>Feature sequence001 <1 1549 gene locus_tag LOCUS_00010 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein 2023 1562 gene locus_tag LOCUS_00020 2023 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405531.1 protein_id gnl|my_center|LOCUS_00020 2650 2081 gene locus_tag LOCUS_00030 2650 2081 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_00030 3759 2653 gene locus_tag LOCUS_00040 3759 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5124 3763 gene locus_tag LOCUS_00050 5124 3763 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064075.1 protein_id gnl|my_center|LOCUS_00050 5702 5133 gene locus_tag LOCUS_00060 5702 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6882 5746 gene locus_tag LOCUS_00070 6882 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8850 6901 gene locus_tag LOCUS_00080 8850 6901 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_00080 10241 8847 gene locus_tag LOCUS_00090 10241 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11902 10280 gene locus_tag LOCUS_00100 11902 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12380 15652 gene locus_tag LOCUS_00110 12380 15652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19303 15662 gene locus_tag LOCUS_00120 19303 15662 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_00120 19697 19858 gene locus_tag LOCUS_00130 19697 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20688 19969 gene locus_tag LOCUS_00140 20688 19969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_00140 23168 20685 gene locus_tag LOCUS_00150 23168 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 24063 23266 gene locus_tag LOCUS_00160 24063 23266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 25876 24248 gene locus_tag LOCUS_00170 25876 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 26202 27905 gene locus_tag LOCUS_00180 26202 27905 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222851.1 protein_id gnl|my_center|LOCUS_00180 27925 29529 gene locus_tag LOCUS_00190 27925 29529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 29930 31189 gene locus_tag LOCUS_00200 gene thrC 29930 31189 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_00200 31256 31678 gene locus_tag LOCUS_00210 31256 31678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 31696 31971 gene locus_tag LOCUS_00220 31696 31971 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_00220 32099 32389 gene locus_tag LOCUS_00230 32099 32389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 32498 33553 gene locus_tag LOCUS_00240 32498 33553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 33655 34014 gene locus_tag LOCUS_00250 33655 34014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34668 37211 gene locus_tag LOCUS_00260 34668 37211 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_00260 41449 37307 gene locus_tag LOCUS_00270 gene rpoC 41449 37307 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895278.1 protein_id gnl|my_center|LOCUS_00270 45380 41472 gene locus_tag LOCUS_00280 gene rpoB 45380 41472 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_00280 45975 45583 gene locus_tag LOCUS_00290 gene rplL 45975 45583 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536194.1 protein_id gnl|my_center|LOCUS_00290 46620 46108 gene locus_tag LOCUS_00300 gene rplJ 46620 46108 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312510.1 protein_id gnl|my_center|LOCUS_00300 47327 46635 gene locus_tag LOCUS_00310 gene rplA 47327 46635 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002020168.1 protein_id gnl|my_center|LOCUS_00310 47806 47381 gene locus_tag LOCUS_00320 gene rplK 47806 47381 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_00320 48414 47869 gene locus_tag LOCUS_00330 gene nusG 48414 47869 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_00330 48768 48679 gene locus_tag LOCUS_t00010 48768 48679 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48856 48781 gene locus_tag LOCUS_t00020 48856 48781 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 50126 48939 gene locus_tag LOCUS_00340 gene tuf 50126 48939 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_00340 50249 50174 gene locus_tag LOCUS_t00030 50249 50174 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 51243 50464 gene locus_tag LOCUS_00350 51243 50464 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_00350 52725 51247 gene locus_tag LOCUS_00360 52725 51247 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_00360 54164 52722 gene locus_tag LOCUS_00370 54164 52722 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_00370 54805 54161 gene locus_tag LOCUS_00380 54805 54161 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_00380 55983 55081 gene locus_tag LOCUS_00390 55983 55081 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_00390 57935 55980 gene locus_tag LOCUS_00400 57935 55980 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_00400 59885 57936 gene locus_tag LOCUS_00410 59885 57936 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_00410 60583 59882 gene locus_tag LOCUS_00420 60583 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 61802 60828 gene locus_tag LOCUS_00430 gene xerC 61802 60828 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_00430 62028 61813 gene locus_tag LOCUS_00440 62028 61813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 65103 62107 gene locus_tag LOCUS_00450 65103 62107 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_00450 66068 65241 gene locus_tag LOCUS_00460 66068 65241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 69106 66065 gene locus_tag LOCUS_00470 69106 66065 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_00470 70156 69398 gene locus_tag LOCUS_00480 70156 69398 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_00480 70231 71094 gene locus_tag LOCUS_00490 70231 71094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 73979 71184 gene locus_tag LOCUS_00500 73979 71184 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_00500 74191 76128 gene locus_tag LOCUS_00510 74191 76128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 76112 78049 gene locus_tag LOCUS_00520 76112 78049 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_00520 78188 80212 gene locus_tag LOCUS_00530 78188 80212 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_00530 81146 80385 gene locus_tag LOCUS_00540 81146 80385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 81192 82424 gene locus_tag LOCUS_00550 81192 82424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 82553 82981 gene locus_tag LOCUS_00560 82553 82981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 83376 83209 gene locus_tag LOCUS_00570 83376 83209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 83688 86294 gene locus_tag LOCUS_00580 83688 86294 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_00580 87656 86334 gene locus_tag LOCUS_00590 87656 86334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 91096 87965 gene locus_tag LOCUS_00600 91096 87965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 92947 91181 gene locus_tag LOCUS_00610 92947 91181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 93848 92967 gene locus_tag LOCUS_00620 93848 92967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 96108 94408 gene locus_tag LOCUS_00630 96108 94408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 96532 96861 gene locus_tag LOCUS_00640 96532 96861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 96977 98449 gene locus_tag LOCUS_00650 96977 98449 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_00650 98731 99774 gene locus_tag LOCUS_00660 98731 99774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 99795 100394 gene locus_tag LOCUS_00670 gene rpoE 99795 100394 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_00670 100391 100903 gene locus_tag LOCUS_00680 100391 100903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 100919 101746 gene locus_tag LOCUS_00690 100919 101746 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462327.1 protein_id gnl|my_center|LOCUS_00690 103898 102156 gene locus_tag LOCUS_00700 103898 102156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 106491 104239 gene locus_tag LOCUS_00710 106491 104239 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108165.1 protein_id gnl|my_center|LOCUS_00710 108519 106816 gene locus_tag LOCUS_00720 108519 106816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 108836 108597 gene locus_tag LOCUS_00730 108836 108597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 110592 109306 gene locus_tag LOCUS_00740 gene purD 110592 109306 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_00740 112401 110656 gene locus_tag LOCUS_00750 112401 110656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 114740 112488 gene locus_tag LOCUS_00760 114740 112488 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_00760 117015 114763 gene locus_tag LOCUS_00770 117015 114763 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_00770 117493 117155 gene locus_tag LOCUS_00780 117493 117155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 117959 121183 gene locus_tag LOCUS_00790 gene secA 117959 121183 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_00790 121340 121669 gene locus_tag LOCUS_00800 121340 121669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 121730 123016 gene locus_tag LOCUS_00810 121730 123016 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_00810 123241 123939 gene locus_tag LOCUS_00820 123241 123939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 123950 125239 gene locus_tag LOCUS_00830 123950 125239 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_00830 125226 125639 gene locus_tag LOCUS_00840 125226 125639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 126279 125668 gene locus_tag LOCUS_00850 gene metW 126279 125668 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_00850 127482 126286 gene locus_tag LOCUS_00860 127482 126286 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_00860 128779 127484 gene locus_tag LOCUS_00870 128779 127484 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_00870 129022 130443 gene locus_tag LOCUS_00880 129022 130443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 131131 133305 gene locus_tag LOCUS_00890 gene cas3u 131131 133305 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_00890 133302 134393 gene locus_tag LOCUS_00900 133302 134393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 134398 135513 gene locus_tag LOCUS_00910 gene cas7u 134398 135513 CDS product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 protein_id gnl|my_center|LOCUS_00910 135523 137157 gene locus_tag LOCUS_00920 gene csb2 135523 137157 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_00920 137497 139338 gene locus_tag LOCUS_00930 gene cas1 137497 139338 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_00930 139342 139632 gene locus_tag LOCUS_00940 gene cas2 139342 139632 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence002 1781 480 gene locus_tag LOCUS_00950 1781 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 2364 1783 gene locus_tag LOCUS_00960 2364 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 2830 2348 gene locus_tag LOCUS_00970 2830 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 3242 5467 gene locus_tag LOCUS_00980 3242 5467 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_00980 6880 7218 gene locus_tag LOCUS_00990 6880 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00990 7272 8276 gene locus_tag LOCUS_01000 7272 8276 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255985.1 protein_id gnl|my_center|LOCUS_01000 8407 9375 gene locus_tag LOCUS_01010 8407 9375 CDS product restriction endonuclease, SacI family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255986.1 protein_id gnl|my_center|LOCUS_01010 9397 10365 gene locus_tag LOCUS_01020 9397 10365 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_01020 10362 10928 gene locus_tag LOCUS_01030 10362 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 10925 11965 gene locus_tag LOCUS_01040 10925 11965 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_01040 11975 13003 gene locus_tag LOCUS_01050 11975 13003 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_01050 13000 13938 gene locus_tag LOCUS_01060 13000 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 14117 15796 gene locus_tag LOCUS_01070 14117 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 15793 16524 gene locus_tag LOCUS_01080 15793 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 16770 18152 gene locus_tag LOCUS_01090 16770 18152 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_01090 18285 19163 gene locus_tag LOCUS_01100 gene dapA 18285 19163 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_01100 19244 19978 gene locus_tag LOCUS_01110 gene dapB 19244 19978 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_01110 20066 20404 gene locus_tag LOCUS_01120 20066 20404 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_01120 20377 21117 gene locus_tag LOCUS_01130 20377 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 21117 21614 gene locus_tag LOCUS_01140 gene folK 21117 21614 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_01140 21651 22019 gene locus_tag LOCUS_01150 21651 22019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 22346 22020 gene locus_tag LOCUS_01160 22346 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 23114 22413 gene locus_tag LOCUS_01170 23114 22413 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01170 23156 23563 gene locus_tag LOCUS_01180 23156 23563 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_01180 23642 24091 gene locus_tag LOCUS_01190 23642 24091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 24213 24512 gene locus_tag LOCUS_01200 24213 24512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 24586 25653 gene locus_tag LOCUS_01210 24586 25653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 25706 26098 gene locus_tag LOCUS_01220 gene hisI 25706 26098 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932151.1 protein_id gnl|my_center|LOCUS_01220 26114 26404 gene locus_tag LOCUS_01230 26114 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 26463 27965 gene locus_tag LOCUS_01240 gene trpE 26463 27965 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_01240 29121 28099 gene locus_tag LOCUS_01250 gene cydB 29121 28099 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_01250 30491 29130 gene locus_tag LOCUS_01260 30491 29130 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_01260 31662 30607 gene locus_tag LOCUS_01270 31662 30607 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_01270 31710 32615 gene locus_tag LOCUS_01280 31710 32615 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_01280 33142 32591 gene locus_tag LOCUS_01290 33142 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 33492 33139 gene locus_tag LOCUS_01300 33492 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 35181 33505 gene locus_tag LOCUS_01310 35181 33505 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390062.1 protein_id gnl|my_center|LOCUS_01310 36121 35192 gene locus_tag LOCUS_01320 36121 35192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 36498 36163 gene locus_tag LOCUS_01330 36498 36163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 37028 36603 gene locus_tag LOCUS_01340 37028 36603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 40592 37293 gene locus_tag LOCUS_01350 40592 37293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 42422 41076 gene locus_tag LOCUS_01360 gene orpR 42422 41076 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_01360 42600 43049 gene locus_tag LOCUS_01370 42600 43049 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454293.1 protein_id gnl|my_center|LOCUS_01370 43042 43887 gene locus_tag LOCUS_01380 43042 43887 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_01380 45902 43893 gene locus_tag LOCUS_01390 45902 43893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 46212 48059 gene locus_tag LOCUS_01400 46212 48059 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079894.1 protein_id gnl|my_center|LOCUS_01400 48169 49422 gene locus_tag LOCUS_01410 48169 49422 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_01410 49435 50208 gene locus_tag LOCUS_01420 49435 50208 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_01420 51106 50312 gene locus_tag LOCUS_01430 51106 50312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 51826 52071 gene locus_tag LOCUS_01440 51826 52071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 52411 53268 gene locus_tag LOCUS_01450 52411 53268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 55010 53265 gene locus_tag LOCUS_01460 gene pilB 55010 53265 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_01460 55804 55013 gene locus_tag LOCUS_01470 55804 55013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 56010 60299 gene locus_tag LOCUS_01480 56010 60299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 62599 60371 gene locus_tag LOCUS_01490 62599 60371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 62956 63510 gene locus_tag LOCUS_01500 62956 63510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 63512 64216 gene locus_tag LOCUS_01510 gene pdxH 63512 64216 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_01510 64659 64435 gene locus_tag LOCUS_01520 64659 64435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 65659 64679 gene locus_tag LOCUS_01530 65659 64679 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_01530 66145 65831 gene locus_tag LOCUS_01540 66145 65831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 66376 67563 gene locus_tag LOCUS_01550 66376 67563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_01550 68048 67608 gene locus_tag LOCUS_01560 68048 67608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 68282 68896 gene locus_tag LOCUS_01570 68282 68896 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_01570 68949 69422 gene locus_tag LOCUS_01580 gene bcp 68949 69422 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_01580 69545 70024 gene locus_tag LOCUS_01590 69545 70024 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_01590 70096 71586 gene locus_tag LOCUS_01600 70096 71586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 71655 72044 gene locus_tag LOCUS_01610 71655 72044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 72066 73181 gene locus_tag LOCUS_01620 72066 73181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 73182 74609 gene locus_tag LOCUS_01630 73182 74609 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_01630 77140 74645 gene locus_tag LOCUS_01640 77140 74645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 77494 77273 gene locus_tag LOCUS_01650 77494 77273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 77493 79439 gene locus_tag LOCUS_01660 77493 79439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 79716 83069 gene locus_tag LOCUS_01670 79716 83069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 83066 83707 gene locus_tag LOCUS_01680 83066 83707 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_01680 83886 86798 gene locus_tag LOCUS_01690 83886 86798 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054074.1 protein_id gnl|my_center|LOCUS_01690 86887 87879 gene locus_tag LOCUS_01700 86887 87879 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767184.1 protein_id gnl|my_center|LOCUS_01700 88113 89087 gene locus_tag LOCUS_01710 88113 89087 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228318.1 protein_id gnl|my_center|LOCUS_01710 89327 89127 gene locus_tag LOCUS_01720 89327 89127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 90759 89311 gene locus_tag LOCUS_01730 90759 89311 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_01730 90843 91100 gene locus_tag LOCUS_01740 90843 91100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 91213 91515 gene locus_tag LOCUS_01750 91213 91515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 91595 91816 gene locus_tag LOCUS_01760 gene infA 91595 91816 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 protein_id gnl|my_center|LOCUS_01760 92982 91975 gene locus_tag LOCUS_01770 92982 91975 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_01770 93260 93880 gene locus_tag LOCUS_01780 93260 93880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_01780 99986 94083 gene locus_tag LOCUS_01790 99986 94083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 100204 103401 gene locus_tag LOCUS_01800 100204 103401 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037325.1 protein_id gnl|my_center|LOCUS_01800 105555 103591 gene locus_tag LOCUS_01810 105555 103591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01810 106434 105610 gene locus_tag LOCUS_01820 106434 105610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 106879 107235 gene locus_tag LOCUS_01830 106879 107235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 107381 110347 gene locus_tag LOCUS_01840 gene uvrA 107381 110347 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_01840 110425 113043 gene locus_tag LOCUS_01850 110425 113043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 114422 113403 gene locus_tag LOCUS_01860 114422 113403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 114522 115697 gene locus_tag LOCUS_01870 114522 115697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 115940 116611 gene locus_tag LOCUS_01880 115940 116611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 117673 116612 gene locus_tag LOCUS_01890 117673 116612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 118065 117760 gene locus_tag LOCUS_01900 118065 117760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 118344 118066 gene locus_tag LOCUS_01910 118344 118066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 119856 118348 gene locus_tag LOCUS_01920 119856 118348 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_01920 120085 119861 gene locus_tag LOCUS_01930 120085 119861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 120414 120103 gene locus_tag LOCUS_01940 120414 120103 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence003 950 234 gene locus_tag LOCUS_01950 950 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1171 959 gene locus_tag LOCUS_01960 1171 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1650 2777 gene locus_tag LOCUS_01970 1650 2777 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_01970 2781 3107 gene locus_tag LOCUS_01980 gene cutA 2781 3107 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_01980 3149 3871 gene locus_tag LOCUS_01990 3149 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3930 4520 gene locus_tag LOCUS_02000 3930 4520 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980172.1 protein_id gnl|my_center|LOCUS_02000 4563 4829 gene locus_tag LOCUS_02010 4563 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5317 4895 gene locus_tag LOCUS_02020 5317 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 6340 5327 gene locus_tag LOCUS_02030 6340 5327 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_02030 7036 6428 gene locus_tag LOCUS_02040 gene rpsD 7036 6428 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989757.1 protein_id gnl|my_center|LOCUS_02040 7639 7070 gene locus_tag LOCUS_02050 7639 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 8050 7655 gene locus_tag LOCUS_02060 gene rpsM 8050 7655 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633368.1 protein_id gnl|my_center|LOCUS_02060 8400 8176 gene locus_tag LOCUS_02070 gene infA 8400 8176 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_02070 9104 8376 gene locus_tag LOCUS_02080 gene map 9104 8376 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_02080 10545 9151 gene locus_tag LOCUS_02090 gene secY 10545 9151 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_02090 11034 10558 gene locus_tag LOCUS_02100 gene rplO 11034 10558 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 protein_id gnl|my_center|LOCUS_02100 11689 11048 gene locus_tag LOCUS_02110 11689 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12075 11710 gene locus_tag LOCUS_02120 gene rplR 12075 11710 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 protein_id gnl|my_center|LOCUS_02120 12657 12121 gene locus_tag LOCUS_02130 gene rplF 12657 12121 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269093.1 protein_id gnl|my_center|LOCUS_02130 13050 12664 gene locus_tag LOCUS_02140 gene rpsH 13050 12664 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062614.1 protein_id gnl|my_center|LOCUS_02140 13395 13126 gene locus_tag LOCUS_02150 gene rpsN 13395 13126 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479943.1 protein_id gnl|my_center|LOCUS_02150 13953 13411 gene locus_tag LOCUS_02160 gene rplE 13953 13411 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_02160 14227 13988 gene locus_tag LOCUS_02170 14227 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 14598 14233 gene locus_tag LOCUS_02180 gene rplN 14598 14233 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_02180 14893 14609 gene locus_tag LOCUS_02190 gene rpsQ 14893 14609 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_02190 15100 14900 gene locus_tag LOCUS_02200 gene rpmC 15100 14900 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919135.1 protein_id gnl|my_center|LOCUS_02200 15529 15107 gene locus_tag LOCUS_02210 gene rplP 15529 15107 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081822.1 protein_id gnl|my_center|LOCUS_02210 16226 15552 gene locus_tag LOCUS_02220 gene rpsC 16226 15552 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919133.1 protein_id gnl|my_center|LOCUS_02220 16560 16228 gene locus_tag LOCUS_02230 gene rplV 16560 16228 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946083.1 protein_id gnl|my_center|LOCUS_02230 16848 16567 gene locus_tag LOCUS_02240 gene rpsS 16848 16567 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_02240 17709 16855 gene locus_tag LOCUS_02250 gene rplB 17709 16855 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_02250 18028 19557 gene locus_tag LOCUS_02260 gene cobA 18028 19557 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_02260 20578 19691 gene locus_tag LOCUS_02270 20578 19691 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_02270 20678 24649 gene locus_tag LOCUS_02280 20678 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 24686 27751 gene locus_tag LOCUS_02290 24686 27751 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_02290 27761 29182 gene locus_tag LOCUS_02300 27761 29182 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_02300 29248 32547 gene locus_tag LOCUS_02310 29248 32547 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_02310 32606 33034 gene locus_tag LOCUS_02320 32606 33034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 34226 33039 gene locus_tag LOCUS_02330 34226 33039 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_02330 34927 34853 gene locus_tag LOCUS_t00040 34927 34853 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35853 38330 gene locus_tag LOCUS_02340 gene ligA 35853 38330 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_02340 38876 38346 gene locus_tag LOCUS_02350 38876 38346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 39437 38916 gene locus_tag LOCUS_02360 39437 38916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 40124 39450 gene locus_tag LOCUS_02370 40124 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 40207 40866 gene locus_tag LOCUS_02380 40207 40866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 40947 43487 gene locus_tag LOCUS_02390 40947 43487 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_02390 44066 43479 gene locus_tag LOCUS_02400 gene coaE 44066 43479 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172233.1 protein_id gnl|my_center|LOCUS_02400 46598 44085 gene locus_tag LOCUS_02410 46598 44085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 55060 46595 gene locus_tag LOCUS_02420 55060 46595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 58638 55186 gene locus_tag LOCUS_02430 58638 55186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 60962 58635 gene locus_tag LOCUS_02440 60962 58635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 63061 60977 gene locus_tag LOCUS_02450 63061 60977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 63948 63064 gene locus_tag LOCUS_02460 63948 63064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 64604 63957 gene locus_tag LOCUS_02470 64604 63957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 66973 64628 gene locus_tag LOCUS_02480 66973 64628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 67811 67026 gene locus_tag LOCUS_02490 67811 67026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 68781 67813 gene locus_tag LOCUS_02500 68781 67813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 70732 68783 gene locus_tag LOCUS_02510 70732 68783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 70915 71178 gene locus_tag LOCUS_02520 70915 71178 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_02520 71182 71904 gene locus_tag LOCUS_02530 71182 71904 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_02530 71975 73009 gene locus_tag LOCUS_02540 gene waaC 71975 73009 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_02540 73174 74346 gene locus_tag LOCUS_02550 73174 74346 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_02550 74395 75045 gene locus_tag LOCUS_02560 74395 75045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 75127 76059 gene locus_tag LOCUS_02570 75127 76059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 76070 76705 gene locus_tag LOCUS_02580 76070 76705 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_02580 76692 77132 gene locus_tag LOCUS_02590 76692 77132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 77343 77053 gene locus_tag LOCUS_02600 77343 77053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 78745 77333 gene locus_tag LOCUS_02610 78745 77333 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_02610 81970 78830 gene locus_tag LOCUS_02620 81970 78830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 83066 82152 gene locus_tag LOCUS_02630 83066 82152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 83375 83178 gene locus_tag LOCUS_02640 gene rpsU 83375 83178 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882681.1 protein_id gnl|my_center|LOCUS_02640 83528 84589 gene locus_tag LOCUS_02650 gene pheA 83528 84589 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_02650 84779 85768 gene locus_tag LOCUS_02660 84779 85768 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073694.1 protein_id gnl|my_center|LOCUS_02660 88996 85856 gene locus_tag LOCUS_02670 88996 85856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 90638 89076 gene locus_tag LOCUS_02680 gene cimA 90638 89076 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_02680 90946 92700 gene locus_tag LOCUS_02690 90946 92700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 93153 94451 gene locus_tag LOCUS_02700 93153 94451 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 protein_id gnl|my_center|LOCUS_02700 94535 94984 gene locus_tag LOCUS_02710 94535 94984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 95784 95053 gene locus_tag LOCUS_02720 95784 95053 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_02720 96350 95847 gene locus_tag LOCUS_02730 96350 95847 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390345.1 protein_id gnl|my_center|LOCUS_02730 97317 96352 gene locus_tag LOCUS_02740 97317 96352 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470624.1 protein_id gnl|my_center|LOCUS_02740 97333 97944 gene locus_tag LOCUS_02750 97333 97944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 99409 98408 gene locus_tag LOCUS_02760 99409 98408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 100445 99504 gene locus_tag LOCUS_02770 100445 99504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 101132 100473 gene locus_tag LOCUS_02780 101132 100473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 101749 105315 gene locus_tag LOCUS_02790 101749 105315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 105520 106323 gene locus_tag LOCUS_02800 105520 106323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 106596 106381 gene locus_tag LOCUS_02810 106596 106381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 108212 106638 gene locus_tag LOCUS_02820 108212 106638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 108428 109015 gene locus_tag LOCUS_02830 108428 109015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 109773 109024 gene locus_tag LOCUS_02840 109773 109024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence004 2015 1455 gene locus_tag LOCUS_02850 2015 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3259 2258 gene locus_tag LOCUS_02860 3259 2258 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582635.1 protein_id gnl|my_center|LOCUS_02860 4459 3281 gene locus_tag LOCUS_02870 4459 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 5734 4505 gene locus_tag LOCUS_02880 5734 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6987 5737 gene locus_tag LOCUS_02890 6987 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8118 7300 gene locus_tag LOCUS_02900 8118 7300 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091464.1 protein_id gnl|my_center|LOCUS_02900 8279 9133 gene locus_tag LOCUS_02910 gene rhlP 8279 9133 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_02910 9309 10733 gene locus_tag LOCUS_02920 gene rseP 9309 10733 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_02920 10744 12522 gene locus_tag LOCUS_02930 10744 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 12534 12902 gene locus_tag LOCUS_02940 12534 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 13086 13436 gene locus_tag LOCUS_02950 13086 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 13608 15494 gene locus_tag LOCUS_02960 gene ilvB 13608 15494 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_02960 15701 17965 gene locus_tag LOCUS_02970 15701 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 18567 19463 gene locus_tag LOCUS_02980 gene dapF 18567 19463 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_02980 19527 20729 gene locus_tag LOCUS_02990 gene rlmD 19527 20729 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_02990 20828 23719 gene locus_tag LOCUS_03000 20828 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 23724 24944 gene locus_tag LOCUS_03010 23724 24944 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_03010 25045 26022 gene locus_tag LOCUS_03020 25045 26022 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_03020 26082 26555 gene locus_tag LOCUS_03030 26082 26555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 26559 27119 gene locus_tag LOCUS_03040 26559 27119 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_03040 27112 27420 gene locus_tag LOCUS_03050 27112 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 27422 27835 gene locus_tag LOCUS_03060 27422 27835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 27879 28658 gene locus_tag LOCUS_03070 27879 28658 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_03070 29414 28668 gene locus_tag LOCUS_03080 29414 28668 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_03080 29515 30066 gene locus_tag LOCUS_03090 29515 30066 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_03090 29996 30367 gene locus_tag LOCUS_03100 29996 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 30376 34083 gene locus_tag LOCUS_03110 30376 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 34181 34744 gene locus_tag LOCUS_03120 34181 34744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 34795 35940 gene locus_tag LOCUS_03130 gene dnaJ 34795 35940 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_03130 36019 36768 gene locus_tag LOCUS_03140 gene rsmE 36019 36768 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 protein_id gnl|my_center|LOCUS_03140 37097 36765 gene locus_tag LOCUS_03150 37097 36765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 37269 38663 gene locus_tag LOCUS_03160 37269 38663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 38667 39770 gene locus_tag LOCUS_03170 38667 39770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 41698 39785 gene locus_tag LOCUS_03180 41698 39785 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_03180 42217 41765 gene locus_tag LOCUS_03190 42217 41765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 43229 42249 gene locus_tag LOCUS_03200 43229 42249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 43439 44923 gene locus_tag LOCUS_03210 gene dnaB 43439 44923 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_03210 44927 47410 gene locus_tag LOCUS_03220 gene bamA 44927 47410 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_03220 47412 49865 gene locus_tag LOCUS_03230 47412 49865 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_03230 49905 50519 gene locus_tag LOCUS_03240 49905 50519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 50819 52618 gene locus_tag LOCUS_03250 50819 52618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 52653 52964 gene locus_tag LOCUS_03260 52653 52964 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_03260 53034 53636 gene locus_tag LOCUS_03270 gene recR 53034 53636 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_03270 53660 54271 gene locus_tag LOCUS_03280 53660 54271 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705021.1 protein_id gnl|my_center|LOCUS_03280 54334 54843 gene locus_tag LOCUS_03290 54334 54843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 56119 54986 gene locus_tag LOCUS_03300 gene mtnA 56119 54986 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532924.1 protein_id gnl|my_center|LOCUS_03300 56675 56256 gene locus_tag LOCUS_03310 56675 56256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 57025 57465 gene locus_tag LOCUS_03320 57025 57465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 57462 58100 gene locus_tag LOCUS_03330 57462 58100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 58111 60141 gene locus_tag LOCUS_03340 58111 60141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 60690 60184 gene locus_tag LOCUS_03350 60690 60184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 61200 61574 gene locus_tag LOCUS_03360 61200 61574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 61659 62399 gene locus_tag LOCUS_03370 61659 62399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 62392 64776 gene locus_tag LOCUS_03380 62392 64776 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036571.1 protein_id gnl|my_center|LOCUS_03380 64773 65699 gene locus_tag LOCUS_03390 64773 65699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 65810 67039 gene locus_tag LOCUS_03400 65810 67039 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040276.1 protein_id gnl|my_center|LOCUS_03400 67067 68287 gene locus_tag LOCUS_03410 67067 68287 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_03410 69671 68313 gene locus_tag LOCUS_03420 69671 68313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 72026 69708 gene locus_tag LOCUS_03430 72026 69708 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474357.1 protein_id gnl|my_center|LOCUS_03430 74312 72060 gene locus_tag LOCUS_03440 74312 72060 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 protein_id gnl|my_center|LOCUS_03440 76243 74540 gene locus_tag LOCUS_03450 76243 74540 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_03450 76451 77701 gene locus_tag LOCUS_03460 76451 77701 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143289.1 protein_id gnl|my_center|LOCUS_03460 77706 78863 gene locus_tag LOCUS_03470 77706 78863 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_03470 78866 80968 gene locus_tag LOCUS_03480 gene prlC 78866 80968 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 protein_id gnl|my_center|LOCUS_03480 80978 82591 gene locus_tag LOCUS_03490 80978 82591 CDS product POT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070418.1 protein_id gnl|my_center|LOCUS_03490 83620 82604 gene locus_tag LOCUS_03500 83620 82604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 83742 84839 gene locus_tag LOCUS_03510 83742 84839 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_03510 84843 86051 gene locus_tag LOCUS_03520 84843 86051 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_03520 86048 86521 gene locus_tag LOCUS_03530 86048 86521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 86518 87258 gene locus_tag LOCUS_03540 86518 87258 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_03540 87242 88126 gene locus_tag LOCUS_03550 87242 88126 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_03550 88214 89233 gene locus_tag LOCUS_03560 88214 89233 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_03560 91589 89253 gene locus_tag LOCUS_03570 91589 89253 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083755.1 protein_id gnl|my_center|LOCUS_03570 91681 93537 gene locus_tag LOCUS_03580 91681 93537 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_03580 93605 94411 gene locus_tag LOCUS_03590 93605 94411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 95028 94480 gene locus_tag LOCUS_03600 95028 94480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 95244 96386 gene locus_tag LOCUS_03610 gene clsB 95244 96386 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097487.1 protein_id gnl|my_center|LOCUS_03610 97123 96383 gene locus_tag LOCUS_03620 97123 96383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 100007 97173 gene locus_tag LOCUS_03630 gene alaS 100007 97173 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_03630 100331 103750 gene locus_tag LOCUS_03640 100331 103750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 104161 105543 gene locus_tag LOCUS_03650 104161 105543 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_03650 105905 105552 gene locus_tag LOCUS_03660 105905 105552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 106141 105902 gene locus_tag LOCUS_03670 106141 105902 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence005 249 2369 gene locus_tag LOCUS_03680 249 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3491 2379 gene locus_tag LOCUS_03690 3491 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4339 3488 gene locus_tag LOCUS_03700 gene aroE 4339 3488 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_03700 4628 8374 gene locus_tag LOCUS_03710 4628 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 9098 8388 gene locus_tag LOCUS_03720 9098 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 9397 9188 gene locus_tag LOCUS_03730 9397 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 11267 9408 gene locus_tag LOCUS_03740 11267 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 12200 11322 gene locus_tag LOCUS_03750 12200 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 12441 14738 gene locus_tag LOCUS_03760 12441 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 16225 14804 gene locus_tag LOCUS_03770 gene lpdA 16225 14804 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_03770 17519 16233 gene locus_tag LOCUS_03780 17519 16233 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_03780 17670 18665 gene locus_tag LOCUS_03790 17670 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 20045 18714 gene locus_tag LOCUS_03800 20045 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 20459 20286 gene locus_tag LOCUS_03810 20459 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 21453 20377 gene locus_tag LOCUS_03820 21453 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 21726 22100 gene locus_tag LOCUS_03830 21726 22100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 24382 22427 gene locus_tag LOCUS_03840 24382 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 24876 24448 gene locus_tag LOCUS_03850 gene fucU 24876 24448 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_03850 26679 24895 gene locus_tag LOCUS_03860 gene fucI 26679 24895 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_03860 27697 26804 gene locus_tag LOCUS_03870 27697 26804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 27831 30545 gene locus_tag LOCUS_03880 27831 30545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 31638 30928 gene locus_tag LOCUS_03890 31638 30928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 33038 31635 gene locus_tag LOCUS_03900 33038 31635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 34956 33484 gene locus_tag LOCUS_03910 34956 33484 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767670.1 protein_id gnl|my_center|LOCUS_03910 36505 35003 gene locus_tag LOCUS_03920 36505 35003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 36915 36502 gene locus_tag LOCUS_03930 36915 36502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 37456 36899 gene locus_tag LOCUS_03940 37456 36899 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_03940 38218 38439 gene locus_tag LOCUS_03950 38218 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 39095 38454 gene locus_tag LOCUS_03960 39095 38454 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_03960 41979 39100 gene locus_tag LOCUS_03970 41979 39100 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_03970 43438 42125 gene locus_tag LOCUS_03980 43438 42125 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_03980 44520 43444 gene locus_tag LOCUS_03990 44520 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 49825 44726 gene locus_tag LOCUS_04000 49825 44726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 50006 51445 gene locus_tag LOCUS_04010 50006 51445 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_04010 55233 51511 gene locus_tag LOCUS_04020 gene smc 55233 51511 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_04020 56257 55502 gene locus_tag LOCUS_04030 56257 55502 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_04030 56349 56480 gene locus_tag LOCUS_04040 56349 56480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 56482 56901 gene locus_tag LOCUS_04050 56482 56901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 56980 58155 gene locus_tag LOCUS_04060 56980 58155 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_04060 58341 60083 gene locus_tag LOCUS_04070 58341 60083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 60599 60096 gene locus_tag LOCUS_04080 60599 60096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 63139 60596 gene locus_tag LOCUS_04090 gene hrpB 63139 60596 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_04090 64122 63184 gene locus_tag LOCUS_04100 64122 63184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 65230 64199 gene locus_tag LOCUS_04110 gene tsaD 65230 64199 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931758.1 protein_id gnl|my_center|LOCUS_04110 66562 65231 gene locus_tag LOCUS_04120 66562 65231 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_04120 67246 66563 gene locus_tag LOCUS_04130 gene ispD 67246 66563 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_04130 67528 67316 gene locus_tag LOCUS_04140 gene infA 67528 67316 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 protein_id gnl|my_center|LOCUS_04140 67958 67602 gene locus_tag LOCUS_04150 67958 67602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 69853 68114 gene locus_tag LOCUS_04160 gene recJ 69853 68114 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_04160 70883 69903 gene locus_tag LOCUS_04170 70883 69903 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_04170 73401 70891 gene locus_tag LOCUS_04180 gene secDF 73401 70891 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_04180 73743 73408 gene locus_tag LOCUS_04190 gene yajC 73743 73408 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_04190 74490 73888 gene locus_tag LOCUS_04200 74490 73888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 74969 74517 gene locus_tag LOCUS_04210 74969 74517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 75290 74985 gene locus_tag LOCUS_04220 75290 74985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 75886 75287 gene locus_tag LOCUS_04230 gene pth 75886 75287 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_04230 76642 75911 gene locus_tag LOCUS_04240 76642 75911 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933030.1 protein_id gnl|my_center|LOCUS_04240 77597 76686 gene locus_tag LOCUS_04250 77597 76686 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_04250 78251 77832 gene locus_tag LOCUS_04260 78251 77832 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_04260 78925 78365 gene locus_tag LOCUS_04270 78925 78365 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_04270 80895 78997 gene locus_tag LOCUS_04280 80895 78997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 84245 80982 gene locus_tag LOCUS_04290 84245 80982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 85251 84232 gene locus_tag LOCUS_04300 85251 84232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 86756 85251 gene locus_tag LOCUS_04310 86756 85251 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_04310 88185 87124 gene locus_tag LOCUS_04320 gene mnmA 88185 87124 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_04320 88990 88250 gene locus_tag LOCUS_04330 88990 88250 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_04330 89326 89042 gene locus_tag LOCUS_04340 89326 89042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 89592 89398 gene locus_tag LOCUS_04350 89592 89398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 89951 90724 gene locus_tag LOCUS_04360 89951 90724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 91093 90728 gene locus_tag LOCUS_04370 91093 90728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 91254 92849 gene locus_tag LOCUS_04380 gene der 91254 92849 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831042.1 protein_id gnl|my_center|LOCUS_04380 92968 93900 gene locus_tag LOCUS_04390 92968 93900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 94205 95143 gene locus_tag LOCUS_04400 94205 95143 CDS product IS630-like element ISRj1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084549.