCUS_17510 2871 3212 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687228.1 protein_id gnl|my_center|LOCUS_17510 3312 3539 gene locus_tag LOCUS_17520 3312 3539 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_17520 3611 4114 gene locus_tag LOCUS_17530 3611 4114 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_17530 4188 4628 gene locus_tag LOCUS_17540 4188 4628 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102267.1 protein_id gnl|my_center|LOCUS_17540 4612 5697 gene locus_tag LOCUS_17550 4612 5697 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_17550 5704 6756 gene locus_tag LOCUS_17560 5704 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6756 7829 gene locus_tag LOCUS_17570 6756 7829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880019.1 protein_id gnl|my_center|LOCUS_17570 8155 9270 gene locus_tag LOCUS_17580 8155 9270 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881275.1 protein_id gnl|my_center|LOCUS_17580 9516 10889 gene locus_tag LOCUS_17590 9516 10889 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_17590 10991 11899 gene locus_tag LOCUS_17600 10991 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 <15277 12622 gene locus_tag LOCUS_17610 <15277 12622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521705.1:valine--tRNA ligase >Feature sequence068 654 142 gene locus_tag LOCUS_17620 654 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 827 2971 gene locus_tag LOCUS_17630 827 2971 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_17630 3069 3935 gene locus_tag LOCUS_17640 3069 3935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895578.1 protein_id gnl|my_center|LOCUS_17640 3932 6001 gene locus_tag LOCUS_17650 3932 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8476 6554 gene locus_tag LOCUS_17660 8476 6554 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_17660 9924 8665 gene locus_tag LOCUS_17670 9924 8665 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_17670 10290 9946 gene locus_tag LOCUS_17680 10290 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 10957 10301 gene locus_tag LOCUS_17690 gene adk 10957 10301 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_17690 11866 11102 gene locus_tag LOCUS_17700 gene kdsB 11866 11102 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_17700 12115 11930 gene locus_tag LOCUS_17710 12115 11930 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_17710 13133 12096 gene locus_tag LOCUS_17720 gene lpxK 13133 12096 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_17720 13563 13141 gene locus_tag LOCUS_17730 13563 13141 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_17730 14142 13576 gene locus_tag LOCUS_17740 14142 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence069 1064 381 gene locus_tag LOCUS_17750 gene yccA 1064 381 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097244.1 protein_id gnl|my_center|LOCUS_17750 1437 1102 gene locus_tag LOCUS_17760 1437 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1992 3245 gene locus_tag LOCUS_17770 1992 3245 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_17770 3242 4471 gene locus_tag LOCUS_17780 3242 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 4449 5294 gene locus_tag LOCUS_17790 4449 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6656 8296 gene locus_tag LOCUS_17800 6656 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 9116 8322 gene locus_tag LOCUS_17810 9116 8322 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_17810 10081 9320 gene locus_tag LOCUS_17820 10081 9320 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_17820 11334 10228 gene locus_tag LOCUS_17830 11334 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 12235 11336 gene locus_tag LOCUS_17840 12235 11336 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_17840 14143 12329 gene locus_tag LOCUS_17850 14143 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 14780 14337 gene locus_tag LOCUS_17860 14780 14337 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence070 715 251 gene locus_tag LOCUS_17870 715 251 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381490.1 protein_id gnl|my_center|LOCUS_17870 1654 716 gene locus_tag LOCUS_17880 1654 716 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_17880 3448 1829 gene locus_tag LOCUS_17890 3448 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4144 3611 gene locus_tag LOCUS_17900 4144 3611 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_17900 5336 4074 gene locus_tag LOCUS_17910 5336 4074 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_17910 5772 5404 gene locus_tag LOCUS_17920 5772 5404 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_17920 7436 5991 gene locus_tag LOCUS_17930 gene gcvPB 7436 5991 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_17930 7947 7444 gene locus_tag LOCUS_17940 gene tpx 7947 7444 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366280.1 protein_id gnl|my_center|LOCUS_17940 9396 7987 gene locus_tag LOCUS_17950 gene gcvPA 9396 7987 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_17950 9890 9501 gene locus_tag LOCUS_17960 gene gcvH 9890 9501 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_17960 11079 10000 gene locus_tag LOCUS_17970 gene gcvT 11079 10000 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_17970 11427 11663 gene locus_tag LOCUS_17980 11427 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 11766 12776 gene locus_tag LOCUS_17990 11766 12776 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 protein_id gnl|my_center|LOCUS_17990 12779 13387 gene locus_tag LOCUS_18000 12779 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 13390 13821 gene locus_tag LOCUS_18010 13390 13821 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921451.1 protein_id gnl|my_center|LOCUS_18010 14201 13977 gene locus_tag LOCUS_18020 14201 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 14953 14252 gene locus_tag LOCUS_18030 14953 14252 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence071 153 1214 gene locus_tag LOCUS_18040 gene leuB 153 1214 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_18040 1373 2452 gene locus_tag LOCUS_18050 gene asd 1373 2452 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_18050 2686 5679 gene locus_tag LOCUS_18060 gene fimV 2686 5679 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_18060 5757 6383 gene locus_tag LOCUS_18070 5757 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 6380 7195 gene locus_tag LOCUS_18080 gene truA 6380 7195 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_18080 7215 7835 gene locus_tag LOCUS_18090 7215 7835 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_18090 7822 9021 gene locus_tag LOCUS_18100 gene trpB 7822 9021 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_18100 9024 9275 gene locus_tag LOCUS_18110 9024 9275 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_18110 9278 9487 gene locus_tag LOCUS_18120 9278 9487 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_18120 9492 10400 gene locus_tag LOCUS_18130 9492 10400 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_18130 10404 11207 gene locus_tag LOCUS_18140 gene trpA 10404 11207 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_18140 11343 12212 gene locus_tag LOCUS_18150 gene accD 11343 12212 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_18150 12508 12305 gene locus_tag LOCUS_18160 12508 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 12449 13549 gene locus_tag LOCUS_18170 gene folC 12449 13549 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_18170 13562 14233 gene locus_tag LOCUS_18180 13562 14233 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198053.1 protein_id gnl|my_center|LOCUS_18180 14329 14820 gene locus_tag LOCUS_18190 14329 14820 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence072 2048 240 gene locus_tag LOCUS_18200 2048 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2347 2928 gene locus_tag LOCUS_18210 2347 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2949 3803 gene locus_tag LOCUS_18220 gene folD 2949 3803 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 protein_id gnl|my_center|LOCUS_18220 4568 3810 gene locus_tag LOCUS_18230 4568 3810 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_18230 4647 5069 gene locus_tag LOCUS_18240 gene dksA 4647 5069 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_18240 5127 5612 gene locus_tag LOCUS_18250 5127 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 7824 5701 gene locus_tag LOCUS_18260 gene pnp 7824 5701 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980838.1 protein_id gnl|my_center|LOCUS_18260 8250 7981 gene locus_tag LOCUS_18270 gene rpsO 8250 7981 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_18270 9256 8342 gene locus_tag LOCUS_18280 gene truB 9256 8342 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_18280 9634 9260 gene locus_tag LOCUS_18290 gene rbfA 9634 9260 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_18290 12316 9668 gene locus_tag LOCUS_18300 gene infB 12316 9668 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_18300 13820 12348 gene locus_tag LOCUS_18310 gene nusA 13820 12348 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_18310 14263 13832 gene locus_tag LOCUS_18320 gene rimP 14263 13832 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence073 199 2511 gene locus_tag LOCUS_18330 gene bamA 199 2511 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039863.1 protein_id gnl|my_center|LOCUS_18330 2522 3034 gene locus_tag LOCUS_18340 2522 3034 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_18340 3064 4116 gene locus_tag LOCUS_18350 gene lpxD 3064 4116 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_18350 4113 4556 gene locus_tag LOCUS_18360 gene fabZ 4113 4556 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_18360 4557 5327 gene locus_tag LOCUS_18370 gene lpxA 4557 5327 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243945.1 protein_id gnl|my_center|LOCUS_18370 5339 6472 gene locus_tag LOCUS_18380 gene lpxB 5339 6472 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_18380 6469 7068 gene locus_tag LOCUS_18390 gene rnhB 6469 7068 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173174.1 protein_id gnl|my_center|LOCUS_18390 7068 7526 gene locus_tag LOCUS_18400 7068 7526 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186668.1 protein_id gnl|my_center|LOCUS_18400 7609 8469 gene locus_tag LOCUS_18410 gene motA 7609 8469 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_18410 8497 9474 gene locus_tag LOCUS_18420 gene motB 8497 9474 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_18420 9632 9483 gene locus_tag LOCUS_18430 9632 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 9730 10305 gene locus_tag LOCUS_18440 9730 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 10302 11747 gene locus_tag LOCUS_18450 10302 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 11755 12540 gene locus_tag LOCUS_18460 11755 12540 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_18460 14324 12537 gene locus_tag LOCUS_18470 gene feoB 14324 12537 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057288.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence074 425 1780 gene locus_tag LOCUS_18480 425 1780 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087200.1 protein_id gnl|my_center|LOCUS_18480 1957 3618 gene locus_tag LOCUS_18490 gene mdcA 1957 3618 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_18490 3633 3941 gene locus_tag LOCUS_18500 3633 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3938 4837 gene locus_tag LOCUS_18510 3938 4837 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994153.1 protein_id gnl|my_center|LOCUS_18510 4834 5550 gene locus_tag LOCUS_18520 gene mdcE 4834 5550 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_18520 5547 6218 gene locus_tag LOCUS_18530 gene mdcG 5547 6218 CDS product malonate decarboxylase holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083098.1 protein_id gnl|my_center|LOCUS_18530 6220 7098 gene locus_tag LOCUS_18540 gene mdcB 6220 7098 CDS product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083097.1 protein_id gnl|my_center|LOCUS_18540 7189 8142 gene locus_tag LOCUS_18550 gene mdcH 7189 8142 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546965.1 protein_id gnl|my_center|LOCUS_18550 8342 9151 gene locus_tag LOCUS_18560 8342 9151 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_18560 9765 9310 gene locus_tag LOCUS_18570 9765 9310 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_18570 12354 9841 gene locus_tag LOCUS_18580 12354 9841 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393352.1 protein_id gnl|my_center|LOCUS_18580 12679 12389 gene locus_tag LOCUS_18590 12679 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 13074 12676 gene locus_tag LOCUS_18600 13074 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 13425 13084 gene locus_tag LOCUS_18610 13425 13084 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_18610 14191 13604 gene locus_tag LOCUS_18620 14191 13604 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence075 2152 317 gene locus_tag LOCUS_18630 2152 317 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_18630 2665 2177 gene locus_tag LOCUS_18640 2665 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3140 2685 gene locus_tag LOCUS_18650 3140 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224933.1 protein_id gnl|my_center|LOCUS_18650 4171 3137 gene locus_tag LOCUS_18660 4171 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5124 4342 gene locus_tag LOCUS_18670 gene nirQ 5124 4342 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_18670 6801 5425 gene locus_tag LOCUS_18680 gene norB 6801 5425 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_18680 7262 6837 gene locus_tag LOCUS_18690 gene norC 7262 6837 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_18690 7557 7997 gene locus_tag LOCUS_18700 7557 7997 