>Feature sequence001 1142 192 gene locus_tag LOCUS_00010 1142 192 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_00010 1570 1220 gene locus_tag LOCUS_00020 1570 1220 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_00020 2451 1606 gene locus_tag LOCUS_00030 gene panC 2451 1606 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_00030 2611 3435 gene locus_tag LOCUS_00040 2611 3435 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_00040 3428 4768 gene locus_tag LOCUS_00050 3428 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4775 6610 gene locus_tag LOCUS_00060 gene glmS 4775 6610 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_00060 8860 6707 gene locus_tag LOCUS_00070 8860 6707 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_00070 9645 9028 gene locus_tag LOCUS_00080 9645 9028 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_00080 10857 9730 gene locus_tag LOCUS_00090 10857 9730 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_00090 11779 10865 gene locus_tag LOCUS_00100 11779 10865 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 protein_id gnl|my_center|LOCUS_00100 12387 11791 gene locus_tag LOCUS_00110 12387 11791 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_00110 13794 12430 gene locus_tag LOCUS_00120 13794 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14144 16171 gene locus_tag LOCUS_00130 14144 16171 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_00130 16711 16271 gene locus_tag LOCUS_00140 16711 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17280 18212 gene locus_tag LOCUS_00150 17280 18212 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_00150 18243 20063 gene locus_tag LOCUS_00160 18243 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20119 20937 gene locus_tag LOCUS_00170 20119 20937 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_00170 20957 21586 gene locus_tag LOCUS_00180 20957 21586 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 protein_id gnl|my_center|LOCUS_00180 21590 22252 gene locus_tag LOCUS_00190 21590 22252 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_00190 22273 23049 gene locus_tag LOCUS_00200 22273 23049 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_00200 23260 23955 gene locus_tag LOCUS_00210 23260 23955 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_00210 24339 25112 gene locus_tag LOCUS_00220 24339 25112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25188 25970 gene locus_tag LOCUS_00230 25188 25970 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_00230 26183 26680 gene locus_tag LOCUS_00240 26183 26680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27026 26727 gene locus_tag LOCUS_00250 27026 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28519 27107 gene locus_tag LOCUS_00260 28519 27107 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_00260 29970 28540 gene locus_tag LOCUS_00270 29970 28540 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_00270 32013 30076 gene locus_tag LOCUS_00280 gene nuoL 32013 30076 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_00280 32246 32019 gene locus_tag LOCUS_00290 32246 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32904 32392 gene locus_tag LOCUS_00300 32904 32392 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_00300 33383 32901 gene locus_tag LOCUS_00310 33383 32901 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_00310 34489 33404 gene locus_tag LOCUS_00320 gene nuoH 34489 33404 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109091.1 protein_id gnl|my_center|LOCUS_00320 35647 34523 gene locus_tag LOCUS_00330 35647 34523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00330 36115 35657 gene locus_tag LOCUS_00340 36115 35657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36694 36143 gene locus_tag LOCUS_00350 36694 36143 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109092.1 protein_id gnl|my_center|LOCUS_00350 37035 36685 gene locus_tag LOCUS_00360 37035 36685 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_00360 39416 37539 gene locus_tag LOCUS_00370 39416 37539 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_00370 41239 39578 gene locus_tag LOCUS_00380 41239 39578 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922627.1 protein_id gnl|my_center|LOCUS_00380 42081 41236 gene locus_tag LOCUS_00390 42081 41236 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_00390 43050 42313 gene locus_tag LOCUS_00400 43050 42313 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_00400 44619 43144 gene locus_tag LOCUS_00410 gene glpK 44619 43144 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_00410 46210 44651 gene locus_tag LOCUS_00420 46210 44651 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_00420 46455 46382 gene locus_tag LOCUS_t00010 46455 46382 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 48289 46568 gene locus_tag LOCUS_00430 48289 46568 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_00430 48487 49908 gene locus_tag LOCUS_00440 48487 49908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49916 50266 gene locus_tag LOCUS_00450 gene folB 49916 50266 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_00450 50459 50665 gene locus_tag LOCUS_00460 50459 50665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50815 50886 gene locus_tag LOCUS_t00020 50815 50886 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51090 51545 gene locus_tag LOCUS_00470 51090 51545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51917 51561 gene locus_tag LOCUS_00480 51917 51561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52174 51914 gene locus_tag LOCUS_00490 52174 51914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52388 52155 gene locus_tag LOCUS_00500 52388 52155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52678 52385 gene locus_tag LOCUS_00510 52678 52385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 53994 52705 gene locus_tag LOCUS_00520 53994 52705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54260 53991 gene locus_tag LOCUS_00530 54260 53991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54553 54260 gene locus_tag LOCUS_00540 54553 54260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55829 54645 gene locus_tag LOCUS_00550 55829 54645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57190 55829 gene locus_tag LOCUS_00560 57190 55829 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_00560 57736 59364 gene locus_tag LOCUS_00570 57736 59364 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_00570 59557 60069 gene locus_tag LOCUS_00580 59557 60069 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_00580 60954 60103 gene locus_tag LOCUS_00590 60954 60103 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_00590 61592 61155 gene locus_tag LOCUS_00600 61592 61155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009777.1 protein_id gnl|my_center|LOCUS_00600 62396 61761 gene locus_tag LOCUS_00610 62396 61761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245013.1 protein_id gnl|my_center|LOCUS_00610 62729 62499 gene locus_tag LOCUS_00620 62729 62499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784731.1 protein_id gnl|my_center|LOCUS_00620 64297 62849 gene locus_tag LOCUS_00630 64297 62849 CDS product O-unit flippase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461036.1 protein_id gnl|my_center|LOCUS_00630 64734 64336 gene locus_tag LOCUS_00640 64734 64336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65474 64731 gene locus_tag LOCUS_00650 65474 64731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 65638 66837 gene locus_tag LOCUS_00660 65638 66837 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_00660 69252 66838 gene locus_tag LOCUS_00670 69252 66838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_00670 69824 69420 gene locus_tag LOCUS_00680 69824 69420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 70356 69835 gene locus_tag LOCUS_00690 70356 69835 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_00690 70946 70482 gene locus_tag LOCUS_00700 gene rnhA 70946 70482 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_00700 72001 70949 gene locus_tag LOCUS_00710 gene rfbB 72001 70949 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_00710 73045 72011 gene locus_tag LOCUS_00720 gene galE 73045 72011 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_00720 74351 73059 gene locus_tag LOCUS_00730 74351 73059 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_00730 75308 74355 gene locus_tag LOCUS_00740 75308 74355 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_00740 75886 75305 gene locus_tag LOCUS_00750 75886 75305 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_00750 77016 75889 gene locus_tag LOCUS_00760 77016 75889 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_00760 77158 78132 gene locus_tag LOCUS_00770 77158 78132 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_00770 78252 79202 gene locus_tag LOCUS_00780 78252 79202 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_00780 79251 80441 gene locus_tag LOCUS_00790 gene kbl 79251 80441 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_00790 83179 80549 gene locus_tag LOCUS_00800 83179 80549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 84549 83341 gene locus_tag LOCUS_00810 84549 83341 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_00810 85729 84731 gene locus_tag LOCUS_00820 85729 84731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 85948 88290 gene locus_tag LOCUS_00830 85948 88290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 88539 88291 gene locus_tag LOCUS_00840 88539 88291 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_00840 89748 88639 gene locus_tag LOCUS_00850 89748 88639 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_00850 89919 91142 gene locus_tag LOCUS_00860 89919 91142 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_00860 91465 94053 gene locus_tag LOCUS_00870 91465 94053 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_00870 94283 94456 gene locus_tag LOCUS_00880 94283 94456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 95279 96667 gene locus_tag LOCUS_00890 95279 96667 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_00890 96912 99794 gene locus_tag LOCUS_00900 96912 99794 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_00900 99904 101118 gene locus_tag LOCUS_00910 99904 101118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 101745 101200 gene locus_tag LOCUS_00920 101745 101200 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258312.1 protein_id gnl|my_center|LOCUS_00920 102131 103669 gene locus_tag LOCUS_00930 102131 103669 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_00930 103669 104805 gene locus_tag LOCUS_00940 gene cydB 103669 104805 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_00940 105855 105076 gene locus_tag LOCUS_00950 105855 105076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 107215 105953 gene locus_tag LOCUS_00960 107215 105953 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_00960 107393 108523 gene locus_tag LOCUS_00970 107393 108523 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_00970 108623 110641 gene locus_tag LOCUS_00980 108623 110641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 110791 112341 gene locus_tag LOCUS_00990 110791 112341 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_00990 114155 112518 gene locus_tag LOCUS_01000 114155 112518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 114675 114220 gene locus_tag LOCUS_01010 114675 114220 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_01010 114808 115782 gene locus_tag LOCUS_01020 114808 115782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 115838 116335 gene locus_tag LOCUS_01030 115838 116335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 116332 116613 gene locus_tag LOCUS_01040 116332 116613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 117569 116610 gene locus_tag LOCUS_01050 117569 116610 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_01050 118008 117703 gene locus_tag LOCUS_01060 118008 117703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 119273 118083 gene locus_tag LOCUS_01070 119273 118083 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_01070 120422 119334 gene locus_tag LOCUS_01080 gene mtnA 120422 119334 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_01080 121156 120425 gene locus_tag LOCUS_01090 121156 120425 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_01090 122604 121531 gene locus_tag LOCUS_01100 122604 121531 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_01100 124039 122906 gene locus_tag LOCUS_01110 124039 122906 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_01110 124360 126927 gene locus_tag LOCUS_01120 124360 126927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 127939 126932 gene locus_tag LOCUS_01130 127939 126932 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047778.1 protein_id gnl|my_center|LOCUS_01130 130525 128246 gene locus_tag LOCUS_01140 130525 128246 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082096.1 protein_id gnl|my_center|LOCUS_01140 131196 130564 gene locus_tag LOCUS_01150 131196 130564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 132201 131290 gene locus_tag LOCUS_01160 gene corA 132201 131290 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_01160 133422 132364 gene locus_tag LOCUS_01170 133422 132364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 134233 133433 gene locus_tag LOCUS_01180 134233 133433 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_01180 135569 134235 gene locus_tag LOCUS_01190 135569 134235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 136535 135603 gene locus_tag LOCUS_01200 136535 135603 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_01200 136755 137498 gene locus_tag LOCUS_01210 136755 137498 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_01210 137835 138752 gene locus_tag LOCUS_01220 137835 138752 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_01220 138858 139256 gene locus_tag LOCUS_01230 gene mscL 138858 139256 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054763.1 protein_id gnl|my_center|LOCUS_01230 139361 140218 gene locus_tag LOCUS_01240 139361 140218 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_01240 140372 141688 gene locus_tag LOCUS_01250 140372 141688 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966868.1 protein_id gnl|my_center|LOCUS_01250 141843 142247 gene locus_tag LOCUS_01260 141843 142247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 142341 142781 gene locus_tag LOCUS_01270 142341 142781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 142984 143535 gene locus_tag LOCUS_01280 142984 143535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 143483 143884 gene locus_tag LOCUS_01290 143483 143884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143868 144695 gene locus_tag LOCUS_01300 143868 144695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 144646 145506 gene locus_tag LOCUS_01310 144646 145506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 145574 147772 gene locus_tag LOCUS_01320 145574 147772 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_01320 148475 147777 gene locus_tag LOCUS_01330 148475 147777 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_01330 149329 148535 gene locus_tag LOCUS_01340 149329 148535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 149636 150388 gene locus_tag LOCUS_01350 149636 150388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 151358 150480 gene locus_tag LOCUS_01360 151358 150480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 151717 152439 gene locus_tag LOCUS_01370 151717 152439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_01370 152532 153704 gene locus_tag LOCUS_01380 152532 153704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 153728 154552 gene locus_tag LOCUS_01390 153728 154552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 154628 154882 gene locus_tag LOCUS_01400 gene rpsT 154628 154882 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_01400 155022 155705 gene locus_tag LOCUS_01410 gene radC 155022 155705 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_01410 155769 156680 gene locus_tag LOCUS_01420 155769 156680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 156677 157333 gene locus_tag LOCUS_01430 gene upp 156677 157333 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_01430 157736 157341 gene locus_tag LOCUS_01440 157736 157341 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_01440 158050 157733 gene locus_tag LOCUS_01450 158050 157733 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_01450 158575 158087 gene locus_tag LOCUS_01460 gene folK 158575 158087 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence002 6078 2971 gene locus_tag LOCUS_01470 6078 2971 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_01470 7137 6088 gene locus_tag LOCUS_01480 7137 6088 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_01480 8827 7388 gene locus_tag LOCUS_01490 8827 7388 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760594.1 protein_id gnl|my_center|LOCUS_01490 12328 8981 gene locus_tag LOCUS_01500 12328 8981 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766164.1 protein_id gnl|my_center|LOCUS_01500 13223 12339 gene locus_tag LOCUS_01510 13223 12339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_01510 14156 13509 gene locus_tag LOCUS_01520 14156 13509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_01520 14408 16576 gene locus_tag LOCUS_01530 gene rnr 14408 16576 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_01530 17683 16661 gene locus_tag LOCUS_01540 17683 16661 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_01540 18116 19402 gene locus_tag LOCUS_01550 18116 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 20528 19410 gene locus_tag LOCUS_01560 20528 19410 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_01560 20689 20928 gene locus_tag LOCUS_01570 20689 20928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 21759 20929 gene locus_tag LOCUS_01580 gene lgt 21759 20929 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_01580 21902 23671 gene locus_tag LOCUS_01590 21902 23671 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_01590 23953 25107 gene locus_tag LOCUS_01600 23953 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 25133 25987 gene locus_tag LOCUS_01610 25133 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 27116 26022 gene locus_tag LOCUS_01620 27116 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 29558 28623 gene locus_tag LOCUS_01630 29558 28623 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_01630 30864 29551 gene locus_tag LOCUS_01640 30864 29551 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921284.1 protein_id gnl|my_center|LOCUS_01640 32662 30938 gene locus_tag LOCUS_01650 32662 30938 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_01650 34548 32674 gene locus_tag LOCUS_01660 gene asnB 34548 32674 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_01660 39518 34752 gene locus_tag LOCUS_01670 39518 34752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 39907 40947 gene locus_tag LOCUS_01680 39907 40947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 42657 45392 gene locus_tag LOCUS_01690 42657 45392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 46261 45566 gene locus_tag LOCUS_01700 46261 45566 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064620.1 protein_id gnl|my_center|LOCUS_01700 47720 46857 gene locus_tag LOCUS_01710 47720 46857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 48740 47724 gene locus_tag LOCUS_01720 48740 47724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 49470 48733 gene locus_tag LOCUS_01730 49470 48733 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_01730 50123 49479 gene locus_tag LOCUS_01740 50123 49479 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303148.1 protein_id gnl|my_center|LOCUS_01740 51137 50196 gene locus_tag LOCUS_01750 51137 50196 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_01750 52954 52118 gene locus_tag LOCUS_01760 52954 52118 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_01760 53439 52951 gene locus_tag LOCUS_01770 53439 52951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 55333 54167 gene locus_tag LOCUS_01780 55333 54167 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263844.1 protein_id gnl|my_center|LOCUS_01780 56443 55337 gene locus_tag LOCUS_01790 56443 55337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 57441 56476 gene locus_tag LOCUS_01800 57441 56476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_01800 58442 57441 gene locus_tag LOCUS_01810 58442 57441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 60090 58549 gene locus_tag LOCUS_01820 60090 58549 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_01820 62495 60147 gene locus_tag LOCUS_01830 62495 60147 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_01830 63292 62513 gene locus_tag LOCUS_01840 63292 62513 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_01840 64375 63479 gene locus_tag LOCUS_01850 64375 63479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 65943 64372 gene locus_tag LOCUS_01860 65943 64372 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392341.1 protein_id gnl|my_center|LOCUS_01860 66970 65984 gene locus_tag LOCUS_01870 gene nadE 66970 65984 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533125.1 protein_id gnl|my_center|LOCUS_01870 68954 66984 gene locus_tag LOCUS_01880 gene asnB 68954 66984 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 protein_id gnl|my_center|LOCUS_01880 69239 68958 gene locus_tag LOCUS_01890 69239 68958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 70432 69380 gene locus_tag LOCUS_01900 70432 69380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 71025 70870 gene locus_tag LOCUS_01910 71025 70870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 73089 71869 gene locus_tag LOCUS_01920 gene cls 73089 71869 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_01920 73615 74454 gene locus_tag LOCUS_01930 73615 74454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 74484 75395 gene locus_tag LOCUS_01940 gene cysK 74484 75395 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_01940 75614 75688 gene locus_tag LOCUS_t00030 75614 75688 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 76409 75780 gene locus_tag LOCUS_01950 76409 75780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 77568 76396 gene locus_tag LOCUS_01960 77568 76396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 77873 77568 gene locus_tag LOCUS_01970 77873 77568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 78369 78049 gene locus_tag LOCUS_01980 78369 78049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 79307 78381 gene locus_tag LOCUS_01990 79307 78381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 79878 79582 gene locus_tag LOCUS_02000 79878 79582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 80358 79948 gene locus_tag LOCUS_02010 80358 79948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 81864 80635 gene locus_tag LOCUS_02020 81864 80635 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_02020 82294 82100 gene locus_tag LOCUS_02030 82294 82100 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_02030 82538 82705 gene locus_tag LOCUS_02040 82538 82705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 82716 82916 gene locus_tag LOCUS_02050 82716 82916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 83657 83136 gene locus_tag LOCUS_02060 83657 83136 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796780.1 protein_id gnl|my_center|LOCUS_02060 83837 84448 gene locus_tag LOCUS_02070 83837 84448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 84538 85986 gene locus_tag LOCUS_02080 84538 85986 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171281526.1 protein_id gnl|my_center|LOCUS_02080 85993 87006 gene locus_tag LOCUS_02090 85993 87006 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_02090 87003 88202 gene locus_tag LOCUS_02100 87003 88202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_02100 88263 89507 gene locus_tag LOCUS_02110 88263 89507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_02110 89853 91019 gene locus_tag LOCUS_02120 89853 91019 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107845.1 protein_id gnl|my_center|LOCUS_02120 91097 91762 gene locus_tag LOCUS_02130 91097 91762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_02130 91853 93082 gene locus_tag LOCUS_02140 91853 93082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_02140 93079 94290 gene locus_tag LOCUS_02150 93079 94290 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_02150 94310 95545 gene locus_tag LOCUS_02160 94310 95545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_02160 95542 96750 gene locus_tag LOCUS_02170 95542 96750 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_02170 96948 98318 gene locus_tag LOCUS_02180 96948 98318 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_02180 98302 99609 gene locus_tag LOCUS_02190 98302 99609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_02190 101152 99614 gene locus_tag LOCUS_02200 101152 99614 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_02200 101338 102501 gene locus_tag LOCUS_02210 101338 102501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 103905 102511 gene locus_tag LOCUS_02220 103905 102511 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_02220 104489 103905 gene locus_tag LOCUS_02230 104489 103905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 105305 104724 gene locus_tag LOCUS_02240 gene lpcA 105305 104724 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 protein_id gnl|my_center|LOCUS_02240 105495 107336 gene locus_tag LOCUS_02250 gene mutL 105495 107336 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_02250 107384 108211 gene locus_tag LOCUS_02260 107384 108211 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_02260 108249 109130 gene locus_tag LOCUS_02270 108249 109130 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_02270 109130 110242 gene locus_tag LOCUS_02280 109130 110242 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_02280 110425 110793 gene locus_tag LOCUS_02290 110425 110793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 113146 110846 gene locus_tag LOCUS_02300 113146 110846 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_02300 115532 113157 gene locus_tag LOCUS_02310 115532 113157 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_02310 116646 115543 gene locus_tag LOCUS_02320 116646 115543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02320 117714 116698 gene locus_tag LOCUS_02330 117714 116698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02330 119590 118010 gene locus_tag LOCUS_02340 119590 118010 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_02340 122909 119613 gene locus_tag LOCUS_02350 122909 119613 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_02350 124233 123136 gene locus_tag LOCUS_02360 124233 123136 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765195.