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 95265 95552 gene locus_tag LOCUS_04410 95265 95552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 96057 96134 gene locus_tag LOCUS_t00050 96057 96134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 96195 97463 gene locus_tag LOCUS_04420 96195 97463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 98206 97472 gene locus_tag LOCUS_04430 98206 97472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 98276 98512 gene locus_tag LOCUS_04440 98276 98512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 98531 99583 gene locus_tag LOCUS_04450 98531 99583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 99580 100746 gene locus_tag LOCUS_04460 99580 100746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 100883 101470 gene locus_tag LOCUS_04470 100883 101470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 101527 102864 gene locus_tag LOCUS_04480 101527 102864 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_04480 102920 103108 gene locus_tag LOCUS_04490 102920 103108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence006 1095 1442 gene locus_tag LOCUS_04500 1095 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1870 2799 gene locus_tag LOCUS_04510 gene fabD 1870 2799 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_04510 2814 4175 gene locus_tag LOCUS_04520 2814 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4249 4992 gene locus_tag LOCUS_04530 gene fabG 4249 4992 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_04530 5114 5356 gene locus_tag LOCUS_04540 gene acpP 5114 5356 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_04540 5422 6681 gene locus_tag LOCUS_04550 gene fabF 5422 6681 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_04550 6704 7045 gene locus_tag LOCUS_04560 6704 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7049 8359 gene locus_tag LOCUS_04570 7049 8359 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674820.1 protein_id gnl|my_center|LOCUS_04570 9498 8368 gene locus_tag LOCUS_04580 9498 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10934 9648 gene locus_tag LOCUS_04590 10934 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 13095 11851 gene locus_tag LOCUS_04600 13095 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 14185 13136 gene locus_tag LOCUS_04610 gene pseI 14185 13136 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 protein_id gnl|my_center|LOCUS_04610 15798 14185 gene locus_tag LOCUS_04620 15798 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 16490 15795 gene locus_tag LOCUS_04630 gene pseF 16490 15795 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_04630 17728 16508 gene locus_tag LOCUS_04640 gene pseC 17728 16508 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_04640 18755 17736 gene locus_tag LOCUS_04650 gene pseB 18755 17736 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_04650 19361 20473 gene locus_tag LOCUS_04660 19361 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 20570 21817 gene locus_tag LOCUS_04670 20570 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 22147 23076 gene locus_tag LOCUS_04680 22147 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 23091 23837 gene locus_tag LOCUS_04690 23091 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 24933 24097 gene locus_tag LOCUS_04700 24933 24097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 27268 25016 gene locus_tag LOCUS_04710 27268 25016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 27622 27272 gene locus_tag LOCUS_04720 27622 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 28581 27931 gene locus_tag LOCUS_04730 28581 27931 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_04730 29615 28578 gene locus_tag LOCUS_04740 29615 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 31368 30178 gene locus_tag LOCUS_04750 31368 30178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 31501 32265 gene locus_tag LOCUS_04760 31501 32265 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_04760 32923 32270 gene locus_tag LOCUS_04770 32923 32270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_04770 33048 33992 gene locus_tag LOCUS_04780 33048 33992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 33989 34711 gene locus_tag LOCUS_04790 33989 34711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 34763 36166 gene locus_tag LOCUS_04800 34763 36166 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_04800 36243 36611 gene locus_tag LOCUS_04810 36243 36611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 36691 37548 gene locus_tag LOCUS_04820 gene folP 36691 37548 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 protein_id gnl|my_center|LOCUS_04820 37538 38416 gene locus_tag LOCUS_04830 gene cdaA 37538 38416 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_04830 38413 38817 gene locus_tag LOCUS_04840 38413 38817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 38834 40219 gene locus_tag LOCUS_04850 gene glmM 38834 40219 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_04850 40235 40651 gene locus_tag LOCUS_04860 40235 40651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 41493 40660 gene locus_tag LOCUS_04870 41493 40660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 42715 41483 gene locus_tag LOCUS_04880 42715 41483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 44391 42739 gene locus_tag LOCUS_04890 gene hcp 44391 42739 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_04890 44611 44856 gene locus_tag LOCUS_04900 gene rpmE 44611 44856 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_04900 44972 46045 gene locus_tag LOCUS_04910 gene prfA 44972 46045 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_04910 46042 46635 gene locus_tag LOCUS_04920 46042 46635 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_04920 49356 46702 gene locus_tag LOCUS_04930 gene mgtA 49356 46702 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932315.1 protein_id gnl|my_center|LOCUS_04930 50646 49693 gene locus_tag LOCUS_04940 gene tal 50646 49693 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_04940 50981 52993 gene locus_tag LOCUS_04950 gene thiC 50981 52993 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_04950 53110 53946 gene locus_tag LOCUS_04960 53110 53946 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_04960 53954 54961 gene locus_tag LOCUS_04970 53954 54961 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_04970 55128 55688 gene locus_tag LOCUS_04980 55128 55688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 55651 55962 gene locus_tag LOCUS_04990 55651 55962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 55962 57005 gene locus_tag LOCUS_05000 55962 57005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 58287 57043 gene locus_tag LOCUS_05010 58287 57043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_05010 58498 59331 gene locus_tag LOCUS_05020 58498 59331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803961.1 protein_id gnl|my_center|LOCUS_05020 59435 60676 gene locus_tag LOCUS_05030 59435 60676 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_05030 60736 61860 gene locus_tag LOCUS_05040 60736 61860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 61833 63503 gene locus_tag LOCUS_05050 61833 63503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 66043 63521 gene locus_tag LOCUS_05060 66043 63521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 66263 67390 gene locus_tag LOCUS_05070 66263 67390 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_05070 67581 68801 gene locus_tag LOCUS_05080 67581 68801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 69650 68808 gene locus_tag LOCUS_05090 69650 68808 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978883.1 protein_id gnl|my_center|LOCUS_05090 69742 70851 gene locus_tag LOCUS_05100 gene dprA 69742 70851 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_05100 74660 71055 gene locus_tag LOCUS_05110 gene dnaE 74660 71055 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_05110 74936 76570 gene locus_tag LOCUS_05120 gene pgi 74936 76570 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_05120 77083 76904 gene locus_tag LOCUS_05130 77083 76904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 77060 78178 gene locus_tag LOCUS_05140 77060 78178 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_05140 79630 78197 gene locus_tag LOCUS_05150 gene uxaC 79630 78197 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_05150 80897 79635 gene locus_tag LOCUS_05160 80897 79635 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_05160 81335 81012 gene locus_tag LOCUS_05170 81335 81012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 81494 81829 gene locus_tag LOCUS_05180 81494 81829 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_05180 82948 81869 gene locus_tag LOCUS_05190 82948 81869 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_05190 85671 83158 gene locus_tag LOCUS_05200 85671 83158 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767196.1 protein_id gnl|my_center|LOCUS_05200 87932 85755 gene locus_tag LOCUS_05210 87932 85755 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_05210 88951 87929 gene locus_tag LOCUS_05220 88951 87929 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_05220 90899 89133 gene locus_tag LOCUS_05230 90899 89133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 91848 91772 gene locus_tag LOCUS_t00060 91848 91772 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 92271 92723 gene locus_tag LOCUS_05240 92271 92723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 92726 94498 gene locus_tag LOCUS_05250 92726 94498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 <95390 94855 gene locus_tag LOCUS_05260 <95390 94855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929287.1:response regulator >Feature sequence007 407 778 gene locus_tag LOCUS_05270 407 778 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_05270 784 1872 gene locus_tag LOCUS_05280 784 1872 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_05280 1877 2746 gene locus_tag LOCUS_05290 1877 2746 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_05290 12054 3178 gene locus_tag LOCUS_05300 12054 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13076 12198 gene locus_tag LOCUS_05310 13076 12198 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_05310 13587 14438 gene locus_tag LOCUS_05320 13587 14438 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_05320 14489 16396 gene locus_tag LOCUS_05330 14489 16396 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_05330 16884 17645 gene locus_tag LOCUS_05340 gene rpsB 16884 17645 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869490.1 protein_id gnl|my_center|LOCUS_05340 17716 18561 gene locus_tag LOCUS_05350 gene tsf 17716 18561 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_05350 18886 20556 gene locus_tag LOCUS_05360 18886 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 20674 21849 gene locus_tag LOCUS_05370 20674 21849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 21881 23149 gene locus_tag LOCUS_05380 21881 23149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 23194 25059 gene locus_tag LOCUS_05390 23194 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 26404 25082 gene locus_tag LOCUS_05400 26404 25082 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_05400 27932 26448 gene locus_tag LOCUS_05410 27932 26448 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_05410 28574 27957 gene locus_tag LOCUS_05420 gene thpR 28574 27957 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_05420 28647 29447 gene locus_tag LOCUS_05430 28647 29447 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_05430 29449 31197 gene locus_tag LOCUS_05440 29449 31197 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_05440 31268 31849 gene locus_tag LOCUS_05450 gene thrH 31268 31849 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_05450 31849 32754 gene locus_tag LOCUS_05460 31849 32754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 33732 32755 gene locus_tag LOCUS_05470 33732 32755 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_05470 34382 33729 gene locus_tag LOCUS_05480 gene plsY 34382 33729 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_05480 34563 35597 gene locus_tag LOCUS_05490 34563 35597 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_05490 36092 35607 gene locus_tag LOCUS_05500 36092 35607 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494663.1 protein_id gnl|my_center|LOCUS_05500 36757 36236 gene locus_tag LOCUS_05510 36757 36236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 36834 37976 gene locus_tag LOCUS_05520 gene lpxB 36834 37976 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_05520 37973 38227 gene locus_tag LOCUS_05530 37973 38227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 38340 38831 gene locus_tag LOCUS_05540 38340 38831 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879700.1 protein_id gnl|my_center|LOCUS_05540 38835 39800 gene locus_tag LOCUS_05550 38835 39800 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_05550 39797 40270 gene locus_tag LOCUS_05560 gene ybeY 39797 40270 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404820.1 protein_id gnl|my_center|LOCUS_05560 40267 40932 gene locus_tag LOCUS_05570 40267 40932 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_05570 40929 41576 gene locus_tag LOCUS_05580 40929 41576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 41620 44004 gene locus_tag LOCUS_05590 41620 44004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 45716 44001 gene locus_tag LOCUS_05600 45716 44001 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_05600 45896 48418 gene locus_tag LOCUS_05610 45896 48418 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_05610 49669 48923 gene locus_tag LOCUS_05620 49669 48923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 49816 49889 gene locus_tag LOCUS_t00070 49816 49889 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50108 50392 gene locus_tag LOCUS_05630 50108 50392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 50319 50669 gene locus_tag LOCUS_05640 50319 50669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 50666 51160 gene locus_tag LOCUS_05650 50666 51160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 51048 51458 gene locus_tag LOCUS_05660 51048 51458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05660 52155 51568 gene locus_tag LOCUS_05670 52155 51568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 52777 52487 gene locus_tag LOCUS_05680 52777 52487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 54240 53071 gene locus_tag LOCUS_05690 54240 53071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 55125 54265 gene locus_tag LOCUS_05700 55125 54265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 55809 55141 gene locus_tag LOCUS_05710 55809 55141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 56112 55948 gene locus_tag LOCUS_05720 56112 55948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 57120 56167 gene locus_tag LOCUS_05730 57120 56167 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105037.1 protein_id gnl|my_center|LOCUS_05730 57608 57162 gene locus_tag LOCUS_05740 57608 57162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 63995 57612 gene locus_tag LOCUS_05750 63995 57612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 65511 64030 gene locus_tag LOCUS_05760 65511 64030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 65679 65957 gene locus_tag LOCUS_05770 65679 65957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 66474 66031 gene locus_tag LOCUS_05780 66474 66031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 66544 66783 gene locus_tag LOCUS_05790 66544 66783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 67854 66901 gene locus_tag LOCUS_05800 67854 66901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 68693 67866 gene locus_tag LOCUS_05810 68693 67866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 69022 68690 gene locus_tag LOCUS_05820 69022 68690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 70092 70514 gene locus_tag LOCUS_05830 70092 70514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 70592 71251 gene locus_tag LOCUS_05840 70592 71251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 71248 73551 gene locus_tag LOCUS_05850 71248 73551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 74153 73602 gene locus_tag LOCUS_05860 74153 73602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 74760 74164 gene locus_tag LOCUS_05870 74760 74164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 77134 74732 gene locus_tag LOCUS_05880 77134 74732 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_05880 78011 77154 gene locus_tag LOCUS_05890 78011 77154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 78613 78008 gene locus_tag LOCUS_05900 78613 78008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 78776 79765 gene locus_tag LOCUS_05910 78776 79765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 80070 79753 gene locus_tag LOCUS_05920 80070 79753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 81091 80081 gene locus_tag LOCUS_05930 81091 80081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence008 3 716 gene locus_tag LOCUS_05940 3 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 793 1113 gene locus_tag LOCUS_05950 793 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1175 1333 gene locus_tag LOCUS_05960 1175 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1338 1811 gene locus_tag LOCUS_05970 1338 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1815 2696 gene locus_tag LOCUS_05980 1815 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2700 3101 gene locus_tag LOCUS_05990 2700 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3105 3557 gene locus_tag LOCUS_06000 3105 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3561 3809 gene locus_tag LOCUS_06010 3561 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3859 4044 gene locus_tag LOCUS_06020 3859 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4049 4336 gene locus_tag LOCUS_06030 4049 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4302 4631 gene locus_tag LOCUS_06040 4302 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4647 5216 gene locus_tag LOCUS_06050 4647 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5290 5499 gene locus_tag LOCUS_06060 5290 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5496 5954 gene locus_tag LOCUS_06070 5496 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5951 6238 gene locus_tag LOCUS_06080 5951 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6235 6699 gene locus_tag LOCUS_06090 6235 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6696 6887 gene locus_tag LOCUS_06100 6696 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6891 7841 gene locus_tag LOCUS_06110 6891 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 7844 8506 gene locus_tag LOCUS_06120 7844 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 8511 10217 gene locus_tag LOCUS_06130 8511 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 10554 10261 gene locus_tag LOCUS_06140 10554 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 10813 13719 gene locus_tag LOCUS_06150 10813 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 13750 13944 gene locus_tag LOCUS_06160 13750 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 14407 13928 gene locus_tag LOCUS_06170 14407 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 14654 14388 gene locus_tag LOCUS_06180 14654 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 15030 14659 gene locus_tag LOCUS_06190 15030 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 15317 15027 gene locus_tag LOCUS_06200 15317 15027 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_06200 15895 15314 gene locus_tag LOCUS_06210 15895 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 16699 15899 gene locus_tag LOCUS_06220 16699 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 17483 16704 gene locus_tag LOCUS_06230 17483 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 18028 17480 gene locus_tag LOCUS_06240 gene yfdR 18028 17480 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001603282.1 protein_id gnl|my_center|LOCUS_06240 19340 18030 gene locus_tag LOCUS_06250 19340 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 19571 19350 gene locus_tag LOCUS_06260 19571 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 19917 19486 gene locus_tag LOCUS_06270 19917 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 21147 20038 gene locus_tag LOCUS_06280 21147 20038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 21505 21251 gene locus_tag LOCUS_06290 21505 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 24521 21642 gene locus_tag LOCUS_06300 24521 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 28909 24521 gene locus_tag LOCUS_06310 28909 24521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 29137 28913 gene locus_tag LOCUS_06320 29137 28913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 29721 29209 gene locus_tag LOCUS_06330 29721 29209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 29865 30212 gene locus_tag LOCUS_06340 29865 30212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 31151 30204 gene locus_tag LOCUS_06350 31151 30204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 31494 31156 gene locus_tag LOCUS_06360 31494 31156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 32333 31491 gene locus_tag LOCUS_06370 32333 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 32827 32330 gene locus_tag LOCUS_06380 32827 32330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 33102 32824 gene locus_tag LOCUS_06390 33102 32824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 33905 33099 gene locus_tag LOCUS_06400 33905 33099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 34839 34015 gene locus_tag LOCUS_06410 34839 34015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 35477 34836 gene locus_tag LOCUS_06420 35477 34836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 35980 35492 gene locus_tag LOCUS_06430 35980 35492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 36924 36088 gene locus_tag LOCUS_06440 36924 36088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 38284 37010 gene locus_tag LOCUS_06450 38284 37010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 38878 38324 gene locus_tag LOCUS_06460 38878 38324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 39715 38924 gene locus_tag LOCUS_06470 39715 38924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 40767 39832 gene locus_tag LOCUS_06480 40767 39832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 41255 40764 gene locus_tag LOCUS_06490 41255 40764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 41925 41260 gene locus_tag LOCUS_06500 41925 41260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 42307 41915 gene locus_tag LOCUS_06510 42307 41915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 42569 42312 gene locus_tag LOCUS_06520 42569 42312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 46326 42598 gene locus_tag LOCUS_06530 46326 42598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 47656 46373 gene locus_tag LOCUS_06540 47656 46373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 49074 47653 gene locus_tag LOCUS_06550 49074 47653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 50015 49140 gene locus_tag LOCUS_06560 50015 49140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 51066 50041 gene locus_tag LOCUS_06570 51066 50041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 51677 51417 gene locus_tag LOCUS_06580 51677 51417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 51998 51729 gene locus_tag LOCUS_06590 51998 51729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 52254 52030 gene locus_tag LOCUS_06600 52254 52030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 52515 52285 gene locus_tag LOCUS_06610 52515 52285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 52785 52558 gene locus_tag LOCUS_06620 52785 52558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 53220 52804 gene locus_tag LOCUS_06630 53220 52804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 54395 53217 gene locus_tag LOCUS_06640 54395 53217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 55088 54399 gene locus_tag LOCUS_06650 55088 54399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 57842 55218 gene locus_tag LOCUS_06660 57842 55218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 60550 57833 gene locus_tag LOCUS_06670 60550 57833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 61153 60590 gene locus_tag LOCUS_06680 61153 60590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 65595 61465 gene locus_tag LOCUS_06690 65595 61465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 65961 66833 gene locus_tag LOCUS_06700 65961 66833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 67034 66807 gene locus_tag LOCUS_06710 67034 66807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 67299 67772 gene locus_tag LOCUS_06720 67299 67772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 68564 69703 gene locus_tag LOCUS_06730 68564 69703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 70250 70549 gene locus_tag LOCUS_06740 70250 70549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 70905 71840 gene locus_tag LOCUS_06750 70905 71840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 72854 73111 gene locus_tag LOCUS_06760 72854 73111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 73248 73430 gene locus_tag LOCUS_06770 73248 73430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 73536 73754 gene locus_tag LOCUS_06780 73536 73754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 73751 74149 gene locus_tag LOCUS_06790 73751 74149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 74146 74514 gene locus_tag LOCUS_06800 74146 74514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 74527 74883 gene locus_tag LOCUS_06810 74527 74883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 74867 75139 gene locus_tag LOCUS_06820 74867 75139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 75219 75653 gene locus_tag LOCUS_06830 75219 75653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 75852 76184 gene locus_tag LOCUS_06840 75852 76184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 76191 76394 gene locus_tag LOCUS_06850 76191 76394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 76401 76835 gene locus_tag LOCUS_06860 76401 76835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 76832 77173 gene locus_tag LOCUS_06870 76832 77173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 77146 77517 gene locus_tag LOCUS_06880 77146 77517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence009 731 411 gene locus_tag LOCUS_06890 731 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6331 944 gene locus_tag LOCUS_06900 6331 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6713 7282 gene locus_tag LOCUS_06910 gene pabA 6713 7282 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_06910 7279 7647 gene locus_tag LOCUS_06920 7279 7647 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_06920 7987 8340 gene locus_tag LOCUS_06930 7987 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 9273 8695 gene locus_tag LOCUS_06940 9273 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 10221 9343 gene locus_tag LOCUS_06950 10221 9343 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_06950 10314 10553 gene locus_tag LOCUS_06960 10314 10553 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071657.1 protein_id gnl|my_center|LOCUS_06960 10550 11113 gene locus_tag LOCUS_06970 10550 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 11139 11402 gene locus_tag LOCUS_06980 11139 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 12546 11410 gene locus_tag LOCUS_06990 12546 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12528 12695 gene locus_tag LOCUS_07000 12528 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 14250 13261 gene locus_tag LOCUS_07010 14250 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 15638 15018 gene locus_tag LOCUS_07020 gene sodA 15638 15018 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_07020 15765 16379 gene locus_tag LOCUS_07030 15765 16379 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098375.1 protein_id gnl|my_center|LOCUS_07030 18365 16422 gene locus_tag LOCUS_07040 18365 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18522 20291 gene locus_tag LOCUS_07050 18522 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 21194 20328 gene locus_tag LOCUS_07060 21194 20328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 22280 21201 gene locus_tag LOCUS_07070 22280 21201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 22689 22546 gene locus_tag LOCUS_07080 22689 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 24293 22770 gene locus_tag LOCUS_07090 24293 22770 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_07090 24866 24318 gene locus_tag LOCUS_07100 24866 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 25071 25535 gene locus_tag LOCUS_07110 25071 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 26001 25582 gene locus_tag LOCUS_07120 26001 25582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 26778 26014 gene locus_tag LOCUS_07130 gene tpiA 26778 26014 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_07130 28070 26805 gene locus_tag LOCUS_07140 28070 26805 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_07140 30520 28262 gene locus_tag LOCUS_07150 gene rnr 30520 28262 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_07150 30703 32463 gene locus_tag LOCUS_07160 30703 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 32577 33158 gene locus_tag LOCUS_07170 gene ruvC 32577 33158 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_07170 33267 33869 gene locus_tag LOCUS_07180 gene ruvA 33267 33869 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_07180 33879 34574 gene locus_tag LOCUS_07190 33879 34574 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_07190 34620 36980 gene locus_tag LOCUS_07200 gene priA 34620 36980 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_07200 37381 36995 gene locus_tag LOCUS_07210 37381 36995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 38381 37818 gene locus_tag LOCUS_07220 38381 37818 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_07220 38645 38451 gene locus_tag LOCUS_07230 38645 38451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 39260 38760 gene locus_tag LOCUS_07240 39260 38760 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_07240 39963 39280 gene locus_tag LOCUS_07250 39963 39280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 41266 40010 gene locus_tag LOCUS_07260 41266 40010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 41794 41270 gene locus_tag LOCUS_07270 41794 41270 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576196.1 protein_id gnl|my_center|LOCUS_07270 42678 43418 gene locus_tag LOCUS_07280 42678 43418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 43474 43881 gene locus_tag LOCUS_07290 43474 43881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 44179 44694 gene locus_tag LOCUS_07300 44179 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 44687 44869 gene locus_tag LOCUS_07310 44687 44869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 44905 45096 gene locus_tag LOCUS_07320 44905 45096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 45693 46256 gene locus_tag LOCUS_07330 45693 46256 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_07330 46308 46490 gene locus_tag LOCUS_07340 46308 46490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 47486 46542 gene locus_tag LOCUS_07350 47486 46542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 48256 48798 gene locus_tag LOCUS_07360 gene lspA 48256 48798 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_07360 48804 49751 gene locus_tag LOCUS_07370 48804 49751 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_07370 50767 49805 gene locus_tag LOCUS_07380 50767 49805 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_07380 51858 50764 gene locus_tag LOCUS_07390 51858 50764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 51995 52576 gene locus_tag LOCUS_07400 51995 52576 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_07400 52665 53561 gene locus_tag LOCUS_07410 52665 53561 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_07410 53892 54452 gene locus_tag LOCUS_07420 53892 54452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 54738 55121 gene locus_tag LOCUS_07430 54738 55121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 55118 55858 gene locus_tag LOCUS_07440 55118 55858 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_07440 56117 55905 gene locus_tag LOCUS_07450 56117 55905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 57396 56905 gene locus_tag LOCUS_07460 57396 56905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 59212 57509 gene locus_tag LOCUS_07470 59212 57509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 60829 59279 gene locus_tag LOCUS_07480 60829 59279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 62211 60826 gene locus_tag LOCUS_07490 62211 60826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 63491 62289 gene locus_tag LOCUS_07500 63491 62289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 65494 63509 gene locus_tag LOCUS_07510 65494 63509 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_07510 66631 65522 gene locus_tag LOCUS_07520 gene hflK 66631 65522 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_07520 67539 66631 gene locus_tag LOCUS_07530 67539 66631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 69401 67536 gene locus_tag LOCUS_07540 69401 67536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 70452 69490 gene locus_tag LOCUS_07550 70452 69490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 71494 70739 gene locus_tag LOCUS_07560 71494 70739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 71628 74513 gene locus_tag LOCUS_07570 71628 74513 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_07570 74516 75211 gene locus_tag LOCUS_07580 74516 75211 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_07580 75434 75628 gene locus_tag LOCUS_07590 75434 75628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence010 206 21 gene locus_tag LOCUS_07600 206 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1341 373 gene locus_tag LOCUS_07610 1341 373 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_07610 2628 1354 gene locus_tag LOCUS_07620 2628 1354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_07620 3755 2709 gene locus_tag LOCUS_07630 3755 2709 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_07630 4582 3761 gene locus_tag LOCUS_07640 4582 3761 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_07640 5532 4888 gene locus_tag LOCUS_07650 5532 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6985 5801 gene locus_tag LOCUS_07660 6985 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7728 6982 gene locus_tag LOCUS_07670 7728 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8966 7896 gene locus_tag LOCUS_07680 8966 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 9132 9554 gene locus_tag LOCUS_07690 9132 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 11742 9718 gene locus_tag LOCUS_07700 11742 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12214 12669 gene locus_tag LOCUS_07710 12214 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 15474 12697 gene locus_tag LOCUS_07720 15474 12697 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_07720 17413 15572 gene locus_tag LOCUS_07730 17413 15572 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615476.1 protein_id gnl|my_center|LOCUS_07730 17519 18622 gene locus_tag LOCUS_07740 17519 18622 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_07740 19809 18655 gene locus_tag LOCUS_07750 19809 18655 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_07750 21686 19824 gene locus_tag LOCUS_07760 21686 19824 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038270.1 protein_id gnl|my_center|LOCUS_07760 21861 22598 gene locus_tag LOCUS_07770 21861 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 23332 23132 gene locus_tag LOCUS_07780 23332 23132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 23669 23484 gene locus_tag LOCUS_07790 23669 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 23998 23765 gene locus_tag LOCUS_07800 23998 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 24303 23995 gene locus_tag LOCUS_07810 24303 23995 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_07810 24443 24300 gene locus_tag LOCUS_07820 24443 24300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 24673 24440 gene locus_tag LOCUS_07830 24673 24440 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_07830 25011 24670 gene locus_tag LOCUS_07840 25011 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 28856 25008 gene locus_tag LOCUS_07850 28856 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 29628 28894 gene locus_tag LOCUS_07860 29628 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 32950 29621 gene locus_tag LOCUS_07870 32950 29621 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_07870 33230 33409 gene locus_tag LOCUS_07880 33230 33409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 33557 33820 gene locus_tag LOCUS_07890 33557 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 33786 34097 gene locus_tag LOCUS_07900 33786 34097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 34102 35025 gene locus_tag LOCUS_07910 34102 35025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_07910 35018 35233 gene locus_tag LOCUS_07920 35018 35233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 35439 35146 gene locus_tag LOCUS_07930 35439 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 35679 35467 gene locus_tag LOCUS_07940 35679 35467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 36958 35978 gene locus_tag LOCUS_07950 36958 35978 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_07950 37373 37023 gene locus_tag LOCUS_07960 37373 37023 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_07960 38392 37394 gene locus_tag LOCUS_07970 38392 37394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_07970 39374 38481 gene locus_tag LOCUS_07980 39374 38481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 40644 39376 gene locus_tag LOCUS_07990 gene rkpK 40644 39376 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974890.1 protein_id gnl|my_center|LOCUS_07990 41081 40641 gene locus_tag LOCUS_08000 41081 40641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 42094 41120 gene locus_tag LOCUS_08010 42094 41120 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_08010 42247 43869 gene locus_tag LOCUS_08020 42247 43869 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_08020 44067 45095 gene locus_tag LOCUS_08030 44067 45095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 46088 45114 gene locus_tag LOCUS_08040 46088 45114 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118899.1 protein_id gnl|my_center|LOCUS_08040 46505 46137 gene locus_tag LOCUS_08050 46505 46137 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_08050 47509 46529 gene locus_tag LOCUS_08060 gene gmd 47509 46529 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_08060 48705 47569 gene locus_tag LOCUS_08070 48705 47569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 49478 48732 gene locus_tag LOCUS_08080 49478 48732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 50963 50367 gene locus_tag LOCUS_08090 50963 50367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 51538 54339 gene locus_tag LOCUS_08100 51538 54339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 55310 54330 gene locus_tag LOCUS_08110 55310 54330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 55344 56174 gene locus_tag LOCUS_08120 gene rfbF 55344 56174 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_08120 56176 57540 gene locus_tag LOCUS_08130 gene lhgO 56176 57540 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_08130 57550 58644 gene locus_tag LOCUS_08140 gene rfbG 57550 58644 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_08140 58655 60073 gene locus_tag LOCUS_08150 gene rfbH 58655 60073 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_08150 60077 60613 gene locus_tag LOCUS_08160 60077 60613 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_08160 60932 61879 gene locus_tag LOCUS_08170 60932 61879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 62807 62004 gene locus_tag LOCUS_08180 62807 62004 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_08180 64465 62810 gene locus_tag LOCUS_08190 64465 62810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 65587 64604 gene locus_tag LOCUS_08200 gene hemB 65587 64604 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460178.1 protein_id gnl|my_center|LOCUS_08200 65719 66402 gene locus_tag LOCUS_08210 65719 66402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 67232 66474 gene locus_tag LOCUS_08220 gene sufC 67232 66474 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_08220 68769 67321 gene locus_tag LOCUS_08230 gene sufB 68769 67321 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_08230 69214 68780 gene locus_tag LOCUS_08240 69214 68780 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_08240 69445 71643 gene locus_tag LOCUS_08250 69445 71643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 71690 72391 gene locus_tag LOCUS_08260 71690 72391 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524184.1 protein_id gnl|my_center|LOCUS_08260 72435 75194 gene locus_tag LOCUS_08270 72435 75194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence011 <1 1744 gene locus_tag LOCUS_08280 <1 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784203.1:glycine--tRNA ligase 1756 2748 gene locus_tag LOCUS_08290 1756 2748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202932.1 protein_id gnl|my_center|LOCUS_08290 2758 3288 gene locus_tag LOCUS_08300 2758 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3351 3719 gene locus_tag LOCUS_08310 3351 3719 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_08310 5300 3750 gene locus_tag LOCUS_08320 5300 3750 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_08320 5465 5680 gene locus_tag LOCUS_08330 gene rpmI 5465 5680 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_08330 5759 6097 gene locus_tag LOCUS_08340 5759 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 7829 6372 gene locus_tag LOCUS_08350 7829 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8169 8978 gene locus_tag LOCUS_08360 8169 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9058 10062 gene locus_tag LOCUS_08370 gene pheS 9058 10062 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143121.1 protein_id gnl|my_center|LOCUS_08370 10069 10797 gene locus_tag LOCUS_08380 10069 10797 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_08380 10797 11741 gene locus_tag LOCUS_08390 10797 11741 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_08390 11831 13645 gene locus_tag LOCUS_08400 11831 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 13829 14368 gene locus_tag LOCUS_08410 13829 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14461 15396 gene locus_tag LOCUS_08420 14461 15396 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_08420 15416 16645 gene locus_tag LOCUS_08430 15416 16645 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813999.1 protein_id gnl|my_center|LOCUS_08430 16642 19137 gene locus_tag LOCUS_08440 gene pheT 16642 19137 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_08440 20376 19213 gene locus_tag LOCUS_08450 20376 19213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_08450 21522 20377 gene locus_tag LOCUS_08460 21522 20377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_08460 21871 21551 gene locus_tag LOCUS_08470 21871 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 22615 21941 gene locus_tag LOCUS_08480 22615 21941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_08480 23365 22760 gene locus_tag LOCUS_08490 gene msrA 23365 22760 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_08490 23337 23567 gene locus_tag LOCUS_08500 23337 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 24156 23659 gene locus_tag LOCUS_08510 24156 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 26605 24227 gene locus_tag LOCUS_08520 26605 24227 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_08520 26744 27580 gene locus_tag LOCUS_08530 gene mip 26744 27580 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_08530 27805 29331 gene locus_tag LOCUS_08540 27805 29331 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_08540 29415 30347 gene locus_tag LOCUS_08550 29415 30347 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_08550 30406 31590 gene locus_tag LOCUS_08560 30406 31590 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_08560 32539 31649 gene locus_tag LOCUS_08570 32539 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 33428 32655 gene locus_tag LOCUS_08580 33428 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 35068 33527 gene locus_tag LOCUS_08590 35068 33527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 35484 35741 gene locus_tag LOCUS_08600 35484 35741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 35751 37151 gene locus_tag LOCUS_08610 35751 37151 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_08610 38378 37212 gene locus_tag LOCUS_08620 gene hemW 38378 37212 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_08620 38639 38430 gene locus_tag LOCUS_08630 gene cspD 38639 38430 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728273.1 protein_id gnl|my_center|LOCUS_08630 39176 38805 gene locus_tag LOCUS_08640 39176 38805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 40670 39186 gene locus_tag LOCUS_08650 40670 39186 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_08650 45308 40698 gene locus_tag LOCUS_08660 gene gltB 45308 40698 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_08660 47806 45665 gene locus_tag LOCUS_08670 47806 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 48152 49147 gene locus_tag LOCUS_08680 48152 49147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 50097 49261 gene locus_tag LOCUS_08690 gene purU 50097 49261 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020112.1 protein_id gnl|my_center|LOCUS_08690 51687 50122 gene locus_tag LOCUS_08700 gene guaB 51687 50122 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_08700 51914 52207 gene locus_tag LOCUS_08710 51914 52207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 52176 54917 gene locus_tag LOCUS_08720 52176 54917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 54851 57106 gene locus_tag LOCUS_08730 54851 57106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 57873 57127 gene locus_tag LOCUS_08740 57873 57127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_08740 58403 57876 gene locus_tag LOCUS_08750 58403 57876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 58593 59591 gene locus_tag LOCUS_08760 58593 59591 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_08760 60335 60763 gene locus_tag LOCUS_08770 gene nikR 60335 60763 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_08770 61049 60732 gene locus_tag LOCUS_08780 61049 60732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 61668 61264 gene locus_tag LOCUS_08790 61668 61264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 62687 61716 gene locus_tag LOCUS_08800 gene galE 62687 61716 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_08800 63203 62775 gene locus_tag LOCUS_08810 63203 62775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 64215 63301 gene locus_tag LOCUS_08820 64215 63301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 64694 64308 gene locus_tag LOCUS_08830 64694 64308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 66083 64710 gene locus_tag LOCUS_08840 66083 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 66164 66787 gene locus_tag LOCUS_08850 66164 66787 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_08850 66834 66908 gene locus_tag LOCUS_t00080 66834 66908 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67211 67029 gene locus_tag LOCUS_08860 67211 67029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 67311 67535 gene locus_tag LOCUS_08870 67311 67535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 68353 68063 gene locus_tag LOCUS_08880 68353 68063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 68986 68618 gene locus_tag LOCUS_08890 68986 68618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 69518 69135 gene locus_tag LOCUS_08900 69518 69135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 69911 69654 gene locus_tag LOCUS_08910 69911 69654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 70351 70043 gene locus_tag LOCUS_08920 70351 70043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 71019 70483 gene locus_tag LOCUS_08930 71019 70483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 71411 71139 gene locus_tag LOCUS_08940 71411 71139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence012 65 1159 gene locus_tag LOCUS_08950 65 1159 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_08950 1156 2064 gene locus_tag LOCUS_08960 1156 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2121 3059 gene locus_tag LOCUS_08970 2121 3059 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_08970 4059 3154 gene locus_tag LOCUS_08980 4059 3154 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_08980 5881 4091 gene locus_tag LOCUS_08990 5881 4091 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_08990 6150 7544 gene locus_tag LOCUS_09000 6150 7544 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_09000 7889 9079 gene locus_tag LOCUS_09010 7889 9079 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_09010 9579 9160 gene locus_tag LOCUS_09020 9579 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11788 9746 gene locus_tag LOCUS_09030 11788 9746 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_09030 12670 11837 gene locus_tag LOCUS_09040 12670 11837 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_09040 13301 13510 gene locus_tag LOCUS_09050 13301 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 13705 14211 gene locus_tag LOCUS_09060 13705 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16921 14465 gene locus_tag LOCUS_09070 16921 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143193.1 protein_id gnl|my_center|LOCUS_09070 18201 17974 gene locus_tag LOCUS_09080 18201 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 19687 18389 gene locus_tag LOCUS_09090 19687 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 19821 20753 gene locus_tag LOCUS_09100 gene lnrL 19821 20753 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_09100 20755 22008 gene locus_tag LOCUS_09110 20755 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 22005 23138 gene locus_tag LOCUS_09120 22005 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 25459 23408 gene locus_tag LOCUS_09130 25459 23408 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_09130 25760 26050 gene locus_tag LOCUS_09140 25760 26050 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_09140 26768 26169 gene locus_tag LOCUS_09150 26768 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 27274 27723 gene locus_tag LOCUS_09160 27274 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29462 27822 gene locus_tag LOCUS_09170 29462 27822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674201.1 protein_id gnl|my_center|LOCUS_09170 30232 29459 gene locus_tag LOCUS_09180 30232 29459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_09180 31606 30242 gene locus_tag LOCUS_09190 31606 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 33822 31795 gene locus_tag LOCUS_09200 33822 31795 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_09200 34058 33819 gene locus_tag LOCUS_09210 34058 33819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 34418 34840 gene locus_tag LOCUS_09220 34418 34840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 35186 34842 gene locus_tag LOCUS_09230 gene trxA 35186 34842 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_09230 35349 36236 gene locus_tag LOCUS_09240 gene folP 35349 36236 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948483.1 protein_id gnl|my_center|LOCUS_09240 37241 36267 gene locus_tag LOCUS_09250 37241 36267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 37392 37748 gene locus_tag LOCUS_09260 37392 37748 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 protein_id gnl|my_center|LOCUS_09260 37871 40117 gene locus_tag LOCUS_09270 37871 40117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 40877 40158 gene locus_tag LOCUS_09280 40877 40158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 41181 41474 gene locus_tag LOCUS_09290 41181 41474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 42532 41612 gene locus_tag LOCUS_09300 42532 41612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 42717 44441 gene locus_tag LOCUS_09310 42717 44441 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_09310 44806 44438 gene locus_tag LOCUS_09320 44806 44438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 45234 46064 gene locus_tag LOCUS_09330 45234 46064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 47769 46180 gene locus_tag LOCUS_09340 47769 46180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_09340 48052 50919 gene locus_tag LOCUS_09350 48052 50919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 51010 51393 gene locus_tag LOCUS_09360 51010 51393 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_09360 51451 51921 gene locus_tag LOCUS_09370 51451 51921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_09370 51924 53291 gene locus_tag LOCUS_09380 51924 53291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 54135 53776 gene locus_tag LOCUS_09390 54135 53776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 55056 54295 gene locus_tag LOCUS_09400 55056 54295 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083962.1 protein_id gnl|my_center|LOCUS_09400 58042 55088 gene locus_tag LOCUS_09410 58042 55088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 58319 58050 gene locus_tag LOCUS_09420 58319 58050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 58805 58326 gene locus_tag LOCUS_09430 58805 58326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 59669 61474 gene locus_tag LOCUS_09440 59669 61474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 61476 63326 gene locus_tag LOCUS_09450 61476 63326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 63323 64147 gene locus_tag LOCUS_09460 63323 64147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 64152 64649 gene locus_tag LOCUS_09470 64152 64649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 64652 66394 gene locus_tag LOCUS_09480 64652 66394 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_09480 66994 67251 gene locus_tag LOCUS_09490 66994 