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_18700 8004 8261 gene locus_tag LOCUS_18710 8004 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8258 9583 gene locus_tag LOCUS_18720 8258 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_18720 9715 10623 gene locus_tag LOCUS_18730 9715 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 12025 10859 gene locus_tag LOCUS_18740 12025 10859 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199381.1 protein_id gnl|my_center|LOCUS_18740 13402 12281 gene locus_tag LOCUS_18750 13402 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 13895 13635 gene locus_tag LOCUS_18760 13895 13635 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence076 157 393 gene locus_tag LOCUS_18770 157 393 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_18770 806 1417 gene locus_tag LOCUS_18780 806 1417 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_18780 1776 5570 gene locus_tag LOCUS_18790 1776 5570 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550020.1 protein_id gnl|my_center|LOCUS_18790 5735 6619 gene locus_tag LOCUS_18800 5735 6619 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_18800 6675 8138 gene locus_tag LOCUS_18810 gene tldD 6675 8138 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_18810 8370 8711 gene locus_tag LOCUS_18820 8370 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 10257 8695 gene locus_tag LOCUS_18830 10257 8695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_18830 11222 10374 gene locus_tag LOCUS_18840 11222 10374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_18840 12137 11226 gene locus_tag LOCUS_18850 gene ntrB 12137 11226 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_18850 12618 12205 gene locus_tag LOCUS_18860 12618 12205 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672395.1 protein_id gnl|my_center|LOCUS_18860 <13923 12649 gene locus_tag LOCUS_18870 <13923 12649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705089.1:CmpA/NrtA family ABC transporter substrate-binding protein >Feature sequence077 <1 3535 gene locus_tag LOCUS_18880 <1 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA 3883 4272 gene locus_tag LOCUS_18890 3883 4272 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_18890 4269 4949 gene locus_tag LOCUS_18900 gene aat 4269 4949 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_18900 4946 5683 gene locus_tag LOCUS_18910 4946 5683 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_18910 5683 7566 gene locus_tag LOCUS_18920 5683 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 7563 7775 gene locus_tag LOCUS_18930 7563 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7777 9891 gene locus_tag LOCUS_18940 7777 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 10053 10868 gene locus_tag LOCUS_18950 10053 10868 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_18950 11008 12243 gene locus_tag LOCUS_18960 11008 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 12240 12743 gene locus_tag LOCUS_18970 12240 12743 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_18970 12766 13584 gene locus_tag LOCUS_18980 12766 13584 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546070.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence078 1587 373 gene locus_tag LOCUS_18990 gene tyrS 1587 373 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_18990 1670 2989 gene locus_tag LOCUS_19000 1670 2989 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_19000 3242 4309 gene locus_tag LOCUS_19010 3242 4309 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_19010 4742 4392 gene locus_tag LOCUS_19020 gene erpA 4742 4392 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_19020 5159 4800 gene locus_tag LOCUS_19030 5159 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5973 5224 gene locus_tag LOCUS_19040 5973 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 6998 5970 gene locus_tag LOCUS_19050 gene argC 6998 5970 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_19050 7496 7104 gene locus_tag LOCUS_19060 gene rpsI 7496 7104 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194309.1 protein_id gnl|my_center|LOCUS_19060 7934 7506 gene locus_tag LOCUS_19070 gene rplM 7934 7506 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215010.1 protein_id gnl|my_center|LOCUS_19070 8069 8485 gene locus_tag LOCUS_19080 8069 8485 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_19080 9288 8662 gene locus_tag LOCUS_19090 gene coq7 9288 8662 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_19090 10546 9272 gene locus_tag LOCUS_19100 10546 9272 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_19100 10876 11481 gene locus_tag LOCUS_19110 10876 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 12301 11504 gene locus_tag LOCUS_19120 12301 11504 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_19120 12847 12413 gene locus_tag LOCUS_19130 gene ybeY 12847 12413 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence079 1576 854 gene locus_tag LOCUS_19140 gene lptB 1576 854 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_19140 2262 1654 gene locus_tag LOCUS_19150 gene lptA 2262 1654 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_19150 2818 2243 gene locus_tag LOCUS_19160 2818 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3371 2850 gene locus_tag LOCUS_19170 3371 2850 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_19170 4572 3583 gene locus_tag LOCUS_19180 4572 3583 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_19180 4862 6832 gene locus_tag LOCUS_19190 4862 6832 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_19190 7565 6918 gene locus_tag LOCUS_19200 7565 6918 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_19200 8570 7854 gene locus_tag LOCUS_19210 8570 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 9692 8622 gene locus_tag LOCUS_19220 9692 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 10126 9713 gene locus_tag LOCUS_19230 10126 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 10822 10154 gene locus_tag LOCUS_19240 10822 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12475 10871 gene locus_tag LOCUS_19250 12475 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 <13155 12477 gene locus_tag LOCUS_19260 <13155 12477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938567.1:type II secretion system F family protein >Feature sequence080 1964 915 gene locus_tag LOCUS_19270 1964 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4972 2045 gene locus_tag LOCUS_19280 4972 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6156 5005 gene locus_tag LOCUS_19290 6156 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7802 6153 gene locus_tag LOCUS_19300 7802 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 8514 7993 gene locus_tag LOCUS_19310 8514 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 9010 8546 gene locus_tag LOCUS_19320 9010 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 11447 9150 gene locus_tag LOCUS_19330 11447 9150 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_19330 12670 11939 gene locus_tag LOCUS_19340 12670 11939 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193555.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence081 1192 257 gene locus_tag LOCUS_19350 1192 257 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_19350 1562 2041 gene locus_tag LOCUS_19360 1562 2041 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878142.1 protein_id gnl|my_center|LOCUS_19360 2109 3773 gene locus_tag LOCUS_19370 gene ettA 2109 3773 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_19370 3878 4126 gene locus_tag LOCUS_19380 3878 4126 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_19380 4123 4509 gene locus_tag LOCUS_19390 4123 4509 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_19390 5203 4802 gene locus_tag LOCUS_19400 gene vapC 5203 4802 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_19400 5437 5207 gene locus_tag LOCUS_19410 5437 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5573 7033 gene locus_tag LOCUS_19420 5573 7033 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207211.1 protein_id gnl|my_center|LOCUS_19420 7818 7252 gene locus_tag LOCUS_19430 7818 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880404.1 protein_id gnl|my_center|LOCUS_19430 7998 9101 gene locus_tag LOCUS_19440 7998 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 9187 9603 gene locus_tag LOCUS_19450 9187 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 10189 9815 gene locus_tag LOCUS_19460 10189 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 protein_id gnl|my_center|LOCUS_19460 10429 10211 gene locus_tag LOCUS_19470 10429 10211 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_19470 10824 10603 gene locus_tag LOCUS_19480 10824 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 11139 11696 gene locus_tag LOCUS_19490 11139 11696 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_19490 11746 12069 gene locus_tag LOCUS_19500 11746 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 12647 12132 gene locus_tag LOCUS_19510 12647 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence082 158 433 gene locus_tag LOCUS_19520 158 433 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_19520 945 430 gene locus_tag LOCUS_19530 945 430 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 protein_id gnl|my_center|LOCUS_19530 2560 1379 gene locus_tag LOCUS_19540 2560 1379 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071381.1 protein_id gnl|my_center|LOCUS_19540 3312 2674 gene locus_tag LOCUS_19550 3312 2674 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 protein_id gnl|my_center|LOCUS_19550 4232 3525 gene locus_tag LOCUS_19560 gene tsaA 4232 3525 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_19560 4336 4896 gene locus_tag LOCUS_19570 4336 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5249 6550 gene locus_tag LOCUS_19580 gene dsrA 5249 6550 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_19580 6875 6636 gene locus_tag LOCUS_19590 6875 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 8998 6893 gene locus_tag LOCUS_19600 8998 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 9779 9144 gene locus_tag LOCUS_19610 9779 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 10466 11785 gene locus_tag LOCUS_19620 10466 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence083 530 1234 gene locus_tag LOCUS_19630 530 1234 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_19630 1231 1638 gene locus_tag LOCUS_19640 1231 1638 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930180.1 protein_id gnl|my_center|LOCUS_19640 3209 1674 gene locus_tag LOCUS_19650 3209 1674 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_19650 4320 3547 gene locus_tag LOCUS_19660 4320 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4466 4906 gene locus_tag LOCUS_19670 4466 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 7522 5039 gene locus_tag LOCUS_19680 7522 5039 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_19680 8479 7688 gene locus_tag LOCUS_19690 gene pssA 8479 7688 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522420.1 protein_id gnl|my_center|LOCUS_19690 9172 8489 gene locus_tag LOCUS_19700 9172 8489 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689647.1 protein_id gnl|my_center|LOCUS_19700 10263 9247 gene locus_tag LOCUS_19710 gene ilvC 10263 9247 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_19710 10844 10377 gene locus_tag LOCUS_19720 gene ilvN 10844 10377 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_19720 12570 10873 gene locus_tag LOCUS_19730 12570 10873 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence084 365 3112 gene locus_tag LOCUS_19740 365 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3369 5966 gene locus_tag LOCUS_19750 3369 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6688 5984 gene locus_tag LOCUS_19760 6688 5984 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 protein_id gnl|my_center|LOCUS_19760 8592 6685 gene locus_tag LOCUS_19770 8592 6685 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_19770 10689 8665 gene locus_tag LOCUS_19780 10689 8665 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_19780 10927 10670 gene locus_tag LOCUS_19790 10927 10670 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_19790 <12611 11057 gene locus_tag LOCUS_19800 <12611 11057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941729.1:cation acetate symporter >Feature sequence085 596 1612 gene locus_tag LOCUS_19810 gene hrcA 596 1612 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_19810 1696 2775 gene locus_tag LOCUS_19820 gene hemH 1696 2775 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_19820 3046 3450 gene locus_tag LOCUS_19830 3046 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3601 4434 gene locus_tag LOCUS_19840 3601 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4431 5084 gene locus_tag LOCUS_19850 4431 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_19850 5168 5536 gene locus_tag LOCUS_19860 5168 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5919 6239 gene locus_tag LOCUS_19870 5919 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 6756 6427 gene locus_tag LOCUS_19880 6756 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 6943 8700 gene locus_tag LOCUS_19890 6943 8700 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_19890 8700 12461 gene locus_tag LOCUS_19900 8700 12461 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193490.