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence003 1930 53 gene locus_tag LOCUS_02370 1930 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2854 2012 gene locus_tag LOCUS_02380 2854 2012 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_02380 3999 2866 gene locus_tag LOCUS_02390 3999 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 5380 4064 gene locus_tag LOCUS_02400 5380 4064 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_02400 6983 7537 gene locus_tag LOCUS_02410 6983 7537 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_02410 7534 9027 gene locus_tag LOCUS_02420 7534 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9247 10227 gene locus_tag LOCUS_02430 9247 10227 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_02430 10236 13097 gene locus_tag LOCUS_02440 gene uvrA 10236 13097 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_02440 13601 14311 gene locus_tag LOCUS_02450 13601 14311 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_02450 14504 15844 gene locus_tag LOCUS_02460 14504 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 15852 17219 gene locus_tag LOCUS_02470 15852 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 17785 17327 gene locus_tag LOCUS_02480 gene smpB 17785 17327 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_02480 18385 17801 gene locus_tag LOCUS_02490 18385 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 18502 19422 gene locus_tag LOCUS_02500 gene miaA 18502 19422 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_02500 19840 19463 gene locus_tag LOCUS_02510 19840 19463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 19897 20262 gene locus_tag LOCUS_02520 19897 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 20259 21704 gene locus_tag LOCUS_02530 20259 21704 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_02530 21935 22636 gene locus_tag LOCUS_02540 21935 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 23299 22664 gene locus_tag LOCUS_02550 23299 22664 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_02550 23568 23993 gene locus_tag LOCUS_02560 23568 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 24473 24018 gene locus_tag LOCUS_02570 24473 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 25867 24476 gene locus_tag LOCUS_02580 25867 24476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 26842 25925 gene locus_tag LOCUS_02590 26842 25925 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_02590 26953 28311 gene locus_tag LOCUS_02600 26953 28311 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023958.1 protein_id gnl|my_center|LOCUS_02600 30182 28308 gene locus_tag LOCUS_02610 30182 28308 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 protein_id gnl|my_center|LOCUS_02610 31892 30354 gene locus_tag LOCUS_02620 31892 30354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_02620 32593 31919 gene locus_tag LOCUS_02630 32593 31919 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_02630 35173 32732 gene locus_tag LOCUS_02640 35173 32732 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_02640 35338 36366 gene locus_tag LOCUS_02650 35338 36366 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_02650 36363 37400 gene locus_tag LOCUS_02660 36363 37400 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_02660 37465 38304 gene locus_tag LOCUS_02670 gene kduI 37465 38304 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_02670 38326 39114 gene locus_tag LOCUS_02680 38326 39114 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_02680 39697 42150 gene locus_tag LOCUS_02690 39697 42150 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_02690 42194 43900 gene locus_tag LOCUS_02700 42194 43900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 44018 44605 gene locus_tag LOCUS_02710 44018 44605 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763511.1 protein_id gnl|my_center|LOCUS_02710 45084 44602 gene locus_tag LOCUS_02720 45084 44602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 45690 45106 gene locus_tag LOCUS_02730 45690 45106 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_02730 46147 47217 gene locus_tag LOCUS_02740 gene serC 46147 47217 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_02740 47245 48168 gene locus_tag LOCUS_02750 47245 48168 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_02750 48253 49500 gene locus_tag LOCUS_02760 48253 49500 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_02760 49744 51006 gene locus_tag LOCUS_02770 49744 51006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 51069 51860 gene locus_tag LOCUS_02780 51069 51860 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_02780 52704 53255 gene locus_tag LOCUS_02790 52704 53255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 53870 53481 gene locus_tag LOCUS_02800 53870 53481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 54762 54073 gene locus_tag LOCUS_02810 54762 54073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 54975 55556 gene locus_tag LOCUS_02820 54975 55556 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_02820 55637 56266 gene locus_tag LOCUS_02830 55637 56266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 56703 57497 gene locus_tag LOCUS_02840 56703 57497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 57982 57617 gene locus_tag LOCUS_02850 57982 57617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 58403 58158 gene locus_tag LOCUS_02860 58403 58158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 59001 59801 gene locus_tag LOCUS_02870 59001 59801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 59816 60679 gene locus_tag LOCUS_02880 59816 60679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 60856 60719 gene locus_tag LOCUS_02890 60856 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 60831 61013 gene locus_tag LOCUS_02900 60831 61013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 61228 62076 gene locus_tag LOCUS_02910 61228 62076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 62429 62929 gene locus_tag LOCUS_02920 62429 62929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 63355 64782 gene locus_tag LOCUS_02930 63355 64782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 64931 66874 gene locus_tag LOCUS_02940 64931 66874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 66976 67386 gene locus_tag LOCUS_02950 66976 67386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 67420 68403 gene locus_tag LOCUS_02960 67420 68403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 68551 69009 gene locus_tag LOCUS_02970 68551 69009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 69094 69549 gene locus_tag LOCUS_02980 69094 69549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 69648 71186 gene locus_tag LOCUS_02990 69648 71186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 71400 72233 gene locus_tag LOCUS_03000 71400 72233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 72978 73373 gene locus_tag LOCUS_03010 72978 73373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 73551 74228 gene locus_tag LOCUS_03020 73551 74228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 74383 74862 gene locus_tag LOCUS_03030 74383 74862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 75121 76260 gene locus_tag LOCUS_03040 75121 76260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 76983 77921 gene locus_tag LOCUS_03050 76983 77921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 80757 77944 gene locus_tag LOCUS_03060 80757 77944 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_03060 81405 80788 gene locus_tag LOCUS_03070 81405 80788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 82386 81421 gene locus_tag LOCUS_03080 82386 81421 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_03080 85619 82386 gene locus_tag LOCUS_03090 85619 82386 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_03090 86465 85722 gene locus_tag LOCUS_03100 86465 85722 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_03100 87658 86579 gene locus_tag LOCUS_03110 87658 86579 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_03110 88965 87691 gene locus_tag LOCUS_03120 88965 87691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_03120 90224 88989 gene locus_tag LOCUS_03130 90224 88989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_03130 90911 90231 gene locus_tag LOCUS_03140 90911 90231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_03140 91863 91150 gene locus_tag LOCUS_03150 91863 91150 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091600.1 protein_id gnl|my_center|LOCUS_03150 92631 91891 gene locus_tag LOCUS_03160 92631 91891 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_03160 93633 92827 gene locus_tag LOCUS_03170 93633 92827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 94020 95513 gene locus_tag LOCUS_03180 94020 95513 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962400.1 protein_id gnl|my_center|LOCUS_03180 95653 97914 gene locus_tag LOCUS_03190 95653 97914 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_03190 98332 98961 gene locus_tag LOCUS_03200 98332 98961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 98877 99653 gene locus_tag LOCUS_03210 98877 99653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 99722 102142 gene locus_tag LOCUS_03220 99722 102142 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_03220 102234 103019 gene locus_tag LOCUS_03230 102234 103019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_03230 103165 103239 gene locus_tag LOCUS_t00040 103165 103239 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 104034 103315 gene locus_tag LOCUS_03240 104034 103315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 104975 104178 gene locus_tag LOCUS_03250 104975 104178 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_03250 107924 105072 gene locus_tag LOCUS_03260 107924 105072 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_03260 108673 107981 gene locus_tag LOCUS_03270 108673 107981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 108955 110961 gene locus_tag LOCUS_03280 108955 110961 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_03280 110965 111456 gene locus_tag LOCUS_03290 110965 111456 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072185.1 protein_id gnl|my_center|LOCUS_03290 111489 113513 gene locus_tag LOCUS_03300 111489 113513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 113651 116413 gene locus_tag LOCUS_03310 113651 116413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 116415 116822 gene locus_tag LOCUS_03320 116415 116822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence004 729 409 gene locus_tag LOCUS_03330 729 409 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_03330 1377 808 gene locus_tag LOCUS_03340 1377 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1706 1380 gene locus_tag LOCUS_03350 1706 1380 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391970.1 protein_id gnl|my_center|LOCUS_03350 4024 2750 gene locus_tag LOCUS_03360 4024 2750 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_03360 4698 4021 gene locus_tag LOCUS_03370 4698 4021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_03370 4849 5328 gene locus_tag LOCUS_03380 4849 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5457 6689 gene locus_tag LOCUS_03390 5457 6689 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_03390 6741 7631 gene locus_tag LOCUS_03400 6741 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7723 10668 gene locus_tag LOCUS_03410 7723 10668 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_03410 10818 13892 gene locus_tag LOCUS_03420 10818 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 13885 15327 gene locus_tag LOCUS_03430 13885 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 17654 15477 gene locus_tag LOCUS_03440 17654 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 18273 17632 gene locus_tag LOCUS_03450 18273 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 19209 18550 gene locus_tag LOCUS_03460 19209 18550 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140947.1 protein_id gnl|my_center|LOCUS_03460 21716 19239 gene locus_tag LOCUS_03470 21716 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 23709 21790 gene locus_tag LOCUS_03480 23709 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 24194 23721 gene locus_tag LOCUS_03490 24194 23721 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_03490 26211 24226 gene locus_tag LOCUS_03500 26211 24226 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365949.1 protein_id gnl|my_center|LOCUS_03500 26250 26432 gene locus_tag LOCUS_03510 26250 26432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 27089 26436 gene locus_tag LOCUS_03520 27089 26436 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_03520 28522 27086 gene locus_tag LOCUS_03530 28522 27086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 28629 32825 gene locus_tag LOCUS_03540 28629 32825 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_03540 33127 36294 gene locus_tag LOCUS_03550 33127 36294 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_03550 36307 37833 gene locus_tag LOCUS_03560 36307 37833 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_03560 37860 38537 gene locus_tag LOCUS_03570 37860 38537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 38568 39638 gene locus_tag LOCUS_03580 38568 39638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 39738 40475 gene locus_tag LOCUS_03590 39738 40475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 40500 42365 gene locus_tag LOCUS_03600 40500 42365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 42468 44030 gene locus_tag LOCUS_03610 42468 44030 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_03610 44139 46535 gene locus_tag LOCUS_03620 44139 46535 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_03620 46554 49124 gene locus_tag LOCUS_03630 46554 49124 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_03630 49141 50313 gene locus_tag LOCUS_03640 49141 50313 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209281.1 protein_id gnl|my_center|LOCUS_03640 50418 52241 gene locus_tag LOCUS_03650 50418 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 52467 53813 gene locus_tag LOCUS_03660 52467 53813 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_03660 53853 56399 gene locus_tag LOCUS_03670 53853 56399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 56710 59064 gene locus_tag LOCUS_03680 56710 59064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 59103 60251 gene locus_tag LOCUS_03690 59103 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 60279 62435 gene locus_tag LOCUS_03700 60279 62435 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172660227.1 protein_id gnl|my_center|LOCUS_03700 66381 63151 gene locus_tag LOCUS_03710 66381 63151 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201938.1 protein_id gnl|my_center|LOCUS_03710 68785 66533 gene locus_tag LOCUS_03720 68785 66533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 70341 68995 gene locus_tag LOCUS_03730 70341 68995 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_03730 71057 70356 gene locus_tag LOCUS_03740 71057 70356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 72770 71202 gene locus_tag LOCUS_03750 72770 71202 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_03750 76380 72880 gene locus_tag LOCUS_03760 76380 72880 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_03760 77512 76526 gene locus_tag LOCUS_03770 77512 76526 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_03770 78202 77606 gene locus_tag LOCUS_03780 78202 77606 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_03780 81576 78271 gene locus_tag LOCUS_03790 81576 78271 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_03790 82145 81741 gene locus_tag LOCUS_03800 82145 81741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 84044 82176 gene locus_tag LOCUS_03810 84044 82176 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_03810 87234 84064 gene locus_tag LOCUS_03820 87234 84064 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_03820 89093 87270 gene locus_tag LOCUS_03830 89093 87270 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_03830 91987 89105 gene locus_tag LOCUS_03840 91987 89105 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_03840 93420 92392 gene locus_tag LOCUS_03850 93420 92392 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_03850 94011 93472 gene locus_tag LOCUS_03860 94011 93472 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_03860 94784 95101 gene locus_tag LOCUS_03870 gene ssb 94784 95101 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_03870 97371 95209 gene locus_tag LOCUS_03880 97371 95209 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109053.1 protein_id gnl|my_center|LOCUS_03880 99419 97506 gene locus_tag LOCUS_03890 99419 97506 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203543.1 protein_id gnl|my_center|LOCUS_03890 100690 99824 gene locus_tag LOCUS_03900 100690 99824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 101209 101970 gene locus_tag LOCUS_03910 101209 101970 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329591.1 protein_id gnl|my_center|LOCUS_03910 101974 102519 gene locus_tag LOCUS_03920 101974 102519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 103615 102566 gene locus_tag LOCUS_03930 103615 102566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence005 634 3294 gene locus_tag LOCUS_03940 634 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3491 3907 gene locus_tag LOCUS_03950 3491 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4407 5423 gene locus_tag LOCUS_03960 4407 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5696 6397 gene locus_tag LOCUS_03970 5696 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8703 6487 gene locus_tag LOCUS_03980 8703 6487 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_03980 10655 8985 gene locus_tag LOCUS_03990 10655 8985 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_03990 12061 10754 gene locus_tag LOCUS_04000 12061 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13441 12299 gene locus_tag LOCUS_04010 13441 12299 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_04010 15497 13929 gene locus_tag LOCUS_04020 15497 13929 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_04020 18897 15508 gene locus_tag LOCUS_04030 18897 15508 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_04030 20150 19032 gene locus_tag LOCUS_04040 20150 19032 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_04040 20778 20194 gene locus_tag LOCUS_04050 20778 20194 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_04050 21215 21907 gene locus_tag LOCUS_04060 21215 21907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_04060 21920 24253 gene locus_tag LOCUS_04070 21920 24253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_04070 24328 26595 gene locus_tag LOCUS_04080 24328 26595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_04080 26678 29062 gene locus_tag LOCUS_04090 26678 29062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_04090 29097 31478 gene locus_tag LOCUS_04100 29097 31478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107496.1 protein_id gnl|my_center|LOCUS_04100 31550 33973 gene locus_tag LOCUS_04110 31550 33973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_04110 34096 36489 gene locus_tag LOCUS_04120 34096 36489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107404.1 protein_id gnl|my_center|LOCUS_04120 36728 37639 gene locus_tag LOCUS_04130 36728 37639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 37690 38700 gene locus_tag LOCUS_04140 37690 38700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 39899 38691 gene locus_tag LOCUS_04150 39899 38691 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_04150 40234 41703 gene locus_tag LOCUS_04160 gene cysS 40234 41703 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_04160 42667 41756 gene locus_tag LOCUS_04170 gene gldA 42667 41756 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_04170 42911 43282 gene locus_tag LOCUS_04180 42911 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 43453 44427 gene locus_tag LOCUS_04190 43453 44427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 45520 44495 gene locus_tag LOCUS_04200 45520 44495 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_04200 46231 45530 gene locus_tag LOCUS_04210 46231 45530 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_04210 46729 46352 gene locus_tag LOCUS_04220 46729 46352 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_04220 50196 46780 gene locus_tag LOCUS_04230 gene ileS 50196 46780 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_04230 51015 50392 gene locus_tag LOCUS_04240 51015 50392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 52458 51019 gene locus_tag LOCUS_04250 gene rpoN 52458 51019 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_04250 54098 52659 gene locus_tag LOCUS_04260 gene asnS 54098 52659 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_04260 54223 55071 gene locus_tag LOCUS_04270 54223 55071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 56766 55072 gene locus_tag LOCUS_04280 56766 55072 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_04280 56965 57939 gene locus_tag LOCUS_04290 56965 57939 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_04290 58881 57988 gene locus_tag LOCUS_04300 58881 57988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_04300 60083 58959 gene locus_tag LOCUS_04310 60083 58959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 61296 60133 gene locus_tag LOCUS_04320 61296 60133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 61493 62200 gene locus_tag LOCUS_04330 61493 62200 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 protein_id gnl|my_center|LOCUS_04330 62796 62197 gene locus_tag LOCUS_04340 62796 62197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 63497 62793 gene locus_tag LOCUS_04350 63497 62793 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_04350 63724 65646 gene locus_tag LOCUS_04360 gene dnaG 63724 65646 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_04360 65772 66461 gene locus_tag LOCUS_04370 65772 66461 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_04370 67592 66453 gene locus_tag LOCUS_04380 gene hemW 67592 66453 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_04380 68030 67596 gene locus_tag LOCUS_04390 68030 67596 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903698.1 protein_id gnl|my_center|LOCUS_04390 68471 68034 gene locus_tag LOCUS_04400 gene rpiB 68471 68034 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_04400 69020 69979 gene locus_tag LOCUS_04410 gene nadA 69020 69979 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_04410 69989 71557 gene locus_tag LOCUS_04420 69989 71557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 71557 72576 gene locus_tag LOCUS_04430 gene ruvB 71557 72576 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_04430 73278 72577 gene locus_tag LOCUS_04440 73278 72577 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_04440 73424 73837 gene locus_tag LOCUS_04450 73424 73837 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_04450 74866 73853 gene locus_tag LOCUS_04460 gene pheS 74866 73853 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_04460 75536 74868 gene locus_tag LOCUS_04470 75536 74868 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_04470 75754 76185 gene locus_tag LOCUS_04480 gene dut 75754 76185 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_04480 76186 77811 gene locus_tag LOCUS_04490 76186 77811 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_04490 77899 78396 gene locus_tag LOCUS_04500 77899 78396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 78426 79571 gene locus_tag LOCUS_04510 78426 79571 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_04510 79665 80063 gene locus_tag LOCUS_04520 79665 80063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 80065 80487 gene locus_tag LOCUS_04530 gene ybeY 80065 80487 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_04530 80484 82355 gene locus_tag LOCUS_04540 gene mnmG 80484 82355 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_04540 82417 84045 gene locus_tag LOCUS_04550 gene ade 82417 84045 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_04550 84045 85841 gene locus_tag LOCUS_04560 gene uvrC 84045 85841 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_04560 86794 85838 gene locus_tag LOCUS_04570 86794 85838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 86897 87196 gene locus_tag LOCUS_04580 86897 87196 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_04580 87209 89971 gene locus_tag LOCUS_04590 gene polA 87209 89971 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_04590 91745 90027 gene locus_tag LOCUS_04600 91745 90027 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence006 261 1184 gene locus_tag LOCUS_04610 261 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 1280 2512 gene locus_tag LOCUS_04620 1280 2512 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_04620 2613 2689 gene locus_tag LOCUS_t00050 2613 2689 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2752 2825 gene locus_tag LOCUS_t00060 