67251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 >Feature sequence013 1640 111 gene locus_tag LOCUS_09500 1640 111 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_09500 2138 1650 gene locus_tag LOCUS_09510 2138 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3259 2264 gene locus_tag LOCUS_09520 3259 2264 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_09520 3755 4696 gene locus_tag LOCUS_09530 3755 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4693 5667 gene locus_tag LOCUS_09540 4693 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5835 6122 gene locus_tag LOCUS_09550 5835 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6969 6172 gene locus_tag LOCUS_09560 6969 6172 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_09560 9297 7018 gene locus_tag LOCUS_09570 9297 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 10188 9406 gene locus_tag LOCUS_09580 10188 9406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_09580 10691 10188 gene locus_tag LOCUS_09590 10691 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 10765 11550 gene locus_tag LOCUS_09600 10765 11550 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_09600 11632 12219 gene locus_tag LOCUS_09610 gene rsmD 11632 12219 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_09610 12957 12259 gene locus_tag LOCUS_09620 12957 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14257 13064 gene locus_tag LOCUS_09630 gene obgE 14257 13064 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496111.1 protein_id gnl|my_center|LOCUS_09630 14632 14378 gene locus_tag LOCUS_09640 gene rpmA 14632 14378 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 protein_id gnl|my_center|LOCUS_09640 14950 14639 gene locus_tag LOCUS_09650 gene rplU 14950 14639 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551971.1 protein_id gnl|my_center|LOCUS_09650 15673 14999 gene locus_tag LOCUS_09660 15673 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 16746 15670 gene locus_tag LOCUS_09670 gene proB 16746 15670 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_09670 17713 16808 gene locus_tag LOCUS_09680 17713 16808 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_09680 18368 17703 gene locus_tag LOCUS_09690 18368 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 19246 18536 gene locus_tag LOCUS_09700 19246 18536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 19980 19255 gene locus_tag LOCUS_09710 19980 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 19862 20113 gene locus_tag LOCUS_09720 19862 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 20549 20169 gene locus_tag LOCUS_09730 20549 20169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 20780 23956 gene locus_tag LOCUS_09740 20780 23956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 24011 25993 gene locus_tag LOCUS_09750 24011 25993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 25997 26692 gene locus_tag LOCUS_09760 25997 26692 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_09760 27437 26913 gene locus_tag LOCUS_09770 27437 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 27932 27585 gene locus_tag LOCUS_09780 27932 27585 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 protein_id gnl|my_center|LOCUS_09780 28425 27973 gene locus_tag LOCUS_09790 gene dtd 28425 27973 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_09790 30665 28647 gene locus_tag LOCUS_09800 30665 28647 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_09800 30736 31416 gene locus_tag LOCUS_09810 30736 31416 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_09810 32548 31439 gene locus_tag LOCUS_09820 32548 31439 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_09820 32695 33708 gene locus_tag LOCUS_09830 32695 33708 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_09830 33711 34337 gene locus_tag LOCUS_09840 33711 34337 CDS product ApaLI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012859081.1 protein_id gnl|my_center|LOCUS_09840 34327 35538 gene locus_tag LOCUS_09850 34327 35538 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256229.1 protein_id gnl|my_center|LOCUS_09850 35517 36572 gene locus_tag LOCUS_09860 gene rfaD 35517 36572 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932927.1 protein_id gnl|my_center|LOCUS_09860 36797 37582 gene locus_tag LOCUS_09870 36797 37582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 37623 38993 gene locus_tag LOCUS_09880 37623 38993 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_09880 38990 39676 gene locus_tag LOCUS_09890 38990 39676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_09890 39713 40942 gene locus_tag LOCUS_09900 39713 40942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_09900 40923 42239 gene locus_tag LOCUS_09910 40923 42239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_09910 43610 42678 gene locus_tag LOCUS_09920 43610 42678 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_09920 43725 44897 gene locus_tag LOCUS_09930 gene metK 43725 44897 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 protein_id gnl|my_center|LOCUS_09930 44991 45347 gene locus_tag LOCUS_09940 44991 45347 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_09940 45383 46885 gene locus_tag LOCUS_09950 gene ahcY 45383 46885 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_09950 47511 47014 gene locus_tag LOCUS_09960 47511 47014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 48029 47508 gene locus_tag LOCUS_09970 gene lepB 48029 47508 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232348.1 protein_id gnl|my_center|LOCUS_09970 48191 51028 gene locus_tag LOCUS_09980 gene leuS 48191 51028 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_09980 53622 51196 gene locus_tag LOCUS_09990 53622 51196 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658103.1 protein_id gnl|my_center|LOCUS_09990 56040 53698 gene locus_tag LOCUS_10000 56040 53698 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797464.1 protein_id gnl|my_center|LOCUS_10000 56588 57571 gene locus_tag LOCUS_10010 56588 57571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 57647 58000 gene locus_tag LOCUS_10020 57647 58000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 58005 58757 gene locus_tag LOCUS_10030 58005 58757 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_10030 58754 59842 gene locus_tag LOCUS_10040 58754 59842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 59826 61229 gene locus_tag LOCUS_10050 59826 61229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 61226 61429 gene locus_tag LOCUS_10060 61226 61429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 61426 62469 gene locus_tag LOCUS_10070 61426 62469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 62466 65579 gene locus_tag LOCUS_10080 62466 65579 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_10080 65628 66047 gene locus_tag LOCUS_10090 65628 66047 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975895.1 protein_id gnl|my_center|LOCUS_10090 66073 66645 gene locus_tag LOCUS_10100 66073 66645 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992389.1 protein_id gnl|my_center|LOCUS_10100 66664 67305 gene locus_tag LOCUS_10110 66664 67305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 67330 67767 gene locus_tag LOCUS_10120 67330 67767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence014 3920 549 gene locus_tag LOCUS_10130 3920 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4920 4075 gene locus_tag LOCUS_10140 4920 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5282 6154 gene locus_tag LOCUS_10150 5282 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7086 6166 gene locus_tag LOCUS_10160 7086 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8354 7203 gene locus_tag LOCUS_10170 8354 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9109 8417 gene locus_tag LOCUS_10180 9109 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9842 11458 gene locus_tag LOCUS_10190 9842 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11640 12497 gene locus_tag LOCUS_10200 11640 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12514 13347 gene locus_tag LOCUS_10210 12514 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 13366 13773 gene locus_tag LOCUS_10220 13366 13773 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_10220 13770 14444 gene locus_tag LOCUS_10230 13770 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 14441 14845 gene locus_tag LOCUS_10240 14441 14845 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018517.1 protein_id gnl|my_center|LOCUS_10240 15256 17076 gene locus_tag LOCUS_10250 15256 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 17141 19072 gene locus_tag LOCUS_10260 17141 19072 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193847.1 protein_id gnl|my_center|LOCUS_10260 19442 22849 gene locus_tag LOCUS_10270 19442 22849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 22875 23558 gene locus_tag LOCUS_10280 22875 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 24152 23553 gene locus_tag LOCUS_10290 24152 23553 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_10290 24627 24136 gene locus_tag LOCUS_10300 24627 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 24931 24629 gene locus_tag LOCUS_10310 24931 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 25449 25033 gene locus_tag LOCUS_10320 25449 25033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 26031 27548 gene locus_tag LOCUS_10330 26031 27548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 27911 28240 gene locus_tag LOCUS_10340 27911 28240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 28311 29657 gene locus_tag LOCUS_10350 28311 29657 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_10350 29661 31427 gene locus_tag LOCUS_10360 29661 31427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 31437 34700 gene locus_tag LOCUS_10370 31437 34700 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_10370 34737 35708 gene locus_tag LOCUS_10380 34737 35708 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_10380 36579 35791 gene locus_tag LOCUS_10390 36579 35791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 37974 37009 gene locus_tag LOCUS_10400 37974 37009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 38992 37979 gene locus_tag LOCUS_10410 gene lpxD 38992 37979 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_10410 39052 40194 gene locus_tag LOCUS_10420 39052 40194 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_10420 40514 43630 gene locus_tag LOCUS_10430 40514 43630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 44510 43623 gene locus_tag LOCUS_10440 44510 43623 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582857.1 protein_id gnl|my_center|LOCUS_10440 44837 44553 gene locus_tag LOCUS_10450 44837 44553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 45329 44925 gene locus_tag LOCUS_10460 45329 44925 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_10460 45467 45371 gene locus_tag LOCUS_t00090 45467 45371 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 47737 45569 gene locus_tag LOCUS_10470 47737 45569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 49047 47893 gene locus_tag LOCUS_10480 49047 47893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 49883 49044 gene locus_tag LOCUS_10490 49883 49044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 51092 49911 gene locus_tag LOCUS_10500 51092 49911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 51306 51524 gene locus_tag LOCUS_10510 51306 51524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 51545 51886 gene locus_tag LOCUS_10520 51545 51886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 55418 52098 gene locus_tag LOCUS_10530 55418 52098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 55566 58988 gene locus_tag LOCUS_10540 55566 58988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_10540 60115 59027 gene locus_tag LOCUS_10550 60115 59027 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103978.1 protein_id gnl|my_center|LOCUS_10550 61291 60158 gene locus_tag LOCUS_10560 gene mqnC 61291 60158 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_10560 61499 63634 gene locus_tag LOCUS_10570 61499 63634 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_10570 64773 63688 gene locus_tag LOCUS_10580 gene rlmN 64773 63688 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_10580 64911 65396 gene locus_tag LOCUS_10590 64911 65396 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_10590 67274 65454 gene locus_tag LOCUS_10600 gene ptsP 67274 65454 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence015 3113 153 gene locus_tag LOCUS_10610 3113 153 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_10610 3483 5369 gene locus_tag LOCUS_10620 3483 5369 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583023.1 protein_id gnl|my_center|LOCUS_10620 5509 6381 gene locus_tag LOCUS_10630 5509 6381 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_10630 6398 7021 gene locus_tag LOCUS_10640 gene gmk 6398 7021 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 protein_id gnl|my_center|LOCUS_10640 7093 7641 gene locus_tag LOCUS_10650 7093 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7647 9038 gene locus_tag LOCUS_10660 7647 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 9035 10429 gene locus_tag LOCUS_10670 9035 10429 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_10670 10680 11543 gene locus_tag LOCUS_10680 gene hpnD 10680 11543 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_10680 12238 11534 gene locus_tag LOCUS_10690 12238 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 12747 12268 gene locus_tag LOCUS_10700 12747 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 13485 12766 gene locus_tag LOCUS_10710 13485 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 14526 13489 gene locus_tag LOCUS_10720 14526 13489 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10720 15463 15726 gene locus_tag LOCUS_10730 15463 15726 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_10730 15728 16225 gene locus_tag LOCUS_10740 15728 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 16222 17385 gene locus_tag LOCUS_10750 16222 17385 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_10750 17541 17888 gene locus_tag LOCUS_10760 17541 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 17999 21958 gene locus_tag LOCUS_10770 17999 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 22443 23027 gene locus_tag LOCUS_10780 22443 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 23034 23204 gene locus_tag LOCUS_10790 23034 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 23225 24610 gene locus_tag LOCUS_10800 gene miaB 23225 24610 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_10800 26647 24659 gene locus_tag LOCUS_10810 gene dxs 26647 24659 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_10810 27085 26723 gene locus_tag LOCUS_10820 27085 26723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 27915 27187 gene locus_tag LOCUS_10830 27915 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 29278 27959 gene locus_tag LOCUS_10840 gene xseA 29278 27959 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_10840 30205 29354 gene locus_tag LOCUS_10850 30205 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 31313 30219 gene locus_tag LOCUS_10860 gene bioB 31313 30219 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_10860 32212 31355 gene locus_tag LOCUS_10870 32212 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 36019 32642 gene locus_tag LOCUS_10880 36019 32642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 37654 36125 gene locus_tag LOCUS_10890 37654 36125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 37921 37766 gene locus_tag LOCUS_10900 37921 37766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 38054 39085 gene locus_tag LOCUS_10910 38054 39085 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 protein_id gnl|my_center|LOCUS_10910 39376 40596 gene locus_tag LOCUS_10920 39376 40596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 40604 41062 gene locus_tag LOCUS_10930 gene ribH 40604 41062 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035936.1 protein_id gnl|my_center|LOCUS_10930 41128 41826 gene locus_tag LOCUS_10940 41128 41826 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_10940 41831 42883 gene locus_tag LOCUS_10950 41831 42883 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_10950 43011 43913 gene locus_tag LOCUS_10960 gene cyoE 43011 43913 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_10960 43920 45803 gene locus_tag LOCUS_10970 gene ctaD 43920 45803 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577418.1 protein_id gnl|my_center|LOCUS_10970 45811 46614 gene locus_tag LOCUS_10980 45811 46614 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_10980 46625 46948 gene locus_tag LOCUS_10990 46625 46948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 46954 47139 gene locus_tag LOCUS_11000 46954 47139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 47142 47390 gene locus_tag LOCUS_11010 47142 47390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 47387 48160 gene locus_tag LOCUS_11020 47387 48160 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329346.1 protein_id gnl|my_center|LOCUS_11020 48303 48956 gene locus_tag LOCUS_11030 48303 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 48953 49381 gene locus_tag LOCUS_11040 48953 49381 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_11040 50305 49472 gene locus_tag LOCUS_11050 50305 49472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 51287 50385 gene locus_tag LOCUS_11060 gene sucD 51287 50385 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_11060 51821 51327 gene locus_tag LOCUS_11070 51821 51327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 52029 51805 gene locus_tag LOCUS_11080 52029 51805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 52439 52065 gene locus_tag LOCUS_11090 52439 52065 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444835.1 protein_id gnl|my_center|LOCUS_11090 53695 52454 gene locus_tag LOCUS_11100 gene sucC 53695 52454 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_11100 54019 53732 gene locus_tag LOCUS_11110 54019 53732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 54012 54929 gene locus_tag LOCUS_11120 54012 54929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 54926 55462 gene locus_tag LOCUS_11130 54926 55462 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_11130 55589 56188 gene locus_tag LOCUS_11140 gene satP 55589 56188 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 protein_id gnl|my_center|LOCUS_11140 56521 56210 gene locus_tag LOCUS_11150 56521 56210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 56886 56500 gene locus_tag LOCUS_11160 56886 56500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 57183 56890 gene locus_tag LOCUS_11170 57183 56890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 57412 58683 gene locus_tag LOCUS_11180 57412 58683 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_11180 60266 58689 gene locus_tag LOCUS_11190 60266 58689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 60479 62143 gene locus_tag LOCUS_11200 gene leuA 60479 62143 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence016 254 415 gene locus_tag LOCUS_11210 254 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 589 1341 gene locus_tag LOCUS_11220 gene tmk 589 1341 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_11220 1338 2039 gene locus_tag LOCUS_11230 gene tmk 1338 2039 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_11230 2516 2043 gene locus_tag LOCUS_11240 2516 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2824 2513 gene locus_tag LOCUS_11250 2824 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3439 2864 gene locus_tag LOCUS_11260 3439 2864 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_11260 3725 3462 gene locus_tag LOCUS_11270 3725 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4544 3834 gene locus_tag LOCUS_11280 gene radC 4544 3834 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_11280 4689 8303 gene locus_tag LOCUS_11290 gene addA 4689 8303 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 protein_id gnl|my_center|LOCUS_11290 9163 8300 gene locus_tag LOCUS_11300 9163 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 9318 10208 gene locus_tag LOCUS_11310 9318 10208 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_11310 10226 11518 gene locus_tag LOCUS_11320 gene pelA 10226 11518 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_11320 12778 11519 gene locus_tag LOCUS_11330 12778 11519 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776884.1 protein_id gnl|my_center|LOCUS_11330 12872 14545 gene locus_tag LOCUS_11340 12872 14545 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_11340 14996 14574 gene locus_tag LOCUS_11350 14996 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 15432 15097 gene locus_tag LOCUS_11360 15432 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 15992 15567 gene locus_tag LOCUS_11370 15992 15567 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_11370 16085 16333 gene locus_tag LOCUS_11380 16085 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 17498 16338 gene locus_tag LOCUS_11390 17498 16338 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_11390 17701 18717 gene locus_tag LOCUS_11400 gene ruvB 17701 18717 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_11400 19449 18736 gene locus_tag LOCUS_11410 19449 18736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 19963 20574 gene locus_tag LOCUS_11420 19963 20574 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_11420 20945 20730 gene locus_tag LOCUS_11430 20945 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 21379 22884 gene locus_tag LOCUS_11440 21379 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 22890 23780 gene locus_tag LOCUS_11450 22890 23780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 23786 25213 gene locus_tag LOCUS_11460 23786 25213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 25210 25872 gene locus_tag LOCUS_11470 25210 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 25869 26138 gene locus_tag LOCUS_11480 25869 26138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 27369 26203 gene locus_tag LOCUS_11490 gene hisC 27369 26203 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390315.1 protein_id gnl|my_center|LOCUS_11490 28987 27392 gene locus_tag LOCUS_11500 28987 27392 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_11500 29323 28997 gene locus_tag LOCUS_11510 gene sugE 29323 28997 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_11510 30619 29327 gene locus_tag LOCUS_11520 gene hisD 30619 29327 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_11520 31577 30678 gene locus_tag LOCUS_11530 31577 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 31679 32383 gene locus_tag LOCUS_11540 gene pyrF 31679 32383 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_11540 33932 32703 gene locus_tag LOCUS_11550 33932 32703 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_11550 35329 34025 gene locus_tag LOCUS_11560 35329 34025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 35729 36436 gene locus_tag LOCUS_11570 gene yihA 35729 36436 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_11570 36449 37759 gene locus_tag LOCUS_11580 36449 37759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 37829 38914 gene locus_tag LOCUS_11590 37829 38914 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_11590 38968 40551 gene locus_tag LOCUS_11600 38968 40551 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_11600 40634 41374 gene locus_tag LOCUS_11610 40634 41374 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 protein_id gnl|my_center|LOCUS_11610 42327 41431 gene locus_tag LOCUS_11620 42327 41431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 47611 45437 gene locus_tag LOCUS_11630 47611 45437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 48868 47813 gene locus_tag LOCUS_11640 48868 47813 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932661.1 protein_id gnl|my_center|LOCUS_11640 50601 49195 gene locus_tag LOCUS_11650 gene argH 50601 49195 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_11650 50693 51610 gene locus_tag LOCUS_11660 50693 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 51791 52045 gene locus_tag LOCUS_11670 51791 52045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 52136 52591 gene locus_tag LOCUS_11680 gene smpB 52136 52591 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_11680 52907 52638 gene locus_tag LOCUS_11690 gene rpmB 52907 52638 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_11690 53029 54270 gene locus_tag LOCUS_11700 53029 54270 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_11700 54547 54320 gene locus_tag LOCUS_11710 54547 54320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 54677 54898 gene locus_tag LOCUS_11720 54677 54898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 55059 55910 gene locus_tag LOCUS_11730 55059 55910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 56769 56065 gene locus_tag LOCUS_11740 56769 56065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 58014 56788 gene locus_tag LOCUS_11750 58014 56788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 58249 58848 gene locus_tag LOCUS_11760 58249 58848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_11760 58880 59692 gene locus_tag LOCUS_11770 gene thiM 58880 59692 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_11770 59689 60291 gene locus_tag LOCUS_11780 gene thiE 59689 60291 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence017 770 1210 gene locus_tag LOCUS_11790 gene fliW 770 1210 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_11790 1222 1539 gene locus_tag LOCUS_11800 1222 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2071 1910 gene locus_tag LOCUS_11810 2071 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2189 4408 gene locus_tag LOCUS_11820 2189 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4432 11886 gene locus_tag LOCUS_11830 4432 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 13991 12153 gene locus_tag LOCUS_11840 13991 12153 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_11840 15091 14018 gene locus_tag LOCUS_11850 15091 14018 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_11850 16147 15179 gene locus_tag LOCUS_11860 16147 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 16842 16144 gene locus_tag LOCUS_11870 16842 16144 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_11870 18523 16847 gene locus_tag LOCUS_11880 18523 16847 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_11880 20499 18529 gene locus_tag LOCUS_11890 20499 18529 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_11890 22754 20496 gene locus_tag LOCUS_11900 22754 20496 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845818.1 protein_id gnl|my_center|LOCUS_11900 25553 22887 gene locus_tag LOCUS_11910 25553 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 27927 25561 gene locus_tag LOCUS_11920 27927 25561 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_11920 29518 28004 gene locus_tag LOCUS_11930 gene araA 29518 28004 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210591.1 protein_id gnl|my_center|LOCUS_11930 31040 29814 gene locus_tag LOCUS_11940 31040 29814 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082680.1 protein_id gnl|my_center|LOCUS_11940 31130 31999 gene locus_tag LOCUS_11950 31130 31999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 32790 32056 gene locus_tag LOCUS_11960 32790 32056 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_11960 33671 32865 gene locus_tag LOCUS_11970 33671 32865 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_11970 33876 36053 gene locus_tag LOCUS_11980 gene glgP 33876 36053 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933260.1 protein_id gnl|my_center|LOCUS_11980 36325 37611 gene locus_tag LOCUS_11990 36325 37611 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184431658.1 protein_id gnl|my_center|LOCUS_11990 37620 38402 gene locus_tag LOCUS_12000 37620 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 39342 38338 gene locus_tag LOCUS_12010 39342 38338 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535304.1 protein_id gnl|my_center|LOCUS_12010 39909 39499 gene locus_tag LOCUS_12020 39909 39499 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_12020 41360 39909 gene locus_tag LOCUS_12030 gene atpD 41360 39909 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016335.1 protein_id gnl|my_center|LOCUS_12030 42261 41383 gene locus_tag LOCUS_12040 gene atpG 42261 41383 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_12040 43803 42271 gene locus_tag LOCUS_12050 gene atpA 43803 42271 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921278.1 protein_id gnl|my_center|LOCUS_12050 44205 43813 gene locus_tag LOCUS_12060 44205 43813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 44711 44214 gene locus_tag LOCUS_12070 44711 44214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 44957 44724 gene locus_tag LOCUS_12080 44957 44724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 46081 45029 gene locus_tag LOCUS_12090 46081 45029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 46868 46194 gene locus_tag LOCUS_12100 46868 46194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 49347 47245 gene locus_tag LOCUS_12110 49347 47245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 50181 49366 gene locus_tag LOCUS_12120 50181 49366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 51901 50192 gene locus_tag LOCUS_12130 51901 50192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 52221 53054 gene locus_tag LOCUS_12140 52221 53054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 55420 53267 gene locus_tag LOCUS_12150 gene pnp 55420 53267 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_12150 55879 55622 gene locus_tag LOCUS_12160 gene rpsO 55879 55622 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059465.1 protein_id gnl|my_center|LOCUS_12160 57405 55933 gene locus_tag LOCUS_12170 gene tilS 57405 55933 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence018 750 1121 gene locus_tag LOCUS_12180 gene hypA 750 1121 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_12180 1126 1953 gene locus_tag LOCUS_12190 gene hypB 1126 1953 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_12190 2600 2524 gene locus_tag LOCUS_t00100 2600 2524 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3943 3059 gene locus_tag LOCUS_12200 3943 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4099 5454 gene locus_tag LOCUS_12210 4099 5454 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_12210 5891 5442 gene locus_tag LOCUS_12220 5891 5442 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_12220 6367 7401 gene locus_tag LOCUS_12230 6367 7401 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_12230 7398 8219 gene locus_tag LOCUS_12240 7398 8219 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_12240 8216 8977 gene locus_tag LOCUS_12250 8216 8977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_12250 9707 9033 gene locus_tag LOCUS_12260 gene nth 9707 9033 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_12260 12046 9782 gene locus_tag LOCUS_12270 12046 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_12270 12526 12086 gene locus_tag LOCUS_12280 12526 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13915 12677 gene locus_tag LOCUS_12290 gene ablA 13915 12677 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_12290 15374 14040 gene locus_tag LOCUS_12300 gene hflX 15374 14040 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413984.1 protein_id gnl|my_center|LOCUS_12300 15461 16804 gene locus_tag LOCUS_12310 gene ffh 15461 16804 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_12310 17726 16908 gene locus_tag LOCUS_12320 17726 16908 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_12320 19222 19653 gene locus_tag LOCUS_12330 19222 19653 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_12330 20692 19805 gene locus_tag LOCUS_12340 20692 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 20782 21105 gene locus_tag LOCUS_12350 20782 21105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 21111 21620 gene locus_tag LOCUS_12360 21111 21620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 21610 22764 gene locus_tag LOCUS_12370 21610 22764 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483569.1 protein_id gnl|my_center|LOCUS_12370 22769 23233 gene locus_tag LOCUS_12380 22769 23233 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_12380 24829 23303 gene locus_tag LOCUS_12390 24829 23303 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_12390 25068 26312 gene locus_tag LOCUS_12400 25068 26312 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_12400 27288 26290 gene locus_tag LOCUS_12410 gene corA 27288 26290 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_12410 28610 27315 gene locus_tag LOCUS_12420 28610 27315 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_12420 29596 28598 gene locus_tag LOCUS_12430 29596 28598 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_12430 30455 29487 gene locus_tag LOCUS_12440 30455 29487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 31480 30578 gene locus_tag LOCUS_12450 31480 30578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 32059 34506 gene locus_tag LOCUS_12460 32059 34506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 34592 38815 gene locus_tag LOCUS_12470 34592 38815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 39812 38865 gene locus_tag LOCUS_12480 39812 38865 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_12480 40448 39909 gene locus_tag LOCUS_12490 gene pyrR 40448 39909 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_12490 40787 40566 gene locus_tag LOCUS_12500 40787 40566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 41150 41677 gene locus_tag LOCUS_12510 41150 41677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 42264 41869 gene locus_tag LOCUS_12520 42264 41869 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_12520 42389 42892 gene locus_tag LOCUS_12530 42389 42892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 43307 43885 gene locus_tag LOCUS_12540 43307 43885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 44731 43937 gene locus_tag LOCUS_12550 44731 43937 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035441.1 protein_id gnl|my_center|LOCUS_12550 45124 44735 gene locus_tag LOCUS_12560 45124 44735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 45438 45121 gene locus_tag LOCUS_12570 45438 45121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 46493 45426 gene locus_tag LOCUS_12580 46493 45426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 46787 48529 gene locus_tag LOCUS_12590 46787 48529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 48536 49150 gene locus_tag LOCUS_12600 48536 49150 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_12600 49152 49634 gene locus_tag LOCUS_12610 49152 49634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 49724 50230 gene locus_tag LOCUS_12620 49724 50230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 50227 51261 gene locus_tag LOCUS_12630 50227 51261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 51266 51778 gene locus_tag LOCUS_12640 51266 51778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 51839 52228 gene locus_tag LOCUS_12650 51839 52228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 52418 52693 gene locus_tag LOCUS_12660 52418 52693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 53807 52752 gene locus_tag LOCUS_12670 53807 52752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 54498 53884 gene locus_tag LOCUS_12680 54498 53884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 55835 54795 gene locus_tag LOCUS_12690 55835 54795 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_12690 56042 56368 gene locus_tag LOCUS_12700 56042 56368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 56538 57371 gene locus_tag LOCUS_12710 gene panC 56538 57371 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence019 715 1404 gene locus_tag LOCUS_12720 715 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1492 3357 gene locus_tag LOCUS_12730 1492 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3407 3610 gene locus_tag LOCUS_12740 3407 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3656 4162 gene locus_tag LOCUS_12750 3656 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4252 4860 gene locus_tag LOCUS_12760 4252 4860 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_12760 4947 5696 gene locus_tag LOCUS_12770 4947 5696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_12770 5728 6468 gene locus_tag LOCUS_12780 5728 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6812 6483 gene locus_tag LOCUS_12790 6812 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7771 6809 gene locus_tag LOCUS_12800 7771 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256555.1 protein_id gnl|my_center|LOCUS_12800 8748 7768 gene locus_tag LOCUS_12810 8748 7768 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_12810 9258 8839 gene locus_tag LOCUS_12820 9258 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 9808 9356 gene locus_tag LOCUS_12830 gene tnpA 9808 9356 CDS product IS200/IS605-like element ISEc46 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 protein_id gnl|my_center|LOCUS_12830 10790 10071 gene locus_tag LOCUS_12840 10790 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 11893 11351 gene locus_tag LOCUS_12850 11893 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 12002 12556 gene locus_tag LOCUS_12860 12002 12556 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_12860 12639 13739 gene locus_tag LOCUS_12870 gene gspE 12639 13739 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 protein_id gnl|my_center|LOCUS_12870 13736 14752 gene locus_tag LOCUS_12880 13736 14752 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_12880 14773 15927 gene locus_tag LOCUS_12890 14773 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 15924 16304 gene locus_tag LOCUS_12900 15924 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 16301 16804 gene locus_tag LOCUS_12910 16301 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16801 17040 gene locus_tag LOCUS_12920 16801 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 17037 17312 gene locus_tag LOCUS_12930 17037 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 17894 17328 gene locus_tag LOCUS_12940 17894 17328 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_12940 17979 18206 gene locus_tag LOCUS_12950 17979 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 18297 19073 gene locus_tag LOCUS_12960 18297 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 19085 19879 gene locus_tag LOCUS_12970 19085 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 20307 20038 gene locus_tag LOCUS_12980 20307 20038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 20506 20309 gene locus_tag LOCUS_12990 20506 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 21978 20845 gene locus_tag LOCUS_13000 21978 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 22035 22262 gene locus_tag LOCUS_13010 22035 22262 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_13010 22259 22747 gene locus_tag LOCUS_13020 22259 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 22849 24024 gene locus_tag LOCUS_13030 22849 24024 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_13030 24104 24967 gene locus_tag LOCUS_13040 24104 24967 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_13040 24979 25464 gene locus_tag LOCUS_13050 24979 25464 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_13050 25508 27067 gene locus_tag LOCUS_13060 25508 27067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 27095 27976 gene locus_tag LOCUS_13070 27095 27976 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_13070 29136 28027 gene locus_tag LOCUS_13080 29136 28027 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_13080 29292 30740 gene locus_tag LOCUS_13090 29292 30740 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_13090 30969 31337 gene locus_tag LOCUS_13100 gene rnpA 30969 31337 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945544.1 protein_id gnl|my_center|LOCUS_13100 31339 31614 gene locus_tag LOCUS_13110 gene yidD 31339 31614 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721423.1 protein_id gnl|my_center|LOCUS_13110 31621 33462 gene locus_tag LOCUS_13120 gene yidC 31621 33462 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_13120 33474 33926 gene locus_tag LOCUS_13130 33474 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 34372 33989 gene locus_tag LOCUS_13140 34372 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 34544 35992 gene locus_tag LOCUS_13150 34544 35992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_13150 36858 36058 gene locus_tag LOCUS_13160 36858 36058 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_13160 38050 36953 gene locus_tag LOCUS_13170 38050 36953 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_13170 39166 38069 gene locus_tag LOCUS_13180 39166 38069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 40171 39194 gene locus_tag LOCUS_13190 40171 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 40590 40255 gene locus_tag LOCUS_13200 40590 40255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 41663 40650 gene locus_tag LOCUS_13210 41663 40650 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_13210 42697 41660 gene locus_tag LOCUS_13220 gene plsX 42697 41660 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_13220 42912 42724 gene locus_tag LOCUS_13230 gene rpmF 42912 42724 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_13230 43440 42919 gene locus_tag LOCUS_13240 43440 42919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 43943 43437 gene locus_tag LOCUS_13250 gene coaD 43943 43437 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094895.1 protein_id gnl|my_center|LOCUS_13250 46289 44019 gene locus_tag LOCUS_13260 46289 44019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 47098 46349 gene locus_tag LOCUS_13270 47098 46349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 49172 47235 gene locus_tag LOCUS_13280 49172 47235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 49554 49282 gene locus_tag LOCUS_13290 49554 49282 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108348.1 protein_id gnl|my_center|LOCUS_13290 49850 51454 gene locus_tag LOCUS_13300 gene serA 49850 51454 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_13300 51480 52631 gene locus_tag LOCUS_13310 51480 52631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 52680 53444 gene locus_tag LOCUS_13320 52680 53444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 53485 53784 gene locus_tag LOCUS_13330 53485 53784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 53781 55136 gene locus_tag LOCUS_13340 53781 55136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 55193 55423 gene locus_tag LOCUS_13350 55193 55423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 55589 56071 gene locus_tag LOCUS_13360 55589 56071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 56303 56695 gene locus_tag LOCUS_13370 56303 56695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 57037 56702 gene locus_tag LOCUS_13380 57037 56702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence020 <1 3207 gene locus_tag LOCUS_13390 <1 3207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244431.1:CusA/CzcA family heavy metal efflux RND transporter 3278 4108 gene locus_tag LOCUS_13400 gene lgt 3278 4108 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722324.1 protein_id gnl|my_center|LOCUS_13400 5016 6890 gene locus_tag LOCUS_13410 5016 6890 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_13410 6906 7646 gene locus_tag LOCUS_13420 6906 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7802 8260 gene locus_tag LOCUS_13430 7802 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8327 8701 gene locus_tag LOCUS_13440 8327 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8843 9388 gene locus_tag LOCUS_13450 8843 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 9679 9326 gene locus_tag LOCUS_13460 9679 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9779 11944 gene locus_tag LOCUS_13470 9779 11944 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244418.1 protein_id gnl|my_center|LOCUS_13470 11982 12518 gene locus_tag LOCUS_13480 11982 12518 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209677908.1 protein_id gnl|my_center|LOCUS_13480 12531 12884 gene locus_tag LOCUS_13490 12531 12884 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262969.