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence086 1935 289 gene locus_tag LOCUS_19910 1935 289 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_19910 2953 1952 gene locus_tag LOCUS_19920 2953 1952 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266270.1 protein_id gnl|my_center|LOCUS_19920 4350 3025 gene locus_tag LOCUS_19930 4350 3025 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198129.1 protein_id gnl|my_center|LOCUS_19930 5273 4458 gene locus_tag LOCUS_19940 5273 4458 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040177.1 protein_id gnl|my_center|LOCUS_19940 5636 5283 gene locus_tag LOCUS_19950 5636 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7185 5653 gene locus_tag LOCUS_19960 7185 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7738 7187 gene locus_tag LOCUS_19970 7738 7187 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930217.1 protein_id gnl|my_center|LOCUS_19970 7921 8817 gene locus_tag LOCUS_19980 7921 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 9307 8780 gene locus_tag LOCUS_19990 9307 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 9435 10082 gene locus_tag LOCUS_20000 9435 10082 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_20000 10451 10089 gene locus_tag LOCUS_20010 10451 10089 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888724.1 protein_id gnl|my_center|LOCUS_20010 12496 10448 gene locus_tag LOCUS_20020 12496 10448 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence087 1243 287 gene locus_tag LOCUS_20030 1243 287 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 protein_id gnl|my_center|LOCUS_20030 1514 3286 gene locus_tag LOCUS_20040 1514 3286 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_20040 3276 3407 gene locus_tag LOCUS_20050 3276 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3625 5151 gene locus_tag LOCUS_20060 gene glgA 3625 5151 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_20060 7706 5148 gene locus_tag LOCUS_20070 gene glgP 7706 5148 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_20070 8436 7888 gene locus_tag LOCUS_20080 gene orn 8436 7888 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_20080 8554 9804 gene locus_tag LOCUS_20090 8554 9804 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039491.1 protein_id gnl|my_center|LOCUS_20090 9829 10137 gene locus_tag LOCUS_20100 9829 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 10154 11008 gene locus_tag LOCUS_20110 gene rsgA 10154 11008 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_20110 11610 10987 gene locus_tag LOCUS_20120 11610 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence088 523 167 gene locus_tag LOCUS_20130 523 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4416 913 gene locus_tag LOCUS_20140 gene dnaE 4416 913 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_20140 4840 5208 gene locus_tag LOCUS_20150 4840 5208 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190980.1 protein_id gnl|my_center|LOCUS_20150 5205 5813 gene locus_tag LOCUS_20160 5205 5813 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523925.1 protein_id gnl|my_center|LOCUS_20160 5814 7145 gene locus_tag LOCUS_20170 5814 7145 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552382.1 protein_id gnl|my_center|LOCUS_20170 7312 8610 gene locus_tag LOCUS_20180 gene yegQ 7312 8610 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_20180 8620 9831 gene locus_tag LOCUS_20190 8620 9831 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035604.1 protein_id gnl|my_center|LOCUS_20190 9971 10423 gene locus_tag LOCUS_20200 9971 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 11710 10514 gene locus_tag LOCUS_20210 11710 10514 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence089 546 1106 gene locus_tag LOCUS_20220 546 1106 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927118.1 protein_id gnl|my_center|LOCUS_20220 1140 1607 gene locus_tag LOCUS_20230 gene ruvX 1140 1607 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706124.1 protein_id gnl|my_center|LOCUS_20230 1711 2661 gene locus_tag LOCUS_20240 1711 2661 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_20240 2663 3940 gene locus_tag LOCUS_20250 2663 3940 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_20250 4037 4474 gene locus_tag LOCUS_20260 4037 4474 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818394.1 protein_id gnl|my_center|LOCUS_20260 4691 5434 gene locus_tag LOCUS_20270 4691 5434 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_20270 5435 6838 gene locus_tag LOCUS_20280 5435 6838 CDS product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 protein_id gnl|my_center|LOCUS_20280 7067 7531 gene locus_tag LOCUS_20290 7067 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7622 9382 gene locus_tag LOCUS_20300 7622 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9398 9523 gene locus_tag LOCUS_20310 9398 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 9640 10053 gene locus_tag LOCUS_20320 9640 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 10134 10703 gene locus_tag LOCUS_20330 10134 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence090 2545 206 gene locus_tag LOCUS_20340 2545 206 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_20340 2898 2593 gene locus_tag LOCUS_20350 2898 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3404 3048 gene locus_tag LOCUS_20360 3404 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4150 3428 gene locus_tag LOCUS_20370 4150 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 4527 4195 gene locus_tag LOCUS_20380 4527 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4923 4585 gene locus_tag LOCUS_20390 4923 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 8066 4980 gene locus_tag LOCUS_20400 8066 4980 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_20400 9317 8076 gene locus_tag LOCUS_20410 9317 8076 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_20410 10643 9348 gene locus_tag LOCUS_20420 10643 9348 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_20420 11080 10730 gene locus_tag LOCUS_20430 11080 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 11193 11657 gene locus_tag LOCUS_20440 gene cadR 11193 11657 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence091 1617 2897 gene locus_tag LOCUS_20450 gene glgC 1617 2897 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_20450 2989 4755 gene locus_tag LOCUS_20460 2989 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 5073 7079 gene locus_tag LOCUS_20470 5073 7079 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_20470 7234 7734 gene locus_tag LOCUS_20480 7234 7734 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_20480 8133 7771 gene locus_tag LOCUS_20490 8133 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence092 <1 931 gene locus_tag LOCUS_20500 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269384.1:FAD-dependent oxidoreductase 2261 1350 gene locus_tag LOCUS_20510 2261 1350 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_20510 2403 2588 gene locus_tag LOCUS_20520 2403 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2614 3234 gene locus_tag LOCUS_20530 2614 3234 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940476.1 protein_id gnl|my_center|LOCUS_20530 3231 4145 gene locus_tag LOCUS_20540 3231 4145 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206550.1 protein_id gnl|my_center|LOCUS_20540 4355 5272 gene locus_tag LOCUS_20550 4355 5272 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_20550 5478 6146 gene locus_tag LOCUS_20560 5478 6146 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968488.1 protein_id gnl|my_center|LOCUS_20560 6740 7549 gene locus_tag LOCUS_20570 gene phnC 6740 7549 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_20570 7553 8407 gene locus_tag LOCUS_20580 7553 8407 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463616.1 protein_id gnl|my_center|LOCUS_20580 8424 9221 gene locus_tag LOCUS_20590 8424 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 9239 10246 gene locus_tag LOCUS_20600 gene gyaR 9239 10246 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_20600 10246 11172 gene locus_tag LOCUS_20610 10246 11172 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence093 <1 1030 gene locus_tag LOCUS_20620 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194230.1:ribonucleoside-diphosphate reductase subunit alpha 1143 2273 gene locus_tag LOCUS_20630 1143 2273 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_20630 2349 2900 gene locus_tag LOCUS_20640 2349 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3635 3874 gene locus_tag LOCUS_20650 3635 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 6036 4363 gene locus_tag LOCUS_20660 6036 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 8284 6647 gene locus_tag LOCUS_20670 8284 6647 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_20670 8505 8747 gene locus_tag LOCUS_20680 8505 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 9117 8881 gene locus_tag LOCUS_20690 9117 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 9073 9222 gene locus_tag LOCUS_20700 9073 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 9403 9945 gene locus_tag LOCUS_20710 9403 9945 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_20710 9961 10290 gene locus_tag LOCUS_20720 9961 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 10788 10381 gene locus_tag LOCUS_20730 10788 10381 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_20730 10972 11316 gene locus_tag LOCUS_20740 10972 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence094 2407 1823 gene locus_tag LOCUS_20750 gene grpE 2407 1823 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_20750 2898 5630 gene locus_tag LOCUS_20760 2898 5630 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_20760 5676 8153 gene locus_tag LOCUS_20770 gene nirB 5676 8153 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_20770 8444 8755 gene locus_tag LOCUS_20780 gene nirD 8444 8755 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275366.1 protein_id gnl|my_center|LOCUS_20780 11359 8789 gene locus_tag LOCUS_20790 11359 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence095 <1 1551 gene locus_tag LOCUS_20800 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389031.1:ribonucleoside triphosphate reductase 1585 1779 gene locus_tag LOCUS_20810 gene nrdD 1585 1779 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196981.1 protein_id gnl|my_center|LOCUS_20810 1860 2555 gene locus_tag LOCUS_20820 1860 2555 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 protein_id gnl|my_center|LOCUS_20820 2629 3543 gene locus_tag LOCUS_20830 2629 3543 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895705.1 protein_id gnl|my_center|LOCUS_20830 4911 3556 gene locus_tag LOCUS_20840 4911 3556 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268599.1 protein_id gnl|my_center|LOCUS_20840 5584 4901 gene locus_tag LOCUS_20850 5584 4901 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_20850 5896 5588 gene locus_tag LOCUS_20860 5896 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 6491 5979 gene locus_tag LOCUS_20870 6491 5979 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210925.1 protein_id gnl|my_center|LOCUS_20870 6727 7632 gene locus_tag LOCUS_20880 6727 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 7732 9180 gene locus_tag LOCUS_20890 gene mpl 7732 9180 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688594.1 protein_id gnl|my_center|LOCUS_20890 9269 11113 gene locus_tag LOCUS_20900 9269 11113 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527764.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence096 1254 349 gene locus_tag LOCUS_20910 1254 349 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_20910 2446 1361 gene locus_tag LOCUS_20920 2446 1361 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_20920 3119 2475 gene locus_tag LOCUS_20930 3119 2475 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_20930 3036 3230 gene locus_tag LOCUS_20940 3036 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4117 3227 gene locus_tag LOCUS_20950 4117 3227 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259301.1 protein_id gnl|my_center|LOCUS_20950 5036 4272 gene locus_tag LOCUS_20960 5036 4272 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192516.1 protein_id gnl|my_center|LOCUS_20960 5197 5030 gene locus_tag LOCUS_20970 5197 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 6239 5190 gene locus_tag LOCUS_20980 gene mutY 6239 5190 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_20980 7935 6247 gene locus_tag LOCUS_20990 7935 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 8038 7965 gene locus_tag LOCUS_t00200 8038 7965 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8437 10044 gene locus_tag LOCUS_21000 8437 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 10240 10443 gene locus_tag LOCUS_21010 gene thiS 10240 10443 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence097 399 815 gene locus_tag LOCUS_21020 gene arfB 399 815 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_21020 1134 2516 gene locus_tag LOCUS_21030 1134 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2605 4686 gene locus_tag LOCUS_21040 2605 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4775 6811 gene locus_tag LOCUS_21050 4775 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6990 8522 gene locus_tag LOCUS_21060 6990 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 8527 10254 gene locus_tag LOCUS_21070 8527 10254 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence098 1076 138 gene locus_tag LOCUS_21080 1076 138 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259483.1 protein_id gnl|my_center|LOCUS_21080 2111 1110 gene locus_tag LOCUS_21090 2111 1110 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_21090 2783 2193 gene locus_tag LOCUS_21100 2783 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21100 3733 2780 gene locus_tag LOCUS_21110 gene trxB 3733 2780 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 protein_id gnl|my_center|LOCUS_21110 4520 5302 gene locus_tag LOCUS_21120 4520 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_21120 6028 6333 gene locus_tag LOCUS_21130 6028 6333 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931769.1 protein_id gnl|my_center|LOCUS_21130 6780 6451 gene locus_tag LOCUS_21140 6780 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 7325 6783 gene locus_tag