2752 2825 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2924 4177 gene locus_tag LOCUS_04630 2924 4177 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_04630 4275 4517 gene locus_tag LOCUS_04640 gene rpmB 4275 4517 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_04640 4530 4712 gene locus_tag LOCUS_04650 gene rpmG 4530 4712 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_04650 4721 4879 gene locus_tag LOCUS_04660 4721 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4959 5918 gene locus_tag LOCUS_04670 gene ftsY 4959 5918 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_04670 6014 7324 gene locus_tag LOCUS_04680 gene rimO 6014 7324 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_04680 10048 7505 gene locus_tag LOCUS_04690 10048 7505 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765726.1 protein_id gnl|my_center|LOCUS_04690 10260 12767 gene locus_tag LOCUS_04700 gene gyrA 10260 12767 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_04700 12863 14158 gene locus_tag LOCUS_04710 12863 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 14326 14751 gene locus_tag LOCUS_04720 14326 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14889 15266 gene locus_tag LOCUS_04730 14889 15266 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942200.1 protein_id gnl|my_center|LOCUS_04730 15675 15277 gene locus_tag LOCUS_04740 15675 15277 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_04740 17233 15770 gene locus_tag LOCUS_04750 17233 15770 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_04750 19390 17414 gene locus_tag LOCUS_04760 19390 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 20788 19406 gene locus_tag LOCUS_04770 20788 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21907 20876 gene locus_tag LOCUS_04780 21907 20876 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_04780 22374 21931 gene locus_tag LOCUS_04790 22374 21931 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_04790 26060 23127 gene locus_tag LOCUS_04800 26060 23127 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_04800 26350 27351 gene locus_tag LOCUS_04810 gene pta 26350 27351 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_04810 27370 28329 gene locus_tag LOCUS_04820 27370 28329 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_04820 28340 29569 gene locus_tag LOCUS_04830 28340 29569 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_04830 29579 30475 gene locus_tag LOCUS_04840 gene ptb 29579 30475 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_04840 30480 31556 gene locus_tag LOCUS_04850 gene buk 30480 31556 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964967.1 protein_id gnl|my_center|LOCUS_04850 32263 31553 gene locus_tag LOCUS_04860 32263 31553 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_04860 32468 33067 gene locus_tag LOCUS_04870 32468 33067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 33348 33148 gene locus_tag LOCUS_04880 33348 33148 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082199.1 protein_id gnl|my_center|LOCUS_04880 33560 34132 gene locus_tag LOCUS_04890 33560 34132 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_04890 34569 34189 gene locus_tag LOCUS_04900 34569 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 35076 34708 gene locus_tag LOCUS_04910 35076 34708 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_04910 36056 35124 gene locus_tag LOCUS_04920 36056 35124 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_04920 36379 36155 gene locus_tag LOCUS_04930 36379 36155 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426908.1 protein_id gnl|my_center|LOCUS_04930 37027 36452 gene locus_tag LOCUS_04940 37027 36452 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_04940 39186 37147 gene locus_tag LOCUS_04950 39186 37147 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_04950 40475 39264 gene locus_tag LOCUS_04960 gene rocD 40475 39264 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_04960 41743 40640 gene locus_tag LOCUS_04970 41743 40640 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704647.1 protein_id gnl|my_center|LOCUS_04970 42400 41819 gene locus_tag LOCUS_04980 42400 41819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_04980 42576 43667 gene locus_tag LOCUS_04990 42576 43667 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_04990 43741 44367 gene locus_tag LOCUS_05000 43741 44367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 44381 45388 gene locus_tag LOCUS_05010 44381 45388 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261546.1 protein_id gnl|my_center|LOCUS_05010 45388 47034 gene locus_tag LOCUS_05020 45388 47034 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_05020 47047 48360 gene locus_tag LOCUS_05030 47047 48360 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_05030 48774 48436 gene locus_tag LOCUS_05040 48774 48436 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044173324.1 protein_id gnl|my_center|LOCUS_05040 48891 50831 gene locus_tag LOCUS_05050 48891 50831 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_05050 51184 50912 gene locus_tag LOCUS_05060 51184 50912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 51459 52538 gene locus_tag LOCUS_05070 51459 52538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 52622 53785 gene locus_tag LOCUS_05080 52622 53785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 53795 54154 gene locus_tag LOCUS_05090 53795 54154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 54245 55075 gene locus_tag LOCUS_05100 54245 55075 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_05100 56864 55182 gene locus_tag LOCUS_05110 56864 55182 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_05110 57879 56935 gene locus_tag LOCUS_05120 57879 56935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 59872 57902 gene locus_tag LOCUS_05130 59872 57902 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_05130 60915 59917 gene locus_tag LOCUS_05140 60915 59917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 62198 61170 gene locus_tag LOCUS_05150 62198 61170 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_05150 62357 62803 gene locus_tag LOCUS_05160 62357 62803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 63317 62793 gene locus_tag LOCUS_05170 63317 62793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 63727 64071 gene locus_tag LOCUS_05180 63727 64071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 64097 64978 gene locus_tag LOCUS_05190 64097 64978 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_05190 65033 65965 gene locus_tag LOCUS_05200 65033 65965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 65972 66589 gene locus_tag LOCUS_05210 65972 66589 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545712.1 protein_id gnl|my_center|LOCUS_05210 66613 67602 gene locus_tag LOCUS_05220 66613 67602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 67606 68937 gene locus_tag LOCUS_05230 gene nrfD 67606 68937 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_05230 68940 69788 gene locus_tag LOCUS_05240 68940 69788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 69827 70237 gene locus_tag LOCUS_05250 69827 70237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 71897 70764 gene locus_tag LOCUS_05260 71897 70764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 72935 72078 gene locus_tag LOCUS_05270 72935 72078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_05270 73023 73376 gene locus_tag LOCUS_05280 73023 73376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 75789 73690 gene locus_tag LOCUS_05290 75789 73690 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_05290 77200 75818 gene locus_tag LOCUS_05300 77200 75818 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964308.1 protein_id gnl|my_center|LOCUS_05300 78828 77329 gene locus_tag LOCUS_05310 78828 77329 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_05310 80840 78930 gene locus_tag LOCUS_05320 gene nuoL 80840 78930 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_05320 81191 80862 gene locus_tag LOCUS_05330 gene nuoK 81191 80862 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_05330 81708 81199 gene locus_tag LOCUS_05340 81708 81199 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_05340 82324 81758 gene locus_tag LOCUS_05350 82324 81758 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_05350 83362 82343 gene locus_tag LOCUS_05360 gene nuoH 83362 82343 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_05360 84519 83548 gene locus_tag LOCUS_05370 84519 83548 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_05370 86077 84731 gene locus_tag LOCUS_05380 gene nuoF 86077 84731 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_05380 86637 86059 gene locus_tag LOCUS_05390 86637 86059 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_05390 88053 86848 gene locus_tag LOCUS_05400 88053 86848 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_05400 88674 88186 gene locus_tag LOCUS_05410 88674 88186 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence007 <1 940 gene locus_tag LOCUS_05420 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964545.1:F0F1 ATP synthase subunit alpha 959 1849 gene locus_tag LOCUS_05430 gene atpG 959 1849 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_05430 2641 1976 gene locus_tag LOCUS_05440 2641 1976 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_05440 2910 4907 gene locus_tag LOCUS_05450 2910 4907 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_05450 5927 5184 gene locus_tag LOCUS_05460 5927 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8908 6038 gene locus_tag LOCUS_05470 8908 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_05470 9265 8918 gene locus_tag LOCUS_05480 9265 8918 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_05480 9515 12382 gene locus_tag LOCUS_05490 9515 12382 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_05490 12496 14028 gene locus_tag LOCUS_05500 12496 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 14039 15127 gene locus_tag LOCUS_05510 gene carA 14039 15127 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_05510 15273 15668 gene locus_tag LOCUS_05520 15273 15668 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_05520 15665 16492 gene locus_tag LOCUS_05530 15665 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 16467 16925 gene locus_tag LOCUS_05540 16467 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 18567 17032 gene locus_tag LOCUS_05550 18567 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 19222 18521 gene locus_tag LOCUS_05560 19222 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 20112 19378 gene locus_tag LOCUS_05570 20112 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 20836 20153 gene locus_tag LOCUS_05580 20836 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05580 22351 20858 gene locus_tag LOCUS_05590 22351 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05590 22643 23422 gene locus_tag LOCUS_05600 22643 23422 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_05600 23485 24318 gene locus_tag LOCUS_05610 23485 24318 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_05610 24373 25317 gene locus_tag LOCUS_05620 24373 25317 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_05620 25536 28673 gene locus_tag LOCUS_05630 25536 28673 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616068.1 protein_id gnl|my_center|LOCUS_05630 29254 28907 gene locus_tag LOCUS_05640 29254 28907 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_05640 29781 29305 gene locus_tag LOCUS_05650 29781 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 30778 29831 gene locus_tag LOCUS_05660 30778 29831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 32103 30775 gene locus_tag LOCUS_05670 32103 30775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 33683 32103 gene locus_tag LOCUS_05680 33683 32103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 34565 33825 gene locus_tag LOCUS_05690 34565 33825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 35737 34883 gene locus_tag LOCUS_05700 35737 34883 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920429.1 protein_id gnl|my_center|LOCUS_05700 37990 35789 gene locus_tag LOCUS_05710 37990 35789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 38271 39077 gene locus_tag LOCUS_05720 gene rhaD 38271 39077 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179721.1 protein_id gnl|my_center|LOCUS_05720 39243 40007 gene locus_tag LOCUS_05730 39243 40007 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_05730 42073 40616 gene locus_tag LOCUS_05740 42073 40616 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_05740 43589 42165 gene locus_tag LOCUS_05750 43589 42165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967480.1 protein_id gnl|my_center|LOCUS_05750 45440 43590 gene locus_tag LOCUS_05760 gene uidA 45440 43590 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966715.1 protein_id gnl|my_center|LOCUS_05760 46381 45452 gene locus_tag LOCUS_05770 46381 45452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 48108 46555 gene locus_tag LOCUS_05780 48108 46555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 48801 48112 gene locus_tag LOCUS_05790 48801 48112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 51761 48819 gene locus_tag LOCUS_05800 51761 48819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 54122 51789 gene locus_tag LOCUS_05810 54122 51789 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_05810 56666 54126 gene locus_tag LOCUS_05820 56666 54126 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_05820 57763 56675 gene locus_tag LOCUS_05830 57763 56675 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640639.1 protein_id gnl|my_center|LOCUS_05830 57507 57516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59410 57848 gene locus_tag LOCUS_05840 59410 57848 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_05840 62908 59480 gene locus_tag LOCUS_05850 62908 59480 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_05850 64101 62995 gene locus_tag LOCUS_05860 64101 62995 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_05860 64761 64177 gene locus_tag LOCUS_05870 64761 64177 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_05870 66286 64922 gene locus_tag LOCUS_05880 66286 64922 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_05880 66557 69574 gene locus_tag LOCUS_05890 66557 69574 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943038.1 protein_id gnl|my_center|LOCUS_05890 69879 70889 gene locus_tag LOCUS_05900 69879 70889 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_05900 70901 73135 gene locus_tag LOCUS_05910 70901 73135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 73300 73863 gene locus_tag LOCUS_05920 73300 73863 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 protein_id gnl|my_center|LOCUS_05920 73867 74811 gene locus_tag LOCUS_05930 73867 74811 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_05930 74839 76155 gene locus_tag LOCUS_05940 74839 76155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 76159 77916 gene locus_tag LOCUS_05950 76159 77916 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_05950 78055 79395 gene locus_tag LOCUS_05960 gene araE 78055 79395 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_05960 79400 80902 gene locus_tag LOCUS_05970 79400 80902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 80905 81684 gene locus_tag LOCUS_05980 80905 81684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 81724 82689 gene locus_tag LOCUS_05990 81724 82689 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_05990 83156 83758 gene locus_tag LOCUS_06000 83156 83758 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263794.1 protein_id gnl|my_center|LOCUS_06000 84050 83787 gene locus_tag LOCUS_06010 84050 83787 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642382.1 protein_id gnl|my_center|LOCUS_06010 85122 84130 gene locus_tag LOCUS_06020 85122 84130 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082912.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence008 213 1121 gene locus_tag LOCUS_06030 213 1121 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_06030 3601 1262 gene locus_tag LOCUS_06040 3601 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4558 3683 gene locus_tag LOCUS_06050 gene murQ 4558 3683 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_06050 5413 4559 gene locus_tag LOCUS_06060 5413 4559 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_06060 5680 6876 gene locus_tag LOCUS_06070 5680 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06070 6862 6871 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6899 8668 gene locus_tag LOCUS_06080 6899 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06080 8697 10160 gene locus_tag LOCUS_06090 8697 10160 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_06090 10301 11278 gene locus_tag LOCUS_06100 10301 11278 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_06100 11282 11776 gene locus_tag LOCUS_06110 11282 11776 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706874.1 protein_id gnl|my_center|LOCUS_06110 11917 13275 gene locus_tag LOCUS_06120 11917 13275 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_06120 13397 15286 gene locus_tag LOCUS_06130 13397 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 15439 17904 gene locus_tag LOCUS_06140 15439 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 17885 19465 gene locus_tag LOCUS_06150 17885 19465 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_06150 19477 20586 gene locus_tag LOCUS_06160 19477 20586 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_06160 20586 21605 gene locus_tag LOCUS_06170 20586 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 23151 21979 gene locus_tag LOCUS_06180 23151 21979 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_06180 23351 24997 gene locus_tag LOCUS_06190 23351 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 25054 26142 gene locus_tag LOCUS_06200 25054 26142 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_06200 26272 26718 gene locus_tag LOCUS_06210 gene tnpA 26272 26718 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_06210 26884 27918 gene locus_tag LOCUS_06220 gene porQ 26884 27918 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_06220 28142 28732 gene locus_tag LOCUS_06230 28142 28732 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_06230 28804 29802 gene locus_tag LOCUS_06240 28804 29802 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681496.1 protein_id gnl|my_center|LOCUS_06240 29941 33342 gene locus_tag LOCUS_06250 29941 33342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767846.1 protein_id gnl|my_center|LOCUS_06250 33360 35366 gene locus_tag LOCUS_06260 33360 35366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 37127 35754 gene locus_tag LOCUS_06270 37127 35754 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760358.1 protein_id gnl|my_center|LOCUS_06270 38562 37309 gene locus_tag LOCUS_06280 38562 37309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_06280 38741 40267 gene locus_tag LOCUS_06290 gene purH 38741 40267 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_06290 40303 41325 gene locus_tag LOCUS_06300 40303 41325 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_06300 41341 42165 gene locus_tag LOCUS_06310 gene mreC 41341 42165 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_06310 42162 42668 gene locus_tag LOCUS_06320 gene mreD 42162 42668 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_06320 42670 44487 gene locus_tag LOCUS_06330 gene mrdA 42670 44487 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_06330 44484 45908 gene locus_tag LOCUS_06340 gene rodA 44484 45908 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_06340 48164 46521 gene locus_tag LOCUS_06350 48164 46521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 49556 48711 gene locus_tag LOCUS_06360 49556 48711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 51479 49590 gene locus_tag LOCUS_06370 51479 49590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 54546 51505 gene locus_tag LOCUS_06380 54546 51505 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764559.1 protein_id gnl|my_center|LOCUS_06380 56736 54859 gene locus_tag LOCUS_06390 56736 54859 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_06390 57888 56737 gene locus_tag LOCUS_06400 57888 56737 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_06400 59058 57901 gene locus_tag LOCUS_06410 59058 57901 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_06410 59321 60550 gene locus_tag LOCUS_06420 59321 60550 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_06420 60600 60938 gene locus_tag LOCUS_06430 60600 60938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 61833 60946 gene locus_tag LOCUS_06440 61833 60946 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_06440 62003 62779 gene locus_tag LOCUS_06450 62003 62779 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_06450 62937 63662 gene locus_tag LOCUS_06460 62937 63662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 64408 63680 gene locus_tag LOCUS_06470 gene lptB 64408 63680 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_06470 66958 64496 gene locus_tag LOCUS_06480 66958 64496 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_06480 67847 67032 gene locus_tag LOCUS_06490 gene tatC 67847 67032 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_06490 68110 70302 gene locus_tag LOCUS_06500 gene recQ 68110 70302 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_06500 71486 70299 gene locus_tag LOCUS_06510 71486 70299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 72599 71496 gene locus_tag LOCUS_06520 72599 71496 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_06520 <74925 72608 gene locus_tag LOCUS_06530 <74925 72608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence009 1011 478 gene locus_tag LOCUS_06540 1011 478 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_06540 3059 1008 gene locus_tag LOCUS_06550 3059 1008 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_06550 3425 3060 gene locus_tag LOCUS_06560 3425 3060 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_06560 3770 3450 gene locus_tag LOCUS_06570 3770 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5635 3806 gene locus_tag LOCUS_06580 5635 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6190 5711 gene locus_tag LOCUS_06590 6190 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6357 7055 gene locus_tag LOCUS_06600 6357 7055 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_06600 10099 7052 gene locus_tag LOCUS_06610 10099 7052 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_06610 10278 12197 gene locus_tag LOCUS_06620 10278 12197 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_06620 12199 13092 gene locus_tag LOCUS_06630 12199 13092 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_06630 13660 13097 gene locus_tag LOCUS_06640 13660 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 16700 13788 gene locus_tag LOCUS_06650 16700 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 17864 16821 gene locus_tag LOCUS_06660 17864 16821 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_06660 17963 18826 gene locus_tag LOCUS_06670 17963 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 18846 19703 gene locus_tag LOCUS_06680 18846 19703 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 protein_id gnl|my_center|LOCUS_06680 19731 21686 gene locus_tag LOCUS_06690 19731 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 22017 21727 gene locus_tag LOCUS_06700 22017 21727 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_06700 22619 22020 gene locus_tag LOCUS_06710 22619 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 22618 22806 gene locus_tag LOCUS_06720 22618 22806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 22970 24766 gene locus_tag LOCUS_06730 22970 24766 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_06730 24914 25570 gene locus_tag LOCUS_06740 gene plsY 24914 25570 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476008.1 protein_id gnl|my_center|LOCUS_06740 26354 25572 gene locus_tag LOCUS_06750 gene cdaA 26354 25572 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_06750 27258 26383 gene locus_tag LOCUS_06760 gene folP 27258 26383 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_06760 27318 28001 gene locus_tag LOCUS_06770 27318 28001 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727970.1 protein_id gnl|my_center|LOCUS_06770 28004 29236 gene locus_tag LOCUS_06780 28004 29236 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_06780 29349 30317 gene locus_tag LOCUS_06790 29349 30317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_06790 30439 31191 gene locus_tag LOCUS_06800 gene tpiA 30439 31191 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_06800 31282 32124 gene locus_tag LOCUS_06810 gene prmA 31282 32124 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_06810 32271 37091 gene locus_tag LOCUS_06820 32271 37091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 37262 37756 gene locus_tag LOCUS_06830 37262 37756 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_06830 37785 38495 gene locus_tag LOCUS_06840 37785 38495 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_06840 38878 38681 gene locus_tag LOCUS_06850 38878 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 39741 38887 gene locus_tag LOCUS_06860 39741 38887 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_06860 40015 39836 gene locus_tag LOCUS_06870 40015 39836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 40667 40080 gene locus_tag LOCUS_06880 40667 40080 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_06880 40837 43641 gene locus_tag LOCUS_06890 gene uvrA 40837 43641 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_06890 44351 43983 gene locus_tag LOCUS_06900 44351 43983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 44647 44414 gene locus_tag LOCUS_06910 44647 44414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 45751 45056 gene locus_tag LOCUS_06920 45751 45056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 46688 45951 gene