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 13092 14207 gene locus_tag LOCUS_13500 13092 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 14403 14621 gene locus_tag LOCUS_13510 14403 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 14714 16012 gene locus_tag LOCUS_13520 14714 16012 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840030.1 protein_id gnl|my_center|LOCUS_13520 16021 16944 gene locus_tag LOCUS_13530 16021 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 16946 20080 gene locus_tag LOCUS_13540 16946 20080 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_13540 20126 22369 gene locus_tag LOCUS_13550 20126 22369 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_13550 22705 22424 gene locus_tag LOCUS_13560 22705 22424 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855280.1 protein_id gnl|my_center|LOCUS_13560 22784 23899 gene locus_tag LOCUS_13570 22784 23899 CDS product Ni(II)/Co(II) efflux transporter permease subunit NcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196366.1 protein_id gnl|my_center|LOCUS_13570 24626 23988 gene locus_tag LOCUS_13580 24626 23988 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964834.1 protein_id gnl|my_center|LOCUS_13580 25603 24623 gene locus_tag LOCUS_13590 25603 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 25781 25632 gene locus_tag LOCUS_13600 25781 25632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 26546 26773 gene locus_tag LOCUS_13610 26546 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 27142 26831 gene locus_tag LOCUS_13620 27142 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 27503 28339 gene locus_tag LOCUS_13630 27503 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 28384 28641 gene locus_tag LOCUS_13640 28384 28641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 29776 28841 gene locus_tag LOCUS_13650 29776 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 29882 30238 gene locus_tag LOCUS_13660 29882 30238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 30281 30616 gene locus_tag LOCUS_13670 30281 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 30613 30891 gene locus_tag LOCUS_13680 30613 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 30895 33663 gene locus_tag LOCUS_13690 30895 33663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 33660 33902 gene locus_tag LOCUS_13700 33660 33902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 33909 34337 gene locus_tag LOCUS_13710 33909 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 34401 35201 gene locus_tag LOCUS_13720 34401 35201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 35222 36313 gene locus_tag LOCUS_13730 35222 36313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 36310 36966 gene locus_tag LOCUS_13740 36310 36966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 36950 37867 gene locus_tag LOCUS_13750 36950 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 37864 38934 gene locus_tag LOCUS_13760 37864 38934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 38931 39515 gene locus_tag LOCUS_13770 38931 39515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 39580 39990 gene locus_tag LOCUS_13780 39580 39990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 40289 40669 gene locus_tag LOCUS_13790 40289 40669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 40709 40978 gene locus_tag LOCUS_13800 40709 40978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 40996 45804 gene locus_tag LOCUS_13810 40996 45804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 45801 46052 gene locus_tag LOCUS_13820 45801 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 46512 47966 gene locus_tag LOCUS_13830 46512 47966 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_13830 47977 48861 gene locus_tag LOCUS_13840 47977 48861 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_13840 49261 52905 gene locus_tag LOCUS_13850 49261 52905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 53374 56799 gene locus_tag LOCUS_13860 53374 56799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence021 1058 1489 gene locus_tag LOCUS_13870 1058 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2694 2014 gene locus_tag LOCUS_13880 2694 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4977 2701 gene locus_tag LOCUS_13890 4977 2701 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_13890 6148 5069 gene locus_tag LOCUS_13900 gene aroB 6148 5069 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_13900 7581 6193 gene locus_tag LOCUS_13910 gene mnmE 7581 6193 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_13910 7881 7624 gene locus_tag LOCUS_13920 7881 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 8504 7878 gene locus_tag LOCUS_13930 8504 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8590 8910 gene locus_tag LOCUS_13940 8590 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 9585 9025 gene locus_tag LOCUS_13950 gene frr 9585 9025 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_13950 13153 9716 gene locus_tag LOCUS_13960 13153 9716 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_13960 13357 14229 gene locus_tag LOCUS_13970 13357 14229 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390592.1 protein_id gnl|my_center|LOCUS_13970 14393 15490 gene locus_tag LOCUS_13980 gene pilM 14393 15490 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_13980 15498 16169 gene locus_tag LOCUS_13990 15498 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 16166 16738 gene locus_tag LOCUS_14000 16166 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 16745 17167 gene locus_tag LOCUS_14010 16745 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 17212 18927 gene locus_tag LOCUS_14020 17212 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 18964 22983 gene locus_tag LOCUS_14030 18964 22983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 23332 23027 gene locus_tag LOCUS_14040 23332 23027 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_14040 23817 23329 gene locus_tag LOCUS_14050 gene mntR 23817 23329 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398443.1 protein_id gnl|my_center|LOCUS_14050 23992 25383 gene locus_tag LOCUS_14060 23992 25383 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_14060 25385 25813 gene locus_tag LOCUS_14070 25385 25813 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932691.1 protein_id gnl|my_center|LOCUS_14070 26818 25820 gene locus_tag LOCUS_14080 26818 25820 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_14080 27418 26909 gene locus_tag LOCUS_14090 gene mcsA 27418 26909 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_14090 28401 27565 gene locus_tag LOCUS_14100 28401 27565 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563253.1 protein_id gnl|my_center|LOCUS_14100 28995 28594 gene locus_tag LOCUS_14110 28995 28594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 28951 29253 gene locus_tag LOCUS_14120 28951 29253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 29532 30425 gene locus_tag LOCUS_14130 29532 30425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 31513 30512 gene locus_tag LOCUS_14140 31513 30512 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_14140 35151 31537 gene locus_tag LOCUS_14150 gene nifJ 35151 31537 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_14150 38215 35462 gene locus_tag LOCUS_14160 38215 35462 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_14160 39093 38476 gene locus_tag LOCUS_14170 39093 38476 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_14170 40216 39104 gene locus_tag LOCUS_14180 40216 39104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 41306 40326 gene locus_tag LOCUS_14190 41306 40326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 43388 41934 gene locus_tag LOCUS_14200 43388 41934 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_14200 43699 45537 gene locus_tag LOCUS_14210 43699 45537 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_14210 45744 48689 gene locus_tag LOCUS_14220 45744 48689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 48722 49408 gene locus_tag LOCUS_14230 48722 49408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 51167 51799 gene locus_tag LOCUS_14240 51167 51799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 51787 52383 gene locus_tag LOCUS_14250 51787 52383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 52589 53263 gene locus_tag LOCUS_14260 52589 53263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 53622 54032 gene locus_tag LOCUS_14270 53622 54032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence022 1838 417 gene locus_tag LOCUS_14280 gene flgK 1838 417 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 protein_id gnl|my_center|LOCUS_14280 2343 1846 gene locus_tag LOCUS_14290 2343 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2792 2340 gene locus_tag LOCUS_14300 2792 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4071 2794 gene locus_tag LOCUS_14310 4071 2794 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_14310 4710 4078 gene locus_tag LOCUS_14320 4710 4078 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_14320 5447 4707 gene locus_tag LOCUS_14330 5447 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6340 5558 gene locus_tag LOCUS_14340 gene flgG 6340 5558 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_14340 7186 6440 gene locus_tag LOCUS_14350 7186 6440 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986945.1 protein_id gnl|my_center|LOCUS_14350 7574 7305 gene locus_tag LOCUS_14360 7574 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8364 7582 gene locus_tag LOCUS_14370 gene motB 8364 7582 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097767.1 protein_id gnl|my_center|LOCUS_14370 9246 8377 gene locus_tag LOCUS_14380 gene motA 9246 8377 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_14380 10103 9243 gene locus_tag LOCUS_14390 10103 9243 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_14390 11438 10419 gene locus_tag LOCUS_14400 11438 10419 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440034.1 protein_id gnl|my_center|LOCUS_14400 13566 11443 gene locus_tag LOCUS_14410 gene flhA 13566 11443 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_14410 13715 13960 gene locus_tag LOCUS_14420 13715 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 14102 13911 gene locus_tag LOCUS_14430 14102 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 19140 14791 gene locus_tag LOCUS_14440 19140 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 19820 19146 gene locus_tag LOCUS_14450 19820 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 20403 20161 gene locus_tag LOCUS_14460 20403 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14460 20592 20404 gene locus_tag LOCUS_14470 20592 20404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 21001 20924 gene locus_tag LOCUS_t00110 21001 20924 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22774 21692 gene locus_tag LOCUS_14480 gene flhB 22774 21692 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193133.1 protein_id gnl|my_center|LOCUS_14480 23621 22854 gene locus_tag LOCUS_14490 gene fliR 23621 22854 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_14490 23929 23660 gene locus_tag LOCUS_14500 gene fliQ 23929 23660 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445741.1 protein_id gnl|my_center|LOCUS_14500 24707 23934 gene locus_tag LOCUS_14510 gene fliP 24707 23934 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_14510 25156 24704 gene locus_tag LOCUS_14520 25156 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 25449 25180 gene locus_tag LOCUS_14530 25449 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 26410 25442 gene locus_tag LOCUS_14540 gene fliM 26410 25442 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_14540 26962 26417 gene locus_tag LOCUS_14550 26962 26417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 27798 26977 gene locus_tag LOCUS_14560 27798 26977 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_14560 28268 27834 gene locus_tag LOCUS_14570 28268 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 30097 28274 gene locus_tag LOCUS_14580 30097 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 30674 30084 gene locus_tag LOCUS_14590 30674 30084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 31178 30708 gene locus_tag LOCUS_14600 31178 30708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 32558 31191 gene locus_tag LOCUS_14610 gene fliI 32558 31191 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_14610 33139 32555 gene locus_tag LOCUS_14620 33139 32555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 34157 33126 gene locus_tag LOCUS_14630 gene fliG 34157 33126 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545416.1 protein_id gnl|my_center|LOCUS_14630 35798 34185 gene locus_tag LOCUS_14640 gene fliF 35798 34185 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_14640 36012 35809 gene locus_tag LOCUS_14650 36012 35809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 35987 36181 gene locus_tag LOCUS_14660 35987 36181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 36617 36189 gene locus_tag LOCUS_14670 gene flgC 36617 36189 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_14670 37042 36623 gene locus_tag LOCUS_14680 gene flgB 37042 36623 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_14680 38850 37450 gene locus_tag LOCUS_14690 gene zraR 38850 37450 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_14690 39379 38921 gene locus_tag LOCUS_14700 39379 38921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 40737 39376 gene locus_tag LOCUS_14710 40737 39376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 41187 40741 gene locus_tag LOCUS_14720 41187 40741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 41069 41482 gene locus_tag LOCUS_14730 41069 41482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 41597 42493 gene locus_tag LOCUS_14740 41597 42493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 43318 42587 gene locus_tag LOCUS_14750 43318 42587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 43713 43327 gene locus_tag LOCUS_14760 43713 43327 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081498.1 protein_id gnl|my_center|LOCUS_14760 44207 43728 gene locus_tag LOCUS_14770 44207 43728 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707397.1 protein_id gnl|my_center|LOCUS_14770 45331 44234 gene locus_tag LOCUS_14780 45331 44234 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_14780 46188 45337 gene locus_tag LOCUS_14790 46188 45337 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_14790 46655 46185 gene locus_tag LOCUS_14800 46655 46185 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_14800 47170 48027 gene locus_tag LOCUS_14810 47170 48027 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 protein_id gnl|my_center|LOCUS_14810 48033 48920 gene locus_tag LOCUS_14820 48033 48920 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942933.1 protein_id gnl|my_center|LOCUS_14820 49198 51351 gene locus_tag LOCUS_14830 49198 51351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 51659 52684 gene locus_tag LOCUS_14840 51659 52684 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095592.1 protein_id gnl|my_center|LOCUS_14840 53818 52703 gene locus_tag LOCUS_14850 53818 52703 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence023 3808 3008 gene locus_tag LOCUS_14860 3808 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4647 4003 gene locus_tag LOCUS_14870 4647 4003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_14870 4879 8328 gene locus_tag LOCUS_14880 4879 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 8872 11154 gene locus_tag LOCUS_14890 8872 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 11523 12338 gene locus_tag LOCUS_14900 11523 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 12471 18470 gene locus_tag LOCUS_14910 12471 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 18832 22470 gene locus_tag LOCUS_14920 18832 22470 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_14920 22664 26773 gene locus_tag LOCUS_14930 gene hrpA 22664 26773 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151655988.1 protein_id gnl|my_center|LOCUS_14930 27538 27140 gene locus_tag LOCUS_14940 27538 27140 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_14940 27815 31264 gene locus_tag LOCUS_14950 27815 31264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 31445 32263 gene locus_tag LOCUS_14960 31445 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 32475 33965 gene locus_tag LOCUS_14970 32475 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 34225 36600 gene locus_tag LOCUS_14980 34225 36600 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_14980 36603 37550 gene locus_tag LOCUS_14990 36603 37550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 37619 37843 gene locus_tag LOCUS_15000 37619 37843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 38022 40157 gene locus_tag LOCUS_15010 gene ccoN 38022 40157 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_15010 40169 40381 gene locus_tag LOCUS_15020 40169 40381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 40378 40971 gene locus_tag LOCUS_15030 40378 40971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 41061 42506 gene locus_tag LOCUS_15040 gene ccoG 41061 42506 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_15040 42511 42975 gene locus_tag LOCUS_15050 42511 42975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 42977 43663 gene locus_tag LOCUS_15060 42977 43663 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_15060 43853 43617 gene locus_tag LOCUS_15070 43853 43617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 44606 43974 gene locus_tag LOCUS_15080 44606 43974 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_15080 45377 44736 gene locus_tag LOCUS_15090 45377 44736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 46535 50185 gene locus_tag LOCUS_15100 46535 50185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 50205 51089 gene locus_tag LOCUS_15110 gene cas1 50205 51089 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_15110 51169 51525 gene locus_tag LOCUS_15120 51169 51525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence024 3398 129 gene locus_tag LOCUS_15130 3398 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3625 4539 gene locus_tag LOCUS_15140 3625 4539 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_15140 5137 4712 gene locus_tag LOCUS_15150 5137 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5758 5168 gene locus_tag LOCUS_15160 5758 5168 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_15160 6751 5783 gene locus_tag LOCUS_15170 6751 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6874 7110 gene locus_tag LOCUS_15180 6874 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 7135 7914 gene locus_tag LOCUS_15190 7135 7914 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_15190 7953 8462 gene locus_tag LOCUS_15200 7953 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9380 8688 gene locus_tag LOCUS_15210 9380 8688 CDS product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615783.1 protein_id gnl|my_center|LOCUS_15210 9506 10309 gene locus_tag LOCUS_15220 gene hisF 9506 10309 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_15220 10942 10667 gene locus_tag LOCUS_15230 10942 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 11270 11587 gene locus_tag LOCUS_15240 11270 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 11720 12919 gene locus_tag LOCUS_15250 11720 12919 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_15250 15174 13840 gene locus_tag LOCUS_15260 15174 13840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_15260 15847 15161 gene locus_tag LOCUS_15270 15847 15161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_15270 17845 15863 gene locus_tag LOCUS_15280 17845 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 19520 17850 gene locus_tag LOCUS_15290 19520 17850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 19789 21312 gene locus_tag LOCUS_15300 19789 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 21381 22283 gene locus_tag LOCUS_15310 21381 22283 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_15310 25478 22299 gene locus_tag LOCUS_15320 25478 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 28813 25523 gene locus_tag LOCUS_15330 28813 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 32583 28810 gene locus_tag LOCUS_15340 32583 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 35500 32585 gene locus_tag LOCUS_15350 35500 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 36308 35523 gene locus_tag LOCUS_15360 36308 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 40504 36386 gene locus_tag LOCUS_15370 40504 36386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 41702 40686 gene locus_tag LOCUS_15380 41702 40686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 42430 41801 gene locus_tag LOCUS_15390 42430 41801 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_15390 43833 42475 gene locus_tag LOCUS_15400 43833 42475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 44551 44000 gene locus_tag LOCUS_15410 44551 44000 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_15410 45869 44556 gene locus_tag LOCUS_15420 45869 44556 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_15420 46228 45923 gene locus_tag LOCUS_15430 46228 45923 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15430 47041 46325 gene locus_tag LOCUS_15440 47041 46325 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_15440 47996 47340 gene locus_tag LOCUS_15450 47996 47340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 48033 50945 gene locus_tag LOCUS_15460 48033 50945 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence025 1090 647 gene locus_tag LOCUS_15470 1090 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1401 1087 gene locus_tag LOCUS_15480 1401 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1623 1536 gene locus_tag LOCUS_t00120 1623 1536 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1687 2979 gene locus_tag LOCUS_15490 1687 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2986 3504 gene locus_tag LOCUS_15500 2986 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4192 3890 gene locus_tag LOCUS_15510 4192 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5376 4300 gene locus_tag LOCUS_15520 gene arsB 5376 4300 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 protein_id gnl|my_center|LOCUS_15520 7161 5386 gene locus_tag LOCUS_15530 gene arsA 7161 5386 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122358.1 protein_id gnl|my_center|LOCUS_15530 7537 7163 gene locus_tag LOCUS_15540 gene arsD 7537 7163 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855180.1 protein_id gnl|my_center|LOCUS_15540 7978 7547 gene locus_tag LOCUS_15550 gene arsC 7978 7547 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 protein_id gnl|my_center|LOCUS_15550 8427 7984 gene locus_tag LOCUS_15560 8427 7984 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_15560 8789 8424 gene locus_tag LOCUS_15570 8789 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15570 9559 8864 gene locus_tag LOCUS_15580 9559 8864 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_15580 10075 9563 gene locus_tag LOCUS_15590 10075 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 10386 10084 gene locus_tag LOCUS_15600 10386 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11200 10718 gene locus_tag LOCUS_15610 11200 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 11459 11229 gene locus_tag LOCUS_15620 11459 11229 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_15620 12631 11513 gene locus_tag LOCUS_15630 12631 11513 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_15630 13373 12642 gene locus_tag LOCUS_15640 13373 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 16597 13433 gene locus_tag LOCUS_15650 16597 13433 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_15650 17703 16594 gene locus_tag LOCUS_15660 17703 16594 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081054.1 protein_id gnl|my_center|LOCUS_15660 19052 17700 gene locus_tag LOCUS_15670 19052 17700 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789673.1 protein_id gnl|my_center|LOCUS_15670 19390 19088 gene locus_tag LOCUS_15680 19390 19088 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_15680 19898 19542 gene locus_tag LOCUS_15690 19898 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 22671 19864 gene locus_tag LOCUS_15700 22671 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 22799 23074 gene locus_tag LOCUS_15710 22799 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 23816 24517 gene locus_tag LOCUS_15720 23816 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 24514 24849 gene locus_tag LOCUS_15730 24514 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 24846 26306 gene locus_tag LOCUS_15740 24846 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 26319 26636 gene locus_tag LOCUS_15750 26319 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 27227 27454 gene locus_tag LOCUS_15760 27227 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 27612 28004 gene locus_tag LOCUS_15770 27612 28004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 28316 28669 gene locus_tag LOCUS_15780 28316 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 28817 32299 gene locus_tag LOCUS_15790 28817 32299 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_15790 32303 35704 gene locus_tag LOCUS_15800 32303 35704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 35902 38442 gene locus_tag LOCUS_15810 35902 38442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 38482 40899 gene locus_tag LOCUS_15820 38482 40899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 40906 41460 gene locus_tag LOCUS_15830 40906 41460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 41482 42741 gene locus_tag LOCUS_15840 41482 42741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 42738 43313 gene locus_tag LOCUS_15850 42738 43313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 43310 45259 gene locus_tag LOCUS_15860 43310 45259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 45335 45922 gene locus_tag LOCUS_15870 45335 45922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 46796 45972 gene locus_tag LOCUS_15880 46796 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 48525 47179 gene locus_tag LOCUS_15890 48525 47179 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445143.1 protein_id gnl|my_center|LOCUS_15890 48878 49648 gene locus_tag LOCUS_15900 48878 49648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 50558 49650 gene locus_tag LOCUS_15910 50558 49650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 50695 51057 gene locus_tag LOCUS_15920 50695 51057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence026 324 524 gene locus_tag LOCUS_15930 324 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1941 1213 gene locus_tag LOCUS_15940 1941 1213 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_15940 5067 2176 gene locus_tag LOCUS_15950 5067 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 6049 5339 gene locus_tag LOCUS_15960 6049 5339 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_15960 7466 6030 gene locus_tag LOCUS_15970 7466 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 12993 7756 gene locus_tag LOCUS_15980 12993 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 13958 13080 gene locus_tag LOCUS_15990 13958 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18019 14054 gene locus_tag LOCUS_16000 18019 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 22901 18357 gene locus_tag LOCUS_16010 22901 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23993 22980 gene locus_tag LOCUS_16020 23993 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 27479 24018 gene locus_tag LOCUS_16030 27479 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 28575 27868 gene locus_tag LOCUS_16040 28575 27868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 29549 28857 gene locus_tag LOCUS_16050 29549 28857 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_16050 31039 29546 gene locus_tag LOCUS_16060 31039 29546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 31452 32777 gene locus_tag LOCUS_16070 31452 32777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 36661 32825 gene locus_tag LOCUS_16080 36661 32825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 36660 36854 gene locus_tag LOCUS_16090 36660 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 38872 36851 gene locus_tag LOCUS_16100 38872 36851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 39427 38930 gene locus_tag LOCUS_16110 39427 38930 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_16110 41115 39676 gene locus_tag LOCUS_16120 41115 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 41570 41109 gene locus_tag LOCUS_16130 41570 41109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 42664 41606 gene locus_tag LOCUS_16140 42664 41606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 43386 42661 gene locus_tag LOCUS_16150 43386 42661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 43808 43383 gene locus_tag LOCUS_16160 43808 43383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 44320 43805 gene locus_tag LOCUS_16170 44320 43805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 45594 44326 gene locus_tag LOCUS_16180 45594 44326 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_16180 45698 46093 gene locus_tag LOCUS_16190 45698 46093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 46555 47049 gene locus_tag LOCUS_16200 gene rpoE 46555 47049 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_16200 47061 47276 gene locus_tag LOCUS_16210 47061 47276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 47284 47943 gene locus_tag LOCUS_16220 47284 47943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 48004 48819 gene locus_tag LOCUS_16230 48004 48819 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868238.1 protein_id gnl|my_center|LOCUS_16230 48977 50512 gene locus_tag LOCUS_16240 48977 50512 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence027 266 93 gene locus_tag LOCUS_16250 266 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1583 480 gene locus_tag LOCUS_16260 gene ald 1583 480 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926910.1 protein_id gnl|my_center|LOCUS_16260 2292 1630 gene locus_tag LOCUS_16270 2292 1630 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_16270 5936 2298 gene locus_tag LOCUS_16280 5936 2298 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_16280 7425 5956 gene locus_tag LOCUS_16290 7425 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7670 7449 gene locus_tag LOCUS_16300 7670 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7853 9406 gene locus_tag LOCUS_16310 7853 9406 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_16310 11629 9431 gene locus_tag LOCUS_16320 11629 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 11888 12709 gene locus_tag LOCUS_16330 11888 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12986 13129 gene locus_tag LOCUS_16340 12986 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 13808 13221 gene locus_tag LOCUS_16350 13808 13221 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_16350 15125 13839 gene locus_tag LOCUS_16360 gene argA 15125 13839 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 protein_id gnl|my_center|LOCUS_16360 15288 16193 gene locus_tag LOCUS_16370 15288 16193 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_16370 16231 18627 gene locus_tag LOCUS_16380 16231 18627 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_16380 19780 18686 gene locus_tag LOCUS_16390 gene hisC 19780 18686 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_16390 20872 19817 gene locus_tag LOCUS_16400 gene pta 20872 19817 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_16400 21039 21767 gene locus_tag LOCUS_16410 21039 21767 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_16410 23787 22273 gene locus_tag LOCUS_16420 23787 22273 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_16420 25947 23917 gene locus_tag LOCUS_16430 25947 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 27419 26163 gene locus_tag LOCUS_16440 27419 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 29616 27397 gene locus_tag LOCUS_16450 29616 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 30895 30113 gene locus_tag LOCUS_16460 30895 30113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 30929 31210 gene locus_tag LOCUS_16470 30929 31210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 31807 33057 gene locus_tag LOCUS_16480 31807 33057 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966057.1 protein_id gnl|my_center|LOCUS_16480 35755 33662 gene locus_tag LOCUS_16490 35755 33662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 37522 35876 gene locus_tag LOCUS_16500 gene groL 37522 35876 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_16500 38008 37715 gene locus_tag LOCUS_16510 gene groES 38008 37715 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_16510 40288 38354 gene locus_tag LOCUS_16520 gene dnaK 40288 38354 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_16520 42343 40718 gene locus_tag LOCUS_16530 42343 40718 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_16530 42566 42354 gene locus_tag LOCUS_16540 42566 42354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 42565 42900 gene locus_tag LOCUS_16550 42565 42900 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_16550 43475 44347 gene locus_tag LOCUS_16560 43475 44347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 45613 46218 gene locus_tag LOCUS_16570 45613 46218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 46854 46351 gene locus_tag LOCUS_16580 46854 46351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 47048 46833 gene locus_tag LOCUS_16590 47048 46833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 47916 47485 gene locus_tag LOCUS_16600 47916 47485 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_16600 48143 47913 gene locus_tag LOCUS_16610 48143 47913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence028 292 2082 gene locus_tag LOCUS_16620 gene lepA 292 2082 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_16620 2168 3379 gene locus_tag LOCUS_16630 2168 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3390 4187 gene locus_tag LOCUS_16640 3390 4187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_16640 4934 4425 gene locus_tag LOCUS_16650 gene tnpA 4934 4425 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_16650 5347 5030 gene locus_tag LOCUS_16660 5347 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8273 5271 gene locus_tag LOCUS_16670 8273 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 11558 8484 gene locus_tag LOCUS_16680 11558 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 13444 12014 gene locus_tag LOCUS_16690 13444 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 17186 13476 gene locus_tag LOCUS_16700 17186 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 17686 20169 gene locus_tag LOCUS_16710 17686 20169 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_16710 20263 21030 gene locus_tag LOCUS_16720 20263 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 21072 22940 gene locus_tag LOCUS_16730 21072 22940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 25500 22930 gene locus_tag LOCUS_16740 25500 22930 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764306.1 protein_id gnl|my_center|LOCUS_16740 27867 25504 gene locus_tag LOCUS_16750 27867 25504 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178933861.1 protein_id gnl|my_center|LOCUS_16750 29195 27864 gene locus_tag LOCUS_16760 29195 27864 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_16760 30907 29321 gene locus_tag LOCUS_16770 30907 29321 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 protein_id gnl|my_center|LOCUS_16770 31090 32415 gene locus_tag LOCUS_16780 31090 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 32412 33068 gene locus_tag LOCUS_16790 32412 33068 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_16790 33137 33697 gene locus_tag LOCUS_16800 33137 33697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 33702 34280 gene locus_tag LOCUS_16810 33702 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 34926 34375 gene locus_tag LOCUS_16820 34926 34375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 36686 35802 gene locus_tag LOCUS_16830 36686 35802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 37536 36709 gene locus_tag LOCUS_16840 37536 36709 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_16840 38808 37561 gene locus_tag LOCUS_16850 38808 37561 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_16850 40008 38971 gene locus_tag LOCUS_16860 40008 38971 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_16860 40107 41558 gene locus_tag LOCUS_16870 40107 41558 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_16870 41668 42222 gene locus_tag LOCUS_16880 41668 42222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 42216 43571 gene locus_tag LOCUS_16890 42216 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 43581 44243 gene locus_tag LOCUS_16900 43581 44243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 44348 45799 gene locus_tag LOCUS_16910 44348 45799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 45796 46635 gene locus_tag LOCUS_16920 45796 46635 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_16920 48226 46643 gene locus_tag LOCUS_16930 48226 46643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence029 1212 199 gene locus_tag LOCUS_16940 1212 199 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_16940 1949 1209 gene locus_tag LOCUS_16950 1949 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2000 3607 gene locus_tag LOCUS_16960 2000 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4081 4005 gene locus_tag LOCUS_t00130 4081 4005 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9041 4341 gene locus_tag LOCUS_16970 9041 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 9385 9158 gene locus_tag LOCUS_16980 9385 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9811 9449 gene locus_tag LOCUS_16990 9811 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10561 10142 gene locus_tag LOCUS_17000 10561 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11222 10629 gene locus_tag LOCUS_17010 11222 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 12286 11219 gene locus_tag LOCUS_17020 12286 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 13200 12283 gene locus_tag LOCUS_17030 13200 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 14255 13644 gene locus_tag LOCUS_17040 14255 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 15385 14297 gene locus_tag LOCUS_17050 15385 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 16206 15406 gene locus_tag LOCUS_17060 16206 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 16683 16273 gene locus_tag LOCUS_17070 16683 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 17567 16710 gene locus_tag LOCUS_17080 17567 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974889.1 protein_id gnl|my_center|LOCUS_17080 20287 17564 gene locus_tag LOCUS_17090 20287 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 20590 20291 gene locus_tag LOCUS_17100 20590 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 21015 20587 gene locus_tag LOCUS_17110 21015 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 21471 21055 gene locus_tag LOCUS_17120 21471 21055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 21797 21468 gene locus_tag LOCUS_17130 21797 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 22187 21831 gene locus_tag LOCUS_17140 22187 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 22315 23223 gene locus_tag LOCUS_17150 22315 23223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 23335 23216 gene locus_tag LOCUS_17160 23335 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 23470 24540 gene locus_tag LOCUS_17170 23470 24540 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943746.1 protein_id gnl|my_center|LOCUS_17170 24585 25571 gene locus_tag LOCUS_17180 24585 25571 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_17180 25574 26329 gene locus_tag LOCUS_17190 25574 26329 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_17190 26382 27392 gene locus_tag LOCUS_17200 26382 27392 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104858.1 protein_id gnl|my_center|LOCUS_17200 28054 27446 gene locus_tag LOCUS_17210 28054 27446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 29384 28548 gene locus_tag LOCUS_17220 29384 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 30043 29705 gene locus_tag LOCUS_17230 30043 29705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 36463 30473 gene locus_tag LOCUS_17240 36463 30473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 37812 36595 gene locus_tag LOCUS_17250 37812 36595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 38636 38376 gene locus_tag LOCUS_17260 38636 38376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 38792 39106 gene locus_tag LOCUS_17270 38792 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 39587 39264 gene locus_tag LOCUS_17280 39587 39264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 39721 39936 gene locus_tag LOCUS_17290 39721 39936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 40201 40500 gene locus_tag LOCUS_17300 40201 40500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 40738 40511 gene locus_tag LOCUS_17310 40738 40511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 41333 41016 gene locus_tag LOCUS_17320 41333 41016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 42805 41345 gene locus_tag LOCUS_17330 42805 41345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 43137 42802 gene locus_tag LOCUS_17340 43137 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 43832 43134 gene locus_tag LOCUS_17350 43832 43134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 44284 43829 gene locus_tag LOCUS_17360 44284 43829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 45002 44493 gene locus_tag LOCUS_17370 45002 44493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 45086 47896 gene locus_tag LOCUS_17380 45086 47896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 47862 48218 gene locus_tag LOCUS_17390 47862 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 48248 >48419 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgcgcccgcgcggg >Feature sequence030 111 881 gene locus_tag LOCUS_17400 111 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 907 1263 gene locus_tag LOCUS_17410 907 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1292 1576 gene locus_tag LOCUS_17420 1292 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1714 2589 gene locus_tag LOCUS_17430 1714 2589 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 protein_id gnl|my_center|LOCUS_17430 2629 3297 gene locus_tag LOCUS_17440 2629 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3637 3816 gene locus_tag LOCUS_17450 3637 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3844 4257 gene locus_tag LOCUS_17460 3844 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 4297 5346 gene locus_tag LOCUS_17470 4297 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 5541 5978 gene locus_tag LOCUS_17480 5541 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5975 6208 gene locus_tag LOCUS_17490 5975 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 6205 7239 gene locus_tag LOCUS_17500 6205 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 7308 8177 gene locus_tag LOCUS_17510 7308 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8186 8482 gene locus_tag LOCUS_17520 8186 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 8475 8786 gene locus_tag LOCUS_17530 8475 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 8761 9012 gene locus_tag LOCUS_17540 8761 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 8999 9226 gene locus_tag LOCUS_17550 8999 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 9314 10045 gene locus_tag LOCUS_17560 9314 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 10029 11822 gene locus_tag LOCUS_17570 10029 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 11838 12203 gene locus_tag LOCUS_17580 11838 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 12203 13843 gene locus_tag LOCUS_17590 12203 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 13846 14679 gene locus_tag LOCUS_17600 13846 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14728 15219 gene locus_tag LOCUS_17610 14728 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 15260 16315 gene locus_tag LOCUS_17620 15260 16315 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101115.1 protein_id gnl|my_center|LOCUS_17620 16337 16864 gene locus_tag LOCUS_17630 16337 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 16870 16944 gene locus_tag LOCUS_t00140 16870 16944 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16995 17294 gene locus_tag LOCUS_17640 16995 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 17298 17858 gene locus_tag LOCUS_17650 17298 17858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 17855 18082 gene locus_tag LOCUS_17660 17855 18082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 18083 20605 gene locus_tag LOCUS_17670 18083 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 20608 20955 gene locus_tag LOCUS_17680 20608 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 20978 21802 gene locus_tag LOCUS_17690 20978 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21799 22245 gene locus_tag LOCUS_17700 21799 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 22242 22601 gene locus_tag LOCUS_17710 22242 22601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 22639 23076 gene locus_tag LOCUS_17720 22639 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 23079 23735 gene locus_tag LOCUS_17730 23079 23735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 23815 25149 gene locus_tag LOCUS_17740 23815 25149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 25146 25973 gene locus_tag LOCUS_17750 25146 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 25977 26333 gene locus_tag LOCUS_17760 25977 26333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 26324 28948 gene locus_tag LOCUS_17770 26324 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 30062 28965 gene locus_tag LOCUS_17780 30062 28965 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098812.1 protein_id gnl|my_center|LOCUS_17780 30291 30216 gene locus_tag LOCUS_t00150 30291 30216 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31387 30572 gene locus_tag LOCUS_17790 31387 30572 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_17790 33005 31392 gene locus_tag LOCUS_17800 33005 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 34208 33039 gene locus_tag LOCUS_17810 34208 33039 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_17810 35072 34287 gene locus_tag LOCUS_17820 35072 34287 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_17820 35189 39097 gene locus_tag LOCUS_17830 35189 39097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 40441 39167 gene locus_tag LOCUS_17840 40441 39167 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_17840 40530 41498 gene locus_tag LOCUS_17850 40530 41498 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_17850 41495 42838 gene locus_tag LOCUS_17860 41495 42838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 42835 44955 gene locus_tag LOCUS_17870 42835 44955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 45441 45349 gene locus_tag LOCUS_t00160 45441 45349 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 1300 512 gene locus_tag LOCUS_17880 1300 512 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_17880 2733 1330 gene locus_tag LOCUS_17890 2733 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3754 2789 gene locus_tag LOCUS_17900 3754 2789 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811019.1 protein_id gnl|my_center|LOCUS_17900 4656 3853 gene locus_tag LOCUS_17910 4656 3853 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_17910 5877 4735 gene locus_tag LOCUS_17920 5877 4735 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392956.1 protein_id gnl|my_center|LOCUS_17920 5876 6103 gene locus_tag LOCUS_17930 5876 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 6259 6882 gene locus_tag LOCUS_17940 6259 6882 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_17940 6927 9473 gene locus_tag LOCUS_17950 6927 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 9479 10549 gene locus_tag LOCUS_17960 9479 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 10700 13894 gene locus_tag LOCUS_17970 10700 13894 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037325.1 protein_id gnl|my_center|LOCUS_17970 13920 14579 gene locus_tag LOCUS_17980 13920 14579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_17980 15158 20122 gene locus_tag LOCUS_17990 15158 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 20136 21029 gene locus_tag LOCUS_18000 20136 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 21085 23859 gene locus_tag LOCUS_18010 21085 23859 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_18010 25887 24031 gene locus_tag LOCUS_18020 25887 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 25976 27235 gene locus_tag LOCUS_18030 gene rsmB 25976 27235 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932290.1 protein_id gnl|my_center|LOCUS_18030 27239 27841 gene locus_tag LOCUS_18040 27239 27841 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350872.1 protein_id gnl|my_center|LOCUS_18040 29122 27842 gene locus_tag LOCUS_18050 gene lysA 29122 27842 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_18050 29914 29144 gene locus_tag LOCUS_18060 29914 29144 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_18060 29995 30639 gene locus_tag LOCUS_18070 29995 30639 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_18070 32885 30711 gene locus_tag LOCUS_18080 32885 30711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 33788 33318 gene locus_tag LOCUS_18090 gene trmL 33788 33318 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_18090 34634 33807 gene locus_tag LOCUS_18100 gene truA 34634 33807 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_18100 35197 34787 gene locus_tag LOCUS_18110 gene ruvX 35197 34787 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_18110 36047 36370 gene locus_tag LOCUS_18120 36047 36370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 38262 37648 gene locus_tag LOCUS_18130 38262 37648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 40334 38259 gene locus_tag LOCUS_18140 40334 38259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 41575 40337 gene locus_tag LOCUS_18150 41575 40337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 42862 41588 gene locus_tag LOCUS_18160 42862 41588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 44658 43444 gene locus_tag LOCUS_18170 44658 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence032 304 1575 gene locus_tag LOCUS_18180 304 1575 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_18180 1589 2383 gene locus_tag LOCUS_18190 1589 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2388 4031 gene locus_tag LOCUS_18200 2388 4031 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_18200 4033 4851 gene locus_tag LOCUS_18210 4033 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5067 5369 gene locus_tag LOCUS_18220 5067 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6808 5417 gene locus_tag LOCUS_18230 6808 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7038 8270 gene locus_tag LOCUS_18240 7038 8270 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_18240 8320 8742 gene locus_tag LOCUS_18250 8320 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9217 9038 gene locus_tag LOCUS_18260 9217 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 10290 9445 gene locus_tag LOCUS_18270 10290 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 12361 10334 gene locus_tag LOCUS_18280 12361 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 12774 14405 gene locus_tag LOCUS_18290 12774 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 14421 14753 gene locus_tag LOCUS_18300 14421 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 14897 20179 gene locus_tag LOCUS_18310 14897 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 20368 21129 gene locus_tag LOCUS_18320 20368 21129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 protein_id gnl|my_center|LOCUS_18320 22346 21186 gene locus_tag LOCUS_18330 gene lptF 22346 21186 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938951.1 protein_id gnl|my_center|LOCUS_18330 23563 22685 gene locus_tag LOCUS_18340 23563 22685 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_18340 24431 23532 gene locus_tag LOCUS_18350 24431 23532 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_18350 25454 24435 gene locus_tag LOCUS_18360 25454 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 25634 25921 gene locus_tag LOCUS_18370 25634 25921 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_18370 29264 25980 gene locus_tag LOCUS_18380 29264 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 30090 29440 gene locus_tag LOCUS_18390 30090 29440 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_18390 30560 30345 gene locus_tag LOCUS_18400 30560 30345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 30504 30704 gene locus_tag LOCUS_18410 30504 30704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 31998 31120 gene locus_tag LOCUS_18420 31998 31120 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_18420 32143 33489 gene locus_tag LOCUS_18430 gene gltX 32143 33489 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_18430 33578 34675 gene locus_tag LOCUS_18440 33578 34675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 35221 34748 gene locus_tag LOCUS_18450 gene rpsG 35221 34748 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021606.1 protein_id gnl|my_center|LOCUS_18450 35632 35240 gene locus_tag LOCUS_18460 gene rpsL 35632 35240 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_18460 35809 36624 gene locus_tag LOCUS_18470 35809 36624 CDS product R.Pab1 family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146495.1 protein_id gnl|my_center|LOCUS_18470 38030 36837 gene locus_tag LOCUS_18480 38030 36837 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_18480 38805 38032 gene locus_tag LOCUS_18490 38805 38032 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_18490 39275 38808 gene locus_tag LOCUS_18500 39275 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_18500 42044 39291 gene locus_tag LOCUS_18510 gene acnA 42044 39291 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_18510 42580 42200 gene locus_tag LOCUS_18520 42580 42200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence033 1130 867 gene locus_tag LOCUS_18530 1130 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1564 2430 gene locus_tag LOCUS_18540 1564 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2900 2412 gene locus_tag LOCUS_18550 2900 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3405 2923 gene locus_tag LOCUS_18560 3405 2923 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814642.1 protein_id gnl|my_center|LOCUS_18560 3771 3538 gene locus_tag LOCUS_18570 3771 3538 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_18570 3892 5310 gene locus_tag LOCUS_18580 gene pyk 3892 5310 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_18580 6824 6081 gene locus_tag LOCUS_18590 6824 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6924 8501 gene locus_tag LOCUS_18600 6924 8501 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_18600 11665 8510 gene locus_tag LOCUS_18610 11665 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 13466 11667 gene locus_tag LOCUS_18620 13466 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 14983 13463 gene locus_tag LOCUS_18630 14983 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 15737 14985 gene locus_tag LOCUS_18640 gene gldF 15737 14985 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_18640 16681 15734 gene locus_tag LOCUS_18650 16681 15734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_18650 16848 18374 gene locus_tag LOCUS_18660 16848 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 18821 18480 gene locus_tag LOCUS_18670 18821 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 19869 19165 gene locus_tag LOCUS_18680 19869 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 19984 21210 gene locus_tag LOCUS_18690 19984 21210 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 protein_id gnl|my_center|LOCUS_18690 22071 21493 gene locus_tag LOCUS_18700 22071 21493 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947373.1 protein_id gnl|my_center|LOCUS_18700 22861 22511 gene locus_tag LOCUS_18710 gene glnB 22861 22511 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420517.1 protein_id gnl|my_center|LOCUS_18710 23809 22898 gene locus_tag LOCUS_18720 gene ftsY 23809 22898 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_18720 24637 23813 gene locus_tag LOCUS_18730 24637 23813 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_18730 25134 24634 gene locus_tag LOCUS_18740 gene nusB 25134 24634 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_18740 25284 26675 gene locus_tag LOCUS_18750 25284 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 26733 27137 gene locus_tag LOCUS_18760 26733 27137 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_18760 27163 28062 gene locus_tag LOCUS_18770 27163 28062 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_18770 28906 28124 gene locus_tag LOCUS_18780 28906 28124 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_18780 30321 28903 gene locus_tag LOCUS_18790 30321 28903 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_18790 30233 30472 gene locus_tag LOCUS_18800 30233 30472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 31757 30447 gene locus_tag LOCUS_18810 gene tig 31757 30447 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_18810 31825 32559 gene locus_tag LOCUS_18820 gene bioD 31825 32559 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030919.1 protein_id gnl|my_center|LOCUS_18820 34534 32534 gene locus_tag LOCUS_18830 34534 32534 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_18830 34686 35411 gene locus_tag LOCUS_18840 gene tolQ 34686 35411 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_18840 35522 35929 gene locus_tag LOCUS_18850 35522 35929 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739842.1 protein_id gnl|my_center|LOCUS_18850 35926 36810 gene locus_tag LOCUS_18860 35926 36810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 36807 37994 gene locus_tag LOCUS_18870 gene tolB 36807 37994 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_18870 38055 38669 gene locus_tag LOCUS_18880 38055 38669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 39172 38939 gene locus_tag LOCUS_18890 39172 38939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 39614 39057 gene locus_tag LOCUS_18900 39614 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 39921 42110 gene locus_tag LOCUS_18910 39921 42110 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_18910 42181 42254 gene locus_tag LOCUS_t00170 42181 42254 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 336 893 gene locus_tag LOCUS_18920 336 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 925 2655 gene locus_tag LOCUS_18930 925 2655 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_18930 2662 3909 gene locus_tag LOCUS_18940 2662 3909 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_18940 3922 4356 gene locus_tag LOCUS_18950 gene gspG 3922 4356 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_18950 4334 4849 gene locus_tag LOCUS_18960 4334 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4950 5312 gene locus_tag LOCUS_18970 4950 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5318 6010 gene locus_tag LOCUS_18980 5318 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 6011 7357 gene locus_tag LOCUS_18990 6011 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 7354 8811 gene locus_tag LOCUS_19000 7354 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 8801 9337 gene locus_tag