LOCUS_21150 7325 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 8821 7406 gene locus_tag LOCUS_21160 8821 7406 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_21160 10356 8818 gene locus_tag LOCUS_21170 10356 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence099 601 350 gene locus_tag LOCUS_21180 601 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 620 2827 gene locus_tag LOCUS_21190 620 2827 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_21190 3220 2867 gene locus_tag LOCUS_21200 3220 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3441 3217 gene locus_tag LOCUS_21210 3441 3217 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_21210 4076 3681 gene locus_tag LOCUS_21220 4076 3681 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_21220 4315 4073 gene locus_tag LOCUS_21230 4315 4073 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_21230 4420 4812 gene locus_tag LOCUS_21240 4420 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 5587 4832 gene locus_tag LOCUS_21250 5587 4832 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706977.1 protein_id gnl|my_center|LOCUS_21250 6544 5597 gene locus_tag LOCUS_21260 6544 5597 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_21260 6892 6548 gene locus_tag LOCUS_21270 6892 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 7704 6976 gene locus_tag LOCUS_21280 7704 6976 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_21280 7724 10426 gene locus_tag LOCUS_21290 gene polA 7724 10426 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence100 669 148 gene locus_tag LOCUS_21300 669 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 1094 747 gene locus_tag LOCUS_21310 1094 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2006 1197 gene locus_tag LOCUS_21320 gene murI 2006 1197 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 protein_id gnl|my_center|LOCUS_21320 3103 2087 gene locus_tag LOCUS_21330 gene queG 3103 2087 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_21330 3170 3661 gene locus_tag LOCUS_21340 3170 3661 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_21340 3634 4968 gene locus_tag LOCUS_21350 3634 4968 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_21350 5361 5068 gene locus_tag LOCUS_21360 5361 5068 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_21360 5799 7562 gene locus_tag LOCUS_21370 gene mutL 5799 7562 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929705.1 protein_id gnl|my_center|LOCUS_21370 7626 8594 gene locus_tag LOCUS_21380 gene miaA 7626 8594 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814337.1 protein_id gnl|my_center|LOCUS_21380 9709 8603 gene locus_tag LOCUS_21390 9709 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 <10480 9706 gene locus_tag LOCUS_21400 <10480 9706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003688847.1:exodeoxyribonuclease VII large subunit >Feature sequence101 205 792 gene locus_tag LOCUS_21410 205 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21410 789 2333 gene locus_tag LOCUS_21420 789 2333 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_21420 2507 2419 gene locus_tag LOCUS_t00210 2507 2419 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3086 2766 gene locus_tag LOCUS_21430 3086 2766 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_21430 3337 3086 gene locus_tag LOCUS_21440 3337 3086 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217148.1 protein_id gnl|my_center|LOCUS_21440 3597 4166 gene locus_tag LOCUS_21450 3597 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 6212 4197 gene locus_tag LOCUS_21460 gene uvrB 6212 4197 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_21460 6328 7563 gene locus_tag LOCUS_21470 6328 7563 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_21470 7627 7702 gene locus_tag LOCUS_t00220 7627 7702 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7955 7779 gene locus_tag LOCUS_21480 7955 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 8441 9124 gene locus_tag LOCUS_21490 8441 9124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence102 <1 861 gene locus_tag LOCUS_21500 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941390.1:polyphosphate:AMP phosphotransferase 1696 1115 gene locus_tag LOCUS_21510 1696 1115 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957925.1 protein_id gnl|my_center|LOCUS_21510 1801 2352 gene locus_tag LOCUS_21520 gene msrA 1801 2352 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_21520 3533 2643 gene locus_tag LOCUS_21530 3533 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5103 3841 gene locus_tag LOCUS_21540 5103 3841 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_21540 6303 5284 gene locus_tag LOCUS_21550 6303 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 7167 6409 gene locus_tag LOCUS_21560 7167 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 7805 7164 gene locus_tag LOCUS_21570 gene purN 7805 7164 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_21570 8902 7802 gene locus_tag LOCUS_21580 gene purM 8902 7802 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_21580 8901 9965 gene locus_tag LOCUS_21590 8901 9965 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_21590 10239 10036 gene locus_tag LOCUS_21600 10239 10036 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence103 173 18 gene locus_tag LOCUS_21610 173 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1253 585 gene locus_tag LOCUS_21620 1253 585 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_21620 1695 1258 gene locus_tag LOCUS_21630 gene moaC 1695 1258 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_21630 1813 3243 gene locus_tag LOCUS_21640 1813 3243 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_21640 3429 3737 gene locus_tag LOCUS_21650 gene clpS 3429 3737 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_21650 3739 6000 gene locus_tag LOCUS_21660 gene clpA 3739 6000 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_21660 6277 6068 gene locus_tag LOCUS_21670 6277 6068 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_21670 7691 6321 gene locus_tag LOCUS_21680 7691 6321 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_21680 7949 8146 gene locus_tag LOCUS_21690 7949 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 8195 9463 gene locus_tag LOCUS_21700 8195 9463 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence104 1155 154 gene locus_tag LOCUS_21710 1155 154 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_21710 1444 1292 gene locus_tag LOCUS_21720 1444 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4260 1585 gene locus_tag LOCUS_21730 4260 1585 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_21730 4449 4910 gene locus_tag LOCUS_21740 4449 4910 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_21740 5083 6189 gene locus_tag LOCUS_21750 gene aroC 5083 6189 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_21750 6411 7547 gene locus_tag LOCUS_21760 6411 7547 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_21760 7654 9066 gene locus_tag LOCUS_21770 gene leuC 7654 9066 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_21770 9119 9283 gene locus_tag LOCUS_21780 9119 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 9284 9922 gene locus_tag LOCUS_21790 gene leuD 9284 9922 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence105 <1 502 gene locus_tag LOCUS_21800 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003689283.1:molecular chaperone DnaK 593 1720 gene locus_tag LOCUS_21810 gene dnaJ 593 1720 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_21810 4828 1922 gene locus_tag LOCUS_21820 4828 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6238 4847 gene locus_tag LOCUS_21830 gene cysS 6238 4847 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_21830 6716 6261 gene locus_tag LOCUS_21840 6716 6261 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 protein_id gnl|my_center|LOCUS_21840 8428 6752 gene locus_tag LOCUS_21850 8428 6752 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247565.1 protein_id gnl|my_center|LOCUS_21850 8527 9609 gene locus_tag LOCUS_21860 8527 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence106 1491 733 gene locus_tag LOCUS_21870 1491 733 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272016.1 protein_id gnl|my_center|LOCUS_21870 4368 1555 gene locus_tag LOCUS_21880 4368 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 5620 4421 gene locus_tag LOCUS_21890 5620 4421 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392896.1 protein_id gnl|my_center|LOCUS_21890 5824 6645 gene locus_tag LOCUS_21900 gene phnD 5824 6645 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_21900 6645 8102 gene locus_tag LOCUS_21910 6645 8102 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937430.1 protein_id gnl|my_center|LOCUS_21910 8095 9405 gene locus_tag LOCUS_21920 8095 9405 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence107 2000 138 gene locus_tag LOCUS_21930 2000 138 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_21930 3446 2301 gene locus_tag LOCUS_21940 3446 2301 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_21940 3532 4278 gene locus_tag LOCUS_21950 3532 4278 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_21950 4764 4390 gene locus_tag LOCUS_21960 4764 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5017 5622 gene locus_tag LOCUS_21970 gene petA 5017 5622 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951385.1 protein_id gnl|my_center|LOCUS_21970 5615 6850 gene locus_tag LOCUS_21980 5615 6850 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_21980 6850 7563 gene locus_tag LOCUS_21990 6850 7563 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181874519.1 protein_id gnl|my_center|LOCUS_21990 7800 8399 gene locus_tag LOCUS_22000 7800 8399 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_22000 8396 8821 gene locus_tag LOCUS_22010 8396 8821 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527881.1 protein_id gnl|my_center|LOCUS_22010 9074 9149 gene locus_tag LOCUS_t00230 9074 9149 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9241 9325 gene locus_tag LOCUS_t00240 9241 9325 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9398 9471 gene locus_tag LOCUS_t00250 9398 9471 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9500 9574 gene locus_tag LOCUS_t00260 9500 9574 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 880 155 gene locus_tag LOCUS_22020 880 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1982 1122 gene locus_tag LOCUS_22030 gene napH 1982 1122 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_22030 2755 1979 gene locus_tag LOCUS_22040 gene napG 2755 1979 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_22040 3006 2758 gene locus_tag LOCUS_22050 3006 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3867 3175 gene locus_tag LOCUS_22060 3867 3175 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_22060 4033 4539 gene locus_tag LOCUS_22070 gene napF 4033 4539 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 protein_id gnl|my_center|LOCUS_22070 4579 7104 gene locus_tag LOCUS_22080 gene napA 4579 7104 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_22080 7216 7677 gene locus_tag LOCUS_22090 gene napB 7216 7677 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081760.1 protein_id gnl|my_center|LOCUS_22090 7892 8467 gene locus_tag LOCUS_22100 7892 8467 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence109 336 635 gene locus_tag LOCUS_22110 336 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1056 1310 gene locus_tag LOCUS_22120 1056 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1403 1645 gene locus_tag LOCUS_22130 1403 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2147 1662 gene locus_tag LOCUS_22140 2147 1662 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_22140 2795 2232 gene locus_tag LOCUS_22150 2795 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2868 3785 gene locus_tag LOCUS_22160 2868 3785 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_22160 5852 3885 gene locus_tag LOCUS_22170 gene acs 5852 3885 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_22170 6034 8739 gene locus_tag LOCUS_22180 gene glnE 6034 8739 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951341.