locus_tag LOCUS_06930 46688 45951 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_06930 47564 46914 gene locus_tag LOCUS_06940 47564 46914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 48171 47566 gene locus_tag LOCUS_06950 48171 47566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 48938 48177 gene locus_tag LOCUS_06960 48938 48177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 49432 48920 gene locus_tag LOCUS_06970 49432 48920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 49527 50444 gene locus_tag LOCUS_06980 gene metA 49527 50444 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_06980 50566 50940 gene locus_tag LOCUS_06990 gene crcB 50566 50940 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 protein_id gnl|my_center|LOCUS_06990 50942 51301 gene locus_tag LOCUS_07000 50942 51301 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_07000 51747 51298 gene locus_tag LOCUS_07010 51747 51298 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_07010 52616 51834 gene locus_tag LOCUS_07020 52616 51834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 52854 53174 gene locus_tag LOCUS_07030 52854 53174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243574.1 protein_id gnl|my_center|LOCUS_07030 54068 53214 gene locus_tag LOCUS_07040 54068 53214 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_07040 54847 54077 gene locus_tag LOCUS_07050 gene pgl 54847 54077 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_07050 56399 54858 gene locus_tag LOCUS_07060 gene zwf 56399 54858 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 protein_id gnl|my_center|LOCUS_07060 57008 56481 gene locus_tag LOCUS_07070 57008 56481 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_07070 57884 57108 gene locus_tag LOCUS_07080 57884 57108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 58154 59602 gene locus_tag LOCUS_07090 58154 59602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 59613 60818 gene locus_tag LOCUS_07100 59613 60818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 61387 60908 gene locus_tag LOCUS_07110 61387 60908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 62258 61464 gene locus_tag LOCUS_07120 62258 61464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 63134 62427 gene locus_tag LOCUS_07130 gene nth 63134 62427 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_07130 63258 64211 gene locus_tag LOCUS_07140 63258 64211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 64214 65164 gene locus_tag LOCUS_07150 64214 65164 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_07150 65229 66305 gene locus_tag LOCUS_07160 gene buk 65229 66305 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_07160 66599 67924 gene locus_tag LOCUS_07170 66599 67924 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_07170 68240 70618 gene locus_tag LOCUS_07180 68240 70618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 71242 70709 gene locus_tag LOCUS_07190 71242 70709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 <71972 71366 gene locus_tag LOCUS_07200 <71972 71366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766471.1:citrate/2-methylcitrate synthase >Feature sequence010 <1 919 gene locus_tag LOCUS_07210 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108789.1:4-phosphoerythronate dehydrogenase PdxB 1092 2546 gene locus_tag LOCUS_07220 gene gnd 1092 2546 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_07220 2723 4291 gene locus_tag LOCUS_07230 2723 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 4348 5316 gene locus_tag LOCUS_07240 4348 5316 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_07240 5587 7536 gene locus_tag LOCUS_07250 5587 7536 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_07250 7749 8450 gene locus_tag LOCUS_07260 7749 8450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_07260 10383 8458 gene locus_tag LOCUS_07270 10383 8458 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_07270 10533 11390 gene locus_tag LOCUS_07280 10533 11390 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 protein_id gnl|my_center|LOCUS_07280 13003 11453 gene locus_tag LOCUS_07290 13003 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 16041 13174 gene locus_tag LOCUS_07300 16041 13174 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_07300 16641 16240 gene locus_tag LOCUS_07310 16641 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 16913 17365 gene locus_tag LOCUS_07320 16913 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 17760 17452 gene locus_tag LOCUS_07330 17760 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 17982 19403 gene locus_tag LOCUS_07340 17982 19403 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093821.1 protein_id gnl|my_center|LOCUS_07340 19576 20985 gene locus_tag LOCUS_07350 19576 20985 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085806.1 protein_id gnl|my_center|LOCUS_07350 21831 21163 gene locus_tag LOCUS_07360 21831 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21998 22825 gene locus_tag LOCUS_07370 21998 22825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 23597 22830 gene locus_tag LOCUS_07380 23597 22830 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_07380 25378 23615 gene locus_tag LOCUS_07390 25378 23615 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_07390 25864 25418 gene locus_tag LOCUS_07400 25864 25418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 26489 25839 gene locus_tag LOCUS_07410 26489 25839 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461640.1 protein_id gnl|my_center|LOCUS_07410 27529 26486 gene locus_tag LOCUS_07420 27529 26486 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_07420 28522 27533 gene locus_tag LOCUS_07430 28522 27533 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_07430 29513 28527 gene locus_tag LOCUS_07440 29513 28527 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_07440 30384 29515 gene locus_tag LOCUS_07450 30384 29515 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_07450 30788 30381 gene locus_tag LOCUS_07460 30788 30381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 31789 30794 gene locus_tag LOCUS_07470 31789 30794 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_07470 31967 32722 gene locus_tag LOCUS_07480 gene truA 31967 32722 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_07480 33359 33871 gene locus_tag LOCUS_07490 33359 33871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 33892 35652 gene locus_tag LOCUS_07500 33892 35652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 37526 36210 gene locus_tag LOCUS_07510 gene fucP 37526 36210 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_07510 38687 37539 gene locus_tag LOCUS_07520 38687 37539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_07520 40132 38786 gene locus_tag LOCUS_07530 40132 38786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 42523 40157 gene locus_tag LOCUS_07540 42523 40157 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_07540 44378 42615 gene locus_tag LOCUS_07550 gene fucI 44378 42615 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_07550 45385 44390 gene locus_tag LOCUS_07560 45385 44390 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783903.1 protein_id gnl|my_center|LOCUS_07560 46712 46047 gene locus_tag LOCUS_07570 gene mnmD 46712 46047 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_07570 46858 47397 gene locus_tag LOCUS_07580 gene cysC 46858 47397 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_07580 47403 48308 gene locus_tag LOCUS_07590 gene cysD 47403 48308 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_07590 48424 49701 gene locus_tag LOCUS_07600 48424 49701 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_07600 50659 49871 gene locus_tag LOCUS_07610 50659 49871 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_07610 50764 52932 gene locus_tag LOCUS_07620 50764 52932 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_07620 53583 52921 gene locus_tag LOCUS_07630 53583 52921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 55966 53594 gene locus_tag LOCUS_07640 55966 53594 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_07640 57174 56335 gene locus_tag LOCUS_07650 57174 56335 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943396.1 protein_id gnl|my_center|LOCUS_07650 57760 57308 gene locus_tag LOCUS_07660 57760 57308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 57945 58403 gene locus_tag LOCUS_07670 57945 58403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 58953 59339 gene locus_tag LOCUS_07680 58953 59339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 59473 59856 gene locus_tag LOCUS_07690 59473 59856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 60719 59946 gene locus_tag LOCUS_07700 60719 59946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 60992 60810 gene locus_tag LOCUS_07710 60992 60810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 61563 61150 gene locus_tag LOCUS_07720 61563 61150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 62745 61570 gene locus_tag LOCUS_07730 62745 61570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 63185 62901 gene locus_tag LOCUS_07740 63185 62901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 63426 63175 gene locus_tag LOCUS_07750 63426 63175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 64855 63428 gene locus_tag LOCUS_07760 64855 63428 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 protein_id gnl|my_center|LOCUS_07760 65258 66229 gene locus_tag LOCUS_07770 65258 66229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 66705 66250 gene locus_tag LOCUS_07780 66705 66250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 67798 66908 gene locus_tag LOCUS_07790 67798 66908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 68201 68602 gene locus_tag LOCUS_07800 68201 68602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 68627 69016 gene locus_tag LOCUS_07810 68627 69016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 69595 69089 gene locus_tag LOCUS_07820 69595 69089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 69996 69577 gene locus_tag LOCUS_07830 69996 69577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence011 2972 1203 gene locus_tag LOCUS_07840 2972 1203 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_07840 4084 3053 gene locus_tag LOCUS_07850 4084 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 5277 4081 gene locus_tag LOCUS_07860 5277 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6269 5274 gene locus_tag LOCUS_07870 6269 5274 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_07870 6889 6299 gene locus_tag LOCUS_07880 6889 6299 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_07880 7038 7214 gene locus_tag LOCUS_07890 7038 7214 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964571.1 protein_id gnl|my_center|LOCUS_07890 7348 8442 gene locus_tag LOCUS_07900 7348 8442 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_07900 8536 9975 gene locus_tag LOCUS_07910 8536 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 9985 11040 gene locus_tag LOCUS_07920 gene pdxA 9985 11040 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_07920 11148 11675 gene locus_tag LOCUS_07930 11148 11675 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_07930 11733 12704 gene locus_tag LOCUS_07940 11733 12704 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 protein_id gnl|my_center|LOCUS_07940 12838 13884 gene locus_tag LOCUS_07950 12838 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14099 17536 gene locus_tag LOCUS_07960 14099 17536 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_07960 17572 19365 gene locus_tag LOCUS_07970 17572 19365 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_07970 20239 20057 gene locus_tag LOCUS_07980 20239 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 20744 20376 gene locus_tag LOCUS_07990 20744 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 21925 20777 gene locus_tag LOCUS_08000 21925 20777 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_08000 22460 21936 gene locus_tag LOCUS_08010 22460 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 22810 22457 gene locus_tag LOCUS_08020 22810 22457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 24060 22798 gene locus_tag LOCUS_08030 24060 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 24797 24123 gene locus_tag LOCUS_08040 24797 24123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 25321 24839 gene locus_tag LOCUS_08050 25321 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 26244 25318 gene locus_tag LOCUS_08060 26244 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 26842 26291 gene locus_tag LOCUS_08070 26842 26291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 28059 26845 gene locus_tag LOCUS_08080 28059 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 29960 28065 gene locus_tag LOCUS_08090 29960 28065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 31427 29988 gene locus_tag LOCUS_08100 31427 29988 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_08100 31951 31424 gene locus_tag LOCUS_08110 31951 31424 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964390.1 protein_id gnl|my_center|LOCUS_08110 32365 31955 gene locus_tag LOCUS_08120 32365 31955 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_08120 38259 32581 gene locus_tag LOCUS_08130 38259 32581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 38977 38375 gene locus_tag LOCUS_08140 38977 38375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 39526 38978 gene locus_tag LOCUS_08150 39526 38978 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964392.1 protein_id gnl|my_center|LOCUS_08150 40794 40120 gene locus_tag LOCUS_08160 40794 40120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 41487 41296 gene locus_tag LOCUS_08170 41487 41296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 49593 41521 gene locus_tag LOCUS_08180 49593 41521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 51124 50687 gene locus_tag LOCUS_08190 51124 50687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 51374 51964 gene locus_tag LOCUS_08200 gene ruvA 51374 51964 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_08200 51982 59385 gene locus_tag LOCUS_08210 gene sprA 51982 59385 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_08210 59462 59842 gene locus_tag LOCUS_08220 gene gcvH 59462 59842 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_08220 59939 60706 gene locus_tag LOCUS_08230 59939 60706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 64196 60942 gene locus_tag LOCUS_08240 gene infB 64196 60942 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_08240 65502 64264 gene locus_tag LOCUS_08250 gene nusA 65502 64264 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_08250 65986 65522 gene locus_tag LOCUS_08260 gene rimP 65986 65522 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_08260 66153 66359 gene locus_tag LOCUS_08270 66153 66359 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08270 67763 66543 gene locus_tag LOCUS_08280 67763 66543 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence012 945 565 gene locus_tag LOCUS_08290 945 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1234 1821 gene locus_tag LOCUS_08300 1234 1821 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_08300 1938 3173 gene locus_tag LOCUS_08310 1938 3173 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_08310 3183 4469 gene locus_tag LOCUS_08320 3183 4469 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_08320 4453 5934 gene locus_tag LOCUS_08330 4453 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6000 8252 gene locus_tag LOCUS_08340 6000 8252 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_08340 8333 8794 gene locus_tag LOCUS_08350 8333 8794 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_08350 9016 10275 gene locus_tag LOCUS_08360 9016 10275 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_08360 11741 10341 gene locus_tag LOCUS_08370 11741 10341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_08370 12873 11752 gene locus_tag LOCUS_08380 12873 11752 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_08380 13964 12879 gene locus_tag LOCUS_08390 13964 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 14702 14022 gene locus_tag LOCUS_08400 14702 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 14836 16158 gene locus_tag LOCUS_08410 14836 16158 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_08410 17217 16267 gene locus_tag LOCUS_08420 17217 16267 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_08420 17954 17316 gene locus_tag LOCUS_08430 17954 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18093 19067 gene locus_tag LOCUS_08440 18093 19067 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_08440 19051 19677 gene locus_tag LOCUS_08450 19051 19677 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_08450 19674 20486 gene locus_tag LOCUS_08460 19674 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 20665 21876 gene locus_tag LOCUS_08470 20665 21876 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_08470 22280 21879 gene locus_tag LOCUS_08480 22280 21879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 22536 23546 gene locus_tag LOCUS_08490 22536 23546 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_08490 24965 23616 gene locus_tag LOCUS_08500 24965 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 25650 24967 gene locus_tag LOCUS_08510 25650 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 26860 25556 gene locus_tag LOCUS_08520 26860 25556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 25704 25713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28755 26866 gene locus_tag LOCUS_08530 28755 26866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 29360 29902 gene locus_tag LOCUS_08540 29360 29902 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_08540 30011 31009 gene locus_tag LOCUS_08550 30011 31009 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_08550 31258 34614 gene locus_tag LOCUS_08560 31258 34614 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_08560 34632 36524 gene locus_tag LOCUS_08570 34632 36524 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_08570 36647 37810 gene locus_tag LOCUS_08580 36647 37810 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_08580 37950 39035 gene locus_tag LOCUS_08590 37950 39035 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_08590 39171 39755 gene locus_tag LOCUS_08600 39171 39755 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_08600 39830 40966 gene locus_tag LOCUS_08610 39830 40966 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765195.1 protein_id gnl|my_center|LOCUS_08610 41205 44693 gene locus_tag LOCUS_08620 41205 44693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108033.1 protein_id gnl|my_center|LOCUS_08620 44717 47020 gene locus_tag LOCUS_08630 44717 47020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 47122 50040 gene locus_tag LOCUS_08640 47122 50040 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109142.1 protein_id gnl|my_center|LOCUS_08640 50044 53664 gene locus_tag LOCUS_08650 50044 53664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 53914 54723 gene locus_tag LOCUS_08660 53914 54723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 54807 56633 gene locus_tag LOCUS_08670 gene rhgW 54807 56633 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_08670 56808 58145 gene locus_tag LOCUS_08680 56808 58145 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_08680 58239 59372 gene locus_tag LOCUS_08690 58239 59372 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_08690 59749 61206 gene locus_tag LOCUS_08700 59749 61206 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_08700 61250 63652 gene locus_tag LOCUS_08710 61250 63652 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_08710 63914 64369 gene locus_tag LOCUS_08720 63914 64369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08720 64346 64355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64357 64977 gene locus_tag LOCUS_08730 64357 64977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 65076 66311 gene locus_tag LOCUS_08740 65076 66311 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence013 526 2400 gene locus_tag LOCUS_08750 526 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2413 3828 gene locus_tag LOCUS_08760 2413 3828 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_08760 4838 3855 gene locus_tag LOCUS_08770 4838 3855 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_08770 5566 4838 gene locus_tag LOCUS_08780 5566 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5825 5577 gene locus_tag LOCUS_08790 gene atpC 5825 5577 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_08790 7455 5947 gene locus_tag LOCUS_08800 gene atpD 7455 5947 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_08800 7849 8262 gene locus_tag LOCUS_08810 7849 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8540 9904 gene locus_tag LOCUS_08820 8540 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10089 11966 gene locus_tag LOCUS_08830 10089 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 12152 11973 gene locus_tag LOCUS_08840 12152 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 12375 12205 gene locus_tag LOCUS_08850 12375 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 13034 12315 gene locus_tag LOCUS_08860 13034 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14108 13056 gene locus_tag LOCUS_08870 14108 13056 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832304.1 protein_id gnl|my_center|LOCUS_08870 14791 14447 gene locus_tag LOCUS_08880 14791 14447 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_08880 14908 16347 gene locus_tag LOCUS_08890 14908 16347 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299143.1 protein_id gnl|my_center|LOCUS_08890 16408 16668 gene locus_tag LOCUS_08900 16408 16668 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_08900 16668 17162 gene locus_tag LOCUS_08910 16668 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 17653 17159 gene locus_tag LOCUS_08920 17653 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 17864 19033 gene locus_tag LOCUS_08930 17864 19033 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_08930 19252 19830 gene locus_tag LOCUS_08940 19252 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 19855 20508 gene locus_tag LOCUS_08950 19855 20508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 20538 22487 gene locus_tag LOCUS_08960 20538 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 22499 24355 gene locus_tag LOCUS_08970 22499 24355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 24887 24417 gene locus_tag LOCUS_08980 24887 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 25134 24805 gene locus_tag LOCUS_08990 25134 24805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 25834 25160 gene locus_tag LOCUS_09000 25834 25160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 26505 25861 gene locus_tag LOCUS_09010 26505 25861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 27388 26507 gene locus_tag LOCUS_09020 27388 26507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 27981 27385 gene locus_tag LOCUS_09030 27981 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 28517 27978 gene locus_tag LOCUS_09040 28517 27978 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_09040 29231 28695 gene locus_tag LOCUS_09050 29231 28695 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_09050 29322 29936 gene locus_tag LOCUS_09060 29322 29936 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_09060 30748 29945 gene locus_tag LOCUS_09070 30748 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 31764 30745 gene locus_tag LOCUS_09080 31764 30745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 32859 31771 gene locus_tag LOCUS_09090 32859 31771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 33096 32866 gene locus_tag LOCUS_09100 33096 32866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 33890 33195 gene locus_tag LOCUS_09110 33890 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 35671 33908 gene locus_tag LOCUS_09120 35671 33908 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_09120 38887 35690 gene locus_tag LOCUS_09130 38887 35690 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_09130 39970 39020 gene locus_tag LOCUS_09140 39970 39020 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_09140 40865 39957 gene locus_tag LOCUS_09150 40865 39957 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_09150 41573 40896 gene locus_tag LOCUS_09160 41573 40896 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980647.1 protein_id gnl|my_center|LOCUS_09160 42050 41601 gene locus_tag LOCUS_09170 42050 41601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 42645 42001 gene locus_tag LOCUS_09180 42645 42001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 45303 43933 gene locus_tag LOCUS_09190 45303 43933 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225147.1 protein_id gnl|my_center|LOCUS_09190 46480 45359 gene locus_tag LOCUS_09200 46480 45359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 48279 46702 gene locus_tag LOCUS_09210 48279 46702 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_09210 51509 48291 gene locus_tag LOCUS_09220 51509 48291 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_09220 52811 51732 gene locus_tag LOCUS_09230 52811 51732 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_09230 53484 52912 gene locus_tag LOCUS_09240 53484 52912 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_09240 54190 53675 gene locus_tag LOCUS_09250 54190 53675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 55624 54203 gene locus_tag LOCUS_09260 gene gntT 55624 54203 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_09260 56651 55629 gene locus_tag LOCUS_09270 56651 55629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 58049 56667 gene locus_tag LOCUS_09280 58049 56667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 59038 58160 gene locus_tag LOCUS_09290 59038 58160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 59571 60587 gene locus_tag LOCUS_09300 59571 60587 