LOCUS_19010 8801 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 9334 9927 gene locus_tag LOCUS_19020 9334 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 9924 11333 gene locus_tag LOCUS_19030 9924 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 11367 12623 gene locus_tag LOCUS_19040 11367 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12666 14255 gene locus_tag LOCUS_19050 12666 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14450 14289 gene locus_tag LOCUS_19060 14450 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 15935 14478 gene locus_tag LOCUS_19070 15935 14478 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_19070 16298 15954 gene locus_tag LOCUS_19080 16298 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 16757 17710 gene locus_tag LOCUS_19090 16757 17710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_19090 17710 18462 gene locus_tag LOCUS_19100 17710 18462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_19100 18476 20386 gene locus_tag LOCUS_19110 18476 20386 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_19110 20383 21546 gene locus_tag LOCUS_19120 20383 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 22397 21573 gene locus_tag LOCUS_19130 22397 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 23494 22754 gene locus_tag LOCUS_19140 23494 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 24631 23789 gene locus_tag LOCUS_19150 24631 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 26361 24772 gene locus_tag LOCUS_19160 26361 24772 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178932430.1 protein_id gnl|my_center|LOCUS_19160 27273 26374 gene locus_tag LOCUS_19170 27273 26374 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_19170 28555 27287 gene locus_tag LOCUS_19180 28555 27287 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206388.1 protein_id gnl|my_center|LOCUS_19180 29940 28789 gene locus_tag LOCUS_19190 29940 28789 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037556.1 protein_id gnl|my_center|LOCUS_19190 30851 29919 gene locus_tag LOCUS_19200 30851 29919 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_19200 30947 31696 gene locus_tag LOCUS_19210 30947 31696 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921845.1 protein_id gnl|my_center|LOCUS_19210 32669 32752 gene locus_tag LOCUS_t00180 32669 32752 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33080 32805 gene locus_tag LOCUS_19220 33080 32805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 34188 33157 gene locus_tag LOCUS_19230 34188 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 34481 35161 gene locus_tag LOCUS_19240 34481 35161 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_19240 35613 35419 gene locus_tag LOCUS_19250 35613 35419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 36883 35744 gene locus_tag LOCUS_19260 36883 35744 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104251.1 protein_id gnl|my_center|LOCUS_19260 37133 37879 gene locus_tag LOCUS_19270 37133 37879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence035 655 581 gene locus_tag LOCUS_t00190 655 581 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2164 767 gene locus_tag LOCUS_19280 gene araE 2164 767 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_19280 3936 2161 gene locus_tag LOCUS_19290 3936 2161 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_19290 4886 3933 gene locus_tag LOCUS_19300 4886 3933 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_19300 6057 4909 gene locus_tag LOCUS_19310 6057 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 9437 6096 gene locus_tag LOCUS_19320 9437 6096 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_19320 10300 9569 gene locus_tag LOCUS_19330 10300 9569 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_19330 10615 12228 gene locus_tag LOCUS_19340 10615 12228 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_19340 12244 13527 gene locus_tag LOCUS_19350 12244 13527 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256342.1 protein_id gnl|my_center|LOCUS_19350 13607 14446 gene locus_tag LOCUS_19360 13607 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_19360 14468 16288 gene locus_tag LOCUS_19370 14468 16288 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_19370 16313 17065 gene locus_tag LOCUS_19380 16313 17065 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_19380 17916 17158 gene locus_tag LOCUS_19390 17916 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 17915 18112 gene locus_tag LOCUS_19400 17915 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 18148 18594 gene locus_tag LOCUS_19410 18148 18594 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_19410 19844 18657 gene locus_tag LOCUS_19420 19844 18657 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067043.1 protein_id gnl|my_center|LOCUS_19420 20915 19947 gene locus_tag LOCUS_19430 20915 19947 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_19430 21958 20930 gene locus_tag LOCUS_19440 21958 20930 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_19440 22138 24579 gene locus_tag LOCUS_19450 22138 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 24576 25769 gene locus_tag LOCUS_19460 24576 25769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 25775 26407 gene locus_tag LOCUS_19470 25775 26407 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 protein_id gnl|my_center|LOCUS_19470 26659 26450 gene locus_tag LOCUS_19480 26659 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 27324 26959 gene locus_tag LOCUS_19490 27324 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 28176 27367 gene locus_tag LOCUS_19500 gene panB 28176 27367 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_19500 29189 28173 gene locus_tag LOCUS_19510 gene rfaE1 29189 28173 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880334.1 protein_id gnl|my_center|LOCUS_19510 29886 29191 gene locus_tag LOCUS_19520 29886 29191 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912209.1 protein_id gnl|my_center|LOCUS_19520 30628 30167 gene locus_tag LOCUS_19530 30628 30167 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258016.1 protein_id gnl|my_center|LOCUS_19530 31131 30625 gene locus_tag LOCUS_19540 31131 30625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 32015 31329 gene locus_tag LOCUS_19550 32015 31329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 33403 32012 gene locus_tag LOCUS_19560 gene lutB 33403 32012 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_19560 33740 34192 gene locus_tag LOCUS_19570 33740 34192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 35541 34354 gene locus_tag LOCUS_19580 35541 34354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_19580 36449 37669 gene locus_tag LOCUS_19590 36449 37669 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_19590 37666 38655 gene locus_tag LOCUS_19600 37666 38655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 38652 39965 gene locus_tag LOCUS_19610 38652 39965 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_19610 40846 39986 gene locus_tag LOCUS_19620 40846 39986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 <42197 40874 gene locus_tag LOCUS_19630 <42197 40874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064152.1:ATP-dependent helicase >Feature sequence036 827 138 gene locus_tag LOCUS_19640 827 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1055 840 gene locus_tag LOCUS_19650 1055 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 13543 1418 gene locus_tag LOCUS_19660 13543 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 17754 13729 gene locus_tag LOCUS_19670 17754 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 18737 17874 gene locus_tag LOCUS_19680 18737 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 19843 18824 gene locus_tag LOCUS_19690 19843 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 20670 19849 gene locus_tag LOCUS_19700 20670 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 21520 20696 gene locus_tag LOCUS_19710 21520 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 22359 21655 gene locus_tag LOCUS_19720 22359 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 22645 22370 gene locus_tag LOCUS_19730 22645 22370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 23002 22721 gene locus_tag LOCUS_19740 23002 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 24432 23113 gene locus_tag LOCUS_19750 24432 23113 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_19750 26142 24439 gene locus_tag LOCUS_19760 26142 24439 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_19760 27260 26151 gene locus_tag LOCUS_19770 27260 26151 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_19770 28981 27272 gene locus_tag LOCUS_19780 28981 27272 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_19780 29841 29143 gene locus_tag LOCUS_19790 gene hisB 29841 29143 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551454.1 protein_id gnl|my_center|LOCUS_19790 30766 29906 gene locus_tag LOCUS_19800 30766 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 31545 30766 gene locus_tag LOCUS_19810 31545 30766 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_19810 32294 31542 gene locus_tag LOCUS_19820 32294 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 32801 32421 gene locus_tag LOCUS_19830 32801 32421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 33394 33014 gene locus_tag LOCUS_19840 33394 33014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 35170 33779 gene locus_tag LOCUS_19850 35170 33779 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_19850 36320 35325 gene locus_tag LOCUS_19860 36320 35325 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_19860 37320 36418 gene locus_tag LOCUS_19870 37320 36418 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022473.1 protein_id gnl|my_center|LOCUS_19870 39869 37362 gene locus_tag LOCUS_19880 39869 37362 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057914.1 protein_id gnl|my_center|LOCUS_19880 41529 40189 gene locus_tag LOCUS_19890 gene pgm 41529 40189 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence037 936 46 gene locus_tag LOCUS_19900 936 46 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156439539.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 1208 930 gene locus_tag LOCUS_19910 1208 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19910 1318 1821 gene locus_tag LOCUS_19920 1318 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2228 1839 gene locus_tag LOCUS_19930 2228 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2407 3036 gene locus_tag LOCUS_19940 2407 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3033 3338 gene locus_tag LOCUS_19950 3033 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3509 4426 gene locus_tag LOCUS_19960 3509 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4430 5821 gene locus_tag LOCUS_19970 gene creD 4430 5821 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_19970 5831 6565 gene locus_tag LOCUS_19980 5831 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6579 7265 gene locus_tag LOCUS_19990 6579 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7295 8014 gene locus_tag LOCUS_20000 7295 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 8067 8534 gene locus_tag LOCUS_20010 8067 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 8725 9948 gene locus_tag LOCUS_20020 8725 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 10059 10571 gene locus_tag LOCUS_20030 10059 10571 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_20030 10568 10996 gene locus_tag LOCUS_20040 10568 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 11079 12845 gene locus_tag LOCUS_20050 11079 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 12964 14445 gene locus_tag LOCUS_20060 gene gatB 12964 14445 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_20060 15383 14679 gene locus_tag LOCUS_20070 15383 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 15912 15391 gene locus_tag LOCUS_20080 15912 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 16724 15909 gene locus_tag LOCUS_20090 16724 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 16788 18116 gene locus_tag LOCUS_20100 16788 18116 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_20100 18231 19454 gene locus_tag LOCUS_20110 18231 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 19996 19451 gene locus_tag LOCUS_20120 19996 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 21501 20125 gene locus_tag LOCUS_20130 21501 20125 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_20130 21629 21889 gene locus_tag LOCUS_20140 21629 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 23071 22160 gene locus_tag LOCUS_20150 gene metF 23071 22160 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_20150 24005 23214 gene locus_tag LOCUS_20160 24005 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 25567 24083 gene locus_tag LOCUS_20170 25567 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 27290 26031 gene locus_tag LOCUS_20180 27290 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 27700 28911 gene locus_tag LOCUS_20190 27700 28911 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_20190 30556 29180 gene locus_tag LOCUS_20200 30556 29180 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_20200 32042 30807 gene locus_tag LOCUS_20210 gene purD 32042 30807 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_20210 32185 32397 gene locus_tag LOCUS_20220 32185 32397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 32394 33191 gene locus_tag LOCUS_20230 32394 33191 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 protein_id gnl|my_center|LOCUS_20230 33561 34433 gene locus_tag LOCUS_20240 33561 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 34735 34430 gene locus_tag LOCUS_20250 34735 34430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20250 35412 34732 gene locus_tag LOCUS_20260 35412 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20260 37924 35483 gene locus_tag LOCUS_20270 37924 35483 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362858.1 protein_id gnl|my_center|LOCUS_20270 38953 38054 gene locus_tag LOCUS_20280 38953 38054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 40333 39128 gene locus_tag LOCUS_20290 40333 39128 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258119.1 protein_id gnl|my_center|LOCUS_20290 40438 40513 gene locus_tag LOCUS_t00200 40438 40513 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 41089 40637 gene locus_tag LOCUS_20300 41089 40637 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence038 535 296 gene locus_tag LOCUS_20310 535 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1984 626 gene locus_tag LOCUS_20320 gene tyrS 1984 626 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_20320 3384 2059 gene locus_tag LOCUS_20330 3384 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7497 3397 gene locus_tag LOCUS_20340 7497 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7871 7494 gene locus_tag LOCUS_20350 7871 7494 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 protein_id gnl|my_center|LOCUS_20350 8005 8733 gene locus_tag LOCUS_20360 8005 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20360 8672 9526 gene locus_tag LOCUS_20370 8672 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20370 9617 11218 gene locus_tag LOCUS_20380 gene murJ 9617 11218 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_20380 12095 11223 gene locus_tag LOCUS_20390 gene ispE 12095 11223 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_20390 12598 12161 gene locus_tag LOCUS_20400 12598 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 13763 12669 gene locus_tag LOCUS_20410 13763 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 14042 13782 gene locus_tag LOCUS_20420 14042 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 15215 14109 gene locus_tag LOCUS_20430 gene leuB 15215 14109 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693328.1 protein_id gnl|my_center|LOCUS_20430 17454 15304 gene locus_tag LOCUS_20440 17454 15304 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_20440 17750 18508 gene locus_tag LOCUS_20450 17750 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 18509 19000 gene locus_tag LOCUS_20460 18509 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 18997 19491 gene locus_tag LOCUS_20470 gene tadA 18997 19491 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_20470 20730 19639 gene locus_tag LOCUS_20480 gene hydE 20730 19639 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_20480 22085 20727 gene locus_tag LOCUS_20490 gene hydF 22085 20727 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_20490 23611 22082 gene locus_tag LOCUS_20500 23611 22082 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939054.1 protein_id gnl|my_center|LOCUS_20500 25352 23943 gene locus_tag LOCUS_20510 gene hydG 25352 23943 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_20510 28632 25417 gene locus_tag LOCUS_20520 28632 25417 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813982.1 protein_id gnl|my_center|LOCUS_20520 29506 28778 gene locus_tag LOCUS_20530 29506 28778 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_20530 29762 30535 gene locus_tag LOCUS_20540 29762 30535 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_20540 32098 30572 gene locus_tag LOCUS_20550 32098 30572 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_20550 32687 32529 gene locus_tag LOCUS_20560 32687 32529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 32906 32709 gene locus_tag LOCUS_20570 32906 32709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 32830 36246 gene locus_tag LOCUS_20580 32830 36246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 37982 37815 gene locus_tag LOCUS_20590 37982 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 38003 39589 gene locus_tag LOCUS_20600 38003 39589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence039 932 1270 gene locus_tag LOCUS_20610 932 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1453 2469 gene locus_tag LOCUS_20620 gene hemH 1453 2469 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 protein_id gnl|my_center|LOCUS_20620 2707 2483 gene locus_tag LOCUS_20630 2707 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3369 2704 gene locus_tag LOCUS_20640 3369 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3905 3468 gene locus_tag LOCUS_20650 3905 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4543 3902 gene locus_tag LOCUS_20660 4543 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4655 5035 gene locus_tag LOCUS_20670 4655 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5187 5783 gene locus_tag LOCUS_20680 gene hpt 5187 5783 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_20680 5815 6123 gene locus_tag LOCUS_20690 5815 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 6098 9535 gene locus_tag LOCUS_20700 6098 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 9702 10163 gene locus_tag LOCUS_20710 9702 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 10250 11587 gene locus_tag LOCUS_20720 10250 11587 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_20720 11597 12364 gene locus_tag LOCUS_20730 gene lpxA 11597 12364 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_20730 12616 20361 gene locus_tag LOCUS_20740 12616 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 22529 20556 gene locus_tag LOCUS_20750 gene acs 22529 20556 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_20750 23629 22682 gene locus_tag LOCUS_20760 gene accD 23629 22682 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_20760 24391 23651 gene locus_tag LOCUS_20770 24391 23651 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_20770 24468 25301 gene locus_tag LOCUS_20780 24468 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 27972 25366 gene locus_tag LOCUS_20790 27972 25366 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_20790 28514 29047 gene locus_tag LOCUS_20800 gene hoxE 28514 29047 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_20800 29044 30678 gene locus_tag LOCUS_20810 29044 30678 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_20810 30682 31398 gene locus_tag LOCUS_20820 gene hoxU 30682 31398 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_20820 31386 31934 gene locus_tag LOCUS_20830 31386 31934 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_20830 31945 33369 gene locus_tag LOCUS_20840 31945 33369 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_20840 33449 33934 gene locus_tag LOCUS_20850 33449 33934 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_20850 34061 36412 gene locus_tag LOCUS_20860 gene hypF 34061 36412 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_20860 36416 36670 gene locus_tag LOCUS_20870 36416 36670 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_20870 36667 37776 gene locus_tag LOCUS_20880 gene hypD 36667 37776 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_20880 37776 38828 gene locus_tag LOCUS_20890 gene hypE 37776 38828 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_20890 <39720 38944 gene locus_tag LOCUS_20900 <39720 38944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393743.1:branched-chain-amino-acid transaminase >Feature sequence040 539 7072 gene locus_tag LOCUS_20910 539 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 7284 11255 gene locus_tag LOCUS_20920 7284 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 11356 11940 gene locus_tag LOCUS_20930 11356 11940 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_20930 12009 14309 gene locus_tag LOCUS_20940 12009 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 16343 14364 gene locus_tag LOCUS_20950 gene ast 16343 14364 CDS product thermostable cytotonic enterotoxin Ast inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704753.1 protein_id gnl|my_center|LOCUS_20950 18080 16644 gene locus_tag LOCUS_20960 18080 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 19634 18159 gene locus_tag LOCUS_20970 19634 18159 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_20970 21033 19669 gene locus_tag LOCUS_20980 21033 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 22839 21184 gene locus_tag LOCUS_20990 22839 21184 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118456.1 protein_id gnl|my_center|LOCUS_20990 24131 22980 gene locus_tag LOCUS_21000 24131 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 24477 25775 gene locus_tag LOCUS_21010 24477 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 26840 26421 gene locus_tag LOCUS_21020 26840 26421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21020 27442 27696 gene locus_tag LOCUS_21030 27442 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 28264 28013 gene locus_tag LOCUS_21040 28264 28013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 28502 28795 gene locus_tag LOCUS_21050 28502 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 28795 28971 gene locus_tag LOCUS_21060 28795 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 29265 29189 gene locus_tag LOCUS_t00210 29265 29189 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29526 29311 gene locus_tag LOCUS_21070 29526 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 31361 29523 gene locus_tag LOCUS_21080 31361 29523 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244120.1 protein_id gnl|my_center|LOCUS_21080 33150 31540 gene locus_tag LOCUS_21090 33150 31540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 33743 33147 gene locus_tag LOCUS_21100 33743 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 34016 33744 gene locus_tag LOCUS_21110 34016 33744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 34393 34013 gene locus_tag LOCUS_21120 34393 34013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 34614 34390 gene locus_tag LOCUS_21130 34614 34390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 35024 34611 gene locus_tag LOCUS_21140 35024 34611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015694.1 protein_id gnl|my_center|LOCUS_21140 35683 35099 gene locus_tag LOCUS_21150 35683 35099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 35810 35733 gene locus_tag LOCUS_t00220 35810 35733 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 36465 36019 gene locus_tag LOCUS_21160 36465 36019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 36736 36551 gene locus_tag LOCUS_21170 36736 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 38034 36733 gene locus_tag LOCUS_21180 38034 36733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 38276 38040 gene locus_tag LOCUS_21190 38276 38040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 38617 38279 gene locus_tag LOCUS_21200 38617 38279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 38817 38614 gene locus_tag LOCUS_21210 38817 38614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence041 325 1152 gene locus_tag LOCUS_21220 325 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2308 1190 gene locus_tag LOCUS_21230 gene bshA 2308 1190 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_21230 3048 2311 gene locus_tag LOCUS_21240 gene bshB1 3048 2311 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 protein_id gnl|my_center|LOCUS_21240 3796 3020 gene locus_tag LOCUS_21250 3796 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5511 3793 gene locus_tag LOCUS_21260 5511 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 8173 5654 gene locus_tag LOCUS_21270 8173 5654 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_21270 8946 8170 gene locus_tag LOCUS_21280 8946 8170 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_21280 9538 8993 gene locus_tag LOCUS_21290 9538 8993 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_21290 10484 9825 gene locus_tag LOCUS_21300 10484 9825 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_21300 14017 10487 gene locus_tag LOCUS_21310 14017 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 15038 15940 gene locus_tag LOCUS_21320 15038 15940 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_21320 16164 17105 gene locus_tag LOCUS_21330 16164 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 17293 18072 gene locus_tag LOCUS_21340 17293 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 18089 18490 gene locus_tag LOCUS_21350 18089 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 18567 21935 gene locus_tag LOCUS_21360 18567 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 22021 23358 gene locus_tag LOCUS_21370 22021 23358 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817242.1 protein_id gnl|my_center|LOCUS_21370 23355 24542 gene locus_tag LOCUS_21380 gene phnW 23355 24542 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 protein_id gnl|my_center|LOCUS_21380 24539 25927 gene locus_tag LOCUS_21390 24539 25927 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_21390 25924 26751 gene locus_tag LOCUS_21400 25924 26751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 26748 29480 gene locus_tag LOCUS_21410 26748 29480 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_21410 29450 30226 gene locus_tag LOCUS_21420 29450 30226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 31083 30355 gene locus_tag LOCUS_21430 31083 30355 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813012.1 protein_id gnl|my_center|LOCUS_21430 31213 31623 gene locus_tag LOCUS_21440 31213 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 31679 31754 gene locus_tag LOCUS_t00230 31679 31754 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32234 32614 gene locus_tag LOCUS_21450 32234 32614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 32611 32820 gene locus_tag LOCUS_21460 32611 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 33022 33213 gene locus_tag LOCUS_21470 33022 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 33219 33542 gene locus_tag LOCUS_21480 33219 33542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 33557 33769 gene locus_tag LOCUS_21490 33557 33769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 33783 33971 gene locus_tag LOCUS_21500 33783 33971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 33971 34294 gene locus_tag LOCUS_21510 33971 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 34298 34876 gene locus_tag LOCUS_21520 34298 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 34869 35516 gene locus_tag LOCUS_21530 34869 35516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 35513 35803 gene locus_tag LOCUS_21540 35513 35803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 35858 36118 gene locus_tag LOCUS_21550 35858 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 36087 36521 gene locus_tag LOCUS_21560 36087 36521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 37151 36498 gene locus_tag LOCUS_21570 37151 36498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 37729 37154 gene locus_tag LOCUS_21580 37729 37154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence042 2277 916 gene locus_tag LOCUS_21590 2277 916 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_21590 3598 3523 gene locus_tag LOCUS_t00240 3598 3523 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6348 3658 gene locus_tag LOCUS_21600 gene aceE 6348 3658 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_21600 6439 7161 gene locus_tag LOCUS_21610 6439 7161 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_21610 7761 7186 gene locus_tag LOCUS_21620 7761 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 9474 7819 gene locus_tag LOCUS_21630 gene recN 9474 7819 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_21630 11072 9678 gene locus_tag LOCUS_21640 gene gltA 11072 9678 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943682.1 protein_id gnl|my_center|LOCUS_21640 11982 11104 gene locus_tag LOCUS_21650 11982 11104 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943683.1 protein_id gnl|my_center|LOCUS_21650 12155 13294 gene locus_tag LOCUS_21660 gene gcvT 12155 13294 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_21660 13439 13816 gene locus_tag LOCUS_21670 13439 13816 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392492.1 protein_id gnl|my_center|LOCUS_21670 13835 14446 gene locus_tag LOCUS_21680 13835 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 14450 15112 gene locus_tag LOCUS_21690 14450 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 15109 16278 gene locus_tag LOCUS_21700 15109 16278 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_21700 16312 16686 gene locus_tag LOCUS_21710 16312 16686 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_21710 16836 17480 gene locus_tag LOCUS_21720 16836 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 17495 18745 gene locus_tag LOCUS_21730 gene nuoH 17495 18745 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_21730 18749 19267 gene locus_tag LOCUS_21740 18749 19267 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_21740 19264 19575 gene locus_tag LOCUS_21750 gene nuoK 19264 19575 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_21750 19572 21683 gene locus_tag LOCUS_21760 gene nuoL 19572 21683 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_21760 21680 23215 gene locus_tag LOCUS_21770 21680 23215 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_21770 23217 24719 gene locus_tag LOCUS_21780 23217 24719 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_21780 24716 26176 gene locus_tag LOCUS_21790 24716 26176 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257845.1 protein_id gnl|my_center|LOCUS_21790 26292 26675 gene locus_tag LOCUS_21800 gene gcvH 26292 26675 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_21800 26672 26914 gene locus_tag LOCUS_21810 26672 26914 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356779.1 protein_id gnl|my_center|LOCUS_21810 26981 27877 gene locus_tag LOCUS_21820 gene lipA 26981 27877 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_21820 28507 27887 gene locus_tag LOCUS_21830 28507 27887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 28620 29267 gene locus_tag LOCUS_21840 28620 29267 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_21840 29324 29752 gene locus_tag LOCUS_21850 29324 29752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 30221 30297 gene locus_tag LOCUS_t00250 30221 30297 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30367 31077 gene locus_tag LOCUS_21860 gene pgl 30367 31077 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_21860 32255 31086 gene locus_tag LOCUS_21870 32255 31086 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_21870 32181 32402 gene locus_tag LOCUS_21880 32181 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 34267 32456 gene locus_tag LOCUS_21890 34267 32456 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_21890 34785 35129 gene locus_tag LOCUS_21900 34785 35129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 35151 36110 gene locus_tag LOCUS_21910 35151 36110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence043 519 10 gene locus_tag LOCUS_21920 519 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 859 422 gene locus_tag LOCUS_21930 859 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2186 903 gene locus_tag LOCUS_21940 2186 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2485 4800 gene locus_tag LOCUS_21950 2485 4800 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_21950 5426 4794 gene locus_tag LOCUS_21960 5426 4794 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_21960 7113 5491 gene locus_tag LOCUS_21970 7113 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7380 8684 gene locus_tag LOCUS_21980 7380 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 8689 10914 gene locus_tag LOCUS_21990 8689 10914 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_21990 11194 12465 gene locus_tag LOCUS_22000 11194 12465 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_22000 12974 15139 gene locus_tag LOCUS_22010 12974 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 15218 15610 gene locus_tag LOCUS_22020 15218 15610 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_22020 15650 17617 gene locus_tag LOCUS_22030 15650 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 17622 19082 gene locus_tag LOCUS_22040 17622 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 19096 19716 gene locus_tag LOCUS_22050 19096 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 19738 19890 gene locus_tag LOCUS_22060 19738 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 19937 20155 gene locus_tag LOCUS_22070 19937 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 20152 20535 gene locus_tag LOCUS_22080 20152 20535 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_22080 20752 21921 gene locus_tag LOCUS_22090 20752 21921 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_22090 22167 24971 gene locus_tag LOCUS_22100 22167 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 25197 26429 gene locus_tag LOCUS_22110 25197 26429 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_22110 26562 27170 gene locus_tag LOCUS_22120 26562 27170 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_22120 29006 27384 gene locus_tag LOCUS_22130 29006 27384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 32293 29093 gene locus_tag LOCUS_22140 gene lacZ 32293 29093 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_22140 33818 32421 gene locus_tag LOCUS_22150 33818 32421 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_22150 34081 35151 gene locus_tag LOCUS_22160 34081 35151 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_22160 36925 35402 gene locus_tag LOCUS_22170 36925 35402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence044 822 2024 gene locus_tag LOCUS_22180 822 2024 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_22180 2049 2918 gene locus_tag LOCUS_22190 2049 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3990 2926 gene locus_tag LOCUS_22200 3990 2926 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_22200 4098 5111 gene locus_tag LOCUS_22210 4098 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5162 7051 gene locus_tag LOCUS_22220 5162 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 7344 8504 gene locus_tag LOCUS_22230 7344 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 8712 9146 gene locus_tag LOCUS_22240 gene purE 8712 9146 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258176.1 protein_id gnl|my_center|LOCUS_22240 9411 10379 gene locus_tag LOCUS_22250 9411 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 10390 11034 gene locus_tag LOCUS_22260 gene cynT 10390 11034 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658640.1 protein_id gnl|my_center|LOCUS_22260 11101 12927 gene locus_tag LOCUS_22270 11101 12927 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_22270 13045 13911 gene locus_tag LOCUS_22280 13045 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 14666 14238 gene locus_tag LOCUS_22290 14666 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 14746 15078 gene locus_tag LOCUS_22300 14746 15078 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479796.1 protein_id gnl|my_center|LOCUS_22300 15244 17439 gene locus_tag LOCUS_22310 gene katG 15244 17439 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_22310 17604 18467 gene locus_tag LOCUS_22320 17604 18467 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_22320 18486 19976 gene locus_tag LOCUS_22330 18486 19976 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_22330 19983 20279 gene locus_tag LOCUS_22340 gene yggU 19983 20279 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707385.1 protein_id gnl|my_center|LOCUS_22340 20563 22173 gene locus_tag LOCUS_22350 20563 22173 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123644.1 protein_id gnl|my_center|LOCUS_22350 22481 23017 gene locus_tag LOCUS_22360 22481 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 23118 24851 gene locus_tag LOCUS_22370 23118 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 26251 25280 gene locus_tag LOCUS_22380 26251 25280 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213957.1 protein_id gnl|my_center|LOCUS_22380 28067 26670 gene locus_tag LOCUS_22390 gene merA 28067 26670 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_22390 28167 28844 gene locus_tag LOCUS_22400 28167 28844 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_22400 28852 29277 gene locus_tag LOCUS_22410 28852 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 30730 29330 gene locus_tag LOCUS_22420 30730 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 31869 30787 gene locus_tag LOCUS_22430 gene aroC 31869 30787 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_22430 32036 32836 gene locus_tag LOCUS_22440 gene trpA 32036 32836 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_22440 33950 35920 gene locus_tag LOCUS_22450 33950 35920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 35925 36833 gene locus_tag LOCUS_22460 35925 36833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 37224 36862 gene locus_tag LOCUS_22470 37224 36862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence045 903 478 gene locus_tag LOCUS_22480 903 478 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_22480 1126 881 gene locus_tag LOCUS_22490 1126 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1356 1541 gene locus_tag LOCUS_22500 1356 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1667 1593 gene locus_tag LOCUS_t00260 1667 1593 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2640 1789 gene locus_tag LOCUS_22510 2640 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3102 2698 gene locus_tag LOCUS_22520 3102 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3382 5934 gene locus_tag LOCUS_22530 3382 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 6175 8136 gene locus_tag LOCUS_22540 6175 8136 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_22540 8273 10615 gene locus_tag LOCUS_22550 8273 10615 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108165.1 protein_id gnl|my_center|LOCUS_22550 10631 12829 gene locus_tag LOCUS_22560 10631 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_22560 13571 12957 gene locus_tag LOCUS_22570 13571 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 13872 13588 gene locus_tag LOCUS_22580 13872 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 13889 14722 gene locus_tag LOCUS_22590 13889 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 14917 15525 gene locus_tag LOCUS_22600 14917 15525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 16137 15535 gene locus_tag LOCUS_22610 16137 15535 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_22610 16589 18004 gene locus_tag LOCUS_22620 16589 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 18516 18022 gene locus_tag LOCUS_22630 18516 18022 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107226.1 protein_id gnl|my_center|LOCUS_22630 18635 20887 gene locus_tag LOCUS_22640 18635 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 21616 20891 gene locus_tag LOCUS_22650 21616 20891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_22650 22575 21835 gene locus_tag LOCUS_22660 22575 21835 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_22660 22929 22711 gene locus_tag LOCUS_22670 22929 22711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 24990 23026 gene locus_tag LOCUS_22680 24990 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 25447 26475 gene locus_tag LOCUS_22690 25447 26475 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_22690 26525 27328 gene locus_tag LOCUS_22700 26525 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 27414 27971 gene locus_tag LOCUS_22710 27414 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 28058 30067 gene locus_tag LOCUS_22720 gene mrdA 28058 30067 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530035.1 protein_id gnl|my_center|LOCUS_22720 30069 31277 gene locus_tag LOCUS_22730 gene rodA 30069 31277 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_22730 31282 33243 gene locus_tag LOCUS_22740 gene rng 31282 33243 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_22740 34806 33385 gene locus_tag LOCUS_22750 gene hpnH 34806 33385 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_22750 35064 35828 gene locus_tag LOCUS_22760 35064 35828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 35913 36497 gene locus_tag LOCUS_22770 35913 36497 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_22770 36843 36604 gene locus_tag LOCUS_22780 36843 36604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22780 >Feature sequence046 1 225 gene locus_tag LOCUS_22790 1 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 336 3992 gene locus_tag LOCUS_22800 336 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5051 4035 gene locus_tag LOCUS_22810 gene nadA 5051 4035 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_22810 5199 7439 gene locus_tag LOCUS_22820 5199 7439 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_22820 8578 7943 gene locus_tag LOCUS_22830 8578 7943 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_22830 8700 9812 gene locus_tag LOCUS_22840 8700 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 9833 10198 gene locus_tag LOCUS_22850 gene folB 9833 10198 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707547.1 protein_id gnl|my_center|LOCUS_22850 12648 10207 gene locus_tag LOCUS_22860 12648 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 13105 12650 gene locus_tag LOCUS_22870 13105 12650 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_22870 13230 14738 gene locus_tag LOCUS_22880 13230 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 14744 15484 gene locus_tag LOCUS_22890 gene pdxJ 14744 15484 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_22890 16149 15472 gene locus_tag LOCUS_22900 16149 15472 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_22900 17324 16182 gene locus_tag LOCUS_22910 17324 16182 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_22910 18493 17321 gene locus_tag LOCUS_22920 gene mutY 18493 17321 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_22920 18686 21625 gene locus_tag LOCUS_22930 18686 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 21670 22635 gene locus_tag LOCUS_22940 gene rnhC 21670 22635 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_22940 22696 24387 gene locus_tag LOCUS_22950 22696 24387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 24543 24881 gene locus_tag LOCUS_22960 24543 24881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 24943 25134 gene locus_tag LOCUS_22970 24943 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 25168 25998 gene locus_tag LOCUS_22980 25168 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 26612 25992 gene locus_tag LOCUS_22990 26612 25992 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_22990 28782 26650 gene locus_tag LOCUS_23000 28782 26650 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_23000 31079 28839 gene locus_tag LOCUS_23010 31079 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 31654 31082 gene locus_tag LOCUS_23020 31654 31082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 32154 31747 gene locus_tag LOCUS_23030 32154 31747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 32903 33580 gene locus_tag LOCUS_23040 32903 33580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 35555 34041 gene locus_tag LOCUS_23050 gene metG 35555 34041 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_23050 36240 35860 gene locus_tag LOCUS_23060 36240 35860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 36533 36958 gene locus_tag LOCUS_23070 36533 36958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence047 755 1453 gene locus_tag LOCUS_23080 755 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1756 1556 gene locus_tag LOCUS_23090 1756 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1695 3095 gene locus_tag LOCUS_23100 1695 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3082 3789 gene locus_tag LOCUS_23110 gene casR 3082 3789 CDS product two-component system response regulator CasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694623.1 protein_id gnl|my_center|LOCUS_23110 4807 3890 gene locus_tag LOCUS_23120 4807 3890 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_23120 4980 5876 gene locus_tag LOCUS_23130 4980 5876 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 protein_id gnl|my_center|LOCUS_23130 7705 6533 gene locus_tag LOCUS_23140 7705 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7908 7708 gene locus_tag LOCUS_23150 7908 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 8549 8175 gene locus_tag LOCUS_23160 gene rplS 8549 8175 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_23160 9238 8561 gene locus_tag LOCUS_23170 gene trmD 9238 8561 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_23170 9493 9248 gene locus_tag LOCUS_23180 9493 9248 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_23180 9764 9507 gene locus_tag LOCUS_23190 gene rpsP 9764 9507 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_23190 9877 10347 gene locus_tag LOCUS_23200 9877 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 10430 10771 gene locus_tag LOCUS_23210 10430 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 11569 10814 gene locus_tag LOCUS_23220 11569 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 11726 12613 gene locus_tag LOCUS_23230 11726 12613 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_23230 12635 13204 gene locus_tag LOCUS_23240 gene def 12635 13204 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_23240 14347 13295 gene locus_tag LOCUS_23250 14347 13295 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392175.1 protein_id gnl|my_center|LOCUS_23250 14659 15075 gene locus_tag LOCUS_23260 14659 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 15056 15901 gene locus_tag LOCUS_23270 gene prpC 15056 15901 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_23270 17399 15960 gene locus_tag LOCUS_23280 17399 15960 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_23280 17771 17433 gene locus_tag LOCUS_23290 17771 17433 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_23290 18261 18121 gene locus_tag LOCUS_23300 18261 18121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 18733 18356 gene locus_tag LOCUS_23310 18733 18356 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_23310 19157 18795 gene locus_tag LOCUS_23320 gene queD 19157 18795 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167265.1 protein_id gnl|my_center|LOCUS_23320 20574 19222 gene locus_tag LOCUS_23330 20574 19222 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057589.1 protein_id gnl|my_center|LOCUS_23330 21700 20567 gene locus_tag LOCUS_23340 21700 20567 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_23340 22741 21803 gene locus_tag LOCUS_23350 22741 21803 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_23350 23306 22785 gene locus_tag LOCUS_23360 23306 22785 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_23360 23707 24594 gene locus_tag LOCUS_23370 23707 24594 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_23370 31818 24973 gene locus_tag LOCUS_23380 31818 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 31763 32035 gene locus_tag LOCUS_23390 31763 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 32060 32263 gene locus_tag LOCUS_23400 32060 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 32393 32602 gene locus_tag LOCUS_23410 32393 32602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 34112 34315 gene locus_tag LOCUS_23420 34112 34315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence048 2499 1582 gene locus_tag LOCUS_23430 2499 1582 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_23430 2776 2639 gene locus_tag LOCUS_23440 2776 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3143 2856 gene locus_tag LOCUS_23450 3143 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3862 3254 gene locus_tag LOCUS_23460 3862 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123417.1 protein_id gnl|my_center|LOCUS_23460 4093 3914 gene locus_tag LOCUS_23470 4093 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 4752 4141 gene locus_tag LOCUS_23480 4752 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 5702 4749 gene locus_tag LOCUS_23490 5702 4749 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_23490 7067 5718 gene locus_tag LOCUS_23500 7067 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 7257 7451 gene locus_tag LOCUS_23510 7257 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 8991 7456 gene locus_tag LOCUS_23520 gene bioA 8991 7456 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_23520 10177 8993 gene locus_tag LOCUS_23530 gene bioF 10177 8993 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_23530 11484 10237 gene locus_tag LOCUS_23540 11484 10237 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_23540 11834 11487 gene locus_tag LOCUS_23550 gene raiA 11834 11487 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_23550 11955 13457 gene locus_tag LOCUS_23560 gene rpoN 11955 13457 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_23560 14570 13461 gene locus_tag LOCUS_23570 gene dusB 14570 13461 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_23570 14637 16697 gene locus_tag LOCUS_23580 gene ftsH 14637 16697 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709279.1 protein_id gnl|my_center|LOCUS_23580 17260 16766 gene locus_tag LOCUS_23590 17260 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 18431 17295 gene locus_tag LOCUS_23600 gene holA 18431 17295 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_23600 18891 18433 gene locus_tag LOCUS_23610 18891 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 19202 20149 gene locus_tag LOCUS_23620 19202 20149 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217731.1 protein_id gnl|my_center|LOCUS_23620 24114 20167 gene locus_tag LOCUS_23630 gene metH 24114 20167 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_23630 22928 23025 gene locus_tag LOCUS_t00270 22928 23025 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24312 24743 gene locus_tag LOCUS_23640 24312 24743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 24740 25651 gene locus_tag LOCUS_23650 24740 25651 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_23650 25799 26167 gene locus_tag LOCUS_23660 25799 26167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 27928 26657 gene locus_tag LOCUS_23670 gene pfp 27928 26657 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_23670 28055 28600 gene locus_tag LOCUS_23680 gene gmhB 28055 28600 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_23680 28604 30460 gene locus_tag LOCUS_23690 gene glmS 28604 30460 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_23690 