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence110 755 2323 gene locus_tag LOCUS_22190 755 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2530 3339 gene locus_tag LOCUS_22200 2530 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3347 3556 gene locus_tag LOCUS_22210 3347 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4052 6649 gene locus_tag LOCUS_22220 4052 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 6646 8256 gene locus_tag LOCUS_22230 6646 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 8253 8972 gene locus_tag LOCUS_22240 8253 8972 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence111 1158 256 gene locus_tag LOCUS_22250 1158 256 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_22250 2450 1338 gene locus_tag LOCUS_22260 2450 1338 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_22260 2776 3960 gene locus_tag LOCUS_22270 2776 3960 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249500.1 protein_id gnl|my_center|LOCUS_22270 4550 5473 gene locus_tag LOCUS_22280 4550 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6424 5699 gene locus_tag LOCUS_22290 6424 5699 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_22290 8049 6421 gene locus_tag LOCUS_22300 8049 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 8186 8413 gene locus_tag LOCUS_22310 8186 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 8438 8893 gene locus_tag LOCUS_22320 8438 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence112 985 329 gene locus_tag LOCUS_22330 gene hisG 985 329 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_22330 2383 1130 gene locus_tag LOCUS_22340 gene murA 2383 1130 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_22340 2710 2387 gene locus_tag LOCUS_22350 gene grxD 2710 2387 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_22350 2962 2723 gene locus_tag LOCUS_22360 2962 2723 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_22360 3719 2964 gene locus_tag LOCUS_22370 3719 2964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_22370 4807 3887 gene locus_tag LOCUS_22380 4807 3887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_22380 5214 4897 gene locus_tag LOCUS_22390 5214 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 5876 5223 gene locus_tag LOCUS_22400 5876 5223 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_22400 6355 5873 gene locus_tag LOCUS_22410 gene mlaD 6355 5873 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_22410 7157 6360 gene locus_tag LOCUS_22420 gene mlaE 7157 6360 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_22420 7968 7147 gene locus_tag LOCUS_22430 7968 7147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_22430 8485 8027 gene locus_tag LOCUS_22440 8485 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence113 653 267 gene locus_tag LOCUS_22450 653 267 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263648.1 protein_id gnl|my_center|LOCUS_22450 2225 933 gene locus_tag LOCUS_22460 2225 933 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_22460 3422 2241 gene locus_tag LOCUS_22470 3422 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3761 3579 gene locus_tag LOCUS_22480 3761 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4009 3731 gene locus_tag LOCUS_22490 4009 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4266 4820 gene locus_tag LOCUS_22500 4266 4820 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_22500 4889 5398 gene locus_tag LOCUS_22510 4889 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5398 6321 gene locus_tag LOCUS_22520 5398 6321 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_22520 6341 6949 gene locus_tag LOCUS_22530 6341 6949 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_22530 6927 7823 gene locus_tag LOCUS_22540 6927 7823 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_22540 9081 7945 gene locus_tag LOCUS_22550 9081 7945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence114 228 1943 gene locus_tag LOCUS_22560 gene soxB 228 1943 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_22560 2005 3174 gene locus_tag LOCUS_22570 2005 3174 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_22570 3174 3902 gene locus_tag LOCUS_22580 3174 3902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_22580 3899 4282 gene locus_tag LOCUS_22590 3899 4282 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_22590 4353 5576 gene locus_tag LOCUS_22600 4353 5576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_22600 5569 6180 gene locus_tag LOCUS_22610 gene cysC 5569 6180 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_22610 6186 6986 gene locus_tag LOCUS_22620 6186 6986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_22620 7224 7616 gene locus_tag LOCUS_22630 7224 7616 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 protein_id gnl|my_center|LOCUS_22630 7671 7964 gene locus_tag LOCUS_22640 7671 7964 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_22640 7957 8310 gene locus_tag LOCUS_22650 7957 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 8540 8863 gene locus_tag LOCUS_22660 8540 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence115 1854 202 gene locus_tag LOCUS_22670 1854 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3656 1848 gene locus_tag LOCUS_22680 3656 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4642 3656 gene locus_tag LOCUS_22690 4642 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 5106 4636 gene locus_tag LOCUS_22700 5106 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 6091 5099 gene locus_tag LOCUS_22710 6091 5099 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_22710 7181 6222 gene locus_tag LOCUS_22720 7181 6222 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 protein_id gnl|my_center|LOCUS_22720 7961 7257 gene locus_tag LOCUS_22730 gene pgl 7961 7257 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547427.1 protein_id gnl|my_center|LOCUS_22730 <9008 8127 gene locus_tag LOCUS_22740 <9008 8127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080226.1:glucose-6-phosphate dehydrogenase >Feature sequence116 <1 551 gene locus_tag LOCUS_22750 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815379.1:murein transglycosylase A 1264 524 gene locus_tag LOCUS_22760 1264 524 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269070.1 protein_id gnl|my_center|LOCUS_22760 1888 1454 gene locus_tag LOCUS_22770 1888 1454 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106175.1 protein_id gnl|my_center|LOCUS_22770 2673 2017 gene locus_tag LOCUS_22780 2673 2017 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083979.1 protein_id gnl|my_center|LOCUS_22780 3350 2682 gene locus_tag LOCUS_22790 3350 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 5032 3587 gene locus_tag LOCUS_22800 5032 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 7436 5154 gene locus_tag LOCUS_22810 7436 5154 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188913.1 protein_id gnl|my_center|LOCUS_22810 7723 8691 gene locus_tag LOCUS_22820 7723 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence117 2931 2722 gene locus_tag LOCUS_22830 2931 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2842 3666 gene locus_tag LOCUS_22840 2842 3666 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_22840 3733 3933 gene locus_tag LOCUS_22850 3733 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4043 4537 gene locus_tag LOCUS_22860 4043 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4534 5157 gene locus_tag LOCUS_22870 4534 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 7127 5199 gene locus_tag LOCUS_22880 7127 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 7455 7180 gene locus_tag LOCUS_22890 7455 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 8110 7472 gene locus_tag LOCUS_22900 8110 7472 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence118 856 137 gene locus_tag LOCUS_22910 856 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1148 972 gene locus_tag LOCUS_22920 1148 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22920 2569 1262 gene locus_tag LOCUS_22930 gene wbpA 2569 1262 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_22930 3644 2745 gene locus_tag LOCUS_22940 gene rfbD 3644 2745 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_22940 4201 3656 gene locus_tag LOCUS_22950 gene rfbC 4201 3656 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_22950 5112 4201 gene locus_tag LOCUS_22960 gene rfbA 5112 4201 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_22960 5502 5116 gene locus_tag LOCUS_22970 5502 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6556 5495 gene locus_tag LOCUS_22980 gene rfbB 6556 5495 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_22980 7572 6553 gene locus_tag LOCUS_22990 7572 6553 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_22990 8330 7569 gene locus_tag LOCUS_23000 8330 7569 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence119 678 1151 gene locus_tag LOCUS_23010 678 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1135 1638 gene locus_tag LOCUS_23020 1135 1638 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_23020 3737 1800 gene locus_tag LOCUS_23030 3737 1800 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 protein_id gnl|my_center|LOCUS_23030 4690 3734 gene locus_tag LOCUS_23040 4690 3734 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_23040 5609 4692 gene locus_tag LOCUS_23050 5609 4692 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_23050 5638 6657 gene locus_tag LOCUS_23060 gene glk 5638 6657 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_23060 7838 6852 gene locus_tag LOCUS_23070 gene moaA 7838 6852 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388276.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence120 8 799 gene locus_tag LOCUS_23080 8 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 860 1261 gene locus_tag LOCUS_23090 860 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1261 3168 gene locus_tag LOCUS_23100 1261 3168 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946745.1 protein_id gnl|my_center|LOCUS_23100 3204 3809 gene locus_tag LOCUS_23110 3204 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3824 4051 gene locus_tag LOCUS_23120 3824 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 4145 4609 gene locus_tag LOCUS_23130 4145 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 4667 4936 gene locus_tag LOCUS_23140 4667 4936 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544631.1 protein_id gnl|my_center|LOCUS_23140 4939 5505 gene locus_tag LOCUS_23150 4939 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 5624 5863 gene locus_tag LOCUS_23160 5624 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 5932 6546 gene locus_tag LOCUS_23170 5932 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 6594 6983 gene locus_tag LOCUS_23180 6594 6983 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_23180 7053 7706 gene locus_tag LOCUS_23190 7053 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 7769 8020 gene locus_tag LOCUS_23200 7769 8020 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272729.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence121 1523 1233 gene locus_tag LOCUS_23210 1523 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1951 1520 gene locus_tag LOCUS_23220 1951 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2178 2525 gene locus_tag LOCUS_23230 2178 2525 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 protein_id gnl|my_center|LOCUS_23230 2614 3075 gene locus_tag LOCUS_23240 2614 3075 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_23240 3198 4289 gene locus_tag LOCUS_23250 gene arsB 3198 4289 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_23250 4282 5241 gene locus_tag LOCUS_23260 4282 5241 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393683.1 protein_id gnl|my_center|LOCUS_23260 5238 5540 gene locus_tag LOCUS_23270 5238 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 5711 5980 gene locus_tag LOCUS_23280 5711 5980 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_23280 5986 6396 gene locus_tag LOCUS_23290 5986 6396 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_23290 6435 7358 gene locus_tag LOCUS_23300 6435 7358 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence122 430 1632 gene locus_tag LOCUS_23310 430 1632 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_23310 1729 2532 gene locus_tag LOCUS_23320 1729 2532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_23320 4260 3193 gene locus_tag LOCUS_23330 4260 3193 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_23330 5387 4338 gene locus_tag LOCUS_23340 gene fbaB 5387 4338 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 protein_id gnl|my_center|LOCUS_23340 5494 7197 gene locus_tag LOCUS_23350 5494 7197 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_23350 7300 7905 gene locus_tag LOCUS_23360 7300 7905 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence123 <1 2617 gene locus_tag LOCUS_23370 <1 2617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461973.1:molybdopterin-dependent oxidoreductase 2619 3335 gene locus_tag LOCUS_23380 2619 3335 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392903.1 protein_id gnl|my_center|LOCUS_23380 3348 4580 gene locus_tag LOCUS_23390 gene nrfD 3348 4580 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817192.1 protein_id gnl|my_center|LOCUS_23390 4643 5029 gene locus_tag LOCUS_23400 4643 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5388 5107 gene locus_tag LOCUS_23410 5388 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5651 5463 gene locus_tag LOCUS_23420 5651 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5799 6773 gene locus_tag LOCUS_23430 5799 6773 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_23430 7303 6977 gene locus_tag LOCUS_23440 7303 6977 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_23440 7419 7877 gene locus_tag LOCUS_23450 7419 7877 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence124 194 604 gene locus_tag LOCUS_23460 gene nsrR 194 604 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_23460 1473 802 gene locus_tag LOCUS_23470 1473 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1579 5004 gene locus_tag LOCUS_23480 gene mfd 1579 5004 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_23480 5195 5593 gene locus_tag LOCUS_23490 5195 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 5936 6541 gene locus_tag LOCUS_23500 5936 6541 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390197.1 protein_id gnl|my_center|LOCUS_23500 6733 7860 gene locus_tag LOCUS_23510 6733 7860 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence125 421 1407 gene locus_tag LOCUS_23520 421 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1656 2465 gene locus_tag LOCUS_23530 gene ccsA 1656 2465 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941366.1 protein_id gnl|my_center|LOCUS_23530 2586 4505 gene locus_tag LOCUS_23540 2586 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 4857 5858 gene locus_tag LOCUS_23550 4857 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 6010 6825 gene locus_tag LOCUS_23560 6010 6825 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123168.1 protein_id gnl|my_center|LOCUS_23560 7313 7056 gene locus_tag LOCUS_23570 7313 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 7706 7942 gene locus_tag LOCUS_23580 7706 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence126 2271 2987 gene locus_tag LOCUS_23590 2271 2987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_23590 3098 5455 gene locus_tag LOCUS_23600 3098 5455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_23600 5457 6653 gene