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_09300 60663 61370 gene locus_tag LOCUS_09310 60663 61370 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 protein_id gnl|my_center|LOCUS_09310 61626 61970 gene locus_tag LOCUS_09320 61626 61970 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_09320 61973 62605 gene locus_tag LOCUS_09330 61973 62605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence014 845 363 gene locus_tag LOCUS_09340 845 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2049 859 gene locus_tag LOCUS_09350 2049 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3645 2119 gene locus_tag LOCUS_09360 gene gltX 3645 2119 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_09360 5636 3813 gene locus_tag LOCUS_09370 5636 3813 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_09370 6282 6623 gene locus_tag LOCUS_09380 6282 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6647 7303 gene locus_tag LOCUS_09390 6647 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7892 7356 gene locus_tag LOCUS_09400 7892 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9644 8157 gene locus_tag LOCUS_09410 9644 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 10000 11409 gene locus_tag LOCUS_09420 10000 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11775 14417 gene locus_tag LOCUS_09430 11775 14417 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_09430 14423 15520 gene locus_tag LOCUS_09440 14423 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 15606 17186 gene locus_tag LOCUS_09450 15606 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_09450 17186 17860 gene locus_tag LOCUS_09460 17186 17860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 17984 18541 gene locus_tag LOCUS_09470 17984 18541 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_09470 18582 19568 gene locus_tag LOCUS_09480 18582 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 19685 20800 gene locus_tag LOCUS_09490 19685 20800 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_09490 20800 21987 gene locus_tag LOCUS_09500 20800 21987 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_09500 22385 21993 gene locus_tag LOCUS_09510 22385 21993 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_09510 23627 22476 gene locus_tag LOCUS_09520 23627 22476 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_09520 24415 24993 gene locus_tag LOCUS_09530 24415 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 24995 25492 gene locus_tag LOCUS_09540 24995 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 25506 25793 gene locus_tag LOCUS_09550 25506 25793 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582457.1 protein_id gnl|my_center|LOCUS_09550 25815 26246 gene locus_tag LOCUS_09560 gene trxA 25815 26246 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_09560 26252 26671 gene locus_tag LOCUS_09570 26252 26671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 27587 28207 gene locus_tag LOCUS_09580 27587 28207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 28224 29096 gene locus_tag LOCUS_09590 28224 29096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 29680 30084 gene locus_tag LOCUS_09600 29680 30084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 30054 30983 gene locus_tag LOCUS_09610 30054 30983 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_09610 31415 32344 gene locus_tag LOCUS_09620 31415 32344 CDS product palindromic element RPE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886190.1 protein_id gnl|my_center|LOCUS_09620 32487 32981 gene locus_tag LOCUS_09630 32487 32981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 33012 33689 gene locus_tag LOCUS_09640 33012 33689 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_09640 33686 35074 gene locus_tag LOCUS_09650 33686 35074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_09650 35159 35887 gene locus_tag LOCUS_09660 35159 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 36008 37102 gene locus_tag LOCUS_09670 36008 37102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 37474 37387 gene locus_tag LOCUS_t00070 37474 37387 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 38619 37585 gene locus_tag LOCUS_09680 38619 37585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 39621 38722 gene locus_tag LOCUS_09690 39621 38722 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_09690 39778 41727 gene locus_tag LOCUS_09700 39778 41727 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_09700 41768 43702 gene locus_tag LOCUS_09710 41768 43702 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_09710 44041 44538 gene locus_tag LOCUS_09720 44041 44538 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_09720 44731 45606 gene locus_tag LOCUS_09730 44731 45606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 46394 45675 gene locus_tag LOCUS_09740 46394 45675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 46578 47855 gene locus_tag LOCUS_09750 46578 47855 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_09750 47877 49223 gene locus_tag LOCUS_09760 47877 49223 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_09760 49245 49952 gene locus_tag LOCUS_09770 gene tsaB 49245 49952 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_09770 50059 50838 gene locus_tag LOCUS_09780 50059 50838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 51091 50930 gene locus_tag LOCUS_09790 51091 50930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 51584 51129 gene locus_tag LOCUS_09800 51584 51129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 52292 51903 gene locus_tag LOCUS_09810 52292 51903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 53603 52401 gene locus_tag LOCUS_09820 53603 52401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 54594 53758 gene locus_tag LOCUS_09830 54594 53758 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225689.1 protein_id gnl|my_center|LOCUS_09830 55179 54757 gene locus_tag LOCUS_09840 55179 54757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 56041 55376 gene locus_tag LOCUS_09850 56041 55376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 56219 56767 gene locus_tag LOCUS_09860 56219 56767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 57229 57852 gene locus_tag LOCUS_09870 57229 57852 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_09870 60327 57892 gene locus_tag LOCUS_09880 60327 57892 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_09880 60904 60338 gene locus_tag LOCUS_09890 60904 60338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence015 412 960 gene locus_tag LOCUS_09900 412 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 977 2137 gene locus_tag LOCUS_09910 977 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2508 3773 gene locus_tag LOCUS_09920 2508 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3890 4411 gene locus_tag LOCUS_09930 3890 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7949 8686 gene locus_tag LOCUS_09940 7949 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 8683 9309 gene locus_tag LOCUS_09950 8683 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 9915 12302 gene locus_tag LOCUS_09960 9915 12302 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_09960 12299 12871 gene locus_tag LOCUS_09970 12299 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12876 13703 gene locus_tag LOCUS_09980 12876 13703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 13703 14329 gene locus_tag LOCUS_09990 13703 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 14342 15292 gene locus_tag LOCUS_10000 gene traM 14342 15292 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842181.1 protein_id gnl|my_center|LOCUS_10000 15393 16124 gene locus_tag LOCUS_10010 gene traN 15393 16124 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032812065.1 protein_id gnl|my_center|LOCUS_10010 16121 16357 gene locus_tag LOCUS_10020 16121 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16658 16918 gene locus_tag LOCUS_10030 16658 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 17397 17567 gene locus_tag LOCUS_10040 17397 17567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 18091 18768 gene locus_tag LOCUS_10050 18091 18768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 19004 19390 gene locus_tag LOCUS_10060 19004 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19741 19463 gene locus_tag LOCUS_10070 19741 19463 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_10070 20116 19754 gene locus_tag LOCUS_10080 20116 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 20430 20185 gene locus_tag LOCUS_10090 20430 20185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 20555 23344 gene locus_tag LOCUS_10100 20555 23344 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_10100 23348 25282 gene locus_tag LOCUS_10110 23348 25282 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_10110 25275 26474 gene locus_tag LOCUS_10120 25275 26474 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966754.1 protein_id gnl|my_center|LOCUS_10120 28354 26690 gene locus_tag LOCUS_10130 28354 26690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 29234 28398 gene locus_tag LOCUS_10140 29234 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 29553 29200 gene locus_tag LOCUS_10150 29553 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 30214 29540 gene locus_tag LOCUS_10160 30214 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 30320 30841 gene locus_tag LOCUS_10170 30320 30841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 30816 31991 gene locus_tag LOCUS_10180 30816 31991 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_10180 31972 32322 gene locus_tag LOCUS_10190 31972 32322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 32634 32834 gene locus_tag LOCUS_10200 32634 32834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 32937 33566 gene locus_tag LOCUS_10210 32937 33566 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_10210 34188 33709 gene locus_tag LOCUS_10220 34188 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 34994 34425 gene locus_tag LOCUS_10230 34994 34425 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_10230 35297 36637 gene locus_tag LOCUS_10240 35297 36637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 37481 36777 gene locus_tag LOCUS_10250 37481 36777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 37779 37549 gene locus_tag LOCUS_10260 37779 37549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 38329 37955 gene locus_tag LOCUS_10270 38329 37955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 38536 41442 gene locus_tag LOCUS_10280 38536 41442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 41820 42398 gene locus_tag LOCUS_10290 41820 42398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 42477 43190 gene locus_tag LOCUS_10300 42477 43190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 44009 43314 gene locus_tag LOCUS_10310 44009 43314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 44226 45374 gene locus_tag LOCUS_10320 gene dinB 44226 45374 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_10320 45381 48311 gene locus_tag LOCUS_10330 45381 48311 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_10330 48702 48325 gene locus_tag LOCUS_10340 48702 48325 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_10340 48840 49622 gene locus_tag LOCUS_10350 48840 49622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 49644 49997 gene locus_tag LOCUS_10360 49644 49997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 51245 51724 gene locus_tag LOCUS_10370 51245 51724 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_10370 51830 52894 gene locus_tag LOCUS_10380 51830 52894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 52931 53266 gene locus_tag LOCUS_10390 52931 53266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 53311 53490 gene locus_tag LOCUS_10400 53311 53490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 53602 54258 gene locus_tag LOCUS_10410 53602 54258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 54891 55184 gene locus_tag LOCUS_10420 54891 55184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 55200 55523 gene locus_tag LOCUS_10430 55200 55523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 55536 55733 gene locus_tag LOCUS_10440 55536 55733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 55730 55939 gene locus_tag LOCUS_10450 55730 55939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 56118 56330 gene locus_tag LOCUS_10460 56118 56330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 56382 57125 gene locus_tag LOCUS_10470 56382 57125 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_10470 57126 57413 gene locus_tag LOCUS_10480 57126 57413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 57416 58648 gene locus_tag LOCUS_10490 57416 58648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence016 1523 513 gene locus_tag LOCUS_10500 1523 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3297 1510 gene locus_tag LOCUS_10510 3297 1510 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_10510 6459 3310 gene locus_tag LOCUS_10520 6459 3310 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_10520 8337 6484 gene locus_tag LOCUS_10530 8337 6484 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_10530 11552 8349 gene locus_tag LOCUS_10540 11552 8349 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_10540 13241 12276 gene locus_tag LOCUS_10550 13241 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 12392 12401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15131 13269 gene locus_tag LOCUS_10560 15131 13269 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_10560 18357 15142 gene locus_tag LOCUS_10570 18357 15142 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_10570 20248 18383 gene locus_tag LOCUS_10580 20248 18383 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_10580 23310 20266 gene locus_tag LOCUS_10590 23310 20266 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_10590 23860 25092 gene locus_tag LOCUS_10600 23860 25092 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_10600 25308 25141 gene locus_tag LOCUS_10610 25308 25141 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_10610 26653 25454 gene locus_tag LOCUS_10620 26653 25454 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_10620 30064 26783 gene locus_tag LOCUS_10630 30064 26783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 30336 31412 gene locus_tag LOCUS_10640 30336 31412 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_10640 31518 33263 gene locus_tag LOCUS_10650 31518 33263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 33279 35273 gene locus_tag LOCUS_10660 33279 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 36056 35292 gene locus_tag LOCUS_10670 36056 35292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 36055 36210 gene locus_tag LOCUS_10680 36055 36210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 36203 38329 gene locus_tag LOCUS_10690 gene glgX 36203 38329 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_10690 38336 40162 gene locus_tag LOCUS_10700 gene treZ 38336 40162 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_10700 40174 44388 gene locus_tag LOCUS_10710 40174 44388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 47304 44392 gene locus_tag LOCUS_10720 47304 44392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 48419 47490 gene locus_tag LOCUS_10730 48419 47490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 49472 48621 gene locus_tag LOCUS_10740 49472 48621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 50284 52203 gene locus_tag LOCUS_10750 gene dnaK 50284 52203 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764765.1 protein_id gnl|my_center|LOCUS_10750 53053 56298 gene locus_tag LOCUS_10760 53053 56298 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_10760 56313 57911 gene locus_tag LOCUS_10770 56313 57911 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_10770 57920 59473 gene locus_tag LOCUS_10780 57920 59473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence017 1608 19 gene locus_tag LOCUS_10790 1608 19 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_10790 1757 2683 gene locus_tag LOCUS_10800 1757 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2680 3315 gene locus_tag LOCUS_10810 2680 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3436 4740 gene locus_tag LOCUS_10820 3436 4740 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_10820 4737 6209 gene locus_tag LOCUS_10830 4737 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6213 7292 gene locus_tag LOCUS_10840 6213 7292 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_10840 7292 9523 gene locus_tag LOCUS_10850 7292 9523 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_10850 9669 10130 gene locus_tag LOCUS_10860 9669 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 10473 11612 gene locus_tag LOCUS_10870 10473 11612 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_10870 12712 12056 gene locus_tag LOCUS_10880 12712 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 12815 13723 gene locus_tag LOCUS_10890 gene dapA 12815 13723 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966863.1 protein_id gnl|my_center|LOCUS_10890 14003 15091 gene locus_tag LOCUS_10900 gene asd 14003 15091 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_10900 15699 15193 gene locus_tag LOCUS_10910 15699 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 17108 15786 gene locus_tag LOCUS_10920 17108 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 17308 17808 gene locus_tag LOCUS_10930 17308 17808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 19063 17900 gene locus_tag LOCUS_10940 19063 17900 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_10940 20826 19171 gene locus_tag LOCUS_10950 20826 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 22876 21353 gene locus_tag LOCUS_10960 22876 21353 CDS product IS1182-like element ISBf5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_10960 23071 22997 gene locus_tag LOCUS_t00080 23071 22997 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 24108 23155 gene locus_tag LOCUS_10970 24108 23155 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_10970 24296 25276 gene locus_tag LOCUS_10980 24296 25276 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_10980 25882 25268 gene locus_tag LOCUS_10990 25882 25268 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_10990 27532 26015 gene locus_tag LOCUS_11000 27532 26015 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_11000 28673 27534 gene locus_tag LOCUS_11010 28673 27534 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_11010 29907 28858 gene locus_tag LOCUS_11020 gene queA 29907 28858 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_11020 30646 29942 gene locus_tag LOCUS_11030 gene truB 30646 29942 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_11030 31425 30643 gene locus_tag LOCUS_11040 31425 30643 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_11040 31694 31440 gene locus_tag LOCUS_11050 31694 31440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 32490 31699 gene locus_tag LOCUS_11060 32490 31699 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_11060 33728 32709 gene locus_tag LOCUS_11070 33728 32709 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_11070 37298 33834 gene locus_tag LOCUS_11080 37298 33834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 37381 38214 gene locus_tag LOCUS_11090 37381 38214 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_11090 38296 38904 gene locus_tag LOCUS_11100 38296 38904 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_11100 39019 41235 gene locus_tag LOCUS_11110 39019 41235 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_11110 41433 41517 gene locus_tag LOCUS_t00090 41433 41517 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41555 42028 gene locus_tag LOCUS_11120 41555 42028 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_11120 42012 43616 gene locus_tag LOCUS_11130 42012 43616 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_11130 43648 44460 gene locus_tag LOCUS_11140 43648 44460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 44476 45393 gene locus_tag LOCUS_11150 44476 45393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_11150 46184 45390 gene locus_tag LOCUS_11160 46184 45390 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_11160 46352 48049 gene locus_tag LOCUS_11170 gene ggt 46352 48049 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_11170 49524 48229 gene locus_tag LOCUS_11180 49524 48229 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_11180 49705 50340 gene locus_tag LOCUS_11190 49705 50340 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_11190 50382 52322 gene locus_tag LOCUS_11200 50382 52322 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_11200 52444 53184 gene locus_tag LOCUS_11210 52444 53184 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_11210 53582 54178 gene locus_tag LOCUS_11220 53582 54178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 54425 55333 gene locus_tag LOCUS_11230 54425 55333 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389232.1 protein_id gnl|my_center|LOCUS_11230 55323 56174 gene locus_tag LOCUS_11240 55323 56174 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388612.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence018 370 65 gene locus_tag LOCUS_11250 370 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 540 358 gene locus_tag LOCUS_11260 540 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2205 613 gene locus_tag LOCUS_11270 2205 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2778 2209 gene locus_tag LOCUS_11280 gene sigW 2778 2209 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_11280 3230 2775 gene locus_tag LOCUS_11290 3230 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5097 3337 gene locus_tag LOCUS_11300 5097 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6486 5224 gene locus_tag LOCUS_11310 6486 5224 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_11310 7058 6657 gene locus_tag LOCUS_11320 7058 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7268 7849 gene locus_tag LOCUS_11330 7268 7849 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_11330 7851 8861 gene locus_tag LOCUS_11340 7851 8861 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_11340 8866 10734 gene locus_tag LOCUS_11350 8866 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 10901 11347 gene locus_tag LOCUS_11360 10901 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 11335 11344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11441 12133 gene locus_tag LOCUS_11370 11441 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12170 14518 gene locus_tag LOCUS_11380 12170 14518 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_11380 15380 14895 gene locus_tag LOCUS_11390 15380 14895 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_11390 17174 15390 gene locus_tag LOCUS_11400 17174 15390 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_11400 19248 17167 gene locus_tag LOCUS_11410 19248 17167 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_11410 19980 19336 gene locus_tag LOCUS_11420 19980 19336 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_11420 21378 19984 gene locus_tag LOCUS_11430 21378 19984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 21953 23077 gene locus_tag LOCUS_11440 21953 23077 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_11440 23074 23811 gene locus_tag LOCUS_11450 23074 23811 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_11450 24169 23795 gene locus_tag LOCUS_11460 24169 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 25181 24153 gene locus_tag LOCUS_11470 25181 24153 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_11470 25511 26773 gene locus_tag LOCUS_11480 25511 26773 CDS product DUF4270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107977.1 protein_id gnl|my_center|LOCUS_11480 26843 28090 gene locus_tag LOCUS_11490 26843 28090 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_11490 29957 28134 gene locus_tag LOCUS_11500 29957 28134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 30250 30978 gene locus_tag LOCUS_11510 30250 30978 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_11510 31721 32134 gene locus_tag LOCUS_11520 31721 32134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 34877 32145 gene locus_tag LOCUS_11530 34877 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 36094 35705 gene locus_tag LOCUS_11540 36094 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 44829 36133 gene locus_tag LOCUS_11550 44829 36133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 45225 45728 gene locus_tag LOCUS_11560 45225 45728 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 protein_id gnl|my_center|LOCUS_11560 45750 47327 gene locus_tag LOCUS_11570 45750 47327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 48142 47600 gene locus_tag LOCUS_11580 48142 47600 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_11580 48269 49462 gene locus_tag LOCUS_11590 gene sucC 48269 49462 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_11590 50457 49834 gene locus_tag LOCUS_11600 gene rsmG 50457 49834 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_11600 51056 50457 gene locus_tag LOCUS_11610 gene sigW 51056 50457 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_11610 52180 51047 gene locus_tag LOCUS_11620 52180 51047 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_11620 52412 53542 gene locus_tag LOCUS_11630 gene tgt 52412 53542 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_11630 53539 54633 gene locus_tag LOCUS_11640 53539 54633 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence019 1923 997 gene locus_tag LOCUS_11650 1923 997 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 protein_id gnl|my_center|LOCUS_11650 3369 2059 gene locus_tag LOCUS_11660 3369 2059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_11660 5009 3477 gene locus_tag LOCUS_11670 5009 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5487 5888 gene locus_tag LOCUS_11680 gene mce 5487 5888 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_11680 