31177 30464 gene locus_tag LOCUS_23700 31177 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 31226 32578 gene locus_tag LOCUS_23710 31226 32578 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_23710 32844 33581 gene locus_tag LOCUS_23720 32844 33581 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_23720 33599 34393 gene locus_tag LOCUS_23730 33599 34393 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_23730 34743 34291 gene locus_tag LOCUS_23740 34743 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 <36452 34743 gene locus_tag LOCUS_23750 <36452 34743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437464.1:DEAD/DEAH box helicase >Feature sequence049 143 949 gene locus_tag LOCUS_23760 143 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1743 997 gene locus_tag LOCUS_23770 gene lptB 1743 997 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_23770 2285 1740 gene locus_tag LOCUS_23780 2285 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2743 2282 gene locus_tag LOCUS_23790 2743 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3282 2740 gene locus_tag LOCUS_23800 3282 2740 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_23800 4099 3284 gene locus_tag LOCUS_23810 gene kdsA 4099 3284 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065134.1 protein_id gnl|my_center|LOCUS_23810 4261 6489 gene locus_tag LOCUS_23820 4261 6489 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_23820 6502 9891 gene locus_tag LOCUS_23830 gene treS 6502 9891 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_23830 9907 11337 gene locus_tag LOCUS_23840 9907 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 11532 11903 gene locus_tag LOCUS_23850 11532 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 11931 13148 gene locus_tag LOCUS_23860 11931 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 13173 14132 gene locus_tag LOCUS_23870 13173 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 14160 15632 gene locus_tag LOCUS_23880 14160 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_23880 15636 16052 gene locus_tag LOCUS_23890 15636 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 16073 16663 gene locus_tag LOCUS_23900 16073 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 16761 16847 gene locus_tag LOCUS_t00280 16761 16847 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16861 17886 gene locus_tag LOCUS_23910 gene holB 16861 17886 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_23910 17891 19282 gene locus_tag LOCUS_23920 17891 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 19293 19724 gene locus_tag LOCUS_23930 gene aroQ 19293 19724 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533076.1 protein_id gnl|my_center|LOCUS_23930 19915 20391 gene locus_tag LOCUS_23940 gene accB 19915 20391 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_23940 20431 21813 gene locus_tag LOCUS_23950 gene accC 20431 21813 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_23950 21976 22299 gene locus_tag LOCUS_23960 21976 22299 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_23960 22406 22870 gene locus_tag LOCUS_23970 22406 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 22874 23206 gene locus_tag LOCUS_23980 gene trxA 22874 23206 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_23980 23282 24430 gene locus_tag LOCUS_23990 23282 24430 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_23990 26574 24427 gene locus_tag LOCUS_24000 26574 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 27211 26567 gene locus_tag LOCUS_24010 27211 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 28770 27196 gene locus_tag LOCUS_24020 28770 27196 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_24020 29025 32348 gene locus_tag LOCUS_24030 29025 32348 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_24030 32361 33092 gene locus_tag LOCUS_24040 32361 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 33096 33251 gene locus_tag LOCUS_24050 33096 33251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 33274 33861 gene locus_tag LOCUS_24060 33274 33861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 35059 33920 gene locus_tag LOCUS_24070 35059 33920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_24070 35238 35705 gene locus_tag LOCUS_24080 35238 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence050 756 1541 gene locus_tag LOCUS_24090 gene kduI 756 1541 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_24090 1548 2321 gene locus_tag LOCUS_24100 gene kduD 1548 2321 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_24100 2390 4711 gene locus_tag LOCUS_24110 2390 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 4749 5144 gene locus_tag LOCUS_24120 4749 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 5791 5150 gene locus_tag LOCUS_24130 5791 5150 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416953.1 protein_id gnl|my_center|LOCUS_24130 5882 6274 gene locus_tag LOCUS_24140 5882 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 6341 8860 gene locus_tag LOCUS_24150 6341 8860 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_24150 8944 9825 gene locus_tag LOCUS_24160 gene rfbA 8944 9825 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_24160 9827 10774 gene locus_tag LOCUS_24170 gene rfbD 9827 10774 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380528.1 protein_id gnl|my_center|LOCUS_24170 10785 11795 gene locus_tag LOCUS_24180 gene rfbB 10785 11795 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186461.1 protein_id gnl|my_center|LOCUS_24180 11835 13184 gene locus_tag LOCUS_24190 11835 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 13498 13238 gene locus_tag LOCUS_24200 13498 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 13497 14624 gene locus_tag LOCUS_24210 13497 14624 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_24210 14767 15678 gene locus_tag LOCUS_24220 gene mgrA 14767 15678 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_24220 15743 16189 gene locus_tag LOCUS_24230 15743 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 18888 16210 gene locus_tag LOCUS_24240 18888 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 20272 19058 gene locus_tag LOCUS_24250 20272 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 22423 20375 gene locus_tag LOCUS_24260 22423 20375 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 protein_id gnl|my_center|LOCUS_24260 24213 22468 gene locus_tag LOCUS_24270 24213 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 24525 24259 gene locus_tag LOCUS_24280 gene rpsT 24525 24259 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_24280 24694 27825 gene locus_tag LOCUS_24290 24694 27825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 27856 28551 gene locus_tag LOCUS_24300 gene rpe 27856 28551 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_24300 28548 29972 gene locus_tag LOCUS_24310 28548 29972 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165438786.1 protein_id gnl|my_center|LOCUS_24310 30162 31175 gene locus_tag LOCUS_24320 30162 31175 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_24320 33145 31658 gene locus_tag LOCUS_24330 gene gnd 33145 31658 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 protein_id gnl|my_center|LOCUS_24330 34124 33312 gene locus_tag LOCUS_24340 34124 33312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24340 34642 34133 gene locus_tag LOCUS_24350 34642 34133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24350 35083 34748 gene locus_tag LOCUS_24360 35083 34748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 <35814 34999 gene locus_tag LOCUS_24370 <35814 34999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000608644.1:IS1380-like element ISEcp1 family transposase note possible pseudo, frameshifted >Feature sequence051 1554 844 gene locus_tag LOCUS_24380 1554 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2112 1636 gene locus_tag LOCUS_24390 2112 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2250 2177 gene locus_tag LOCUS_t00290 2250 2177 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5146 2333 gene locus_tag LOCUS_24400 gene glnD 5146 2333 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_24400 5792 5196 gene locus_tag LOCUS_24410 gene folA 5792 5196 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261097.1 protein_id gnl|my_center|LOCUS_24410 7243 5834 gene locus_tag LOCUS_24420 7243 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 8277 7390 gene locus_tag LOCUS_24430 8277 7390 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_24430 8746 8342 gene locus_tag LOCUS_24440 8746 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 10070 8805 gene locus_tag LOCUS_24450 10070 8805 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275469.1 protein_id gnl|my_center|LOCUS_24450 10162 11364 gene locus_tag LOCUS_24460 gene thiH 10162 11364 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_24460 11368 12441 gene locus_tag LOCUS_24470 11368 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 13556 12438 gene locus_tag LOCUS_24480 13556 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 14949 13675 gene locus_tag LOCUS_24490 14949 13675 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_24490 15041 15760 gene locus_tag LOCUS_24500 15041 15760 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393990.1 protein_id gnl|my_center|LOCUS_24500 16051 16794 gene locus_tag LOCUS_24510 16051 16794 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459695.1 protein_id gnl|my_center|LOCUS_24510 16760 17404 gene locus_tag LOCUS_24520 gene coaB 16760 17404 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282564.1 protein_id gnl|my_center|LOCUS_24520 19150 17435 gene locus_tag LOCUS_24530 19150 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 19245 20717 gene locus_tag LOCUS_24540 19245 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_24540 20906 21439 gene locus_tag LOCUS_24550 20906 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 21489 21917 gene locus_tag LOCUS_24560 21489 21917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 21914 23101 gene locus_tag LOCUS_24570 gene ribD 21914 23101 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_24570 23214 23510 gene locus_tag LOCUS_24580 23214 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 23886 27344 gene locus_tag LOCUS_24590 23886 27344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 27477 29534 gene locus_tag LOCUS_24600 27477 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 29852 31906 gene locus_tag LOCUS_24610 29852 31906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108528.1 protein_id gnl|my_center|LOCUS_24610 31927 33945 gene locus_tag LOCUS_24620 31927 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 34112 35464 gene locus_tag LOCUS_24630 34112 35464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence052 816 3161 gene locus_tag LOCUS_24640 816 3161 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_24640 3337 5361 gene locus_tag LOCUS_24650 3337 5361 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_24650 5581 7431 gene locus_tag LOCUS_24660 5581 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 7918 12021 gene locus_tag LOCUS_24670 7918 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 12537 12148 gene locus_tag LOCUS_24680 12537 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 14609 12555 gene locus_tag LOCUS_24690 14609 12555 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_24690 17600 14661 gene locus_tag LOCUS_24700 17600 14661 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_24700 17881 18666 gene locus_tag LOCUS_24710 17881 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 18699 20009 gene locus_tag LOCUS_24720 18699 20009 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_24720 20023 22734 gene locus_tag LOCUS_24730 gene galB 20023 22734 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039185.1 protein_id gnl|my_center|LOCUS_24730 22843 24156 gene locus_tag LOCUS_24740 gene xylA 22843 24156 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_24740 24333 24701 gene locus_tag LOCUS_24750 24333 24701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 24688 24891 gene locus_tag LOCUS_24760 24688 24891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 25326 24931 gene locus_tag LOCUS_24770 25326 24931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 26004 30173 gene locus_tag LOCUS_24780 26004 30173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 30600 30974 gene locus_tag LOCUS_24790 30600 30974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 31132 32367 gene locus_tag LOCUS_24800 31132 32367 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_24800 32376 33311 gene locus_tag LOCUS_24810 32376 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence053 2671 104 gene locus_tag LOCUS_24820 2671 104 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117213798.1 protein_id gnl|my_center|LOCUS_24820 2937 4226 gene locus_tag LOCUS_24830 gene eno 2937 4226 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123706.1 protein_id gnl|my_center|LOCUS_24830 4568 4398 gene locus_tag LOCUS_24840 4568 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4697 4831 gene locus_tag LOCUS_24850 4697 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 5247 4828 gene locus_tag LOCUS_24860 5247 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5519 5244 gene locus_tag LOCUS_24870 5519 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5859 5984 gene locus_tag LOCUS_24880 5859 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7627 6254 gene locus_tag LOCUS_24890 7627 6254 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_24890 8687 7743 gene locus_tag LOCUS_24900 8687 7743 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_24900 9269 9616 gene locus_tag LOCUS_24910 9269 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 9742 11151 gene locus_tag LOCUS_24920 9742 11151 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_24920 11357 11920 gene locus_tag LOCUS_24930 11357 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 12114 13157 gene locus_tag LOCUS_24940 12114 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 13169 14647 gene locus_tag LOCUS_24950 13169 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 14651 16792 gene locus_tag LOCUS_24960 14651 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 18298 16811 gene locus_tag LOCUS_24970 18298 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 19067 18393 gene locus_tag LOCUS_24980 19067 18393 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_24980 19432 19070 gene locus_tag LOCUS_24990 19432 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 19397 19648 gene locus_tag LOCUS_25000 19397 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 20059 20265 gene locus_tag LOCUS_25010 20059 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 20708 21409 gene locus_tag LOCUS_25020 20708 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 21451 22827 gene locus_tag LOCUS_25030 21451 22827 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_25030 22861 23301 gene locus_tag LOCUS_25040 22861 23301 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883561.1 protein_id gnl|my_center|LOCUS_25040 24126 23410 gene locus_tag LOCUS_25050 gene scpB 24126 23410 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_25050 25118 24135 gene locus_tag LOCUS_25060 25118 24135 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_25060 25210 25587 gene locus_tag LOCUS_25070 25210 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 25587 26504 gene locus_tag LOCUS_25080 25587 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 26562 26924 gene locus_tag LOCUS_25090 26562 26924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_25090 27288 27070 gene locus_tag LOCUS_25100 27288 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 27374 30460 gene locus_tag LOCUS_25110 27374 30460 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_25110 31961 30831 gene locus_tag LOCUS_25120 31961 30831 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence054 2722 2279 gene locus_tag LOCUS_25130 2722 2279 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_25130 5364 2719 gene locus_tag LOCUS_25140 5364 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 5749 5381 gene locus_tag LOCUS_25150 5749 5381 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_25150 6093 6560 gene locus_tag LOCUS_25160 6093 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 9433 6611 gene locus_tag LOCUS_25170 9433 6611 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_25170 10929 9505 gene locus_tag LOCUS_25180 10929 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 11106 11633 gene locus_tag LOCUS_25190 11106 11633 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_25190 11665 12066 gene locus_tag LOCUS_25200 11665 12066 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_25200 13618 12140 gene locus_tag LOCUS_25210 gene cls 13618 12140 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_25210 14703 13663 gene locus_tag LOCUS_25220 gene queG 14703 13663 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968507.1 protein_id gnl|my_center|LOCUS_25220 15233 14700 gene locus_tag LOCUS_25230 15233 14700 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_25230 15318 15890 gene locus_tag LOCUS_25240 15318 15890 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_25240 16055 16864 gene locus_tag LOCUS_25250 16055 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 16900 17937 gene locus_tag LOCUS_25260 16900 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 19054 17909 gene locus_tag LOCUS_25270 gene rlmN 19054 17909 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460524.1 protein_id gnl|my_center|LOCUS_25270 19579 19160 gene locus_tag LOCUS_25280 19579 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 20511 19576 gene locus_tag LOCUS_25290 20511 19576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 21417 20611 gene locus_tag LOCUS_25300 21417 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 22478 21468 gene locus_tag LOCUS_25310 22478 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 23004 22480 gene locus_tag LOCUS_25320 23004 22480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 23452 25155 gene locus_tag LOCUS_25330 23452 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 25739 25179 gene locus_tag LOCUS_25340 25739 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 26950 25736 gene locus_tag LOCUS_25350 26950 25736 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_25350 27384 27034 gene locus_tag LOCUS_25360 27384 27034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 27787 28599 gene locus_tag LOCUS_25370 27787 28599 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_25370 29282 29938 gene locus_tag LOCUS_25380 29282 29938 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668950.1 protein_id gnl|my_center|LOCUS_25380 30073 31812 gene locus_tag LOCUS_25390 gene fliD 30073 31812 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080294.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence055 356 42 gene locus_tag LOCUS_25400 356 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 535 281 gene locus_tag LOCUS_25410 535 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1079 552 gene locus_tag LOCUS_25420 1079 552 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_25420 1493 1089 gene locus_tag LOCUS_25430 1493 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3061 1622 gene locus_tag LOCUS_25440 3061 1622 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_25440 4582 3083 gene locus_tag LOCUS_25450 4582 3083 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_25450 4676 5437 gene locus_tag LOCUS_25460 4676 5437 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_25460 5527 6408 gene locus_tag LOCUS_25470 gene argB 5527 6408 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_25470 6989 6519 gene locus_tag LOCUS_25480 6989 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 8873 8631 gene locus_tag LOCUS_25490 8873 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 9693 8887 gene locus_tag LOCUS_25500 9693 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 9774 11057 gene locus_tag LOCUS_25510 9774 11057 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928539.1 protein_id gnl|my_center|LOCUS_25510 11064 11684 gene locus_tag LOCUS_25520 11064 11684 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064359.1 protein_id gnl|my_center|LOCUS_25520 11790 12935 gene locus_tag LOCUS_25530 gene moeB 11790 12935 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_25530 13333 13172 gene locus_tag LOCUS_25540 13333 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 13709 13296 gene locus_tag LOCUS_25550 13709 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 13927 13706 gene locus_tag LOCUS_25560 13927 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 13918 15114 gene locus_tag LOCUS_25570 13918 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 15165 15449 gene locus_tag LOCUS_25580 15165 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 15446 15718 gene locus_tag LOCUS_25590 15446 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 16288 15800 gene locus_tag LOCUS_25600 16288 15800 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_25600 16551 16285 gene locus_tag LOCUS_25610 16551 16285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 19688 16614 gene locus_tag LOCUS_25620 19688 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 19971 20372 gene locus_tag LOCUS_25630 19971 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 20788 20991 gene locus_tag LOCUS_25640 20788 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 20988 22280 gene locus_tag LOCUS_25650 20988 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 22299 22223 gene locus_tag LOCUS_t00300 22299 22223 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22737 24731 gene locus_tag LOCUS_25660 gene mutL 22737 24731 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929705.1 protein_id gnl|my_center|LOCUS_25660 25055 25681 gene locus_tag LOCUS_25670 25055 25681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 25687 26391 gene locus_tag LOCUS_25680 gene rnc 25687 26391 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_25680 26447 31690 gene locus_tag LOCUS_25690 26447 31690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence056 1633 2589 gene locus_tag LOCUS_25700 1633 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2586 3920 gene locus_tag LOCUS_25710 2586 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3917 4579 gene locus_tag LOCUS_25720 3917 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 4874 5359 gene locus_tag LOCUS_25730 4874 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 5440 6060 gene locus_tag LOCUS_25740 5440 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 6014 6526 gene locus_tag LOCUS_25750 6014 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 6523 7041 gene locus_tag LOCUS_25760 6523 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6939 7844 gene locus_tag LOCUS_25770 6939 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 8069 8488 gene locus_tag LOCUS_25780 8069 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 10967 8904 gene locus_tag LOCUS_25790 10967 8904 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_25790 11053 11769 gene locus_tag LOCUS_25800 11053 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 11766 12716 gene locus_tag LOCUS_25810 gene thiL 11766 12716 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_25810 12767 13210 gene locus_tag LOCUS_25820 12767 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 13191 13820 gene locus_tag LOCUS_25830 gene tsaB 13191 13820 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262633.1 protein_id gnl|my_center|LOCUS_25830 14210 13842 gene locus_tag LOCUS_25840 14210 13842 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494334.1 protein_id gnl|my_center|LOCUS_25840 14767 14207 gene locus_tag LOCUS_25850 14767 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 14866 15732 gene locus_tag LOCUS_25860 14866 15732 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392660.1 protein_id gnl|my_center|LOCUS_25860 15753 16601 gene locus_tag LOCUS_25870 15753 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 16651 17523 gene locus_tag LOCUS_25880 gene prmC 16651 17523 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_25880 17564 18823 gene locus_tag LOCUS_25890 gene murA 17564 18823 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411265.1 protein_id gnl|my_center|LOCUS_25890 18946 19794 gene locus_tag LOCUS_25900 18946 19794 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_25900 19791 20477 gene locus_tag LOCUS_25910 19791 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 20479 21570 gene locus_tag LOCUS_25920 20479 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 22146 21808 gene locus_tag LOCUS_25930 22146 21808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 22445 23452 gene locus_tag LOCUS_25940 22445 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 25324 23465 gene locus_tag LOCUS_25950 25324 23465 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_25950 25894 25343 gene locus_tag LOCUS_25960 25894 25343 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190418.1 protein_id gnl|my_center|LOCUS_25960 26300 25914 gene locus_tag LOCUS_25970 26300 25914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 26498 26316 gene locus_tag LOCUS_25980 26498 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 27293 26583 gene locus_tag LOCUS_25990 27293 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 27642 28997 gene locus_tag LOCUS_26000 27642 28997 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804912.1 protein_id gnl|my_center|LOCUS_26000 29073 30155 gene locus_tag LOCUS_26010 gene rsgA 29073 30155 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_26010 30171 30344 gene locus_tag LOCUS_26020 30171 30344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence057 3019 356 gene locus_tag LOCUS_26030 3019 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 4247 3345 gene locus_tag LOCUS_26040 4247 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 6569 4803 gene locus_tag LOCUS_26050 6569 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 7043 6579 gene locus_tag LOCUS_26060 7043 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 7594 7046 gene locus_tag LOCUS_26070 7594 7046 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_26070 9107 7932 gene locus_tag LOCUS_26080 9107 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 9860 9201 gene locus_tag LOCUS_26090 9860 9201 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_26090 10142 11524 gene locus_tag LOCUS_26100 10142 11524 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_26100 12452 11544 gene locus_tag LOCUS_26110 12452 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 12381 12587 gene locus_tag LOCUS_26120 12381 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 12666 14381 gene locus_tag LOCUS_26130 12666 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 14438 15106 gene locus_tag LOCUS_26140 14438 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 15124 16944 gene locus_tag LOCUS_26150 gene dnaG 15124 16944 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_26150 17410 17000 gene locus_tag LOCUS_26160 17410 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 17519 18385 gene locus_tag LOCUS_26170 17519 18385 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_26170 18429 19508 gene locus_tag LOCUS_26180 18429 19508 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_26180 19508 20278 gene locus_tag LOCUS_26190 19508 20278 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925727.1 protein_id gnl|my_center|LOCUS_26190 20324 21076 gene locus_tag LOCUS_26200 20324 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 21632 21108 gene locus_tag LOCUS_26210 21632 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26210 21960 21658 gene locus_tag LOCUS_26220 21960 21658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26220 24922 21995 gene locus_tag LOCUS_26230 24922 21995 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_26230 25049 25534 gene locus_tag LOCUS_26240 gene rfaE2 25049 25534 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_26240 25550 26653 gene locus_tag LOCUS_26250 25550 26653 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_26250 27425 26703 gene locus_tag LOCUS_26260 27425 26703 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674084.1 protein_id gnl|my_center|LOCUS_26260 27984 27430 gene locus_tag LOCUS_26270 27984 27430 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957728.1 protein_id gnl|my_center|LOCUS_26270 28498 27986 gene locus_tag LOCUS_26280 28498 27986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 29254 28658 gene locus_tag LOCUS_26290 29254 28658 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_26290 30098 29382 gene locus_tag LOCUS_26300 gene hddC 30098 29382 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence058 2387 3568 gene locus_tag LOCUS_26310 2387 3568 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_26310 4495 3584 gene locus_tag LOCUS_26320 4495 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 5721 4615 gene locus_tag LOCUS_26330 gene ydiK 5721 4615 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_26330 6877 6635 gene locus_tag LOCUS_26340 6877 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 7436 6849 gene locus_tag LOCUS_26350 7436 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 9860 7479 gene locus_tag LOCUS_26360 9860 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 11653 9926 gene locus_tag LOCUS_26370 11653 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 11825 12793 gene locus_tag LOCUS_26380 11825 12793 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_26380 14135 12801 gene locus_tag LOCUS_26390 gene purB 14135 12801 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_26390 15143 14208 gene locus_tag LOCUS_26400 15143 14208 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_26400 16137 15193 gene locus_tag LOCUS_26410 16137 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 16794 16210 gene locus_tag LOCUS_26420 16794 16210 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_26420 17543 16866 gene locus_tag LOCUS_26430 gene lolD 17543 16866 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_26430 18810 17536 gene locus_tag LOCUS_26440 18810 17536 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_26440 19214 18927 gene locus_tag LOCUS_26450 19214 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 19693 20622 gene locus_tag LOCUS_26460 gene trxB 19693 20622 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_26460 21006 21911 gene locus_tag LOCUS_26470 21006 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 21959 22579 gene locus_tag LOCUS_26480 gene hisH 21959 22579 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_26480 23150 22764 gene locus_tag LOCUS_26490 23150 22764 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_26490 24270 23395 gene locus_tag LOCUS_26500 gene hisG 24270 23395 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_26500 24924 24400 gene locus_tag LOCUS_26510 24924 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 25544 24921 gene locus_tag LOCUS_26520 gene purN 25544 24921 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_26520 25974 25693 gene locus_tag LOCUS_26530 gene rplW 25974 25693 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_26530 26606 25977 gene locus_tag LOCUS_26540 gene rplD 26606 25977 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546805.1 protein_id gnl|my_center|LOCUS_26540 27323 26616 gene locus_tag LOCUS_26550 gene rplC 27323 26616 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_26550 27639 27334 gene locus_tag LOCUS_26560 gene rpsJ 27639 27334 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_26560 28315 28677 gene locus_tag LOCUS_26570 28315 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 <30200 29034 gene locus_tag LOCUS_26580 <30200 29034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000090370.1:elongation factor G >Feature sequence059 1425 400 gene locus_tag LOCUS_26590 1425 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2681 1647 gene locus_tag LOCUS_26600 gene hemA 2681 1647 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_26600 3610 2789 gene locus_tag LOCUS_26610 3610 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 4599 3703 gene locus_tag LOCUS_26620 4599 3703 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258970.1 protein_id gnl|my_center|LOCUS_26620 5573 4596 gene locus_tag LOCUS_26630 5573 4596 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258969.1 protein_id gnl|my_center|LOCUS_26630 6406 5669 gene locus_tag LOCUS_26640 6406 5669 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_26640 7090 6515 gene locus_tag LOCUS_26650 7090 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 7444 7599 gene locus_tag LOCUS_26660 7444 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 7689 8399 gene locus_tag LOCUS_26670 7689 8399 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_26670 8414 9589 gene locus_tag LOCUS_26680 8414 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 9669 10463 gene locus_tag LOCUS_26690 gene folD 9669 10463 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_26690 10570 11004 gene locus_tag LOCUS_26700 10570 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 13503 11383 gene locus_tag LOCUS_26710 13503 11383 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_26710 14416 13532 gene locus_tag LOCUS_26720 14416 13532 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972960.1 protein_id gnl|my_center|LOCUS_26720 14653 16623 gene locus_tag LOCUS_26730 14653 16623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 17554 16871 gene locus_tag LOCUS_26740 17554 16871 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_26740 17931 17551 gene locus_tag LOCUS_26750 17931 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 19089 18097 gene locus_tag LOCUS_26760 19089 18097 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_26760 21531 19180 gene locus_tag LOCUS_26770 21531 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 22327 21818 gene locus_tag LOCUS_26780 22327 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 23790 22504 gene locus_tag LOCUS_26790 23790 22504 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_26790 24001 23759 gene locus_tag LOCUS_26800 24001 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 25111 24011 gene locus_tag LOCUS_26810 25111 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 25251 25469 gene locus_tag LOCUS_26820 25251 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 25466 26365 gene locus_tag LOCUS_26830 25466 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 27983 26274 gene locus_tag LOCUS_26840 27983 26274 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_26840 29007 28033 gene locus_tag LOCUS_26850 29007 28033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 <30153 29418 gene locus_tag LOCUS_26860 <30153 29418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:aminopeptidase P family protein >Feature sequence060 1806 271 gene locus_tag LOCUS_26870 1806 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2136 2354 gene locus_tag LOCUS_26880 2136 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3643 2669 gene locus_tag LOCUS_26890 3643 2669 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_26890 4414 3656 gene locus_tag LOCUS_26900 4414 3656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_26900 5148 4411 gene locus_tag LOCUS_26910 5148 4411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_26910 6686 5166 gene locus_tag LOCUS_26920 6686 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_26920 9531 6739 gene locus_tag LOCUS_26930 9531 6739 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_26930 9875 9537 gene locus_tag LOCUS_26940 9875 9537 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_26940 10577 9975 gene locus_tag LOCUS_26950 10577 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 10545 10727 gene locus_tag LOCUS_26960 10545 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 11746 10838 gene locus_tag LOCUS_26970 gene galU 11746 10838 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147293.1 protein_id gnl|my_center|LOCUS_26970 13285 11840 gene locus_tag LOCUS_26980 gene galK 13285 11840 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053437.1 protein_id gnl|my_center|LOCUS_26980 13582 13412 gene locus_tag LOCUS_26990 13582 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 13701 15074 gene locus_tag LOCUS_27000 13701 15074 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_27000 15820 15092 gene locus_tag LOCUS_27010 15820 15092 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467616.1 protein_id gnl|my_center|LOCUS_27010 16444 15875 gene locus_tag LOCUS_27020 16444 15875 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_27020 17015 16446 gene locus_tag LOCUS_27030 17015 16446 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_27030 17647 17012 gene locus_tag LOCUS_27040 17647 17012 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_27040 17750 18889 gene locus_tag LOCUS_27050 gene nifS 17750 18889 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_27050 19093 20199 gene locus_tag LOCUS_27060 gene dnaN 19093 20199 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_27060 22873 20246 gene locus_tag LOCUS_27070 22873 20246 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_27070 22955 23746 gene locus_tag LOCUS_27080 gene lpxA 22955 23746 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921002.1 protein_id gnl|my_center|LOCUS_27080 23746 24045 gene locus_tag LOCUS_27090 23746 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 24042 24554 gene locus_tag LOCUS_27100 24042 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 24555 24974 gene locus_tag LOCUS_27110 24555 24974 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805090.1 protein_id gnl|my_center|LOCUS_27110 26254 25010 gene locus_tag LOCUS_27120 26254 25010 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_27120 28064 26367 gene locus_tag LOCUS_27130 28064 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 29178 28114 gene locus_tag LOCUS_27140 gene recA 29178 28114 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence061 328 2304 gene locus_tag LOCUS_27150 328 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3467 2523 gene locus_tag LOCUS_27160 3467 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3830 5011 gene locus_tag LOCUS_27170 gene tgt 3830 5011 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_27170 7756 5639 gene locus_tag LOCUS_27180 7756 5639 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_27180 10635 7918 gene locus_tag LOCUS_27190 10635 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 12591 10918 gene locus_tag LOCUS_27200 gene rpsA 12591 10918 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882963.1 protein_id gnl|my_center|LOCUS_27200 14257 12917 gene locus_tag LOCUS_27210 14257 12917 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_27210 14355 15311 gene locus_tag LOCUS_27220 14355 15311 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_27220 15313 16596 gene locus_tag LOCUS_27230 gene gabT 15313 16596 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_27230 16677 17576 gene locus_tag LOCUS_27240 gene rsmA 16677 17576 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_27240 17723 18625 gene locus_tag LOCUS_27250 17723 18625 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_27250 19214 18651 gene locus_tag LOCUS_27260 19214 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 19340 20095 gene locus_tag LOCUS_27270 19340 20095 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_27270 22174 20534 gene locus_tag LOCUS_27280 22174 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 23238 22372 gene locus_tag LOCUS_27290 23238 22372 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_27290 23373 23448 gene locus_tag LOCUS_t00310 23373 23448 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23508 24629 gene locus_tag LOCUS_27300 23508 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 24716 26410 gene locus_tag LOCUS_27310 24716 26410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 26504 28420 gene locus_tag LOCUS_27320 gene mnmG 26504 28420 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_27320 28797 28483 gene locus_tag LOCUS_27330 28797 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence062 <1 885 gene locus_tag LOCUS_27340 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640796.1:ATP-dependent Clp protease ATP-binding subunit ClpX 4053 892 gene locus_tag LOCUS_27350 4053 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 7242 4774 gene locus_tag LOCUS_27360 7242 4774 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_27360 8706 7330 gene locus_tag LOCUS_27370 8706 7330 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_27370 9134 10021 gene locus_tag LOCUS_27380 9134 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 10176 12740 gene locus_tag LOCUS_27390 10176 12740 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037536.1 protein_id gnl|my_center|LOCUS_27390 15363 13060 gene locus_tag LOCUS_27400 15363 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 18676 15425 gene locus_tag LOCUS_27410 18676 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 19906 18773 gene locus_tag LOCUS_27420 19906 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 20252 20890 gene locus_tag LOCUS_27430 20252 20890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 20912 22027 gene locus_tag LOCUS_27440 20912 22027 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_27440 22024 25122 gene locus_tag LOCUS_27450 22024 25122 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_27450 25155 25853 gene locus_tag LOCUS_27460 25155 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 26078 27103 gene locus_tag LOCUS_27470 26078 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 27422 27216 gene locus_tag LOCUS_27480 27422 27216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 27938 27489 gene locus_tag LOCUS_27490 27938 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence063 1539 559 gene locus_tag LOCUS_27500 1539 559 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_27500 2697 1549 gene locus_tag LOCUS_27510 gene rho 2697 1549 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311067.1 protein_id gnl|my_center|LOCUS_27510 3897 2914 gene locus_tag LOCUS_27520 gene cysK 3897 2914 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_27520 6424 5876 gene locus_tag LOCUS_27530 6424 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 6842 6405 gene locus_tag LOCUS_27540 6842 6405 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_27540 8676 6913 gene locus_tag LOCUS_27550 8676 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8863 9174 gene locus_tag LOCUS_27560 gene clpS 8863 9174 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896307.1 protein_id gnl|my_center|LOCUS_27560 9171 9659 gene locus_tag LOCUS_27570 9171 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 10073 10456 gene locus_tag LOCUS_27580 10073 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 10493 10795 gene locus_tag LOCUS_27590 10493 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 10923 12353 gene locus_tag LOCUS_27600 10923 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 12377 13288 gene locus_tag LOCUS_27610 12377 13288 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_27610 13868 13326 gene locus_tag LOCUS_27620 13868 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 14068 14931 gene locus_tag LOCUS_27630 14068 14931 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929258.1 protein_id gnl|my_center|LOCUS_27630 15226 14948 gene locus_tag LOCUS_27640 15226 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 15681 15223 gene locus_tag LOCUS_27650 15681 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 15852 17336 gene locus_tag LOCUS_27660 15852 17336 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_27660 17404 18519 gene locus_tag LOCUS_27670 17404 18519 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_27670 18567 21641 gene locus_tag LOCUS_27680 18567 21641 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_27680 23010 21745 gene locus_tag LOCUS_27690 gene icd 23010 21745 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_27690 23172 23912 gene locus_tag LOCUS_27700 23172 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 24501 24262 gene locus_tag LOCUS_27710 24501 24262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 24941 24387 gene locus_tag LOCUS_27720 24941 24387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 25894 25007 gene locus_tag LOCUS_27730 25894 25007 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_27730 25989 26450 gene locus_tag LOCUS_27740 25989 26450 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256335.1 protein_id gnl|my_center|LOCUS_27740 27031 26447 gene locus_tag LOCUS_27750 27031 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 27450 27190 gene locus_tag LOCUS_27760 27450 27190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence064 1818 1189 gene locus_tag LOCUS_27770 1818 1189 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_27770 2027 3322 gene locus_tag LOCUS_27780 2027 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3390 4394 gene locus_tag LOCUS_27790 gene pstS 3390 4394 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_27790 4498 5457 gene locus_tag LOCUS_27800 gene pstC 4498 5457 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_27800 5459 6340 gene locus_tag LOCUS_27810 gene pstA 5459 6340 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_27810 6342 7133 gene locus_tag LOCUS_27820 gene pstB 6342 7133 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_27820 7155 7835 gene locus_tag LOCUS_27830 gene phoU 7155 7835 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_27830 7901 8266 gene locus_tag LOCUS_27840 7901 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 8270 9130 gene locus_tag LOCUS_27850 8270 9130 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_27850 9210 10403 gene locus_tag LOCUS_27860 9210 10403 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_27860 10400 11611 gene locus_tag LOCUS_27870 10400 11611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_27870 11608 12333 gene locus_tag LOCUS_27880 11608 12333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_27880 12330 13424 gene locus_tag LOCUS_27890 gene arsB 12330 13424 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 protein_id gnl|my_center|LOCUS_27890 13430 13972 gene locus_tag LOCUS_27900 13430 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 17074 14102 gene locus_tag LOCUS_27910 17074 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 17977 17225 gene locus_tag LOCUS_27920 17977 17225 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_27920 19068 18121 gene locus_tag LOCUS_27930 gene fmt 19068 18121 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_27930 20009 19116 gene locus_tag LOCUS_27940 20009 19116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 20151 20714 gene locus_tag LOCUS_27950 20151 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 20715 21446 gene locus_tag LOCUS_27960 20715 21446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 23624 21459 gene locus_tag LOCUS_27970 23624 21459 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_27970 25567 23684 gene locus_tag LOCUS_27980 25567 23684 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783169.1 protein_id gnl|my_center|LOCUS_27980 27353 26046 gene locus_tag LOCUS_27990 27353 26046 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27990 27686 27366 gene locus_tag LOCUS_28000 27686 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28000 >Feature sequence065 5645 2217 gene locus_tag LOCUS_28010 5645 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 7485 6055 gene locus_tag LOCUS_28020 7485 6055 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_28020 9253 7499 gene locus_tag LOCUS_28030 9253 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 9618 12137 gene locus_tag LOCUS_28040 9618 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 12134 13615 gene locus_tag LOCUS_28050 12134 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 13629 14693 gene locus_tag LOCUS_28060 13629 14693 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_28060 14674 15174 gene locus_tag LOCUS_28070 14674 15174 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_28070 15179 15409 gene locus_tag LOCUS_28080 15179 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 15421 17076 gene locus_tag LOCUS_28090 15421 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 17106 19022 gene locus_tag LOCUS_28100 17106 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 21003 19270 gene locus_tag LOCUS_28110 21003 19270 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_28110 21270 25508 gene locus_tag LOCUS_28120 21270 25508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 25960 25640 gene locus_tag LOCUS_28130 25960 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 25847 26314 gene locus_tag LOCUS_28140 25847 26314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 27216 26419 gene locus_tag LOCUS_28150 27216 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence066 1569 589 gene locus_tag LOCUS_28160 gene miaA 1569 589 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674562.1 protein_id gnl|my_center|LOCUS_28160 2359 1580 gene locus_tag LOCUS_28170 gene lgt 2359 1580 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_28170 3325 2420 gene locus_tag LOCUS_28180 3325 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3756 3322 gene locus_tag LOCUS_28190 3756 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 3997 5025 gene locus_tag LOCUS_28200 gene hemE 3997 5025 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444333.1 protein_id gnl|my_center|LOCUS_28200 5114 6490 gene locus_tag LOCUS_28210 gene hemN 5114 6490 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_28210 6859 6996 gene locus_tag LOCUS_28220 6859 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 7124 7348 gene locus_tag LOCUS_28230 7124 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 8673 7798 gene locus_tag LOCUS_28240 8673 7798 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_28240 8816 10081 gene locus_tag LOCUS_28250 8816 10081 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_28250 10081 11415 gene locus_tag LOCUS_28260 gene fucP 10081 11415 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_28260 12398 11484 gene locus_tag LOCUS_28270 12398 11484 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_28270 15131 12462 gene locus_tag LOCUS_28280 15131 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 16033 15128 gene locus_tag LOCUS_28290 16033 15128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_28290 16257 16030 gene locus_tag LOCUS_28300 16257 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 16652 16254 gene locus_tag LOCUS_28310 16652 16254 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_28310 16841 17272 gene locus_tag LOCUS_28320 16841 17272 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_28320 18455 17301 gene locus_tag LOCUS_28330 gene waaF 18455 17301 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_28330 19326 18457 gene locus_tag LOCUS_28340 19326 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 20498 19326 gene locus_tag LOCUS_28350 gene lpxK 20498 19326 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_28350 21018 20545 gene locus_tag LOCUS_28360 21018 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 21466 21098 gene locus_tag LOCUS_28370 21466 21098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 22465 21578 gene locus_tag LOCUS_28380 22465 21578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_28380 22678 22469 gene locus_tag LOCUS_28390 22678 22469 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689143.1 protein_id gnl|my_center|LOCUS_28390 22880 22671 gene locus_tag LOCUS_28400 22880 22671 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_28400 22989 23684 gene locus_tag LOCUS_28410 22989 23684 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 protein_id gnl|my_center|LOCUS_28410 23748 23987 gene locus_tag LOCUS_28420 23748 23987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 24009 24617 gene locus_tag LOCUS_28430 24009 24617 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_28430 24679 