locus_tag LOCUS_23610 5457 6653 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_23610 6711 7565 gene locus_tag LOCUS_23620 gene purU 6711 7565 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence127 895 362 gene locus_tag LOCUS_23630 895 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1348 896 gene locus_tag LOCUS_23640 1348 896 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_23640 2891 1401 gene locus_tag LOCUS_23650 gene pepA 2891 1401 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_23650 3252 4367 gene locus_tag LOCUS_23660 gene lptF 3252 4367 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_23660 4364 5437 gene locus_tag LOCUS_23670 gene lptG 4364 5437 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_23670 5849 5364 gene locus_tag LOCUS_23680 5849 5364 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_23680 6530 5991 gene locus_tag LOCUS_23690 6530 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 6886 6503 gene locus_tag LOCUS_23700 6886 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 7488 6883 gene locus_tag LOCUS_23710 7488 6883 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence128 2 4204 gene locus_tag LOCUS_23720 gene rpoC 2 4204 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_23720 4375 4752 gene locus_tag LOCUS_23730 gene rpsL 4375 4752 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 protein_id gnl|my_center|LOCUS_23730 4810 5280 gene locus_tag LOCUS_23740 gene rpsG 4810 5280 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215391.1 protein_id gnl|my_center|LOCUS_23740 5317 7410 gene locus_tag LOCUS_23750 gene fusA 5317 7410 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence129 <1 1092 gene locus_tag LOCUS_23760 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550179.1:type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein 1089 1748 gene locus_tag LOCUS_23770 1089 1748 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 protein_id gnl|my_center|LOCUS_23770 2845 1955 gene locus_tag LOCUS_23780 2845 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3025 3534 gene locus_tag LOCUS_23790 3025 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 5381 3663 gene locus_tag LOCUS_23800 5381 3663 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_23800 6316 5378 gene locus_tag LOCUS_23810 gene porB 6316 5378 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_23810 <7572 6446 gene locus_tag LOCUS_23820 <7572 6446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393422.1:pyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence130 548 1435 gene locus_tag LOCUS_23830 gene sucD 548 1435 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165487.1 protein_id gnl|my_center|LOCUS_23830 1737 1573 gene locus_tag LOCUS_23840 1737 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1831 3708 gene locus_tag LOCUS_23850 gene dnaK 1831 3708 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_23850 3857 4948 gene locus_tag LOCUS_23860 gene dnaJ 3857 4948 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_23860 4989 7412 gene locus_tag LOCUS_23870 4989 7412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence131 353 278 gene locus_tag LOCUS_t00270 353 278 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 527 847 gene locus_tag LOCUS_23880 527 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 760 963 gene locus_tag LOCUS_23890 760 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 944 1339 gene locus_tag LOCUS_23900 944 1339 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187469.1 protein_id gnl|my_center|LOCUS_23900 1371 2990 gene locus_tag LOCUS_23910 1371 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3247 5148 gene locus_tag LOCUS_23920 3247 5148 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_23920 6081 5203 gene locus_tag LOCUS_23930 6081 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 7150 6254 gene locus_tag LOCUS_23940 7150 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence132 2530 989 gene locus_tag LOCUS_23950 2530 989 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_23950 3362 2742 gene locus_tag LOCUS_23960 3362 2742 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_23960 3992 3528 gene locus_tag LOCUS_23970 gene sixA 3992 3528 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_23970 4709 5509 gene locus_tag LOCUS_23980 gene prpC 4709 5509 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_23980 5517 5642 gene locus_tag LOCUS_23990 5517 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 5734 5919 gene locus_tag LOCUS_24000 5734 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 5909 6214 gene locus_tag LOCUS_24010 5909 6214 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140812.1 protein_id gnl|my_center|LOCUS_24010 6673 6506 gene locus_tag LOCUS_24020 6673 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 6924 6715 gene locus_tag LOCUS_24030 6924 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence133 159 19 gene locus_tag LOCUS_24040 159 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 431 507 gene locus_tag LOCUS_t00280 431 507 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 596 2503 gene locus_tag LOCUS_24050 596 2503 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 protein_id gnl|my_center|LOCUS_24050 2697 3476 gene locus_tag LOCUS_24060 gene malR 2697 3476 CDS product LuxR family transcriptional regulator MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205386.1 protein_id gnl|my_center|LOCUS_24060 3624 4238 gene locus_tag LOCUS_24070 gene lasI 3624 4238 CDS product acyl-homoserine-lactone synthase LasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083017.1 protein_id gnl|my_center|LOCUS_24070 4248 4649 gene locus_tag LOCUS_24080 4248 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5140 6171 gene locus_tag LOCUS_24090 5140 6171 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_24090 6181 6549 gene locus_tag LOCUS_24100 6181 6549 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553206.1 protein_id gnl|my_center|LOCUS_24100 6785 7096 gene locus_tag LOCUS_24110 6785 7096 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence134 405 1691 gene locus_tag LOCUS_24120 405 1691 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_24120 1696 3966 gene locus_tag LOCUS_24130 1696 3966 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_24130 3977 4576 gene locus_tag LOCUS_24140 3977 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4587 5483 gene locus_tag LOCUS_24150 4587 5483 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_24150 5584 5901 gene locus_tag LOCUS_24160 5584 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6960 5908 gene locus_tag LOCUS_24170 6960 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence135 180 779 gene locus_tag LOCUS_24180 180 779 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_24180 787 1674 gene locus_tag LOCUS_24190 787 1674 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_24190 1680 2177 gene locus_tag LOCUS_24200 1680 2177 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_24200 3448 2186 gene locus_tag LOCUS_24210 gene lplT 3448 2186 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_24210 3628 4518 gene locus_tag LOCUS_24220 3628 4518 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_24220 4518 4883 gene locus_tag LOCUS_24230 4518 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 5078 6730 gene locus_tag LOCUS_24240 5078 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence136 666 914 gene locus_tag LOCUS_24250 666 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 914 1336 gene locus_tag LOCUS_24260 914 1336 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_24260 2042 2263 gene locus_tag LOCUS_24270 2042 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2241 2495 gene locus_tag LOCUS_24280 2241 2495 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_24280 3055 2591 gene locus_tag LOCUS_24290 3055 2591 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_24290 4191 3073 gene locus_tag LOCUS_24300 gene aroF 4191 3073 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_24300 4936 4208 gene locus_tag LOCUS_24310 gene lpxH 4936 4208 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_24310 5512 5021 gene locus_tag LOCUS_24320 5512 5021 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_24320 6167 5505 gene locus_tag LOCUS_24330 6167 5505 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_24330 <7135 6164 gene locus_tag LOCUS_24340 <7135 6164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880067.1:murein L,D-transpeptidase >Feature sequence137 786 154 gene locus_tag LOCUS_24350 786 154 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_24350 1081 2079 gene locus_tag LOCUS_24360 gene dusB 1081 2079 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_24360 2076 2312 gene locus_tag LOCUS_24370 2076 2312 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_24370 2439 4007 gene locus_tag LOCUS_24380 gene purH 2439 4007 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_24380 4119 5411 gene locus_tag LOCUS_24390 gene purD 4119 5411 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_24390 5415 5921 gene locus_tag LOCUS_24400 gene purE 5415 5921 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_24400 5977 6600 gene locus_tag LOCUS_24410 5977 6600 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070453.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence138 339 1994 gene locus_tag LOCUS_24420 339 1994 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_24420 2011 2502 gene locus_tag LOCUS_24430 2011 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2670 3887 gene locus_tag LOCUS_24440 2670 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3884 4558 gene locus_tag LOCUS_24450 gene narL 3884 4558 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_24450 4864 6294 gene locus_tag LOCUS_24460 gene cysG 4864 6294 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence139 422 147 gene locus_tag LOCUS_24470 422 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2253 730 gene locus_tag LOCUS_24480 2253 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2598 2341 gene locus_tag LOCUS_24490 2598 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 4112 2838 gene locus_tag LOCUS_24500 4112 2838 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_24500 5485 4427 gene locus_tag LOCUS_24510 gene corA 5485 4427 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_24510 6399 5581 gene locus_tag LOCUS_24520 6399 5581 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071255.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence140 <1 1560 gene locus_tag LOCUS_24530 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087307.1:dihydroxy-acid dehydratase 1567 3354 gene locus_tag LOCUS_24540 1567 3354 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_24540 3438 3779 gene locus_tag LOCUS_24550 gene nirM 3438 3779 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_24550 5242 3836 gene locus_tag LOCUS_24560 5242 3836 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_24560 6358 5456 gene locus_tag LOCUS_24570 gene hemF 6358 5456 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence141 1 123 gene locus_tag LOCUS_24580 1 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 120 614 gene locus_tag LOCUS_24590 120 614 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_24590 719 1555 gene locus_tag LOCUS_24600 gene nadC 719 1555 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_24600 2426 1710 gene locus_tag LOCUS_24610 2426 1710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_24610 4401 2446 gene locus_tag LOCUS_24620 4401 2446 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209484109.1 protein_id gnl|my_center|LOCUS_24620 5499 4621 gene locus_tag LOCUS_24630 5499 4621 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815515.1 protein_id gnl|my_center|LOCUS_24630 <6528 5550 gene locus_tag LOCUS_24640 <6528 5550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152802079.1:ABC transporter substrate-binding protein >Feature sequence142 1160 213 gene locus_tag LOCUS_24650 gene hypB 1160 213 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337652.1 protein_id gnl|my_center|LOCUS_24650 1583 1242 gene locus_tag LOCUS_24660 gene hypA 1583 1242 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_24660 2484 2840 gene locus_tag LOCUS_24670 2484 2840 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035759.1 protein_id gnl|my_center|LOCUS_24670 2954 3520 gene locus_tag LOCUS_24680 2954 3520 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_24680 3682 5460 gene locus_tag LOCUS_24690 3682 5460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_24690 5522 5869 gene locus_tag LOCUS_24700 5522 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence143 926 180 gene locus_tag LOCUS_24710 926 180 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_24710 2209 923 gene locus_tag LOCUS_24720 gene hpnE 2209 923 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_24720 3200 2367 gene locus_tag LOCUS_24730 gene hpnD 3200 2367 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_24730 4026 3214 gene locus_tag LOCUS_24740 gene hpnC 4026 3214 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 protein_id gnl|my_center|LOCUS_24740 4235 4319 gene locus_tag LOCUS_t00290 4235 4319 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4380 5039 gene locus_tag LOCUS_24750 4380 5039 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence144 1694 225 gene locus_tag LOCUS_24760 1694 225 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266437.1 protein_id gnl|my_center|LOCUS_24760 3907 1979 gene locus_tag LOCUS_24770 3907 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536019.1 protein_id gnl|my_center|LOCUS_24770 <6069 4241 gene locus_tag LOCUS_24780 <6069 4241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038070.1:DNA helicase RecQ >Feature sequence145 <1 1750 gene locus_tag LOCUS_24790 <1 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193335.1:DNA mismatch repair protein MutS 2229 1747 gene locus_tag LOCUS_24800 2229 1747 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_24800 2698 2234 gene locus_tag LOCUS_24810 2698 2234 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_24810 2778 3281 gene locus_tag LOCUS_24820 2778 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3506 3736 gene locus_tag LOCUS_24830 3506 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4578 3814 gene locus_tag LOCUS_24840 4578 3814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_24840 5737 4592 gene locus_tag LOCUS_24850 gene bamC 5737 4592 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence146 431 2401 gene locus_tag LOCUS_24860 431 2401 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930279.1 protein_id gnl|my_center|LOCUS_24860 2454 3290 gene locus_tag LOCUS_24870 2454 3290 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_24870 3287 5728 gene locus_tag LOCUS_24880 3287 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence147 3 1286 gene locus_tag LOCUS_24890 3 1286 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_24890 1283 2683 gene locus_tag LOCUS_24900 gene thrC 1283 2683 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_24900 2785 3690 gene locus_tag LOCUS_24910 2785 3690 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_24910 5209 3899 gene locus_tag LOCUS_24920 5209 3899 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence148 573 1745 gene locus_tag LOCUS_24930 573 1745 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821312.1 protein_id gnl|my_center|LOCUS_24930 2117 4138 gene locus_tag LOCUS_24940 gene ligA 2117 4138 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_24940 4135 5007 gene locus_tag LOCUS_24950 gene galU 4135 5007 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_24950 5004 5552 gene locus_tag LOCUS_24960 5004 5552 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194377.