5916 7475 gene locus_tag LOCUS_11690 5916 7475 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_11690 7478 7828 gene locus_tag LOCUS_11700 7478 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 7950 8381 gene locus_tag LOCUS_11710 7950 8381 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_11710 8387 9676 gene locus_tag LOCUS_11720 8387 9676 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_11720 9912 10952 gene locus_tag LOCUS_11730 9912 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 11119 12285 gene locus_tag LOCUS_11740 11119 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12513 14024 gene locus_tag LOCUS_11750 12513 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 14028 15017 gene locus_tag LOCUS_11760 14028 15017 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_11760 15082 16680 gene locus_tag LOCUS_11770 15082 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 16758 17273 gene locus_tag LOCUS_11780 16758 17273 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_11780 19195 17378 gene locus_tag LOCUS_11790 19195 17378 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_11790 19359 20159 gene locus_tag LOCUS_11800 19359 20159 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_11800 20247 21110 gene locus_tag LOCUS_11810 20247 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 21112 22125 gene locus_tag LOCUS_11820 21112 22125 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_11820 23734 22349 gene locus_tag LOCUS_11830 23734 22349 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 protein_id gnl|my_center|LOCUS_11830 24334 23882 gene locus_tag LOCUS_11840 24334 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 24576 24896 gene locus_tag LOCUS_11850 24576 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 25903 24917 gene locus_tag LOCUS_11860 25903 24917 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_11860 26092 26961 gene locus_tag LOCUS_11870 26092 26961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 28989 26962 gene locus_tag LOCUS_11880 28989 26962 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108318.1 protein_id gnl|my_center|LOCUS_11880 30240 28993 gene locus_tag LOCUS_11890 30240 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 31575 30247 gene locus_tag LOCUS_11900 31575 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 31802 33394 gene locus_tag LOCUS_11910 31802 33394 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_11910 33551 34837 gene locus_tag LOCUS_11920 gene galK 33551 34837 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_11920 35005 36060 gene locus_tag LOCUS_11930 35005 36060 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_11930 36075 36767 gene locus_tag LOCUS_11940 36075 36767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 36889 37632 gene locus_tag LOCUS_11950 36889 37632 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_11950 37749 39494 gene locus_tag LOCUS_11960 37749 39494 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_11960 39498 40184 gene locus_tag LOCUS_11970 39498 40184 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_11970 40290 41966 gene locus_tag LOCUS_11980 gene araB 40290 41966 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951836.1 protein_id gnl|my_center|LOCUS_11980 43578 42145 gene locus_tag LOCUS_11990 43578 42145 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_11990 44981 43578 gene locus_tag LOCUS_12000 44981 43578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 45377 45000 gene locus_tag LOCUS_12010 45377 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 45736 45389 gene locus_tag LOCUS_12020 45736 45389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 46899 45754 gene locus_tag LOCUS_12030 46899 45754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 47841 47143 gene locus_tag LOCUS_12040 47841 47143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_12040 49145 47910 gene locus_tag LOCUS_12050 49145 47910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 50643 49150 gene locus_tag LOCUS_12060 50643 49150 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_12060 51145 50708 gene locus_tag LOCUS_12070 51145 50708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_12070 51314 52702 gene locus_tag LOCUS_12080 51314 52702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 52977 52708 gene locus_tag LOCUS_12090 52977 52708 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_12090 <53717 52980 gene locus_tag LOCUS_12100 <53717 52980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444958.1:Xaa-Pro aminopeptidase >Feature sequence020 103 1347 gene locus_tag LOCUS_12110 103 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1353 2216 gene locus_tag LOCUS_12120 1353 2216 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_12120 2294 3193 gene locus_tag LOCUS_12130 2294 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3206 3685 gene locus_tag LOCUS_12140 3206 3685 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389161.1 protein_id gnl|my_center|LOCUS_12140 3698 4795 gene locus_tag LOCUS_12150 3698 4795 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_12150 4884 7163 gene locus_tag LOCUS_12160 4884 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7250 8893 gene locus_tag LOCUS_12170 7250 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9494 8931 gene locus_tag LOCUS_12180 9494 8931 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_12180 9565 9744 gene locus_tag LOCUS_12190 9565 9744 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965557.1 protein_id gnl|my_center|LOCUS_12190 9751 10998 gene locus_tag LOCUS_12200 9751 10998 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813632.1 protein_id gnl|my_center|LOCUS_12200 11004 11825 gene locus_tag LOCUS_12210 gene ccsA 11004 11825 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_12210 12415 11822 gene locus_tag LOCUS_12220 gene hisIE 12415 11822 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_12220 13186 12422 gene locus_tag LOCUS_12230 gene hisF 13186 12422 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_12230 13907 13188 gene locus_tag LOCUS_12240 gene hisA 13907 13188 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 protein_id gnl|my_center|LOCUS_12240 14500 13904 gene locus_tag LOCUS_12250 gene hisH 14500 13904 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_12250 15389 14511 gene locus_tag LOCUS_12260 gene purU 15389 14511 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_12260 16524 15397 gene locus_tag LOCUS_12270 gene hisB 16524 15397 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_12270 17590 16526 gene locus_tag LOCUS_12280 gene hisC 17590 16526 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_12280 18872 17577 gene locus_tag LOCUS_12290 gene hisD 18872 17577 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_12290 19748 18891 gene locus_tag LOCUS_12300 gene hisG 19748 18891 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_12300 21432 20101 gene locus_tag LOCUS_12310 21432 20101 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_12310 21552 22217 gene locus_tag LOCUS_12320 21552 22217 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 protein_id gnl|my_center|LOCUS_12320 22425 22225 gene locus_tag LOCUS_12330 22425 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 23886 22765 gene locus_tag LOCUS_12340 23886 22765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_12340 24936 23893 gene locus_tag LOCUS_12350 24936 23893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_12350 25746 25006 gene locus_tag LOCUS_12360 25746 25006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 26669 25743 gene locus_tag LOCUS_12370 26669 25743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 27573 26680 gene locus_tag LOCUS_12380 27573 26680 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_12380 28862 27579 gene locus_tag LOCUS_12390 28862 27579 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_12390 29514 28873 gene locus_tag LOCUS_12400 29514 28873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 29842 29657 gene locus_tag LOCUS_12410 29842 29657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 30051 30626 gene locus_tag LOCUS_12420 30051 30626 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_12420 30619 31167 gene locus_tag LOCUS_12430 30619 31167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 31148 32233 gene locus_tag LOCUS_12440 31148 32233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 33655 32303 gene locus_tag LOCUS_12450 33655 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 33663 33983 gene locus_tag LOCUS_12460 33663 33983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 35629 34244 gene locus_tag LOCUS_12470 35629 34244 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_12470 36003 35656 gene locus_tag LOCUS_12480 36003 35656 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_12480 36730 36041 gene locus_tag LOCUS_12490 36730 36041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107993.1 protein_id gnl|my_center|LOCUS_12490 37165 38124 gene locus_tag LOCUS_12500 37165 38124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 38838 38125 gene locus_tag LOCUS_12510 38838 38125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 39212 38874 gene locus_tag LOCUS_12520 39212 38874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 39858 39379 gene locus_tag LOCUS_12530 39858 39379 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106480813.1 protein_id gnl|my_center|LOCUS_12530 40165 43863 gene locus_tag LOCUS_12540 gene purL 40165 43863 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_12540 46367 44229 gene locus_tag LOCUS_12550 46367 44229 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_12550 46540 48483 gene locus_tag LOCUS_12560 gene thrS 46540 48483 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_12560 48520 49074 gene locus_tag LOCUS_12570 gene infC 48520 49074 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_12570 49111 49299 gene locus_tag LOCUS_12580 gene rpmI 49111 49299 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_12580 49378 49728 gene locus_tag LOCUS_12590 gene rplT 49378 49728 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_12590 49928 50644 gene locus_tag LOCUS_12600 gene dapB 49928 50644 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_12600 50687 52072 gene locus_tag LOCUS_12610 gene lepB 50687 52072 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_12610 53619 52168 gene locus_tag LOCUS_12620 53619 52168 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence021 1129 626 gene locus_tag LOCUS_12630 1129 626 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680658.1 protein_id gnl|my_center|LOCUS_12630 1306 2100 gene locus_tag LOCUS_12640 1306 2100 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_12640 3672 2137 gene locus_tag LOCUS_12650 3672 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4893 3742 gene locus_tag LOCUS_12660 4893 3742 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_12660 5035 5436 gene locus_tag LOCUS_12670 5035 5436 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_12670 5509 6420 gene locus_tag LOCUS_12680 5509 6420 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_12680 6502 6825 gene locus_tag LOCUS_12690 6502 6825 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_12690 6904 7386 gene locus_tag LOCUS_12700 6904 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 7392 7961 gene locus_tag LOCUS_12710 gene nrfH 7392 7961 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_12710 7982 9478 gene locus_tag LOCUS_12720 gene nrfA 7982 9478 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_12720 10311 9637 gene locus_tag LOCUS_12730 gene lipB 10311 9637 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_12730 11204 10308 gene locus_tag LOCUS_12740 gene lipA 11204 10308 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_12740 11374 12546 gene locus_tag LOCUS_12750 11374 12546 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_12750 12622 13176 gene locus_tag LOCUS_12760 12622 13176 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085899.1 protein_id gnl|my_center|LOCUS_12760 13747 13178 gene locus_tag LOCUS_12770 13747 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 14872 13859 gene locus_tag LOCUS_12780 14872 13859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_12780 15694 14951 gene locus_tag LOCUS_12790 15694 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 17380 15764 gene locus_tag LOCUS_12800 17380 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 17764 17384 gene locus_tag LOCUS_12810 17764 17384 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_12810 17931 18665 gene locus_tag LOCUS_12820 17931 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 18796 18722 gene locus_tag LOCUS_t00100 18796 18722 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19489 19106 gene locus_tag LOCUS_12830 19489 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 19681 22335 gene locus_tag LOCUS_12840 gene leuS 19681 22335 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_12840 22335 23198 gene locus_tag LOCUS_12850 22335 23198 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_12850 23217 24476 gene locus_tag LOCUS_12860 23217 24476 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_12860 24674 26209 gene locus_tag LOCUS_12870 24674 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 28091 26604 gene locus_tag LOCUS_12880 28091 26604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 29283 28099 gene locus_tag LOCUS_12890 29283 28099 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_12890 29921 29349 gene locus_tag LOCUS_12900 gene purN 29921 29349 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_12900 30081 30317 gene locus_tag LOCUS_12910 30081 30317 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_12910 30336 31589 gene locus_tag LOCUS_12920 gene fabF 30336 31589 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_12920 31713 32366 gene locus_tag LOCUS_12930 31713 32366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 32378 32797 gene locus_tag LOCUS_12940 32378 32797 CDS product IPExxxVDY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_12940 33159 34730 gene locus_tag LOCUS_12950 33159 34730 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_12950 34779 35468 gene locus_tag LOCUS_12960 34779 35468 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_12960 37676 35469 gene locus_tag LOCUS_12970 37676 35469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 40106 37701 gene locus_tag LOCUS_12980 40106 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767692.1 protein_id gnl|my_center|LOCUS_12980 40637 40233 gene locus_tag LOCUS_12990 40637 40233 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_12990 41067 41807 gene locus_tag LOCUS_13000 41067 41807 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_13000 42101 46609 gene locus_tag LOCUS_13010 gene gltB 42101 46609 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_13010 46736 48157 gene locus_tag LOCUS_13020 46736 48157 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_13020 48314 49672 gene locus_tag LOCUS_13030 48314 49672 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_13030 51183 49918 gene locus_tag LOCUS_13040 51183 49918 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence022 3927 805 gene locus_tag LOCUS_13050 3927 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4771 4058 gene locus_tag LOCUS_13060 4771 4058 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_13060 5715 4903 gene locus_tag LOCUS_13070 5715 4903 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_13070 6349 5690 gene locus_tag LOCUS_13080 6349 5690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_13080 6669 6373 gene locus_tag LOCUS_13090 6669 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 9851 6831 gene locus_tag LOCUS_13100 gene secDF 9851 6831 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_13100 11353 10184 gene locus_tag LOCUS_13110 gene nhaA 11353 10184 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_13110 11552 11890 gene locus_tag LOCUS_13120 11552 11890 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_13120 12051 13385 gene locus_tag LOCUS_13130 12051 13385 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_13130 14349 13507 gene locus_tag LOCUS_13140 14349 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 14804 14373 gene locus_tag LOCUS_13150 14804 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 15098 14907 gene locus_tag LOCUS_13160 15098 14907 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964571.1 protein_id gnl|my_center|LOCUS_13160 15676 15215 gene locus_tag LOCUS_13170 15676 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 15835 16275 gene locus_tag LOCUS_13180 15835 16275 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188904829.1 protein_id gnl|my_center|LOCUS_13180 18355 16409 gene locus_tag LOCUS_13190 18355 16409 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_13190 19735 18512 gene locus_tag LOCUS_13200 19735 18512 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109254.1 protein_id gnl|my_center|LOCUS_13200 20045 19722 gene locus_tag LOCUS_13210 20045 19722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 23727 21886 gene locus_tag LOCUS_13220 23727 21886 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_13220 23870 24202 gene locus_tag LOCUS_13230 23870 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 24299 24775 gene locus_tag LOCUS_13240 24299 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 24818 26080 gene locus_tag LOCUS_13250 24818 26080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 26180 26638 gene locus_tag LOCUS_13260 26180 26638 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_13260 26772 26984 gene locus_tag LOCUS_13270 26772 26984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 28227 27331 gene locus_tag LOCUS_13280 28227 27331 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_13280 28610 28242 gene locus_tag LOCUS_13290 28610 28242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 28615 28827 gene locus_tag LOCUS_13300 28615 28827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 29047 29724 gene locus_tag LOCUS_13310 29047 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 30029 31468 gene locus_tag LOCUS_13320 30029 31468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_13320 31477 32313 gene locus_tag LOCUS_13330 31477 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 32414 34297 gene locus_tag LOCUS_13340 32414 34297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 34430 35686 gene locus_tag LOCUS_13350 34430 35686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 35850 37037 gene locus_tag LOCUS_13360 35850 37037 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_13360 37148 38056 gene locus_tag LOCUS_13370 37148 38056 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_13370 43987 38060 gene locus_tag LOCUS_13380 43987 38060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 45020 44181 gene locus_tag LOCUS_13390 45020 44181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 50043 45025 gene locus_tag LOCUS_13400 50043 45025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence023 4518 3727 gene locus_tag LOCUS_13410 4518 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4700 5926 gene locus_tag LOCUS_13420 gene larA 4700 5926 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_13420 7842 5947 gene locus_tag LOCUS_13430 7842 5947 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_13430 9812 7839 gene locus_tag LOCUS_13440 9812 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10075 9815 gene locus_tag LOCUS_13450 10075 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 11743 10088 gene locus_tag LOCUS_13460 11743 10088 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257360.1 protein_id gnl|my_center|LOCUS_13460 13115 11868 gene locus_tag LOCUS_13470 13115 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 13281 14792 gene locus_tag LOCUS_13480 13281 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 15338 17029 gene locus_tag LOCUS_13490 15338 17029 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_13490 17051 18277 gene locus_tag LOCUS_13500 gene icd 17051 18277 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705337.1 protein_id gnl|my_center|LOCUS_13500 18472 18981 gene locus_tag LOCUS_13510 18472 18981 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080283.1 protein_id gnl|my_center|LOCUS_13510 19306 19130 gene locus_tag LOCUS_13520 19306 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 19259 19885 gene locus_tag LOCUS_13530 19259 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 19927 20352 gene locus_tag LOCUS_13540 19927 20352 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_13540 20535 22643 gene locus_tag LOCUS_13550 20535 22643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 22886 23662 gene locus_tag LOCUS_13560 22886 23662 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064443.1 protein_id gnl|my_center|LOCUS_13560 23681 24352 gene locus_tag LOCUS_13570 23681 24352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 24339 25277 gene locus_tag LOCUS_13580 gene ligD 24339 25277 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_13580 25548 26081 gene locus_tag LOCUS_13590 25548 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 26085 27215 gene locus_tag LOCUS_13600 26085 27215 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 protein_id gnl|my_center|LOCUS_13600 27222 27602 gene locus_tag LOCUS_13610 27222 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 27792 28397 gene locus_tag LOCUS_13620 27792 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 28479 28679 gene locus_tag LOCUS_13630 28479 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 28682 29125 gene locus_tag LOCUS_13640 28682 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 29257 29625 gene locus_tag LOCUS_13650 29257 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 29629 29844 gene locus_tag LOCUS_13660 29629 29844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 30004 30540 gene locus_tag LOCUS_13670 30004 30540 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166090.1 protein_id gnl|my_center|LOCUS_13670 30620 31123 gene locus_tag LOCUS_13680 30620 31123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 31143 31784 gene locus_tag LOCUS_13690 31143 31784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 31806 31991 gene locus_tag LOCUS_13700 31806 31991 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_13700 32021 32179 gene locus_tag LOCUS_13710 32021 32179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 32254 32802 gene locus_tag LOCUS_13720 32254 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 32833 33108 gene locus_tag LOCUS_13730 32833 33108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 33179 34477 gene locus_tag LOCUS_13740 33179 34477 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_13740 34643 35209 gene locus_tag LOCUS_13750 34643 35209 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_13750 35368 36156 gene locus_tag LOCUS_13760 35368 36156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 36194 36865 gene locus_tag LOCUS_13770 36194 36865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 36893 37456 gene locus_tag LOCUS_13780 36893 37456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 37648 38013 gene locus_tag LOCUS_13790 37648 38013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 39228 38326 gene locus_tag LOCUS_13800 39228 38326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 40055 39429 gene locus_tag LOCUS_13810 40055 39429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 40322 41182 gene locus_tag LOCUS_13820 40322 41182 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_13820 41304 43691 gene locus_tag LOCUS_13830 41304 43691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 43756 44574 gene locus_tag LOCUS_13840 43756 44574 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_13840 45651 44560 gene locus_tag LOCUS_13850 45651 44560 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_13850 49238 45654 gene locus_tag LOCUS_13860 49238 45654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence024 2611 3339 gene locus_tag LOCUS_13870 gene cmoA 2611 3339 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 protein_id gnl|my_center|LOCUS_13870 3342 4055 gene locus_tag LOCUS_13880 3342 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4258 5799 gene locus_tag LOCUS_13890 4258 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5804 7150 gene locus_tag LOCUS_13900 5804 7150 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_13900 7179 8489 gene locus_tag LOCUS_13910 7179 8489 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_13910 8502 9713 gene locus_tag LOCUS_13920 8502 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9741 10682 gene locus_tag LOCUS_13930 9741 10682 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_13930 10679 12736 gene locus_tag LOCUS_13940 10679 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13377 12895 gene locus_tag LOCUS_13950 13377 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 13615 15192 gene locus_tag LOCUS_13960 13615 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 17378 15216 gene locus_tag LOCUS_13970 17378 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 16253 16262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17296 17481 gene locus_tag LOCUS_13980 17296 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 17672 22081 gene locus_tag LOCUS_13990 17672 22081 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107220.1 protein_id gnl|my_center|LOCUS_13990 22457 24433 gene locus_tag LOCUS_14000 22457 24433 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_14000 24505 26232 gene locus_tag LOCUS_14010 24505 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 26327 29536 gene locus_tag LOCUS_14020 26327 29536 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_14020 29560 31314 gene locus_tag LOCUS_14030 29560 31314 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_14030 31533 33194 gene locus_tag LOCUS_14040 31533 33194 