25251 gene locus_tag LOCUS_28440 24679 25251 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038751.1 protein_id gnl|my_center|LOCUS_28440 25315 26394 gene locus_tag LOCUS_28450 gene rsmH 25315 26394 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence067 849 55 gene locus_tag LOCUS_28460 849 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28460 1226 894 gene locus_tag LOCUS_28470 1226 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28470 1582 2112 gene locus_tag LOCUS_28480 1582 2112 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_28480 2117 2734 gene locus_tag LOCUS_28490 2117 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2740 4011 gene locus_tag LOCUS_28500 gene nuoD 2740 4011 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_28500 4134 4619 gene locus_tag LOCUS_28510 4134 4619 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_28510 4648 4845 gene locus_tag LOCUS_28520 4648 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 4842 5219 gene locus_tag LOCUS_28530 4842 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 5302 5229 gene locus_tag LOCUS_t00320 5302 5229 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5355 6800 gene locus_tag LOCUS_28540 gene nuoF 5355 6800 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_28540 7105 7698 gene locus_tag LOCUS_28550 7105 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 7701 8681 gene locus_tag LOCUS_28560 7701 8681 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_28560 9002 9457 gene locus_tag LOCUS_28570 9002 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 9460 11205 gene locus_tag LOCUS_28580 9460 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 11323 12384 gene locus_tag LOCUS_28590 gene nuoH 11323 12384 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_28590 12386 12949 gene locus_tag LOCUS_28600 12386 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 12956 13489 gene locus_tag LOCUS_28610 12956 13489 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_28610 13491 13796 gene locus_tag LOCUS_28620 gene nuoK 13491 13796 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_28620 13800 15665 gene locus_tag LOCUS_28630 gene nuoL 13800 15665 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_28630 15768 17330 gene locus_tag LOCUS_28640 15768 17330 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_28640 17335 18792 gene locus_tag LOCUS_28650 17335 18792 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_28650 19778 18879 gene locus_tag LOCUS_28660 19778 18879 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_28660 21333 19783 gene locus_tag LOCUS_28670 21333 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 21987 21742 gene locus_tag LOCUS_28680 21987 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 23221 22010 gene locus_tag LOCUS_28690 23221 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 24004 23225 gene locus_tag LOCUS_28700 24004 23225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28700 25472 24072 gene locus_tag LOCUS_28710 gene selA 25472 24072 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence068 173 2134 gene locus_tag LOCUS_28720 173 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2167 2370 gene locus_tag LOCUS_28730 2167 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 2469 3638 gene locus_tag LOCUS_28740 gene galK 2469 3638 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292299.1 protein_id gnl|my_center|LOCUS_28740 4602 3688 gene locus_tag LOCUS_28750 4602 3688 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_28750 6871 4604 gene locus_tag LOCUS_28760 6871 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 7020 8291 gene locus_tag LOCUS_28770 7020 8291 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_28770 8285 9229 gene locus_tag LOCUS_28780 8285 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 10428 9235 gene locus_tag LOCUS_28790 10428 9235 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_28790 11416 10589 gene locus_tag LOCUS_28800 11416 10589 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921521.1 protein_id gnl|my_center|LOCUS_28800 11696 13660 gene locus_tag LOCUS_28810 11696 13660 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_28810 13697 16168 gene locus_tag LOCUS_28820 13697 16168 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_28820 18896 16674 gene locus_tag LOCUS_28830 18896 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 20039 18963 gene locus_tag LOCUS_28840 gene hemA 20039 18963 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_28840 21883 20180 gene locus_tag LOCUS_28850 21883 20180 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_28850 24178 22046 gene locus_tag LOCUS_28860 24178 22046 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_28860 24416 24679 gene locus_tag LOCUS_28870 24416 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 24863 24636 gene locus_tag LOCUS_28880 24863 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 24974 25219 gene locus_tag LOCUS_28890 24974 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence069 2043 589 gene locus_tag LOCUS_28900 gene glgA 2043 589 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_28900 3344 2043 gene locus_tag LOCUS_28910 gene serS 3344 2043 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_28910 4055 3447 gene locus_tag LOCUS_28920 4055 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 4936 4052 gene locus_tag LOCUS_28930 4936 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 6375 4933 gene locus_tag LOCUS_28940 6375 4933 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_28940 6743 6372 gene locus_tag LOCUS_28950 6743 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 7918 6740 gene locus_tag LOCUS_28960 7918 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_28960 8651 7998 gene locus_tag LOCUS_28970 8651 7998 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_28970 9190 8651 gene locus_tag LOCUS_28980 9190 8651 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_28980 10622 9183 gene locus_tag LOCUS_28990 gene nrfD 10622 9183 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_28990 13840 10622 gene locus_tag LOCUS_29000 13840 10622 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_29000 14472 13837 gene locus_tag LOCUS_29010 14472 13837 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_29010 16708 14744 gene locus_tag LOCUS_29020 16708 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 19783 17024 gene locus_tag LOCUS_29030 gene ppdK 19783 17024 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_29030 20496 20173 gene locus_tag LOCUS_29040 20496 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 20776 20480 gene locus_tag LOCUS_29050 20776 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 20660 21481 gene locus_tag LOCUS_29060 gene lpxI 20660 21481 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_29060 21474 22016 gene locus_tag LOCUS_29070 21474 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 22019 22969 gene locus_tag LOCUS_29080 22019 22969 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_29080 22953 23780 gene locus_tag LOCUS_29090 22953 23780 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_29090 24327 23896 gene locus_tag LOCUS_29100 24327 23896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence070 899 1864 gene locus_tag LOCUS_29110 gene hemC 899 1864 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141022.1 protein_id gnl|my_center|LOCUS_29110 2196 1894 gene locus_tag LOCUS_29120 gene yhbY 2196 1894 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036888.1 protein_id gnl|my_center|LOCUS_29120 2434 3501 gene locus_tag LOCUS_29130 gene sppA 2434 3501 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881360.1 protein_id gnl|my_center|LOCUS_29130 3498 4130 gene locus_tag LOCUS_29140 gene upp 3498 4130 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_29140 4798 4127 gene locus_tag LOCUS_29150 4798 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 4876 6423 gene locus_tag LOCUS_29160 4876 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 6543 7280 gene locus_tag LOCUS_29170 6543 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 7402 7941 gene locus_tag LOCUS_29180 7402 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 7991 8890 gene locus_tag LOCUS_29190 7991 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 9022 9183 gene locus_tag LOCUS_29200 9022 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 9671 9213 gene locus_tag LOCUS_29210 9671 9213 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_29210 10396 9668 gene locus_tag LOCUS_29220 10396 9668 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130094389.1 protein_id gnl|my_center|LOCUS_29220 10745 10491 gene locus_tag LOCUS_29230 10745 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 10916 10749 gene locus_tag LOCUS_29240 gene rpmG 10916 10749 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_29240 11516 10920 gene locus_tag LOCUS_29250 11516 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 12484 11618 gene locus_tag LOCUS_29260 gene folE2 12484 11618 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_29260 12612 13568 gene locus_tag LOCUS_29270 12612 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 13739 14014 gene locus_tag LOCUS_29280 13739 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 15237 14017 gene locus_tag LOCUS_29290 gene ftsZ 15237 14017 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 protein_id gnl|my_center|LOCUS_29290 16459 15248 gene locus_tag LOCUS_29300 gene ftsA 16459 15248 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_29300 17417 16452 gene locus_tag LOCUS_29310 17417 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 18398 17457 gene locus_tag LOCUS_29320 18398 17457 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_29320 18802 18395 gene locus_tag LOCUS_29330 18802 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 19038 18799 gene locus_tag LOCUS_29340 19038 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 19989 19069 gene locus_tag LOCUS_29350 gene murB 19989 19069 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_29350 21161 19986 gene locus_tag LOCUS_29360 gene murG 21161 19986 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_29360 22318 21158 gene locus_tag LOCUS_29370 gene spoVE 22318 21158 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_29370 23190 22357 gene locus_tag LOCUS_29380 23190 22357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 24668 23487 gene locus_tag LOCUS_29390 gene mraY 24668 23487 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689450.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence071 1538 708 gene locus_tag LOCUS_29400 1538 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3047 1956 gene locus_tag LOCUS_29410 3047 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7668 3241 gene locus_tag LOCUS_29420 7668 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 14946 7702 gene locus_tag LOCUS_29430 14946 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 15197 15370 gene locus_tag LOCUS_29440 15197 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 19203 15919 gene locus_tag LOCUS_29450 19203 15919 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_29450 20195 19200 gene locus_tag LOCUS_29460 20195 19200 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_29460 20461 20240 gene locus_tag LOCUS_29470 20461 20240 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_29470 21139 20753 gene locus_tag LOCUS_29480 21139 20753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 21414 21136 gene locus_tag LOCUS_29490 21414 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 22126 21485 gene locus_tag LOCUS_29500 gene rpoE 22126 21485 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 protein_id gnl|my_center|LOCUS_29500 22306 22737 gene locus_tag LOCUS_29510 22306 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 <24643 22795 gene locus_tag LOCUS_29520 <24643 22795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333793.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence072 1306 1563 gene locus_tag LOCUS_29530 1306 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1624 2499 gene locus_tag LOCUS_29540 1624 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3469 2468 gene locus_tag LOCUS_29550 gene waaC 3469 2468 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_29550 4409 3471 gene locus_tag LOCUS_29560 4409 3471 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660376.1 protein_id gnl|my_center|LOCUS_29560 5177 4416 gene locus_tag LOCUS_29570 5177 4416 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_29570 5834 5418 gene locus_tag LOCUS_29580 5834 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 6094 5831 gene locus_tag LOCUS_29590 6094 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 7490 6411 gene locus_tag LOCUS_29600 7490 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 7950 7546 gene locus_tag LOCUS_29610 7950 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 8162 7947 gene locus_tag LOCUS_29620 8162 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 8507 8286 gene locus_tag LOCUS_29630 8507 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 9292 8702 gene locus_tag LOCUS_29640 9292 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 9512 9264 gene locus_tag LOCUS_29650 9512 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 9759 10739 gene locus_tag LOCUS_29660 9759 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 11779 10766 gene locus_tag LOCUS_29670 11779 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 12705 11776 gene locus_tag LOCUS_29680 12705 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 13609 12743 gene locus_tag LOCUS_29690 13609 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 14110 13730 gene locus_tag LOCUS_29700 14110 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 14724 16547 gene locus_tag LOCUS_29710 gene msbA 14724 16547 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_29710 16651 17658 gene locus_tag LOCUS_29720 16651 17658 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 protein_id gnl|my_center|LOCUS_29720 17733 18740 gene locus_tag LOCUS_29730 17733 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 19144 20952 gene locus_tag LOCUS_29740 19144 20952 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_29740 20971 21909 gene locus_tag LOCUS_29750 20971 21909 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_29750 22003 22467 gene locus_tag LOCUS_29760 22003 22467 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142766.1 protein_id gnl|my_center|LOCUS_29760 22464 23633 gene locus_tag LOCUS_29770 22464 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence073 178 252 gene locus_tag LOCUS_t00330 178 252 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 511 257 gene locus_tag LOCUS_29780 511 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 1261 800 gene locus_tag LOCUS_29790 1261 800 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_29790 2410 1322 gene locus_tag LOCUS_29800 2410 1322 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583800.1 protein_id gnl|my_center|LOCUS_29800 2650 3510 gene locus_tag LOCUS_29810 2650 3510 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_29810 3630 4109 gene locus_tag LOCUS_29820 3630 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_29820 4303 4124 gene locus_tag LOCUS_29830 4303 4124 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933047.1 protein_id gnl|my_center|LOCUS_29830 4623 5798 gene locus_tag LOCUS_29840 4623 5798 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101927.1 protein_id gnl|my_center|LOCUS_29840 6431 6024 gene locus_tag LOCUS_29850 6431 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 7448 6552 gene locus_tag LOCUS_29860 7448 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 7762 9183 gene locus_tag LOCUS_29870 7762 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 9233 10678 gene locus_tag LOCUS_29880 9233 10678 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_29880 11959 10685 gene locus_tag LOCUS_29890 11959 10685 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_29890 14556 12253 gene locus_tag LOCUS_29900 14556 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 15539 14736 gene locus_tag LOCUS_29910 15539 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 15813 18374 gene locus_tag LOCUS_29920 15813 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 18383 20155 gene locus_tag LOCUS_29930 18383 20155 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_29930 20160 21677 gene locus_tag LOCUS_29940 20160 21677 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_29940 23512 21725 gene locus_tag LOCUS_29950 23512 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence074 3048 2650 gene locus_tag LOCUS_29960 3048 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 4718 3141 gene locus_tag LOCUS_29970 4718 3141 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709077.1 protein_id gnl|my_center|LOCUS_29970 4721 5050 gene locus_tag LOCUS_29980 4721 5050 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336823.1 protein_id gnl|my_center|LOCUS_29980 6112 5123 gene locus_tag LOCUS_29990 gene xerD 6112 5123 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_29990 6429 7235 gene locus_tag LOCUS_30000 6429 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 9453 7426 gene locus_tag LOCUS_30010 gene uvrB 9453 7426 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_30010 9661 10644 gene locus_tag LOCUS_30020 9661 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 10667 11539 gene locus_tag LOCUS_30030 10667 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 13519 11552 gene locus_tag LOCUS_30040 13519 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 14654 13605 gene locus_tag LOCUS_30050 14654 13605 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_30050 14812 15711 gene locus_tag LOCUS_30060 14812 15711 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_30060 15831 22202 gene locus_tag LOCUS_30070 15831 22202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 22317 22859 gene locus_tag LOCUS_30080 22317 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 <23742 22852 gene locus_tag LOCUS_30090 <23742 22852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942471.1:L-aspartate oxidase >Feature sequence075 1169 138 gene locus_tag LOCUS_30100 1169 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1343 1173 gene locus_tag LOCUS_30110 1343 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1446 2729 gene locus_tag LOCUS_30120 gene hemL 1446 2729 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_30120 2809 3222 gene locus_tag LOCUS_30130 2809 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4116 3268 gene locus_tag LOCUS_30140 4116 3268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_30140 5571 4360 gene locus_tag LOCUS_30150 5571 4360 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039286.1 protein_id gnl|my_center|LOCUS_30150 6213 5677 gene locus_tag LOCUS_30160 6213 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 9296 6399 gene locus_tag LOCUS_30170 9296 6399 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_30170 13532 10038 gene locus_tag LOCUS_30180 gene mfd 13532 10038 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389755.1 protein_id gnl|my_center|LOCUS_30180 13724 15115 gene locus_tag LOCUS_30190 13724 15115 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_30190 15209 16930 gene locus_tag LOCUS_30200 15209 16930 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_30200 17332 18375 gene locus_tag LOCUS_30210 17332 18375 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_30210 18412 20136 gene locus_tag LOCUS_30220 18412 20136 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_30220 20146 20862 gene locus_tag LOCUS_30230 gene cybH 20146 20862 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924456.1 protein_id gnl|my_center|LOCUS_30230 20859 21365 gene locus_tag LOCUS_30240 20859 21365 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221964.1 protein_id gnl|my_center|LOCUS_30240 23328 21469 gene locus_tag LOCUS_30250 gene typA 23328 21469 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence076 <1 664 gene locus_tag LOCUS_30260 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082827567.1:DHA2 family efflux MFS transporter permease subunit 2726 1242 gene locus_tag LOCUS_30270 2726 1242 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_30270 5802 2764 gene locus_tag LOCUS_30280 5802 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 7648 5810 gene locus_tag LOCUS_30290 7648 5810 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_30290 7758 11177 gene locus_tag LOCUS_30300 gene addB 7758 11177 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816091.1 protein_id gnl|my_center|LOCUS_30300 11189 11719 gene locus_tag LOCUS_30310 11189 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 11885 12100 gene locus_tag LOCUS_30320 11885 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 15875 12399 gene locus_tag LOCUS_30330 15875 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 16198 18399 gene locus_tag LOCUS_30340 gene glgB 16198 18399 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_30340 18396 19148 gene locus_tag LOCUS_30350 18396 19148 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615807.1 protein_id gnl|my_center|LOCUS_30350 19608 19165 gene locus_tag LOCUS_30360 19608 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 19702 20583 gene locus_tag LOCUS_30370 19702 20583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 20580 20987 gene locus_tag LOCUS_30380 20580 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 21473 21397 gene locus_tag LOCUS_t00340 21473 21397 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <22527 21617 gene locus_tag LOCUS_30390 <22527 21617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328455.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence077 198 866 gene locus_tag LOCUS_30400 198 866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_30400 1128 2795 gene locus_tag LOCUS_30410 1128 2795 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_30410 2888 3919 gene locus_tag LOCUS_30420 2888 3919 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_30420 4023 5759 gene locus_tag LOCUS_30430 4023 5759 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_30430 5813 6568 gene locus_tag LOCUS_30440 gene larB 5813 6568 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_30440 6604 7932 gene locus_tag LOCUS_30450 gene larC 6604 7932 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_30450 7929 8762 gene locus_tag LOCUS_30460 gene larE 7929 8762 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_30460 8832 9608 gene locus_tag LOCUS_30470 8832 9608 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_30470 10632 9655 gene locus_tag LOCUS_30480 10632 9655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_30480 12025 10760 gene locus_tag LOCUS_30490 gene dnaA 12025 10760 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_30490 12912 15794 gene locus_tag LOCUS_30500 gene ileS 12912 15794 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_30500 15878 16666 gene locus_tag LOCUS_30510 15878 16666 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_30510 17777 16686 gene locus_tag LOCUS_30520 17777 16686 CDS product 23S rRNA (cytosine(2499)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_30520 18966 18001 gene locus_tag LOCUS_30530 gene trpS 18966 18001 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_30530 19781 19062 gene locus_tag LOCUS_30540 19781 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 21060 19978 gene locus_tag LOCUS_30550 gene recF 21060 19978 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906242.1 protein_id gnl|my_center|LOCUS_30550 21285 22172 gene locus_tag LOCUS_30560 21285 22172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence078 1559 453 gene locus_tag LOCUS_30570 1559 453 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_30570 2957 1665 gene locus_tag LOCUS_30580 2957 1665 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_30580 3028 3879 gene locus_tag LOCUS_30590 3028 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4587 5990 gene locus_tag LOCUS_30600 gene cysS 4587 5990 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_30600 6079 6738 gene locus_tag LOCUS_30610 gene tmk 6079 6738 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_30610 6782 7114 gene locus_tag LOCUS_30620 6782 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 8898 7159 gene locus_tag LOCUS_30630 8898 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 9633 8995 gene locus_tag LOCUS_30640 9633 8995 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_30640 10301 9630 gene locus_tag LOCUS_30650 gene cmk 10301 9630 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_30650 11903 10380 gene locus_tag LOCUS_30660 gene aroA 11903 10380 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812770.1 protein_id gnl|my_center|LOCUS_30660 12789 11905 gene locus_tag LOCUS_30670 12789 11905 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_30670 14464 12869 gene locus_tag LOCUS_30680 gene xylB 14464 12869 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013398.1 protein_id gnl|my_center|LOCUS_30680 17530 15014 gene locus_tag LOCUS_30690 17530 15014 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_30690 19954 17639 gene locus_tag LOCUS_30700 19954 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 20607 19975 gene locus_tag LOCUS_30710 20607 19975 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_30710 <22221 20614 gene locus_tag LOCUS_30720 <22221 20614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038432.1:ligand-binding sensor domain-containing diguanylate cyclase >Feature sequence079 379 1527 gene locus_tag LOCUS_30730 379 1527 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086689.1 protein_id gnl|my_center|LOCUS_30730 1538 3490 gene locus_tag LOCUS_30740 1538 3490 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_30740 4718 3681 gene locus_tag LOCUS_30750 4718 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 5434 4715 gene locus_tag LOCUS_30760 5434 4715 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_30760 5997 5461 gene locus_tag LOCUS_30770 5997 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 6614 6009 gene locus_tag LOCUS_30780 6614 6009 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_30780 6760 6891 gene locus_tag LOCUS_30790 6760 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 9036 6937 gene locus_tag LOCUS_30800 9036 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 9295 9510 gene locus_tag LOCUS_30810 9295 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 9737 9931 gene locus_tag LOCUS_30820 9737 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 9925 10248 gene locus_tag LOCUS_30830 9925 10248 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_30830 11271 10321 gene locus_tag LOCUS_30840 11271 10321 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_30840 12029 11268 gene locus_tag LOCUS_30850 12029 11268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252874.1 protein_id gnl|my_center|LOCUS_30850 14734 13148 gene locus_tag LOCUS_30860 14734 13148 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_30860 14980 14750 gene locus_tag LOCUS_30870 14980 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 16320 14986 gene locus_tag LOCUS_30880 16320 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 16656 16997 gene locus_tag LOCUS_30890 16656 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 17063 17794 gene locus_tag LOCUS_30900 17063 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 17894 19978 gene locus_tag LOCUS_30910 17894 19978 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_30910 20056 19981 gene locus_tag LOCUS_t00350 20056 19981 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20151 20075 gene locus_tag LOCUS_t00360 20151 20075 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20222 20773 gene locus_tag LOCUS_30920 20222 20773 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_30920 21658 21005 gene locus_tag LOCUS_30930 gene clpP 21658 21005 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence080 1087 674 gene locus_tag LOCUS_30940 1087 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1536 1132 gene locus_tag LOCUS_30950 1536 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3855 5504 gene locus_tag LOCUS_30960 3855 5504 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566295.1 protein_id gnl|my_center|LOCUS_30960 5511 6260 gene locus_tag LOCUS_30970 5511 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 6288 6671 gene locus_tag LOCUS_30980 6288 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 6665 7297 gene locus_tag LOCUS_30990 6665 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30990 7351 7578 gene locus_tag LOCUS_31000 7351 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 7787 8131 gene locus_tag LOCUS_31010 7787 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 8138 8698 gene locus_tag LOCUS_31020 8138 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063598.1 protein_id gnl|my_center|LOCUS_31020 8803 9591 gene locus_tag LOCUS_31030 8803 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 10024 9614 gene locus_tag LOCUS_31040 10024 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 12080 10029 gene locus_tag LOCUS_31050 12080 10029 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_31050 13122 12085 gene locus_tag LOCUS_31060 13122 12085 CDS product PD-(D/E)XK motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383505.1 protein_id gnl|my_center|LOCUS_31060 16042 13112 gene locus_tag LOCUS_31070 16042 13112 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_31070 17549 16035 gene locus_tag LOCUS_31080 17549 16035 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_31080 19226 17556 gene locus_tag LOCUS_31090 19226 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 19553 19275 gene locus_tag LOCUS_31100 19553 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 19697 20833 gene locus_tag LOCUS_31110 19697 20833 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200836483.1 protein_id gnl|my_center|LOCUS_31110 20830 21414 gene locus_tag LOCUS_31120 20830 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102948.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence081 1103 255 gene locus_tag LOCUS_31130 1103 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2246 1209 gene locus_tag LOCUS_31140 2246 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2684 2277 gene locus_tag LOCUS_31150 2684 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 5709 3073 gene locus_tag LOCUS_31160 gene gyrA 5709 3073 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_31160 8256 5737 gene locus_tag LOCUS_31170 gene gyrB 8256 5737 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871536.1 protein_id gnl|my_center|LOCUS_31170 9264 8425 gene locus_tag LOCUS_31180 9264 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 10179 9268 gene locus_tag LOCUS_31190 10179 9268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_31190 10751 10176 gene locus_tag LOCUS_31200 10751 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 11341 10748 gene locus_tag LOCUS_31210 11341 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 11496 14480 gene locus_tag LOCUS_31220 gene gcvP 11496 14480 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_31220 16218 14785 gene locus_tag LOCUS_31230 16218 14785 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_31230 17643 16237 gene locus_tag LOCUS_31240 17643 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 17909 18397 gene locus_tag LOCUS_31250 17909 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 18609 18842 gene locus_tag LOCUS_31260 18609 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 18885 19406 gene locus_tag LOCUS_31270 18885 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_31270 19860 20930 gene locus_tag LOCUS_31280 19860 20930 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence082 142 1785 gene locus_tag LOCUS_31290 142 1785 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_31290 2077 3279 gene locus_tag LOCUS_31300 2077 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_31300 3700 4851 gene locus_tag LOCUS_31310 3700 4851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887944.1 protein_id gnl|my_center|LOCUS_31310 4844 5758 gene locus_tag LOCUS_31320 4844 5758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141403.1 protein_id gnl|my_center|LOCUS_31320 5773 6582 gene locus_tag LOCUS_31330 5773 6582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 protein_id gnl|my_center|LOCUS_31330 6579 7634 gene locus_tag LOCUS_31340 6579 7634 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_31340 9447 7777 gene locus_tag LOCUS_31350 9447 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 10365 9463 gene locus_tag LOCUS_31360 10365 9463 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_31360 11776 10376 gene locus_tag LOCUS_31370 11776 10376 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_31370 13818 11773 gene locus_tag LOCUS_31380 13818 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 15985 13829 gene locus_tag LOCUS_31390 15985 13829 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211634420.1 protein_id gnl|my_center|LOCUS_31390 20313 15982 gene locus_tag LOCUS_31400 20313 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 <21087 20435 gene locus_tag LOCUS_31410 <21087 20435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence083 <1 1549 gene locus_tag LOCUS_31420 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein 1599 2918 gene locus_tag LOCUS_31430 1599 2918 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_31430 2929 3885 gene locus_tag LOCUS_31440 2929 3885 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615605.1 protein_id gnl|my_center|LOCUS_31440 3882 5453 gene locus_tag LOCUS_31450 3882 5453 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665541.1 protein_id gnl|my_center|LOCUS_31450 6271 5837 gene locus_tag LOCUS_31460 6271 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 6499 6927 gene locus_tag LOCUS_31470 6499 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31470 7525 6914 gene locus_tag LOCUS_31480 7525 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 7947 7471 gene locus_tag LOCUS_31490 7947 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 8112 8028 gene locus_tag LOCUS_t00370 8112 8028 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8525 8773 gene locus_tag LOCUS_31500 8525 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31500 9675 8755 gene locus_tag LOCUS_31510 9675 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 9947 10639 gene locus_tag LOCUS_31520 9947 10639 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327813.1 protein_id gnl|my_center|LOCUS_31520 10649 11521 gene locus_tag LOCUS_31530 gene pssA 10649 11521 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072696843.1 protein_id gnl|my_center|LOCUS_31530 11523 12215 gene locus_tag LOCUS_31540 11523 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 12217 13320 gene locus_tag LOCUS_31550 gene ychF 12217 13320 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_31550 13511 13353 gene locus_tag LOCUS_31560 13511 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 14648 13857 gene locus_tag LOCUS_31570 14648 13857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_31570 15483 15073 gene locus_tag LOCUS_31580 15483 15073 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_31580 15769 16182 gene locus_tag LOCUS_31590 15769 16182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 16237 18636 gene locus_tag LOCUS_31600 gene lon 16237 18636 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_31600 18747 19448 gene locus_tag LOCUS_31610 18747 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 19521 20435 gene locus_tag LOCUS_31620 19521 20435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence084 1315 1046 gene locus_tag LOCUS_31630 1315 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 7283 1329 gene locus_tag LOCUS_31640 7283 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 7370 7714 gene locus_tag LOCUS_31650 7370 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 8738 7686 gene locus_tag LOCUS_31660 8738 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 9046 8798 gene locus_tag LOCUS_31670 9046 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 9912 9052 gene locus_tag LOCUS_31680 9912 9052 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_31680 10089 11177 gene locus_tag LOCUS_31690 10089 11177 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_31690 11268 11687 gene locus_tag LOCUS_31700 11268 11687 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_31700 11837 14086 gene locus_tag LOCUS_31710 11837 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 14286 16655 gene locus_tag LOCUS_31720 14286 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 16857 18587 gene locus_tag LOCUS_31730 16857 18587 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_31730 19961 18591 gene locus_tag LOCUS_31740 19961 18591 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence085 274 4071 gene locus_tag LOCUS_31750 274 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4145 5029 gene locus_tag LOCUS_31760 4145 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 5423 6598 gene locus_tag LOCUS_31770 5423 6598 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_31770 7085 8062 gene locus_tag LOCUS_31780 7085 8062 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_31780 8354 10162 gene locus_tag LOCUS_31790 8354 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 10311 12083 gene locus_tag LOCUS_31800 10311 12083 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_31800 12773 12141 gene locus_tag LOCUS_31810 12773 12141 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_31810 14989 12770 gene locus_tag LOCUS_31820 14989 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 15492 17849 gene locus_tag LOCUS_31830 15492 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 18048 17830 gene locus_tag LOCUS_31840 18048 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 <19990 18045 gene locus_tag LOCUS_31850 <19990 18045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158298054.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence086 993 340 gene locus_tag LOCUS_31860 gene rnhB 993 340 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_31860 2531 1707 gene locus_tag LOCUS_31870 2531 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3832 2555 gene locus_tag LOCUS_31880 3832 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 4284 3919 gene locus_tag LOCUS_31890 4284 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 4501 7134 gene locus_tag LOCUS_31900 gene mutS 4501 7134 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_31900 8882 7539 gene locus_tag LOCUS_31910 8882 7539 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444660.1 protein_id gnl|my_center|LOCUS_31910 11935 8879 gene locus_tag LOCUS_31920 11935 8879 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_31920 13084 12071 gene locus_tag LOCUS_31930 13084 12071 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096739.1 protein_id gnl|my_center|LOCUS_31930 14557 13199 gene locus_tag LOCUS_31940 14557 13199 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943578.1 protein_id gnl|my_center|LOCUS_31940 15323 14652 gene locus_tag LOCUS_31950 15323 14652 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_31950 15461 15679 gene locus_tag LOCUS_31960 15461 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 15676 15882 gene locus_tag LOCUS_31970 15676 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 16213 16686 gene locus_tag LOCUS_31980 16213 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 16919 17593 gene locus_tag LOCUS_31990 16919 17593 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_31990 17590 18990 gene locus_tag LOCUS_32000 17590 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence087 3648 3881 gene locus_tag LOCUS_32010 3648 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 5714 4596 gene locus_tag LOCUS_32020 5714 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 5989 6672 gene locus_tag LOCUS_32030 gene tcdA 5989 6672 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212114.1 protein_id gnl|my_center|LOCUS_32030 7669 6857 gene locus_tag LOCUS_32040 7669 6857 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 protein_id gnl|my_center|LOCUS_32040 8082 7666 gene locus_tag LOCUS_32050 8082 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 8864 8097 gene locus_tag LOCUS_32060 8864 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 8870 9118 gene locus_tag LOCUS_32070 8870 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 10263 9076 gene locus_tag LOCUS_32080 10263 9076 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_32080 11566 10268 gene locus_tag LOCUS_32090 gene lysA 11566 10268 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_32090 12376 11663 gene locus_tag LOCUS_32100 12376 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 13418 12387 gene locus_tag LOCUS_32110 13418 12387 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_32110 13579 14994 gene locus_tag LOCUS_32120 13579 14994 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_32120 15496 15011 gene locus_tag LOCUS_32130 15496 15011 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 protein_id gnl|my_center|LOCUS_32130 16008 15613 gene locus_tag LOCUS_32140 16008 15613 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943273.1 protein_id gnl|my_center|LOCUS_32140 16823 16542 gene locus_tag LOCUS_32150 16823 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 18675 17323 gene locus_tag LOCUS_32160 18675 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence088 1915 3087 gene locus_tag LOCUS_32170 1915 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3228 6341 gene locus_tag LOCUS_32180 3228 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 6313 8298 gene locus_tag LOCUS_32190 6313 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 9343 8306 gene locus_tag LOCUS_32200 9343 8306 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_32200 9477 10979 gene locus_tag LOCUS_32210 9477 10979 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_32210 11013 11657 gene locus_tag LOCUS_32220 11013 11657 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177694.1 protein_id gnl|my_center|LOCUS_32220 11675 12793 gene locus_tag LOCUS_32230 11675 12793 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_32230 12806 15916 gene locus_tag LOCUS_32240 12806 15916 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_32240 15978 17129 gene locus_tag LOCUS_32250 15978 17129 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence089 352 891 gene locus_tag LOCUS_32260 352 891 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_32260 943 2565 gene locus_tag LOCUS_32270 943 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 2678 4864 gene locus_tag LOCUS_32280 2678 4864 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_32280 7365 4918 gene locus_tag LOCUS_32290 7365 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 7773 9065 gene locus_tag LOCUS_32300 7773 9065 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369608.1 protein_id gnl|my_center|LOCUS_32300 9152 11134 gene locus_tag LOCUS_32310 gene shc 9152 11134 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_32310 15006 11185 gene locus_tag LOCUS_32320 15006 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 15392 15003 gene locus_tag LOCUS_32330 15392 15003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_32330 16309 15389 gene locus_tag LOCUS_32340 16309 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32340 16425 17207 gene locus_tag LOCUS_32350 16425 17207 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_32350 17809 17462 gene locus_tag LOCUS_32360 17809 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 17833 18003 gene locus_tag LOCUS_32370 17833 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 18090 18323 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttgacttcaccccccggagaggtcagctacaat >Feature sequence090 <1 1527 gene locus_tag LOCUS_32380 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615922.1:ATPase, T2SS/T4P/T4SS family 1653 3056 gene locus_tag LOCUS_32390 1653 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3053 3634 gene locus_tag LOCUS_32400 3053 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3631 5970 gene locus_tag LOCUS_32410 3631 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 6347 5964 gene locus_tag LOCUS_32420 6347 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32420 6683 6357 gene locus_tag LOCUS_32430 6683 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32430 7562 6747 gene locus_tag LOCUS_32440 7562 6747 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256233.1 protein_id gnl|my_center|LOCUS_32440 7848 7567 gene locus_tag LOCUS_32450 7848 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 8256 7864 gene locus_tag LOCUS_32460 8256 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 9305 8373 gene locus_tag LOCUS_32470 gene amrS 9305 8373 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32470 9658 9455 gene locus_tag LOCUS_32480 9658 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32480 10825 9665 gene locus_tag LOCUS_32490 gene amrA 10825 9665 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32490 11200 10916 gene locus_tag LOCUS_32500 11200 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 11607 12308 gene locus_tag LOCUS_32510 11607 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 13969 13073 gene locus_tag LOCUS_32520 gene argF 13969 13073 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_32520 14164 15729 gene locus_tag LOCUS_32530 14164 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 16310 16771 gene locus_tag LOCUS_32540 16310 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 17636 18250 gene locus_tag LOCUS_32550 17636 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence091 638 282 gene locus_tag LOCUS_32560 638 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 2760 643 gene locus_tag LOCUS_32570 gene recG 2760 643 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_32570 3019 3405 gene locus_tag LOCUS_32580 3019 3405 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_32580 3402 4511 gene locus_tag LOCUS_32590 3402 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 6373 5309 gene locus_tag LOCUS_32600 6373 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 7487 6405 gene locus_tag LOCUS_32610 7487 6405 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_32610 7624 13947 gene locus_tag LOCUS_32620 7624 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 13956 16037 gene locus_tag LOCUS_32630 13956 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 16050 17063 gene locus_tag LOCUS_32640 16050 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence092 <1 5240 gene locus_tag LOCUS_32650 <1 5240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 6295 6987 gene locus_tag LOCUS_32660 6295 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 7315 7145 gene locus_tag LOCUS_32670 7315 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 8019 8756 gene locus_tag LOCUS_32680 8019 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 8907 8746 gene locus_tag LOCUS_32690 8907 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 10422 9310 gene locus_tag LOCUS_32700 10422 9310 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_32700 10871 10548 gene locus_tag LOCUS_32710 10871 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 10963 12186 gene locus_tag LOCUS_32720 10963 12186 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_32720 12279 12875 gene locus_tag LOCUS_32730 gene pgsA 12279 12875 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_32730 13424 12936 gene locus_tag LOCUS_32740 13424 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 13617 13835 gene locus_tag LOCUS_32750 13617 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 13991 14308 gene locus_tag LOCUS_32760 13991 14308 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_32760 14430 14678 gene locus_tag LOCUS_32770 14430 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 14818 14892 gene locus_tag LOCUS_t00380 14818 14892 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15241 15062 gene locus_tag LOCUS_32780 15241 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 15948 15646 gene locus_tag LOCUS_32790 15948 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 15829 16692 gene locus_tag LOCUS_32800 15829 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence093 764 201 gene locus_tag LOCUS_32810 764 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 2391 724 gene locus_tag LOCUS_32820 2391 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3550 2579 gene locus_tag LOCUS_32830 3550 2579 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839880.1 protein_id gnl|my_center|LOCUS_32830 4101 3547 gene locus_tag LOCUS_32840 4101 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 5095 4187 gene locus_tag LOCUS_32850 5095 4187 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_32850 5135 5368 gene locus_tag LOCUS_32860 5135 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 5365 5667 gene locus_tag LOCUS_32870 5365 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 6282 6058 gene locus_tag LOCUS_32880 6282 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 6355 7059 gene locus_tag LOCUS_32890 6355 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 7126 8109 gene locus_tag LOCUS_32900 7126 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 8135 8830 gene locus_tag LOCUS_32910 8135 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 9849 8860 gene locus_tag LOCUS_32920 9849 8860 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_32920 10739 9999 gene locus_tag LOCUS_32930 10739 9999 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_32930 12526 10736 gene locus_tag LOCUS_32940 12526 10736 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_32940 12650 15022 gene locus_tag LOCUS_32950 12650 15022 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766169.1 protein_id gnl|my_center|LOCUS_32950 16191 15037 gene locus_tag LOCUS_32960 16191 15037 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665638.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence094 473 1612 gene locus_tag LOCUS_32970 473 1612 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_32970 1629 1901 gene locus_tag LOCUS_32980 1629 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1982 2254 gene locus_tag LOCUS_32990 1982 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2258 2791 gene locus_tag LOCUS_33000 2258 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2788 3000 gene locus_tag LOCUS_33010 2788 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 2993 6865 gene locus_tag LOCUS_33020 2993 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 7124 7999 gene locus_tag LOCUS_33030 7124 7999 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_33030 8829 8002 gene locus_tag LOCUS_33040 8829 8002 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_33040 8986 10266 gene locus_tag LOCUS_33050 8986 10266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_33050 10238 10414 gene locus_tag LOCUS_33060 10238 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 10795 10406 gene locus_tag LOCUS_33070 10795 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 11145 15704 gene locus_tag LOCUS_33080 11145 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence095 285 1202 gene locus_tag LOCUS_33090 285 1202 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_33090 1215 1592 gene locus_tag LOCUS_33100 1215 1592 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792791.1 protein_id gnl|my_center|LOCUS_33100 1643 2503 gene locus_tag LOCUS_33110 1643 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 2500 3285 gene locus_tag LOCUS_33120 2500 3285 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_33120 3298 4599 gene locus_tag LOCUS_33130 3298 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 5244 4663 gene locus_tag LOCUS_33140 5244 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 6218 5265 gene locus_tag LOCUS_33150 6218 5265 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_33150 8226 6382 gene locus_tag LOCUS_33160 gene htpG 8226 6382 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_33160 8405 8638 gene locus_tag LOCUS_33170 8405 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 10516 8927 gene locus_tag LOCUS_33180 10516 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 10454 10624 gene locus_tag LOCUS_33190 10454 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 10732 11898 gene locus_tag LOCUS_33200 10732 11898 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_33200 12069 12647 gene locus_tag LOCUS_33210 12069 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 12733 14907 gene locus_tag LOCUS_33220 12733 14907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence096 96 4 gene locus_tag LOCUS_t00390 96 4 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 829 1440 gene locus_tag LOCUS_33230 829 1440 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_33230 1526 3520 gene locus_tag LOCUS_33240 1526 3520 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_33240 4512 5405 gene locus_tag LOCUS_33250 4512 5405 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_33250 5490 6635 gene locus_tag LOCUS_33260 5490 6635 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_33260 6781 7857 gene locus_tag LOCUS_33270 6781 7857 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_33270 8751 7906 gene locus_tag LOCUS_33280 8751 7906 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_33280 10360 8846 gene locus_tag LOCUS_33290 10360 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345469.