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence149 337 95 gene locus_tag LOCUS_24970 337 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1150 608 gene locus_tag LOCUS_24980 1150 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1938 1147 gene locus_tag LOCUS_24990 1938 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2449 1919 gene locus_tag LOCUS_25000 2449 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2817 4517 gene locus_tag LOCUS_25010 2817 4517 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_25010 4514 5350 gene locus_tag LOCUS_25020 gene kdsA 4514 5350 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence150 186 674 gene locus_tag LOCUS_25030 gene rfaE2 186 674 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_25030 854 2221 gene locus_tag LOCUS_25040 854 2221 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_25040 3181 2471 gene locus_tag LOCUS_25050 3181 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3900 3178 gene locus_tag LOCUS_25060 3900 3178 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_25060 4874 3897 gene locus_tag LOCUS_25070 gene birA 4874 3897 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_25070 5097 4989 gene locus_tag LOCUS_r00010 5097 4989 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence151 148 221 gene locus_tag LOCUS_t00300 148 221 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1729 272 gene locus_tag LOCUS_25080 1729 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2634 1726 gene locus_tag LOCUS_25090 gene phnD 2634 1726 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272048.1 protein_id gnl|my_center|LOCUS_25090 4424 2730 gene locus_tag LOCUS_25100 4424 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 4877 4428 gene locus_tag LOCUS_25110 4877 4428 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence152 <1 601 gene locus_tag LOCUS_25120 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105407.1:HAD family hydrolase 968 1279 gene locus_tag LOCUS_25130 968 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25130 1422 2330 gene locus_tag LOCUS_25140 1422 2330 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_25140 2330 3088 gene locus_tag LOCUS_25150 2330 3088 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336738.1 protein_id gnl|my_center|LOCUS_25150 3165 4529 gene locus_tag LOCUS_25160 gene pcnB 3165 4529 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_25160 4590 5090 gene locus_tag LOCUS_25170 gene folK 4590 5090 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221222.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence153 372 2849 gene locus_tag LOCUS_25180 gene parC 372 2849 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_25180 2936 3826 gene locus_tag LOCUS_25190 gene argB 2936 3826 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_25190 3823 4467 gene locus_tag LOCUS_25200 3823 4467 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_25200 4606 5094 gene locus_tag LOCUS_25210 4606 5094 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence154 <1 774 gene locus_tag LOCUS_25220 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195216.1:RNA polymerase factor sigma-54 797 1120 gene locus_tag LOCUS_25230 gene hpf 797 1120 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_25230 1164 1619 gene locus_tag LOCUS_25240 gene ptsN 1164 1619 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_25240 1607 2548 gene locus_tag LOCUS_25250 gene hprK 1607 2548 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687702.1 protein_id gnl|my_center|LOCUS_25250 2555 3394 gene locus_tag LOCUS_25260 gene rapZ 2555 3394 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_25260 3397 3762 gene locus_tag LOCUS_25270 3397 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3898 4440 gene locus_tag LOCUS_25280 3898 4440 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081957.1 protein_id gnl|my_center|LOCUS_25280 4437 5006 gene locus_tag LOCUS_25290 4437 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence155 2558 150 gene locus_tag LOCUS_25300 2558 150 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_25300 3343 2558 gene locus_tag LOCUS_25310 3343 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4792 3347 gene locus_tag LOCUS_25320 gene ccoG 4792 3347 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088522.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence156 1013 1088 gene locus_tag LOCUS_t00310 1013 1088 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2593 1235 gene locus_tag LOCUS_25330 2593 1235 CDS product TniQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188384634.1 protein_id gnl|my_center|LOCUS_25330 3749 2580 gene locus_tag LOCUS_25340 3749 2580 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085739.1 protein_id gnl|my_center|LOCUS_25340 4807 3746 gene locus_tag LOCUS_25350 4807 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence157 <1 2877 gene locus_tag LOCUS_25360 <1 2877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086886.1:CusA/CzcA family heavy metal efflux RND transporter 2874 3185 gene locus_tag LOCUS_25370 2874 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3182 4483 gene locus_tag LOCUS_25380 3182 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence158 317 1024 gene locus_tag LOCUS_25390 317 1024 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199747194.1 protein_id gnl|my_center|LOCUS_25390 1024 1950 gene locus_tag LOCUS_25400 1024 1950 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_25400 2013 4502 gene locus_tag LOCUS_25410 2013 4502 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence159 110 832 gene locus_tag LOCUS_25420 110 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 945 1664 gene locus_tag LOCUS_25430 945 1664 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 protein_id gnl|my_center|LOCUS_25430 1759 2145 gene locus_tag LOCUS_25440 1759 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2142 2915 gene locus_tag LOCUS_25450 2142 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3318 4472 gene locus_tag LOCUS_25460 3318 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence160 708 19 gene locus_tag LOCUS_25470 708 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 953 3535 gene locus_tag LOCUS_25480 gene clpB 953 3535 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_25480 3954 4325 gene locus_tag LOCUS_25490 3954 4325 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence161 301 1980 gene locus_tag LOCUS_25500 gene ubiB 301 1980 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_25500 2377 2835 gene locus_tag LOCUS_25510 2377 2835 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_25510 2844 4307 gene locus_tag LOCUS_25520 2844 4307 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence162 737 234 gene locus_tag LOCUS_25530 737 234 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197245.1 protein_id gnl|my_center|LOCUS_25530 1060 737 gene locus_tag LOCUS_25540 1060 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1662 1213 gene locus_tag LOCUS_25550 gene moaE 1662 1213 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_25550 1918 1664 gene locus_tag LOCUS_25560 gene moaD 1918 1664 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_25560 3138 1933 gene locus_tag LOCUS_25570 3138 1933 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_25570 3652 3131 gene locus_tag LOCUS_25580 gene mobB 3652 3131 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_25580 4095 3649 gene locus_tag LOCUS_25590 gene smpB 4095 3649 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229688.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence163 3433 4287 gene locus_tag LOCUS_25600 gene rhdA 3433 4287 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence164 26 646 gene locus_tag LOCUS_25610 26 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 672 1547 gene locus_tag LOCUS_25620 672 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2979 3890 gene locus_tag LOCUS_25630 2979 3890 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255934.1 protein_id gnl|my_center|LOCUS_25630 3901 4077 gene locus_tag LOCUS_25640 3901 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence165 1277 336 gene locus_tag LOCUS_25650 gene gluQRS 1277 336 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951304.1 protein_id gnl|my_center|LOCUS_25650 1470 2168 gene locus_tag LOCUS_25660 1470 2168 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_25660 2383 3465 gene locus_tag LOCUS_25670 2383 3465 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_25670 3590 4201 gene locus_tag LOCUS_25680 3590 4201 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence166 963 82 gene locus_tag LOCUS_25690 963 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1631 1026 gene locus_tag LOCUS_25700 gene msrQ 1631 1026 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_25700 2593 1631 gene locus_tag LOCUS_25710 gene msrP 2593 1631 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_25710 2848 4032 gene locus_tag LOCUS_25720 2848 4032 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence167 698 623 gene locus_tag LOCUS_t00320 698 623 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1354 2355 gene locus_tag LOCUS_25730 1354 2355 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_25730 2551 3882 gene locus_tag LOCUS_25740 2551 3882 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence168 686 348 gene locus_tag LOCUS_25750 686 348 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_25750 879 673 gene locus_tag LOCUS_25760 879 673 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_25760 1274 975 gene locus_tag LOCUS_25770 1274 975 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_25770 1563 1285 gene locus_tag LOCUS_25780 1563 1285 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086466044.1 protein_id gnl|my_center|LOCUS_25780 1693 3003 gene locus_tag LOCUS_25790 gene hisD 1693 3003 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_25790 3019 4080 gene locus_tag LOCUS_25800 gene hisC 3019 4080 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence169 <1 867 gene locus_tag LOCUS_25810 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094907.1:ADP-heptose--LPS heptosyltransferase RfaF 2421 1051 gene locus_tag LOCUS_25820 gene hemN 2421 1051 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_25820 <4155 2579 gene locus_tag LOCUS_25830 <4155 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943274.1:alpha-amylase family glycosyl hydrolase >Feature sequence170 443 721 gene locus_tag LOCUS_25840 443 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 699 2261 gene locus_tag LOCUS_25850 699 2261 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195345.1 protein_id gnl|my_center|LOCUS_25850 2281 3420 gene locus_tag LOCUS_25860 gene cydB 2281 3420 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168027.1 protein_id gnl|my_center|LOCUS_25860 3605 3961 gene locus_tag LOCUS_25870 3605 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence171 500 1087 gene locus_tag LOCUS_25880 gene hisB 500 1087 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_25880 1258 1911 gene locus_tag LOCUS_25890 gene hisH 1258 1911 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_25890 2284 3030 gene locus_tag LOCUS_25900 gene hisA 2284 3030 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_25900 3030 3803 gene locus_tag LOCUS_25910 gene hisF 3030 3803 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence172 1527 301 gene locus_tag LOCUS_25920 1527 301 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_25920 1633 2013 gene locus_tag LOCUS_25930 1633 2013 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_25930 2770 2108 gene locus_tag LOCUS_25940 gene yrfG 2770 2108 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_25940 <3935 2771 gene locus_tag LOCUS_25950 <3935 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880955.1:GspE/PulE family protein >Feature sequence173 195 1484 gene locus_tag LOCUS_25960 195 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2439 1585 gene locus_tag LOCUS_25970 gene rsgA 2439 1585 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_25970 2764 2456 gene locus_tag LOCUS_25980 2764 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 <3915 2790 gene locus_tag LOCUS_25990 <3915 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039491.1:M48 family metallopeptidase >Feature sequence174 215 290 gene locus_tag LOCUS_t00330 215 290 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 394 741 gene locus_tag LOCUS_26000 gene secE 394 741 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_26000 741 1274 gene locus_tag LOCUS_26010 gene nusG 741 1274 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_26010 1445 1876 gene locus_tag LOCUS_26020 gene rplK 1445 1876 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_26020 1877 2572 gene locus_tag LOCUS_26030 gene rplA 1877 2572 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_26030 2939 3460 gene locus_tag LOCUS_26040 gene rplJ 2939 3460 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_26040 3520 3900 gene locus_tag LOCUS_26050 gene rplL 3520 3900 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence175 <1 902 gene locus_tag LOCUS_26060 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807616.1:glutamyl-tRNA reductase 985 2067 gene locus_tag LOCUS_26070 gene prfA 985 2067 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527811.1 protein_id gnl|my_center|LOCUS_26070 2269 2706 gene locus_tag LOCUS_26080 2269 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2699 3598 gene locus_tag LOCUS_26090 gene prmC 2699 3598 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929958.