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_14040 33515 34510 gene locus_tag LOCUS_14050 33515 34510 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_14050 34753 35451 gene locus_tag LOCUS_14060 34753 35451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 35457 36185 gene locus_tag LOCUS_14070 35457 36185 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986422.1 protein_id gnl|my_center|LOCUS_14070 36765 36196 gene locus_tag LOCUS_14080 36765 36196 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_14080 37293 36913 gene locus_tag LOCUS_14090 37293 36913 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_14090 37766 37290 gene locus_tag LOCUS_14100 37766 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 38096 37773 gene locus_tag LOCUS_14110 38096 37773 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_14110 38614 41961 gene locus_tag LOCUS_14120 gene mfd 38614 41961 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_14120 42036 42635 gene locus_tag LOCUS_14130 42036 42635 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_14130 42716 43834 gene locus_tag LOCUS_14140 42716 43834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 44045 47473 gene locus_tag LOCUS_14150 44045 47473 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence025 <1 876 gene locus_tag LOCUS_14160 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791521.1:DNA-directed RNA polymerase subunit beta 947 5251 gene locus_tag LOCUS_14170 gene rpoC 947 5251 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_14170 5256 5570 gene locus_tag LOCUS_14180 5256 5570 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_14180 6057 5674 gene locus_tag LOCUS_14190 6057 5674 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_14190 6308 6820 gene locus_tag LOCUS_14200 6308 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 6929 7804 gene locus_tag LOCUS_14210 6929 7804 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_14210 7832 8851 gene locus_tag LOCUS_14220 7832 8851 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_14220 8872 10578 gene locus_tag LOCUS_14230 8872 10578 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_14230 12136 11387 gene locus_tag LOCUS_14240 12136 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12500 12117 gene locus_tag LOCUS_14250 12500 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 13617 12517 gene locus_tag LOCUS_14260 13617 12517 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_14260 13814 14314 gene locus_tag LOCUS_14270 13814 14314 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_14270 14326 15213 gene locus_tag LOCUS_14280 14326 15213 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107954.1 protein_id gnl|my_center|LOCUS_14280 15254 17839 gene locus_tag LOCUS_14290 15254 17839 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_14290 18090 19037 gene locus_tag LOCUS_14300 18090 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 19116 19817 gene locus_tag LOCUS_14310 19116 19817 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766234.1 protein_id gnl|my_center|LOCUS_14310 19853 21574 gene locus_tag LOCUS_14320 19853 21574 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_14320 21757 22722 gene locus_tag LOCUS_14330 21757 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 22886 23773 gene locus_tag LOCUS_14340 22886 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 24535 23777 gene locus_tag LOCUS_14350 24535 23777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 24623 25222 gene locus_tag LOCUS_14360 24623 25222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 25306 26424 gene locus_tag LOCUS_14370 25306 26424 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_14370 26666 29959 gene locus_tag LOCUS_14380 26666 29959 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767846.1 protein_id gnl|my_center|LOCUS_14380 29979 31685 gene locus_tag LOCUS_14390 29979 31685 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_14390 31799 34954 gene locus_tag LOCUS_14400 31799 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 34958 36373 gene locus_tag LOCUS_14410 34958 36373 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767194.1 protein_id gnl|my_center|LOCUS_14410 36534 36929 gene locus_tag LOCUS_14420 36534 36929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 37334 37786 gene locus_tag LOCUS_14430 37334 37786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 38064 38522 gene locus_tag LOCUS_14440 38064 38522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 39587 38535 gene locus_tag LOCUS_14450 39587 38535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 39671 40465 gene locus_tag LOCUS_14460 39671 40465 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_14460 40446 40964 gene locus_tag LOCUS_14470 40446 40964 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_14470 41006 41938 gene locus_tag LOCUS_14480 41006 41938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 41941 42531 gene locus_tag LOCUS_14490 41941 42531 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_14490 42528 44681 gene locus_tag LOCUS_14500 42528 44681 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_14500 44688 45089 gene locus_tag LOCUS_14510 gene nikR 44688 45089 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932159.1 protein_id gnl|my_center|LOCUS_14510 45189 46334 gene locus_tag LOCUS_14520 45189 46334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence026 539 1603 gene locus_tag LOCUS_14530 539 1603 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_14530 1622 2896 gene locus_tag LOCUS_14540 1622 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_14540 2975 4060 gene locus_tag LOCUS_14550 2975 4060 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_14550 4254 5000 gene locus_tag LOCUS_14560 4254 5000 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103734.1 protein_id gnl|my_center|LOCUS_14560 5424 6320 gene locus_tag LOCUS_14570 5424 6320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14570 6523 9750 gene locus_tag LOCUS_14580 6523 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9939 10604 gene locus_tag LOCUS_14590 9939 10604 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_14590 13291 10688 gene locus_tag LOCUS_14600 13291 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 13978 13475 gene locus_tag LOCUS_14610 13978 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 14873 14052 gene locus_tag LOCUS_14620 14873 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 15120 15560 gene locus_tag LOCUS_14630 15120 15560 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_14630 15625 17445 gene locus_tag LOCUS_14640 15625 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 18596 17448 gene locus_tag LOCUS_14650 18596 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 24675 18679 gene locus_tag LOCUS_14660 24675 18679 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085385.1 protein_id gnl|my_center|LOCUS_14660 24987 27404 gene locus_tag LOCUS_14670 24987 27404 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_14670 27483 28538 gene locus_tag LOCUS_14680 27483 28538 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645284.1 protein_id gnl|my_center|LOCUS_14680 28977 28584 gene locus_tag LOCUS_tm00010 28977 28584 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 29229 32111 gene locus_tag LOCUS_14690 29229 32111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 32134 32766 gene locus_tag LOCUS_14700 32134 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 32790 33164 gene locus_tag LOCUS_14710 32790 33164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 33187 33978 gene locus_tag LOCUS_14720 33187 33978 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665481.1 protein_id gnl|my_center|LOCUS_14720 33975 34682 gene locus_tag LOCUS_14730 33975 34682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439090.1 protein_id gnl|my_center|LOCUS_14730 35264 34959 gene locus_tag LOCUS_14740 35264 34959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 35650 36069 gene locus_tag LOCUS_14750 35650 36069 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_14750 36212 36640 gene locus_tag LOCUS_14760 36212 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 37298 36642 gene locus_tag LOCUS_14770 gene rpe 37298 36642 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_14770 38235 37366 gene locus_tag LOCUS_14780 38235 37366 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_14780 38412 38421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38628 40352 gene locus_tag LOCUS_14790 38628 40352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 40499 41944 gene locus_tag LOCUS_14800 40499 41944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14800 41845 44034 gene locus_tag LOCUS_14810 41845 44034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 44167 44589 gene locus_tag LOCUS_14820 gene ruvX 44167 44589 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_14820 44600 45154 gene locus_tag LOCUS_14830 gene def 44600 45154 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_14830 46216 45203 gene locus_tag LOCUS_14840 46216 45203 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence027 <1 841 gene locus_tag LOCUS_14850 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966661.1:histidine kinase N-terminal 7TM domain-containing protein 888 2294 gene locus_tag LOCUS_14860 888 2294 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_14860 2331 3500 gene locus_tag LOCUS_14870 2331 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5020 3635 gene locus_tag LOCUS_14880 5020 3635 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_14880 5708 5013 gene locus_tag LOCUS_14890 5708 5013 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_14890 5715 5882 gene locus_tag LOCUS_14900 5715 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 6714 5884 gene locus_tag LOCUS_14910 6714 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 6965 7318 gene locus_tag LOCUS_14920 6965 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8232 7696 gene locus_tag LOCUS_14930 8232 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 11332 8342 gene locus_tag LOCUS_14940 11332 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 12057 11458 gene locus_tag LOCUS_14950 12057 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12668 13120 gene locus_tag LOCUS_14960 12668 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 13117 13953 gene locus_tag LOCUS_14970 13117 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 15156 13966 gene locus_tag LOCUS_14980 15156 13966 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125591658.1 protein_id gnl|my_center|LOCUS_14980 18260 15411 gene locus_tag LOCUS_14990 18260 15411 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918674.1 protein_id gnl|my_center|LOCUS_14990 18600 22718 gene locus_tag LOCUS_15000 18600 22718 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_15000 23823 25580 gene locus_tag LOCUS_15010 23823 25580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_15010 25756 26559 gene locus_tag LOCUS_15020 25756 26559 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_15020 26578 27462 gene locus_tag LOCUS_15030 26578 27462 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975143.1 protein_id gnl|my_center|LOCUS_15030 27455 28372 gene locus_tag LOCUS_15040 27455 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 30570 29191 gene locus_tag LOCUS_15050 30570 29191 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043268.1 protein_id gnl|my_center|LOCUS_15050 31648 30557 gene locus_tag LOCUS_15060 31648 30557 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969513.1 protein_id gnl|my_center|LOCUS_15060 31719 32312 gene locus_tag LOCUS_15070 31719 32312 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_15070 32728 32378 gene locus_tag LOCUS_15080 32728 32378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 32950 34314 gene locus_tag LOCUS_15090 32950 34314 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_15090 34466 34759 gene locus_tag LOCUS_15100 34466 34759 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_15100 34743 35117 gene locus_tag LOCUS_15110 34743 35117 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_15110 35302 36375 gene locus_tag LOCUS_15120 35302 36375 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_15120 36498 36857 gene locus_tag LOCUS_15130 36498 36857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 37585 36872 gene locus_tag LOCUS_15140 37585 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 37788 38738 gene locus_tag LOCUS_15150 37788 38738 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_15150 38974 39048 gene locus_tag LOCUS_t00110 38974 39048 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 40223 39534 gene locus_tag LOCUS_15160 40223 39534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 40404 40658 gene locus_tag LOCUS_15170 40404 40658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 44876 41070 gene locus_tag LOCUS_15180 44876 41070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence028 3537 100 gene locus_tag LOCUS_15190 3537 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3681 5018 gene locus_tag LOCUS_15200 gene gdhA 3681 5018 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_15200 5362 5171 gene locus_tag LOCUS_15210 5362 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5484 6230 gene locus_tag LOCUS_15220 5484 6230 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_15220 7171 6290 gene locus_tag LOCUS_15230 7171 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 7633 7181 gene locus_tag LOCUS_15240 7633 7181 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279177.1 protein_id gnl|my_center|LOCUS_15240 9021 7645 gene locus_tag LOCUS_15250 9021 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 9889 9110 gene locus_tag LOCUS_15260 9889 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 10303 11508 gene locus_tag LOCUS_15270 gene trpB 10303 11508 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_15270 11612 12817 gene locus_tag LOCUS_15280 11612 12817 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880259.1 protein_id gnl|my_center|LOCUS_15280 12829 13857 gene locus_tag LOCUS_15290 gene mer 12829 13857 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_15290 13997 14362 gene locus_tag LOCUS_15300 13997 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 14958 14476 gene locus_tag LOCUS_15310 14958 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 16267 15188 gene locus_tag LOCUS_15320 16267 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 17168 16608 gene locus_tag LOCUS_15330 17168 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 17756 17424 gene locus_tag LOCUS_15340 17756 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 18728 17949 gene locus_tag LOCUS_15350 18728 17949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 19159 20985 gene locus_tag LOCUS_15360 19159 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 21512 21072 gene locus_tag LOCUS_15370 21512 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 22489 21962 gene locus_tag LOCUS_15380 22489 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 23055 22516 gene locus_tag LOCUS_15390 23055 22516 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_15390 23937 23251 gene locus_tag LOCUS_15400 23937 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 25389 24202 gene locus_tag LOCUS_15410 25389 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 26971 25985 gene locus_tag LOCUS_15420 26971 25985 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_15420 27505 26975 gene locus_tag LOCUS_15430 27505 26975 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_15430 29899 27647 gene locus_tag LOCUS_15440 29899 27647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 30061 30963 gene locus_tag LOCUS_15450 30061 30963 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_15450 31937 31158 gene locus_tag LOCUS_15460 31937 31158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 32456 32025 gene locus_tag LOCUS_15470 32456 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 32936 33298 gene locus_tag LOCUS_15480 32936 33298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 33306 33869 gene locus_tag LOCUS_15490 33306 33869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 33896 34321 gene locus_tag LOCUS_15500 33896 34321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 34448 35389 gene locus_tag LOCUS_15510 34448 35389 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_15510 35621 35995 gene locus_tag LOCUS_15520 35621 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 36019 36183 gene locus_tag LOCUS_15530 36019 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 36512 36318 gene locus_tag LOCUS_15540 36512 36318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 37506 36586 gene locus_tag LOCUS_15550 37506 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 39965 37941 gene locus_tag LOCUS_15560 39965 37941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 42437 39993 gene locus_tag LOCUS_15570 42437 39993 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_15570 42738 45053 gene locus_tag LOCUS_15580 42738 45053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 45147 45440 gene locus_tag LOCUS_15590 45147 45440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence029 <1 1049 gene locus_tag LOCUS_15600 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962568.1:signal peptide peptidase SppA 1062 2177 gene locus_tag LOCUS_15610 gene lpxK 1062 2177 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_15610 2134 2943 gene locus_tag LOCUS_15620 2134 2943 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_15620 3026 3682 gene locus_tag LOCUS_15630 3026 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6302 3756 gene locus_tag LOCUS_15640 6302 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6551 7558 gene locus_tag LOCUS_15650 6551 7558 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_15650 7780 9687 gene locus_tag LOCUS_15660 7780 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 12320 9843 gene locus_tag LOCUS_15670 12320 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 14577 12496 gene locus_tag LOCUS_15680 14577 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 17696 14805 gene locus_tag LOCUS_15690 gene dnaE 17696 14805 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673716.1 protein_id gnl|my_center|LOCUS_15690 18995 17745 gene locus_tag LOCUS_15700 gene dinB 18995 17745 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_15700 20346 19402 gene locus_tag LOCUS_15710 20346 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 22267 20348 gene locus_tag LOCUS_15720 22267 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 27966 22468 gene locus_tag LOCUS_15730 27966 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 29348 28317 gene locus_tag LOCUS_15740 29348 28317 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 protein_id gnl|my_center|LOCUS_15740 29891 29352 gene locus_tag LOCUS_15750 29891 29352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232768.1 protein_id gnl|my_center|LOCUS_15750 30994 29999 gene locus_tag LOCUS_15760 30994 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 31744 30998 gene locus_tag LOCUS_15770 31744 30998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 31921 31930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32311 31958 gene locus_tag LOCUS_15780 32311 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15780 32817 32434 gene locus_tag LOCUS_15790 32817 32434 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_15790 33577 32795 gene locus_tag LOCUS_15800 33577 32795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_15800 34788 33925 gene locus_tag LOCUS_15810 34788 33925 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_15810 36623 34857 gene locus_tag LOCUS_15820 36623 34857 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_15820 40112 36645 gene locus_tag LOCUS_15830 40112 36645 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_15830 41608 40460 gene locus_tag LOCUS_15840 41608 40460 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_15840 42295 41693 gene locus_tag LOCUS_15850 42295 41693 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_15850 <44061 42309 gene locus_tag LOCUS_15860 <44061 42309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033404426.1:beta-galactosidase >Feature sequence030 3995 861 gene locus_tag LOCUS_15870 3995 861 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_15870 5838 4327 gene locus_tag LOCUS_15880 5838 4327 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_15880 9017 5775 gene locus_tag LOCUS_15890 9017 5775 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_15890 9446 10915 gene locus_tag LOCUS_15900 9446 10915 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_15900 11041 11901 gene locus_tag LOCUS_15910 11041 11901 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_15910 12757 11906 gene locus_tag LOCUS_15920 12757 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 13212 14597 gene locus_tag LOCUS_15930 13212 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 14750 17446 gene locus_tag LOCUS_15940 14750 17446 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_15940 17743 18156 gene locus_tag LOCUS_15950 17743 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 18195 19238 gene locus_tag LOCUS_15960 18195 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 19287 19970 gene locus_tag LOCUS_15970 19287 19970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 20214 24011 gene locus_tag LOCUS_15980 20214 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871158.1 protein_id gnl|my_center|LOCUS_15980 24846 24463 gene locus_tag LOCUS_15990 24846 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 25457 26287 gene locus_tag LOCUS_16000 25457 26287 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_16000 29303 26484 gene locus_tag LOCUS_16010 29303 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 30222 29536 gene locus_tag LOCUS_16020 30222 29536 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244115.1 protein_id gnl|my_center|LOCUS_16020 30293 30637 gene locus_tag LOCUS_16030 30293 30637 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528651.1 protein_id gnl|my_center|LOCUS_16030 30648 31043 gene locus_tag LOCUS_16040 30648 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 protein_id gnl|my_center|LOCUS_16040 31141 31374 gene locus_tag LOCUS_16050 31141 31374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16050 31482 31793 gene locus_tag LOCUS_16060 31482 31793 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784184.1 protein_id gnl|my_center|LOCUS_16060 33698 32067 gene locus_tag LOCUS_16070 33698 32067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 34040 34771 gene locus_tag LOCUS_16080 34040 34771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 34992 35480 gene locus_tag LOCUS_16090 34992 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 35680 37152 gene locus_tag LOCUS_16100 35680 37152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 37445 38218 gene locus_tag LOCUS_16110 37445 38218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 38502 40385 gene locus_tag LOCUS_16120 38502 40385 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941954.