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence097 157 561 gene locus_tag LOCUS_33300 157 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 836 648 gene locus_tag LOCUS_33310 836 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 1017 1502 gene locus_tag LOCUS_33320 1017 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 1919 2122 gene locus_tag LOCUS_33330 1919 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 2170 3129 gene locus_tag LOCUS_33340 2170 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3146 4168 gene locus_tag LOCUS_33350 gene pdxA 3146 4168 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_33350 4283 4660 gene locus_tag LOCUS_33360 4283 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 5540 4704 gene locus_tag LOCUS_33370 gene trpC 5540 4704 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_33370 5906 5565 gene locus_tag LOCUS_33380 5906 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 6127 5903 gene locus_tag LOCUS_33390 6127 5903 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_33390 7391 6297 gene locus_tag LOCUS_33400 7391 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 8589 7555 gene locus_tag LOCUS_33410 gene prfB 8589 7555 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130963.1 protein_id gnl|my_center|LOCUS_33410 9068 11092 gene locus_tag LOCUS_33420 9068 11092 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_33420 11773 11093 gene locus_tag LOCUS_33430 11773 11093 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_33430 13521 11887 gene locus_tag LOCUS_33440 13521 11887 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_33440 14919 13996 gene locus_tag LOCUS_33450 gene ribF 14919 13996 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_33450 <15508 14923 gene locus_tag LOCUS_33460 <15508 14923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546120.1:tRNA pseudouridine(55) synthase TruB >Feature sequence098 209 607 gene locus_tag LOCUS_33470 gene crcB 209 607 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_33470 695 1039 gene locus_tag LOCUS_33480 695 1039 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_33480 1341 2021 gene locus_tag LOCUS_33490 1341 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 2147 3454 gene locus_tag LOCUS_33500 2147 3454 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_33500 3454 4806 gene locus_tag LOCUS_33510 gene thrC 3454 4806 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_33510 5052 5834 gene locus_tag LOCUS_33520 gene kdsB 5052 5834 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_33520 5849 6151 gene locus_tag LOCUS_33530 5849 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33530 6157 6495 gene locus_tag LOCUS_33540 6157 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 6717 6541 gene locus_tag LOCUS_33550 6717 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 7199 6927 gene locus_tag LOCUS_33560 7199 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 7445 7813 gene locus_tag LOCUS_33570 7445 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 7872 9563 gene locus_tag LOCUS_33580 7872 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 9560 10078 gene locus_tag LOCUS_33590 9560 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 10039 12045 gene locus_tag LOCUS_33600 10039 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 12529 12095 gene locus_tag LOCUS_33610 12529 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 12740 12540 gene locus_tag LOCUS_33620 12740 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 13562 13365 gene locus_tag LOCUS_33630 13562 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 13985 13897 gene locus_tag LOCUS_t00400 13985 13897 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 132 566 gene locus_tag LOCUS_33640 132 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 521 1003 gene locus_tag LOCUS_33650 521 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 936 1133 gene locus_tag LOCUS_33660 936 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 1259 1939 gene locus_tag LOCUS_33670 1259 1939 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_33670 3676 2024 gene locus_tag LOCUS_33680 3676 2024 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050547433.1 protein_id gnl|my_center|LOCUS_33680 5659 4040 gene locus_tag LOCUS_33690 5659 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 6279 5725 gene locus_tag LOCUS_33700 6279 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 7686 6301 gene locus_tag LOCUS_33710 7686 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 8378 9643 gene locus_tag LOCUS_33720 gene nusA 8378 9643 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_33720 9735 12248 gene locus_tag LOCUS_33730 9735 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 12340 12717 gene locus_tag LOCUS_33740 gene rbfA 12340 12717 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_33740 12714 13697 gene locus_tag LOCUS_33750 12714 13697 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence100 719 108 gene locus_tag LOCUS_33760 719 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1232 1104 gene locus_tag LOCUS_33770 1232 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 1527 1234 gene locus_tag LOCUS_33780 1527 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1724 1524 gene locus_tag LOCUS_33790 1724 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4146 1741 gene locus_tag LOCUS_33800 gene purL 4146 1741 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055555.1 protein_id gnl|my_center|LOCUS_33800 5063 4143 gene locus_tag LOCUS_33810 5063 4143 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_33810 5452 5186 gene locus_tag LOCUS_33820 5452 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 5666 5433 gene locus_tag LOCUS_33830 5666 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6381 5671 gene locus_tag LOCUS_33840 gene purQ 6381 5671 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_33840 6695 6450 gene locus_tag LOCUS_33850 gene purS 6695 6450 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_33850 6876 8429 gene locus_tag LOCUS_33860 gene zwf 6876 8429 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_33860 8918 9934 gene locus_tag LOCUS_33870 8918 9934 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_33870 9939 10919 gene locus_tag LOCUS_33880 9939 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 11497 10934 gene locus_tag LOCUS_33890 11497 10934 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 protein_id gnl|my_center|LOCUS_33890 13438 11606 gene locus_tag LOCUS_33900 13438 11606 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence101 658 891 gene locus_tag LOCUS_33910 658 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 893 1474 gene locus_tag LOCUS_33920 893 1474 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_33920 2411 1644 gene locus_tag LOCUS_33930 2411 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 2507 3490 gene locus_tag LOCUS_33940 2507 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 3504 4724 gene locus_tag LOCUS_33950 gene eboE 3504 4724 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_33950 6243 4702 gene locus_tag LOCUS_33960 6243 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 6890 6240 gene locus_tag LOCUS_33970 6890 6240 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_33970 7090 7815 gene locus_tag LOCUS_33980 gene pyrH 7090 7815 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_33980 7874 8725 gene locus_tag LOCUS_33990 gene mutM 7874 8725 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114617.1 protein_id gnl|my_center|LOCUS_33990 8778 8852 gene locus_tag LOCUS_t00410 8778 8852 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9434 9144 gene locus_tag LOCUS_34000 9434 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 10286 9540 gene locus_tag LOCUS_34010 10286 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243746.1 protein_id gnl|my_center|LOCUS_34010 10475 10290 gene locus_tag LOCUS_34020 10475 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 11027 10488 gene locus_tag LOCUS_34030 11027 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 11224 11024 gene locus_tag LOCUS_34040 11224 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 11439 11167 gene locus_tag LOCUS_34050 11439 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 11539 11751 gene locus_tag LOCUS_34060 11539 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 11735 11962 gene locus_tag LOCUS_34070 11735 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 12132 12533 gene locus_tag LOCUS_34080 12132 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 12616 12936 gene locus_tag LOCUS_34090 12616 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence102 347 595 gene locus_tag LOCUS_34100 347 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 592 759 gene locus_tag LOCUS_34110 592 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 749 1144 gene locus_tag LOCUS_34120 749 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1141 1392 gene locus_tag LOCUS_34130 1141 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 1396 1941 gene locus_tag LOCUS_34140 1396 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 1941 3380 gene locus_tag LOCUS_34150 1941 3380 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_34150 3517 5856 gene locus_tag LOCUS_34160 3517 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 5853 6575 gene locus_tag LOCUS_34170 5853 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 6600 7928 gene locus_tag LOCUS_34180 6600 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 8047 8220 gene locus_tag LOCUS_34190 8047 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 8224 8862 gene locus_tag LOCUS_34200 8224 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 8859 9443 gene locus_tag LOCUS_34210 8859 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 9443 10210 gene locus_tag LOCUS_34220 9443 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 10223 11221 gene locus_tag LOCUS_34230 10223 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 11241 11648 gene locus_tag LOCUS_34240 11241 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence103 1674 256 gene locus_tag LOCUS_34250 1674 256 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_34250 2799 1696 gene locus_tag LOCUS_34260 2799 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3984 2827 gene locus_tag LOCUS_34270 3984 2827 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_34270 4982 4347 gene locus_tag LOCUS_34280 gene snatA 4982 4347 CDS product neutral amino acid NAAT transporter SnatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250610.1 protein_id gnl|my_center|LOCUS_34280 6340 4979 gene locus_tag LOCUS_34290 6340 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 6494 8575 gene locus_tag LOCUS_34300 6494 8575 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638992.1 protein_id gnl|my_center|LOCUS_34300 9878 8595 gene locus_tag LOCUS_34310 9878 8595 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208331.1 protein_id gnl|my_center|LOCUS_34310 10689 10018 gene locus_tag LOCUS_34320 10689 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 11301 10693 gene locus_tag LOCUS_34330 11301 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 11485 12381 gene locus_tag LOCUS_34340 11485 12381 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409725.1 protein_id gnl|my_center|LOCUS_34340 12378 13226 gene locus_tag LOCUS_34350 12378 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence104 <1 1976 gene locus_tag LOCUS_34360 <1 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941497.1:CusA/CzcA family heavy metal efflux RND transporter 2533 3963 gene locus_tag LOCUS_34370 2533 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3960 4877 gene locus_tag LOCUS_34380 3960 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4894 5073 gene locus_tag LOCUS_34390 4894 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 5057 5728 gene locus_tag LOCUS_34400 gene nadD 5057 5728 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_34400 5820 6197 gene locus_tag LOCUS_34410 gene rsfS 5820 6197 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633572.1 protein_id gnl|my_center|LOCUS_34410 6497 6231 gene locus_tag LOCUS_34420 6497 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 8018 6714 gene locus_tag LOCUS_34430 8018 6714 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_34430 9500 8220 gene locus_tag LOCUS_34440 gene argJ 9500 8220 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_34440 10429 9623 gene locus_tag LOCUS_34450 10429 9623 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_34450 11492 10431 gene locus_tag LOCUS_34460 gene argC 11492 10431 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_34460 12008 11610 gene locus_tag LOCUS_34470 gene rpsI 12008 11610 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_34470 12451 12017 gene locus_tag LOCUS_34480 gene rplM 12451 12017 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_34480 13210 12656 gene locus_tag LOCUS_34490 13210 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence105 2140 1367 gene locus_tag LOCUS_34500 2140 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3193 2159 gene locus_tag LOCUS_34510 gene trpD 3193 2159 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_34510 3360 4577 gene locus_tag LOCUS_34520 3360 4577 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_34520 4581 5342 gene locus_tag LOCUS_34530 4581 5342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_34530 5339 6556 gene locus_tag LOCUS_34540 5339 6556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_34540 6597 7658 gene locus_tag LOCUS_34550 6597 7658 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_34550 9495 7660 gene locus_tag LOCUS_34560 9495 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 10854 9499 gene locus_tag LOCUS_34570 10854 9499 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_34570 12192 10954 gene locus_tag LOCUS_34580 12192 10954 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence106 989 417 gene locus_tag LOCUS_34590 989 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34590 1612 884 gene locus_tag LOCUS_34600 1612 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34600 1919 3538 gene locus_tag LOCUS_34610 1919 3538 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_34610 5214 3871 gene locus_tag LOCUS_34620 5214 3871 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_34620 5936 5211 gene locus_tag LOCUS_34630 5936 5211 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 protein_id gnl|my_center|LOCUS_34630 7135 6032 gene locus_tag LOCUS_34640 7135 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 7538 7317 gene locus_tag LOCUS_34650 7538 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34650 7968 7546 gene locus_tag LOCUS_34660 7968 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34660 9619 8042 gene locus_tag LOCUS_34670 9619 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 11555 9624 gene locus_tag LOCUS_34680 gene asnB 11555 9624 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532773.1 protein_id gnl|my_center|LOCUS_34680 11718 11557 gene locus_tag LOCUS_34690 11718 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 12439 12020 gene locus_tag LOCUS_34700 12439 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence107 323 949 gene locus_tag LOCUS_34710 323 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 949 1338 gene locus_tag LOCUS_34720 949 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 2885 1386 gene locus_tag LOCUS_34730 gene purH 2885 1386 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_34730 3150 4610 gene locus_tag LOCUS_34740 3150 4610 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_34740 4779 6155 gene locus_tag LOCUS_34750 4779 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 6204 7235 gene locus_tag LOCUS_34760 6204 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 7232 7573 gene locus_tag LOCUS_34770 7232 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 7656 8477 gene locus_tag LOCUS_34780 gene nadC 7656 8477 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_34780 8474 9451 gene locus_tag LOCUS_34790 8474 9451 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_34790 9543 10292 gene locus_tag LOCUS_34800 9543 10292 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_34800 10296 11618 gene locus_tag LOCUS_34810 10296 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 11862 12428 gene locus_tag LOCUS_34820 11862 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34820 >Feature sequence108 322 1077 gene locus_tag LOCUS_34830 322 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 1102 2112 gene locus_tag LOCUS_34840 1102 2112 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_34840 2188 2412 gene locus_tag LOCUS_34850 2188 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2435 2611 gene locus_tag LOCUS_34860 2435 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2619 2942 gene locus_tag LOCUS_34870 2619 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2899 3486 gene locus_tag LOCUS_34880 2899 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3990 5261 gene locus_tag LOCUS_34890 3990 5261 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_34890 5267 5605 gene locus_tag LOCUS_34900 5267 5605 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_34900 6698 5718 gene locus_tag LOCUS_34910 6698 5718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_34910 7709 6705 gene locus_tag LOCUS_34920 7709 6705 CDS product Ppx/GppA phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391641.1 protein_id gnl|my_center|LOCUS_34920 7985 9652 gene locus_tag LOCUS_34930 7985 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 9754 11061 gene locus_tag LOCUS_34940 9754 11061 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_34940 11080 11952 gene locus_tag LOCUS_34950 11080 11952 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 protein_id gnl|my_center|LOCUS_34950 12236 11955 gene locus_tag LOCUS_34960 12236 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence109 347 66 gene locus_tag LOCUS_34970 gene eutM 347 66 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_34970 1857 544 gene locus_tag LOCUS_34980 1857 544 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_34980 2201 1944 gene locus_tag LOCUS_34990 2201 1944 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_34990 2540 2256 gene locus_tag LOCUS_35000 2540 2256 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_35000 3401 2724 gene locus_tag LOCUS_35010 3401 2724 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_35010 3827 4873 gene locus_tag LOCUS_35020 3827 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4907 5278 gene locus_tag LOCUS_35030 4907 5278 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106458570.1 protein_id gnl|my_center|LOCUS_35030 5342 6127 gene locus_tag LOCUS_35040 5342 6127 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_35040 6212 6388 gene locus_tag LOCUS_35050 6212 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 6641 7054 gene locus_tag LOCUS_35060 6641 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 7099 7025 gene locus_tag LOCUS_t00420 7099 7025 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8288 7680 gene locus_tag LOCUS_35070 8288 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 10543 8444 gene locus_tag LOCUS_35080 gene fusA 10543 8444 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931838.1 protein_id gnl|my_center|LOCUS_35080 10680 12335 gene locus_tag LOCUS_35090 10680 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence110 <1 1437 gene locus_tag LOCUS_35100 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024698054.1:IS66 family transposase 8393 1668 gene locus_tag LOCUS_35110 8393 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 9816 8434 gene locus_tag LOCUS_35120 9816 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence111 2232 205 gene locus_tag LOCUS_35130 2232 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 2467 3576 gene locus_tag LOCUS_35140 2467 3576 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_35140 3716 4678 gene locus_tag LOCUS_35150 gene fba 3716 4678 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_35150 5406 4813 gene locus_tag LOCUS_35160 5406 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 7281 5764 gene locus_tag LOCUS_35170 7281 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 9772 7379 gene locus_tag LOCUS_35180 9772 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 9998 10342 gene locus_tag LOCUS_35190 9998 10342 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence112 1766 516 gene locus_tag LOCUS_35200 1766 516 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_35200 4400 1872 gene locus_tag LOCUS_35210 4400 1872 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639999.1 protein_id gnl|my_center|LOCUS_35210 6745 4397 gene locus_tag LOCUS_35220 6745 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 6847 7749 gene locus_tag LOCUS_35230 6847 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 8115 7885 gene locus_tag LOCUS_35240 8115 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 8716 9882 gene locus_tag LOCUS_35250 8716 9882 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974302.1 protein_id gnl|my_center|LOCUS_35250 10461 10060 gene locus_tag LOCUS_35260 10461 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 10766 10458 gene locus_tag LOCUS_35270 10766 10458 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 protein_id gnl|my_center|LOCUS_35270 11008 10763 gene locus_tag LOCUS_35280 11008 10763 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948081.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence113 1029 289 gene locus_tag LOCUS_35290 gene queE 1029 289 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118723.1 protein_id gnl|my_center|LOCUS_35290 1176 2735 gene locus_tag LOCUS_35300 1176 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 2789 4045 gene locus_tag LOCUS_35310 2789 4045 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_35310 4922 4053 gene locus_tag LOCUS_35320 gene thiD 4922 4053 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_35320 5828 4962 gene locus_tag LOCUS_35330 5828 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 5929 7665 gene locus_tag LOCUS_35340 gene polX 5929 7665 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_35340 7926 9113 gene locus_tag LOCUS_35350 7926 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence114 718 191 gene locus_tag LOCUS_35360 gene efp 718 191 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_35360 900 1355 gene locus_tag LOCUS_35370 gene nrdR 900 1355 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894570.1 protein_id gnl|my_center|LOCUS_35370 1352 1909 gene locus_tag LOCUS_35380 1352 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 1981 2322 gene locus_tag LOCUS_35390 1981 2322 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_35390 2894 2328 gene locus_tag LOCUS_35400 gene pyrE 2894 2328 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_35400 2998 3651 gene locus_tag LOCUS_35410 2998 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3717 4181 gene locus_tag LOCUS_35420 3717 4181 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069646.1 protein_id gnl|my_center|LOCUS_35420 4283 6043 gene locus_tag LOCUS_35430 gene argS 4283 6043 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025371.1 protein_id gnl|my_center|LOCUS_35430 6443 7249 gene locus_tag LOCUS_35440 6443 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 7353 7544 gene locus_tag LOCUS_35450 7353 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 7460 7888 gene locus_tag LOCUS_35460 7460 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 9136 8603 gene locus_tag LOCUS_35470 9136 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 10793 9159 gene locus_tag LOCUS_35480 10793 9159 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_35480 >Feature sequence115 1136 2248 gene locus_tag LOCUS_35490 1136 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 2296 2380 gene locus_tag LOCUS_t00430 2296 2380 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3057 2680 gene locus_tag LOCUS_35500 3057 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 3245 3054 gene locus_tag LOCUS_35510 3245 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3772 5451 gene locus_tag LOCUS_35520 gene cysI 3772 5451 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_35520 6176 5547 gene locus_tag LOCUS_35530 6176 5547 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_35530 6288 6962 gene locus_tag LOCUS_35540 6288 6962 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 protein_id gnl|my_center|LOCUS_35540 7058 7996 gene locus_tag LOCUS_35550 gene cysD 7058 7996 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_35550 8000 8524 gene locus_tag LOCUS_35560 8000 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 8530 9849 gene locus_tag LOCUS_35570 8530 9849 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence116 1527 289 gene locus_tag LOCUS_35580 1527 289 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_35580 2155 1604 gene locus_tag LOCUS_35590 gene sufT 2155 1604 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_35590 2650 2195 gene locus_tag LOCUS_35600 2650 2195 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_35600 4089 2737 gene locus_tag LOCUS_35610 gene sufD 4089 2737 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_35610 6921 4258 gene locus_tag LOCUS_35620 6921 4258 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108155.1 protein_id gnl|my_center|LOCUS_35620 7245 6931 gene locus_tag LOCUS_35630 7245 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 8112 7315 gene locus_tag LOCUS_35640 8112 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776583.1 protein_id gnl|my_center|LOCUS_35640 9323 8115 gene locus_tag LOCUS_35650 9323 8115 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_35650 9740 9483 gene locus_tag LOCUS_35660 9740 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 <10570 10051 gene locus_tag LOCUS_35670 <10570 10051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038753.1:glycosyltransferase >Feature sequence117 253 1440 gene locus_tag LOCUS_35680 253 1440 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_35680 2142 1552 gene locus_tag LOCUS_35690 2142 1552 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_35690 2617 2126 gene locus_tag LOCUS_35700 2617 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 2922 2620 gene locus_tag LOCUS_35710 2922 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 3370 3020 gene locus_tag LOCUS_35720 3370 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3916 3572 gene locus_tag LOCUS_35730 3916 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 4921 4076 gene locus_tag LOCUS_35740 4921 4076 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074724765.1 protein_id gnl|my_center|LOCUS_35740 5302 5637 gene locus_tag LOCUS_35750 5302 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 5795 6331 gene locus_tag LOCUS_35760 5795 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 6976 8313 gene locus_tag LOCUS_35770 6976 8313 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444633.1 protein_id gnl|my_center|LOCUS_35770 8322 10172 gene locus_tag LOCUS_35780 8322 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 >Feature sequence118 649 356 gene locus_tag LOCUS_35790 649 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 1659 1165 gene locus_tag LOCUS_35800 1659 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1976 1656 gene locus_tag LOCUS_35810 1976 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 2551 1973 gene locus_tag LOCUS_35820 2551 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 2765 2580 gene locus_tag LOCUS_35830 2765 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 3328 2762 gene locus_tag LOCUS_35840 3328 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3549 3325 gene locus_tag LOCUS_35850 3549 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 4691 3546 gene locus_tag LOCUS_35860 4691 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 6379 4715 gene locus_tag LOCUS_35870 6379 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 7053 6826 gene locus_tag LOCUS_35880 7053 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 8023 7100 gene locus_tag LOCUS_35890 8023 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 8214 8020 gene locus_tag LOCUS_35900 8214 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 8474 8211 gene locus_tag LOCUS_35910 8474 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 8665 8471 gene locus_tag LOCUS_35920 8665 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 8782 9123 gene locus_tag LOCUS_35930 8782 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 9331 9726 gene locus_tag LOCUS_35940 9331 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 >Feature sequence119 289 2589 gene locus_tag LOCUS_35950 289 2589 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_35950 2708 5308 gene locus_tag LOCUS_35960 2708 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 5573 6880 gene locus_tag LOCUS_35970 5573 6880 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_35970 8151 7180 gene locus_tag LOCUS_35980 8151 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 8792 8148 gene locus_tag LOCUS_35990 8792 8148 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence120 1958 1227 gene locus_tag LOCUS_36000 1958 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3842 1962 gene locus_tag LOCUS_36010 3842 1962 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_36010 4304 3924 gene locus_tag LOCUS_36020 4304 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 5219 4314 gene locus_tag LOCUS_36030 gene rsmH 5219 4314 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_36030 5743 5255 gene locus_tag LOCUS_36040 5743 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 6270 5746 gene locus_tag LOCUS_36050 6270 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 6391 7464 gene locus_tag LOCUS_36060 gene queA 6391 7464 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_36060 7472 8173 gene locus_tag LOCUS_36070 7472 8173 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902910.1 protein_id gnl|my_center|LOCUS_36070 8726 8199 gene locus_tag LOCUS_36080 8726 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 8993 8733 gene locus_tag LOCUS_36090 8993 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence121 1520 282 gene locus_tag LOCUS_36100 gene hisS 1520 282 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_36100 1987 1688 gene locus_tag LOCUS_36110 1987 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3252 2515 gene locus_tag LOCUS_36120 3252 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 4397 3666 gene locus_tag LOCUS_36130 4397 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 5050 4370 gene locus_tag LOCUS_36140 5050 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 5572 6942 gene locus_tag LOCUS_36150 5572 6942 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_36150 7576 7025 gene locus_tag LOCUS_36160 7576 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 <9249 7687 gene locus_tag LOCUS_36170 <9249 7687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123734.1:tetratricopeptide repeat protein >Feature sequence122 <1 763 gene locus_tag LOCUS_36180 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541595.1:radical SAM protein 2244 1480 gene locus_tag LOCUS_36190 2244 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3187 2246 gene locus_tag LOCUS_36200 3187 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3534 3184 gene locus_tag LOCUS_36210 3534 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4349 4053 gene locus_tag LOCUS_36220 4349 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 4807 5013 gene locus_tag LOCUS_36230 4807 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 7445 4953 gene locus_tag LOCUS_36240 7445 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 7673 9211 gene locus_tag LOCUS_36250 7673 9211 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence123 229 411 gene locus_tag LOCUS_36260 229 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 722 4630 gene locus_tag LOCUS_36270 722 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 4714 5607 gene locus_tag LOCUS_36280 4714 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 5774 7000 gene locus_tag LOCUS_36290 5774 7000 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_36290 7056 8297 gene locus_tag LOCUS_36300 7056 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 8364 8756 gene locus_tag LOCUS_36310 8364 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence124 267 449 gene locus_tag LOCUS_36320 267 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 504 689 gene locus_tag LOCUS_36330 504 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 674 976 gene locus_tag LOCUS_36340 674 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1326 1856 gene locus_tag LOCUS_36350 1326 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 2965 1877 gene locus_tag LOCUS_36360 2965 1877 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_36360 3768 3073 gene locus_tag LOCUS_36370 3768 3073 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_36370 4702 3854 gene locus_tag LOCUS_36380 4702 3854 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957563.1 protein_id gnl|my_center|LOCUS_36380 5482 4877 gene locus_tag LOCUS_36390 5482 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 7164 6484 gene locus_tag LOCUS_36400 7164 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 7499 8194 gene locus_tag LOCUS_36410 7499 8194 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence125 332 126 gene locus_tag LOCUS_36420 332 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 231 1040 gene locus_tag LOCUS_36430 231 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1439 1807 gene locus_tag LOCUS_36440 1439 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 2618 1917 gene locus_tag LOCUS_36450 gene rsmI 2618 1917 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_36450 3823 2756 gene locus_tag LOCUS_36460 gene gap 3823 2756 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_36460 4243 4683 gene locus_tag LOCUS_36470 4243 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 4849 5538 gene locus_tag LOCUS_36480 4849 5538 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_36480 5583 6626 gene locus_tag LOCUS_36490 5583 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 6629 7162 gene locus_tag LOCUS_36500 6629 7162 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972163.1 protein_id gnl|my_center|LOCUS_36500 7170 7934 gene locus_tag LOCUS_36510 7170 7934 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943189.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence126 838 155 gene locus_tag LOCUS_36520 gene deoC 838 155 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_36520 2326 845 gene locus_tag LOCUS_36530 gene purF 2326 845 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_36530 2488 3243 gene locus_tag LOCUS_36540 2488 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 4509 3331 gene locus_tag LOCUS_36550 4509 3331 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138985883.1 protein_id gnl|my_center|LOCUS_36550 5445 5017 gene locus_tag LOCUS_36560 5445 5017 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_36560 6947 5529 gene locus_tag LOCUS_36570 6947 5529 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_36570 7499 6990 gene locus_tag LOCUS_36580 7499 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence127 <1 872 gene locus_tag LOCUS_36590 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001129615.1:MBL fold metallo-hydrolase 869 2353 gene locus_tag LOCUS_36600 869 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 2935 2342 gene locus_tag LOCUS_36610 2935 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 4013 2958 gene locus_tag LOCUS_36620 4013 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 4106 4462 gene locus_tag LOCUS_36630 4106 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 4459 5313 gene locus_tag LOCUS_36640 4459 5313 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_36640 5325 6056 gene locus_tag LOCUS_36650 5325 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 6429 7679 gene locus_tag LOCUS_36660 6429 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence128 795 355 gene locus_tag LOCUS_36670 795 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 1304 852 gene locus_tag LOCUS_36680 1304 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1496 2554 gene locus_tag LOCUS_36690 gene carA 1496 2554 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_36690 2623 3183 gene locus_tag LOCUS_36700 2623 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 3559 4206 gene locus_tag LOCUS_36710 gene thiE 3559 4206 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_36710 4833 4249 gene locus_tag LOCUS_36720 4833 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 6205 5174 gene locus_tag LOCUS_36730 6205 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 6611 6321 gene locus_tag LOCUS_36740 6611 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 6820 6596 gene locus_tag LOCUS_36750 6820 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 6975 7340 gene locus_tag LOCUS_36760 6975 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence129 <1 1215 gene locus_tag LOCUS_36770 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946170.1:sugar porter family MFS transporter 1252 2685 gene locus_tag LOCUS_36780 1252 2685 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_36780 2833 4803 gene locus_tag LOCUS_36790 2833 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 4800 6173 gene locus_tag LOCUS_36800 4800 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 6177 7034 gene locus_tag LOCUS_36810 6177 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence130 795 91 gene locus_tag LOCUS_36820 795 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537623.1 protein_id gnl|my_center|LOCUS_36820 1275 799 gene locus_tag LOCUS_36830 1275 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 1500 1285 gene locus_tag LOCUS_36840 1500 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 2386 1847 gene locus_tag LOCUS_36850 2386 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2626 2414 gene locus_tag LOCUS_36860 2626 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3093 2659 gene locus_tag LOCUS_36870 3093 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 4279 3119 gene locus_tag LOCUS_36880 4279 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 6436 4301 gene locus_tag LOCUS_36890 6436 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 7271 6594 gene locus_tag LOCUS_36900 7271 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence131 3094 1163 gene locus_tag LOCUS_36910 3094 1163 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_36910 3804 3097 gene locus_tag LOCUS_36920 3804 3097 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_36920 7015 3869 gene locus_tag LOCUS_36930 7015 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence132 858 1415 gene locus_tag LOCUS_36940 858 1415 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_36940 1482 3803 gene locus_tag LOCUS_36950 1482 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4031 3807 gene locus_tag LOCUS_36960 4031 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 4922 4113 gene locus_tag LOCUS_36970 4922 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 5981 4998 gene locus_tag LOCUS_36980 5981 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 6402 6911 gene locus_tag LOCUS_36990 6402 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence133 174 2759 gene locus_tag LOCUS_37000 174 2759 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_37000 2766 4703 gene locus_tag LOCUS_37010 2766 4703 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_37010 6423 4822 gene locus_tag LOCUS_37020 6423 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 6783 6708 gene locus_tag LOCUS_t00440 6783 6708 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 2 835 gene locus_tag LOCUS_37030 2 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 899 3085 gene locus_tag LOCUS_37040 gene recQ 899 3085 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_37040 5587 3299 gene locus_tag LOCUS_37050 5587 3299 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178933861.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence135 686 844 gene locus_tag LOCUS_37060 686 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 1302 841 gene locus_tag LOCUS_37070 1302 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 1511 1299 gene locus_tag LOCUS_37080 1511 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 1677 1537 gene locus_tag LOCUS_37090 1677 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 2839 1817 gene locus_tag LOCUS_37100 gene ilvC 2839 1817 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880791.1 protein_id gnl|my_center|LOCUS_37100 3362 2889 gene locus_tag LOCUS_37110 gene ilvN 3362 2889 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_37110 4938 3448 gene locus_tag LOCUS_37120 gene gatA 4938 3448 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_37120 5234 4947 gene locus_tag LOCUS_37130 gene gatC 5234 4947 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_37130 5710 5414 gene locus_tag LOCUS_37140 5710 5414 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_37140 6731 5763 gene locus_tag LOCUS_37150 gene hprK 6731 5763 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence136 139 1338 gene locus_tag LOCUS_37160 gene alr 139 1338 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_37160 1463 2263 gene locus_tag LOCUS_37170 1463 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3359 2322 gene locus_tag LOCUS_37180 3359 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 3445 4485 gene locus_tag LOCUS_37190 3445 4485 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_37190 4721 5587 gene locus_tag LOCUS_37200 4721 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 6044 6310 gene locus_tag LOCUS_37210 6044 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 6303 6710 gene locus_tag LOCUS_37220 6303 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence137 1066 512 gene locus_tag LOCUS_37230 1066 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 1159 1506 gene locus_tag LOCUS_37240 1159 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 1503 1709 gene locus_tag LOCUS_37250 1503 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3243 1924 gene locus_tag LOCUS_37260 3243 1924 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_37260 5425 3284 gene locus_tag LOCUS_37270 5425 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 6444 5491 gene locus_tag LOCUS_37280 6444 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence138 <1 1393 gene locus_tag LOCUS_37290 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545424.1:glutamine-hydrolyzing GMP synthase 2342 1656 gene locus_tag LOCUS_37300 2342 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 2513 3331 gene locus_tag LOCUS_37310 gene proC 2513 3331 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_37310 4621 3476 gene locus_tag LOCUS_37320 4621 3476 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_37320 4853 4668 gene locus_tag LOCUS_37330 4853 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 5363 4941 gene locus_tag LOCUS_37340 5363 4941 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_37340 5650 5360 gene locus_tag LOCUS_37350 5650 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 5568 5861 gene locus_tag LOCUS_37360 5568 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence139 2982 670 gene locus_tag LOCUS_37370 2982 670 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_37370 4280 3003 gene locus_tag LOCUS_37380 4280 3003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_37380 4694 4302 gene locus_tag LOCUS_37390 4694 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 5137 4703 gene locus_tag LOCUS_37400 gene fliS 5137 4703 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704959.1 protein_id gnl|my_center|LOCUS_37400 5478 5191 gene locus_tag LOCUS_37410 5478 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence140 707 525 gene locus_tag LOCUS_37420 707 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 1766 744 gene locus_tag LOCUS_37430 1766 744 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_37430 2755 1763 gene locus_tag LOCUS_37440 2755 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 3501 2770 gene locus_tag LOCUS_37450 3501 2770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_37450 4280 3498 gene locus_tag LOCUS_37460 4280 3498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_37460 4385 4963 gene locus_tag LOCUS_37470 4385 4963 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974184.1 protein_id gnl|my_center|LOCUS_37470 5294 4950 gene locus_tag LOCUS_37480 5294 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence141 739 338 gene locus_tag LOCUS_37490 739 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 2564 741 gene locus_tag LOCUS_37500 2564 741 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_37500 2917 3735 gene locus_tag LOCUS_37510 2917 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 3773 4471 gene locus_tag LOCUS_37520 3773 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 5498 4575 gene locus_tag LOCUS_37530 gene miaA 5498 4575 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence142 354 1442 gene locus_tag LOCUS_37540 354 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 1439 2200 gene locus_tag LOCUS_37550 1439 2200 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_37550 2356 5271 gene locus_tag LOCUS_37560 2356 5271 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence143 244 1404 gene locus_tag LOCUS_37570 244 1404 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_37570 1409 2449 gene locus_tag LOCUS_37580 gene galT 1409 2449 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_37580 3867 2725 gene locus_tag LOCUS_37590 3867 2725 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_37590 5381 3864 gene locus_tag LOCUS_37600 5381 3864 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_37600 >Feature sequence144 <1 971 gene locus_tag LOCUS_37610 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009292032.1:GH92 family glycosyl hydrolase 1753 3303 gene locus_tag LOCUS_37620 1753 3303 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_37620 3340 4458 gene locus_tag LOCUS_37630 3340 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence145 2500 560 gene locus_tag LOCUS_37640 gene speA 2500 560 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_37640 3164 2670 gene locus_tag LOCUS_37650 3164 2670 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926836.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence146 1383 43 gene locus_tag LOCUS_37660 1383 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 46 138 gene locus_tag LOCUS_t00450 46 138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2310 1603 gene locus_tag LOCUS_37670 2310 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 3748 2645 gene locus_tag LOCUS_37680 gene arsB 3748 2645 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence147 639 938 gene locus_tag LOCUS_37690 639 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 1124 2350 gene locus_tag LOCUS_37700 1124 2350 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_37700 2354 3154 gene locus_tag LOCUS_37710 2354 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 3102 3410 gene locus_tag LOCUS_37720 3102 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 >Feature sequence148 239 1444 gene locus_tag LOCUS_37730 239 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2564 1503 gene locus_tag LOCUS_37740 2564 1503 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_37740 3340 2561 gene locus_tag LOCUS_37750 3340 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 >Feature sequence149 3591 2197 gene locus_tag LOCUS_37760 gene hemG 3591 2197 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence150 98 322 gene locus_tag LOCUS_37770 98 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 448 2139 gene locus_tag LOCUS_37780 448 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 2136 3113 gene locus_tag LOCUS_37790 2136 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3467 3658 gene locus_tag LOCUS_37800 3467 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 >Feature sequence151 368 733 gene locus_tag LOCUS_37810 368 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37810 730 1179 gene locus_tag LOCUS_37820 730 1179 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_37820 1190 2035 gene locus_tag LOCUS_37830 1190 2035 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_37830 2043 2489 gene locus_tag LOCUS_37840 2043 2489 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023042.1 protein_id gnl|my_center|LOCUS_37840 2671 3060 gene locus_tag LOCUS_37850 2671 3060 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_37850 >Feature sequence152 476 721 gene locus_tag LOCUS_37860 476 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 1696 1019 gene locus_tag LOCUS_37870 1696 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 2230 1781 gene locus_tag LOCUS_37880 2230 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 2910 2596 gene locus_tag LOCUS_37890 2910 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence153 2130 2960 gene locus_tag LOCUS_37900 2130 2960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence154 172 864 gene locus_tag LOCUS_37910 172 864 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37910 1607 909 gene locus_tag LOCUS_37920 1607 909 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_37920 2183 1611 gene locus_tag LOCUS_37930 2183 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 2670 2197 gene locus_tag LOCUS_37940 2670 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence155 1855 2112 gene locus_tag LOCUS_37950 1855 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 2161 2439 gene locus_tag LOCUS_37960 2161 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence156 1498 1917 gene locus_tag LOCUS_37970 1498 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 >Feature sequence157 731 105 gene locus_tag LOCUS_37980 731 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 921 724 gene locus_tag LOCUS_37990 921 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 986 2044 gene locus_tag LOCUS_38000 gene purM 986 2044 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence158 1415 306 gene locus_tag LOCUS_38010 1415 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 2099 1791 gene locus_tag LOCUS_38020 2099 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence159 341 1672 gene locus_tag LOCUS_38030 341 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 >Feature sequence160 1334 180 gene locus_tag LOCUS_38040 1334 180 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_38040 >Feature sequence161 462 755 gene locus_tag LOCUS_38050 462 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 1276 1500 gene locus_tag LOCUS_38060 1276 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060