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence176 201 1214 gene locus_tag LOCUS_26100 201 1214 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_26100 1330 2244 gene locus_tag LOCUS_26110 1330 2244 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence177 81 5 gene locus_tag LOCUS_t00340 81 5 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 174 98 gene locus_tag LOCUS_t00350 174 98 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1847 246 gene locus_tag LOCUS_26120 gene merA 1847 246 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136268.1 protein_id gnl|my_center|LOCUS_26120 2146 1844 gene locus_tag LOCUS_26130 gene merP 2146 1844 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735441.1 protein_id gnl|my_center|LOCUS_26130 2519 2163 gene locus_tag LOCUS_26140 2519 2163 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_26140 2607 3008 gene locus_tag LOCUS_26150 gene merR 2607 3008 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_26150 3533 3111 gene locus_tag LOCUS_26160 gene cueR 3533 3111 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391497.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence178 315 554 gene locus_tag LOCUS_26170 315 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 541 981 gene locus_tag LOCUS_26180 541 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 997 2511 gene locus_tag LOCUS_26190 gene lysS 997 2511 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 protein_id gnl|my_center|LOCUS_26190 2911 3597 gene locus_tag LOCUS_26200 2911 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence179 1293 268 gene locus_tag LOCUS_26210 gene dctP 1293 268 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087202.1 protein_id gnl|my_center|LOCUS_26210 1500 2207 gene locus_tag LOCUS_26220 1500 2207 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_26220 2311 3639 gene locus_tag LOCUS_26230 2311 3639 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence180 263 2674 gene locus_tag LOCUS_26240 gene hypF 263 2674 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388061.1 protein_id gnl|my_center|LOCUS_26240 2678 2902 gene locus_tag LOCUS_26250 2678 2902 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence181 1701 175 gene locus_tag LOCUS_26260 1701 175 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_26260 1769 2713 gene locus_tag LOCUS_26270 1769 2713 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_26270 2956 3405 gene locus_tag LOCUS_26280 2956 3405 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence182 222 2933 gene locus_tag LOCUS_26290 222 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3304 2927 gene locus_tag LOCUS_26300 3304 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence183 <1 526 gene locus_tag LOCUS_26310 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087828.1:uracil-DNA glycosylase 535 720 gene locus_tag LOCUS_26320 535 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 932 2731 gene locus_tag LOCUS_26330 gene uvrC 932 2731 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_26330 2738 3310 gene locus_tag LOCUS_26340 gene pgsA 2738 3310 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244239.1 protein_id gnl|my_center|LOCUS_26340 3366 3441 gene locus_tag LOCUS_t00360 3366 3441 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence184 792 412 gene locus_tag LOCUS_26350 792 412 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_26350 1679 834 gene locus_tag LOCUS_26360 gene panC 1679 834 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222669.1 protein_id gnl|my_center|LOCUS_26360 2481 1690 gene locus_tag LOCUS_26370 gene panB 2481 1690 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_26370 3126 2485 gene locus_tag LOCUS_26380 3126 2485 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence185 242 667 gene locus_tag LOCUS_26390 gene fur 242 667 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_26390 634 1098 gene locus_tag LOCUS_26400 634 1098 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_26400 2765 1095 gene locus_tag LOCUS_26410 gene recN 2765 1095 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence186 408 241 gene locus_tag LOCUS_26420 408 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 776 1030 gene locus_tag LOCUS_26430 776 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1116 1415 gene locus_tag LOCUS_26440 1116 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1441 2118 gene locus_tag LOCUS_26450 gene tsaB 1441 2118 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_26450 2115 2576 gene locus_tag LOCUS_26460 gene rimI 2115 2576 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_26460 2573 3253 gene locus_tag LOCUS_26470 2573 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence187 914 312 gene locus_tag LOCUS_26480 914 312 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_26480 1657 911 gene locus_tag LOCUS_26490 1657 911 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214390.1 protein_id gnl|my_center|LOCUS_26490 2979 1687 gene locus_tag LOCUS_26500 2979 1687 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527797.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence188 338 135 gene locus_tag LOCUS_26510 338 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 440 1315 gene locus_tag LOCUS_26520 gene hslO 440 1315 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_26520 1318 2649 gene locus_tag LOCUS_26530 1318 2649 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_26530 2789 3193 gene locus_tag LOCUS_26540 2789 3193 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence189 <1 1384 gene locus_tag LOCUS_26550 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525195.1:amidophosphoribosyltransferase 1473 2648 gene locus_tag LOCUS_26560 1473 2648 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_26560 2688 3101 gene locus_tag LOCUS_26570 2688 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence190 364 128 gene locus_tag LOCUS_26580 gene rpmB 364 128 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_26580 1129 455 gene locus_tag LOCUS_26590 gene radC 1129 455 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_26590 1327 2526 gene locus_tag LOCUS_26600 gene coaBC 1327 2526 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_26600 2523 2984 gene locus_tag LOCUS_26610 gene dut 2523 2984 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence191 294 106 gene locus_tag LOCUS_26620 294 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 464 291 gene locus_tag LOCUS_26630 464 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1099 533 gene locus_tag LOCUS_26640 1099 533 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_26640 1666 1121 gene locus_tag LOCUS_26650 1666 1121 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194156.1 protein_id gnl|my_center|LOCUS_26650 2217 1666 gene locus_tag LOCUS_26660 2217 1666 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_26660 2702 2214 gene locus_tag LOCUS_26670 2702 2214 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence192 2350 263 gene locus_tag LOCUS_26680 2350 263 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_26680 2468 2611 gene locus_tag LOCUS_26690 2468 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence193 2912 348 gene locus_tag LOCUS_26700 2912 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence194 626 1291 gene locus_tag LOCUS_26710 626 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1358 1615 gene locus_tag LOCUS_26720 1358 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1718 3067 gene locus_tag LOCUS_26730 1718 3067 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539908.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence195 526 362 gene locus_tag LOCUS_26740 526 362 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098330.1 protein_id gnl|my_center|LOCUS_26740 1027 557 gene locus_tag LOCUS_26750 1027 557 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_26750 2096 1161 gene locus_tag LOCUS_26760 2096 1161 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence196 <1 2167 gene locus_tag LOCUS_26770 <1 2167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203868.1:methionine--tRNA ligase 2580 2215 gene locus_tag LOCUS_26780 2580 2215 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761890.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence197 <1 718 gene locus_tag LOCUS_26790 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001043146.1:pyruvate/proton symporter CstA 703 906 gene locus_tag LOCUS_26800 703 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1283 903 gene locus_tag LOCUS_26810 1283 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2173 1391 gene locus_tag LOCUS_26820 gene lgt 2173 1391 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence198 235 555 gene locus_tag LOCUS_26830 235 555 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927225.1 protein_id gnl|my_center|LOCUS_26830 552 887 gene locus_tag LOCUS_26840 552 887 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_26840 911 1132 gene locus_tag LOCUS_26850 gene tatA 911 1132 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_26850 1145 1579 gene locus_tag LOCUS_26860 gene tatB 1145 1579 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_26860 1611 2438 gene locus_tag LOCUS_26870 gene tatC 1611 2438 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence199 286 612 gene locus_tag LOCUS_26880 286 612 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_26880 1114 650 gene locus_tag LOCUS_26890 1114 650 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266668.1 protein_id gnl|my_center|LOCUS_26890 1448 1137 gene locus_tag LOCUS_26900 1448 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence200 627 253 gene locus_tag LOCUS_26910 627 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence201 1183 1107 gene locus_tag LOCUS_t00370 1183 1107 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1999 1226 gene locus_tag LOCUS_26920 1999 1226 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_26920 2163 2363 gene locus_tag LOCUS_26930 2163 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence202 151 639 gene locus_tag LOCUS_26940 151 639 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_26940 791 1300 gene locus_tag LOCUS_26950 791 1300 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 protein_id gnl|my_center|LOCUS_26950 1309 2061 gene locus_tag LOCUS_26960 1309 2061 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence203 311 1330 gene locus_tag LOCUS_26970 311 1330 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_26970 1437 2291 gene locus_tag LOCUS_26980 1437 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence204 479 404 gene locus_tag LOCUS_t00380 479 404 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 951 523 gene locus_tag LOCUS_26990 951 523 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_26990 2102 984 gene locus_tag LOCUS_27000 gene thiO 2102 984 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence205 748 1824 gene locus_tag LOCUS_27010 748 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence206 1537 416 gene locus_tag LOCUS_27020 1537 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1854 2021 gene locus_tag LOCUS_27030 1854 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence207 1250 201 gene locus_tag LOCUS_27040 gene hypE 1250 201 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_27040 1805 1347 gene locus_tag LOCUS_27050 1805 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence208 258 923 gene locus_tag LOCUS_27060 258 923 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_27060 <1802 1113 gene locus_tag LOCUS_27070 <1802 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence209 1224 880 gene locus_tag LOCUS_27080 1224 880 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence210 997 1257 gene locus_tag LOCUS_27090 997 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 1254 1586 gene locus_tag LOCUS_27100 1254 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence211 358 134 gene locus_tag LOCUS_27110 358 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 909 355 gene locus_tag LOCUS_27120 909 355 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_27120 1526 909 gene locus_tag LOCUS_27130 1526 909 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 protein_id gnl|my_center|LOCUS_27130