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence031 950 333 gene locus_tag LOCUS_16130 950 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2653 1049 gene locus_tag LOCUS_16140 2653 1049 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119667283.1 protein_id gnl|my_center|LOCUS_16140 6041 2673 gene locus_tag LOCUS_16150 6041 2673 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_16150 7356 6244 gene locus_tag LOCUS_16160 7356 6244 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_16160 8025 7441 gene locus_tag LOCUS_16170 8025 7441 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_16170 8283 10364 gene locus_tag LOCUS_16180 8283 10364 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_16180 11200 10382 gene locus_tag LOCUS_16190 11200 10382 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_16190 11376 11852 gene locus_tag LOCUS_16200 11376 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12847 11849 gene locus_tag LOCUS_16210 gene xylF 12847 11849 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_16210 12979 14721 gene locus_tag LOCUS_16220 12979 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 17243 14724 gene locus_tag LOCUS_16230 17243 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 17490 18455 gene locus_tag LOCUS_16240 gene rfaD 17490 18455 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_16240 18517 19077 gene locus_tag LOCUS_16250 18517 19077 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_16250 19148 20299 gene locus_tag LOCUS_16260 19148 20299 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_16260 20537 23893 gene locus_tag LOCUS_16270 20537 23893 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_16270 23903 25786 gene locus_tag LOCUS_16280 23903 25786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 25928 26827 gene locus_tag LOCUS_16290 25928 26827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 26860 28212 gene locus_tag LOCUS_16300 26860 28212 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_16300 28234 29256 gene locus_tag LOCUS_16310 28234 29256 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_16310 29455 30063 gene locus_tag LOCUS_16320 29455 30063 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_16320 30190 30765 gene locus_tag LOCUS_16330 gene sodB 30190 30765 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_16330 30829 31719 gene locus_tag LOCUS_16340 gene lipA 30829 31719 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_16340 31768 32229 gene locus_tag LOCUS_16350 31768 32229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_16350 32230 32916 gene locus_tag LOCUS_16360 32230 32916 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_16360 33914 32883 gene locus_tag LOCUS_16370 33914 32883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 34445 33948 gene locus_tag LOCUS_16380 34445 33948 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_16380 35359 34448 gene locus_tag LOCUS_16390 35359 34448 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_16390 35810 35496 gene locus_tag LOCUS_16400 35810 35496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 35897 36232 gene locus_tag LOCUS_16410 35897 36232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 38573 36306 gene locus_tag LOCUS_16420 38573 36306 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_16420 38835 39140 gene locus_tag LOCUS_16430 38835 39140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16430 39171 40103 gene locus_tag LOCUS_16440 39171 40103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16440 40096 40500 gene locus_tag LOCUS_16450 40096 40500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 41562 40555 gene locus_tag LOCUS_16460 gene gapA 41562 40555 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_16460 42473 41697 gene locus_tag LOCUS_16470 42473 41697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 42763 42557 gene locus_tag LOCUS_16480 42763 42557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence032 2 205 gene locus_tag LOCUS_16490 2 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2064 271 gene locus_tag LOCUS_16500 2064 271 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_16500 4736 2118 gene locus_tag LOCUS_16510 gene alaS 4736 2118 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_16510 4881 5855 gene locus_tag LOCUS_16520 4881 5855 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_16520 5901 6242 gene locus_tag LOCUS_16530 5901 6242 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_16530 6287 7384 gene locus_tag LOCUS_16540 6287 7384 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_16540 7387 8142 gene locus_tag LOCUS_16550 7387 8142 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_16550 9400 8207 gene locus_tag LOCUS_16560 9400 8207 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_16560 10154 9444 gene locus_tag LOCUS_16570 10154 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 10644 10213 gene locus_tag LOCUS_16580 10644 10213 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_16580 11238 10648 gene locus_tag LOCUS_16590 11238 10648 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_16590 11331 11762 gene locus_tag LOCUS_16600 11331 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 12247 11774 gene locus_tag LOCUS_16610 gene ispF 12247 11774 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_16610 13490 12258 gene locus_tag LOCUS_16620 gene porV 13490 12258 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_16620 16928 13527 gene locus_tag LOCUS_16630 gene porU 16928 13527 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_16630 17140 17358 gene locus_tag LOCUS_16640 17140 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 17486 18478 gene locus_tag LOCUS_16650 17486 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 18550 20046 gene locus_tag LOCUS_16660 gene gldJ 18550 20046 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_16660 20101 21387 gene locus_tag LOCUS_16670 20101 21387 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_16670 21796 21389 gene locus_tag LOCUS_16680 21796 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 22701 21940 gene locus_tag LOCUS_16690 22701 21940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 23768 22767 gene locus_tag LOCUS_16700 23768 22767 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_16700 24657 23761 gene locus_tag LOCUS_16710 24657 23761 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_16710 25460 24654 gene locus_tag LOCUS_16720 25460 24654 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_16720 27685 25628 gene locus_tag LOCUS_16730 gene ppk1 27685 25628 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271572.1 protein_id gnl|my_center|LOCUS_16730 28230 27718 gene locus_tag LOCUS_16740 gene sixA 28230 27718 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_16740 29606 28278 gene locus_tag LOCUS_16750 29606 28278 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_16750 29699 30208 gene locus_tag LOCUS_16760 29699 30208 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_16760 30202 31512 gene locus_tag LOCUS_16770 30202 31512 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_16770 31616 31691 gene locus_tag LOCUS_t00120 31616 31691 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32763 31840 gene locus_tag LOCUS_16780 32763 31840 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362003.1 protein_id gnl|my_center|LOCUS_16780 33175 32798 gene locus_tag LOCUS_16790 33175 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963519.1 protein_id gnl|my_center|LOCUS_16790 33783 33286 gene locus_tag LOCUS_16800 33783 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 35245 34016 gene locus_tag LOCUS_16810 gene pepT 35245 34016 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_16810 35701 35336 gene locus_tag LOCUS_16820 35701 35336 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_16820 35899 36867 gene locus_tag LOCUS_16830 35899 36867 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_16830 37068 38297 gene locus_tag LOCUS_16840 37068 38297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 38301 38699 gene locus_tag LOCUS_16850 38301 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 38864 41215 gene locus_tag LOCUS_16860 38864 41215 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037536.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence033 957 28 gene locus_tag LOCUS_16870 957 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1863 979 gene locus_tag LOCUS_16880 1863 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2932 1895 gene locus_tag LOCUS_16890 2932 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3843 3067 gene locus_tag LOCUS_16900 gene fabG 3843 3067 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_16900 4915 4040 gene locus_tag LOCUS_16910 gene sucD 4915 4040 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_16910 6420 5293 gene locus_tag LOCUS_16920 6420 5293 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_16920 6992 8380 gene locus_tag LOCUS_16930 gene mnmE 6992 8380 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_16930 9941 8475 gene locus_tag LOCUS_16940 9941 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 10618 9938 gene locus_tag LOCUS_16950 10618 9938 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369262.1 protein_id gnl|my_center|LOCUS_16950 13224 10618 gene locus_tag LOCUS_16960 13224 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13651 14118 gene locus_tag LOCUS_16970 13651 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 14118 14612 gene locus_tag LOCUS_16980 14118 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 14876 15199 gene locus_tag LOCUS_16990 14876 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 15364 16791 gene locus_tag LOCUS_17000 15364 16791 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_17000 17109 16825 gene locus_tag LOCUS_17010 17109 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 17285 17121 gene locus_tag LOCUS_17020 17285 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 17609 17956 gene locus_tag LOCUS_17030 17609 17956 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_17030 19134 18022 gene locus_tag LOCUS_17040 19134 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 20446 19277 gene locus_tag LOCUS_17050 20446 19277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_17050 21803 20577 gene locus_tag LOCUS_17060 21803 20577 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_17060 22927 21908 gene locus_tag LOCUS_17070 22927 21908 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_17070 24172 22928 gene locus_tag LOCUS_17080 24172 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 24902 24156 gene locus_tag LOCUS_17090 24902 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 26641 24899 gene locus_tag LOCUS_17100 26641 24899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 26787 27506 gene locus_tag LOCUS_17110 26787 27506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 27952 27509 gene locus_tag LOCUS_17120 27952 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 29560 28139 gene locus_tag LOCUS_17130 29560 28139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 31263 29857 gene locus_tag LOCUS_17140 31263 29857 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009972112.1 protein_id gnl|my_center|LOCUS_17140 32182 31460 gene locus_tag LOCUS_17150 32182 31460 CDS product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 protein_id gnl|my_center|LOCUS_17150 33685 32279 gene locus_tag LOCUS_17160 33685 32279 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_17160 34316 33807 gene locus_tag LOCUS_17170 34316 33807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 34626 34414 gene locus_tag LOCUS_17180 34626 34414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 35847 34630 gene locus_tag LOCUS_17190 35847 34630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 36128 36712 gene locus_tag LOCUS_17200 36128 36712 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 protein_id gnl|my_center|LOCUS_17200 36719 37465 gene locus_tag LOCUS_17210 36719 37465 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_17210 37699 38805 gene locus_tag LOCUS_17220 37699 38805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 38825 40045 gene locus_tag LOCUS_17230 38825 40045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_17230 40064 40750 gene locus_tag LOCUS_17240 40064 40750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_17240 40773 41975 gene locus_tag LOCUS_17250 40773 41975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_17250 42442 41972 gene locus_tag LOCUS_17260 gene ohrR 42442 41972 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence034 172 999 gene locus_tag LOCUS_17270 gene nudC 172 999 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_17270 1821 1111 gene locus_tag LOCUS_17280 1821 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3173 1887 gene locus_tag LOCUS_17290 3173 1887 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_17290 4096 3263 gene locus_tag LOCUS_17300 gene pyrF 4096 3263 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_17300 5192 4104 gene locus_tag LOCUS_17310 gene prfA 5192 4104 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_17310 6615 5446 gene locus_tag LOCUS_17320 6615 5446 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_17320 8620 6632 gene locus_tag LOCUS_17330 8620 6632 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_17330 8868 9509 gene locus_tag LOCUS_17340 8868 9509 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_17340 9506 10663 gene locus_tag LOCUS_17350 9506 10663 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_17350 10677 13070 gene locus_tag LOCUS_17360 10677 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 13082 14038 gene locus_tag LOCUS_17370 13082 14038 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_17370 14072 14818 gene locus_tag LOCUS_17380 14072 14818 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_17380 14820 15941 gene locus_tag LOCUS_17390 14820 15941 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_17390 16707 15985 gene locus_tag LOCUS_17400 16707 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 18832 16976 gene locus_tag LOCUS_17410 18832 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 21284 18834 gene locus_tag LOCUS_17420 21284 18834 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760984.1 protein_id gnl|my_center|LOCUS_17420 21862 21287 gene locus_tag LOCUS_17430 21862 21287 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_17430 22064 22816 gene locus_tag LOCUS_17440 22064 22816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 22809 24110 gene locus_tag LOCUS_17450 22809 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 24073 24774 gene locus_tag LOCUS_17460 gene rsmI 24073 24774 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_17460 25192 24800 gene locus_tag LOCUS_17470 25192 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 25887 25252 gene locus_tag LOCUS_17480 25887 25252 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397610.1 protein_id gnl|my_center|LOCUS_17480 26284 25895 gene locus_tag LOCUS_17490 26284 25895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 27713 26379 gene locus_tag LOCUS_17500 27713 26379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 27934 29382 gene locus_tag LOCUS_17510 27934 29382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 30193 29390 gene locus_tag LOCUS_17520 30193 29390 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_17520 30698 30300 gene locus_tag LOCUS_17530 30698 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 30851 31978 gene locus_tag LOCUS_17540 gene lpxB 30851 31978 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_17540 32022 33113 gene locus_tag LOCUS_17550 32022 33113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 33491 33114 gene locus_tag LOCUS_17560 33491 33114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 35307 33757 gene locus_tag LOCUS_17570 gene ahpF 35307 33757 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695883.1 protein_id gnl|my_center|LOCUS_17570 35937 35374 gene locus_tag LOCUS_17580 gene ahpC 35937 35374 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_17580 36050 36973 gene locus_tag LOCUS_17590 36050 36973 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_17590 37202 36999 gene locus_tag LOCUS_17600 37202 36999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 37614 37324 gene locus_tag LOCUS_17610 37614 37324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 37793 37653 gene locus_tag LOCUS_17620 37793 37653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 37879 39762 gene locus_tag LOCUS_17630 37879 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence035 141 1223 gene locus_tag LOCUS_17640 141 1223 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084951.1 protein_id gnl|my_center|LOCUS_17640 1925 1476 gene locus_tag LOCUS_17650 1925 1476 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965703.1 protein_id gnl|my_center|LOCUS_17650 2405 1971 gene locus_tag LOCUS_17660 2405 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2643 4088 gene locus_tag LOCUS_17670 2643 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4251 6221 gene locus_tag LOCUS_17680 4251 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 6224 7195 gene locus_tag LOCUS_17690 6224 7195 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_17690 7447 7199 gene locus_tag LOCUS_17700 7447 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 8092 7451 gene locus_tag LOCUS_17710 8092 7451 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 protein_id gnl|my_center|LOCUS_17710 8818 8396 gene locus_tag LOCUS_17720 8818 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 9830 8703 gene locus_tag LOCUS_17730 9830 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17730 8840 8849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11192 9840 gene locus_tag LOCUS_17740 11192 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 11863 12303 gene locus_tag LOCUS_17750 11863 12303 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_17750 13489 12305 gene locus_tag LOCUS_17760 13489 12305 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_17760 14223 13594 gene locus_tag LOCUS_17770 14223 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 15518 14211 gene locus_tag LOCUS_17780 15518 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 17702 15519 gene locus_tag LOCUS_17790 17702 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 19048 17702 gene locus_tag LOCUS_17800 gene fslC 19048 17702 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_17800 20097 19054 gene locus_tag LOCUS_17810 20097 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 20338 20090 gene locus_tag LOCUS_17820 20338 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 20856 21485 gene locus_tag LOCUS_17830 20856 21485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 21618 22886 gene locus_tag LOCUS_17840 21618 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 24903 23059 gene locus_tag LOCUS_17850 24903 23059 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766740.1 protein_id gnl|my_center|LOCUS_17850 25096 26037 gene locus_tag LOCUS_17860 25096 26037 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_17860 28775 26532 gene locus_tag LOCUS_17870 28775 26532 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_17870 29405 28797 gene locus_tag LOCUS_17880 29405 28797 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_17880 30139 29444 gene locus_tag LOCUS_17890 gene ric 30139 29444 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_17890 30257 30694 gene locus_tag LOCUS_17900 30257 30694 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933365.1 protein_id gnl|my_center|LOCUS_17900 30696 31688 gene locus_tag LOCUS_17910 30696 31688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 31809 33050 gene locus_tag LOCUS_17920 31809 33050 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_17920 33047 33571 gene locus_tag LOCUS_17930 33047 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 33772 34473 gene locus_tag LOCUS_17940 33772 34473 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_17940 34732 35892 gene locus_tag LOCUS_17950 gene pncB 34732 35892 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766265.1 protein_id gnl|my_center|LOCUS_17950 35903 36691 gene locus_tag LOCUS_17960 35903 36691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 37023 38903 gene locus_tag LOCUS_17970 37023 38903 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880592.1 protein_id gnl|my_center|LOCUS_17970 39887 38961 gene locus_tag LOCUS_17980 39887 38961 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938866.1 protein_id gnl|my_center|LOCUS_17980 40031 40954 gene locus_tag LOCUS_17990 40031 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence036 1493 102 gene locus_tag LOCUS_18000 gene lpdA 1493 102 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_18000 2626 1556 gene locus_tag LOCUS_18010 2626 1556 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478915.1 protein_id gnl|my_center|LOCUS_18010 2884 5100 gene locus_tag LOCUS_18020 2884 5100 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_18020 5124 6083 gene locus_tag LOCUS_18030 5124 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7240 6140 gene locus_tag LOCUS_18040 7240 6140 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_18040 8478 7384 gene locus_tag LOCUS_18050 gene meaB 8478 7384 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_18050 9839 8550 gene locus_tag LOCUS_18060 9839 8550 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_18060 11926 9980 gene locus_tag LOCUS_18070 11926 9980 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_18070 11963 12595 gene locus_tag LOCUS_18080 11963 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 12624 13448 gene locus_tag LOCUS_18090 12624 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 13459 14202 gene locus_tag LOCUS_18100 13459 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 14302 15090 gene locus_tag LOCUS_18110 14302 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 16362 15106 gene locus_tag LOCUS_18120 16362 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 17753 16359 gene locus_tag LOCUS_18130 17753 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 18457 17783 gene locus_tag LOCUS_18140 18457 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 18771 19769 gene locus_tag LOCUS_18150 gene argF 18771 19769 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261198.1 protein_id gnl|my_center|LOCUS_18150 19892 20152 gene locus_tag LOCUS_18160 19892 20152 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_18160 20725 20249 gene locus_tag LOCUS_18170 20725 20249 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_18170 21065 20727 gene locus_tag LOCUS_18180 21065 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 21312 21121 gene locus_tag LOCUS_18190 21312 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 23818 21317 gene locus_tag LOCUS_18200 gene feoB 23818 21317 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_18200 24078 24839 gene locus_tag LOCUS_18210 24078 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 26633 24843 gene locus_tag LOCUS_18220 26633 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 27022 27957 gene locus_tag LOCUS_18230 27022 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 28008 31445 gene locus_tag LOCUS_18240 28008 31445 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_18240 31465 33120 gene locus_tag LOCUS_18250 31465 33120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 33233 34591 gene locus_tag LOCUS_18260 33233 34591 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_18260 34681 36108 gene locus_tag LOCUS_18270 34681 36108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 37104 36127 gene locus_tag LOCUS_18280 37104 36127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 38668 37109 gene locus_tag LOCUS_18290 38668 37109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 38893 39180 gene locus_tag LOCUS_18300 38893 39180 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_18300 39669 39220 gene locus_tag LOCUS_18310 39669 39220 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_18310 39924 40841 gene locus_tag LOCUS_18320 gene nusB 39924 40841 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_18320 40964 41287 gene locus_tag LOCUS_18330 40964 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence037 691 101 gene locus_tag LOCUS_18340 691 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1301 699 gene locus_tag LOCUS_18350 1301 699 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_18350 1822 1313 gene locus_tag LOCUS_18360 1822 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2638 3612 gene locus_tag LOCUS_18370 2638 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3722 4588 gene locus_tag LOCUS_18380 3722 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4657 6819 gene locus_tag LOCUS_18390 4657 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 6816 8426 gene locus_tag LOCUS_18400 6816 8426 CDS product nodulation protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084826.1 protein_id gnl|my_center|LOCUS_18400 9162 11372 gene locus_tag LOCUS_18410 9162 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201942.1 protein_id gnl|my_center|LOCUS_18410 11389 14505 gene locus_tag LOCUS_18420 11389 14505 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108138.1 protein_id gnl|my_center|LOCUS_18420 14766 17105 gene locus_tag LOCUS_18430 14766 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 18481 17198 gene locus_tag LOCUS_18440 18481 17198 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_18440 19601 18570 gene locus_tag LOCUS_18450 19601 18570 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_18450 20482 19613 gene locus_tag LOCUS_18460 20482 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 22063 20555 gene locus_tag LOCUS_18470 22063 20555 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_18470 25546 22094 gene locus_tag LOCUS_18480 25546 22094 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_18480 26849 25710 gene locus_tag LOCUS_18490 26849 25710 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_18490 27553 26951 gene locus_tag LOCUS_18500 27553 26951 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_18500 30068 27756 gene locus_tag LOCUS_18510 30068 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 32690 30072 gene locus_tag LOCUS_18520 32690 30072 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_18520 33045 32803 gene locus_tag LOCUS_18530 33045 32803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 34372 33047 gene locus_tag LOCUS_18540 34372 33047 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767112.1 protein_id gnl|my_center|LOCUS_18540 34642 35136 gene locus_tag LOCUS_18550 34642 35136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18550 35269 36504 gene locus_tag LOCUS_18560 35269 36504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18560 37738 36599 gene locus_tag LOCUS_18570 37738 36599 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_18570 39288 37951 gene locus_tag LOCUS_18580 39288 37951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 <40665 39301 gene locus_tag LOCUS_18590 <40665 39301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108778.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence038 286 2847 gene locus_tag LOCUS_18600 286 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2879 4345 gene locus_tag LOCUS_18610 2879 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5033 6763 gene locus_tag LOCUS_18620 5033 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6815 8617 gene locus_tag LOCUS_18630 6815 8617 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_18630 8755 12027 gene locus_tag LOCUS_18640 8755 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 12020 12955 gene locus_tag LOCUS_18650 12020 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 12949 15474 gene locus_tag LOCUS_18660 12949 15474 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_18660 15512 17518 gene locus_tag LOCUS_18670 15512 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 17633 19363 gene locus_tag LOCUS_18680 17633 19363 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767037.1 protein_id gnl|my_center|LOCUS_18680 19485 21869 gene locus_tag LOCUS_18690 19485 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 22205 25780 gene locus_tag LOCUS_18700 22205 25780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 25968 27077 gene locus_tag LOCUS_18710 25968 27077 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_18710 27703 27906 gene locus_tag LOCUS_18720 27703 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 30038 28017 gene locus_tag LOCUS_18730 30038 28017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 31076 30159 gene locus_tag LOCUS_18740 31076 30159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 31293 32759 gene locus_tag LOCUS_18750 gene fucK 31293 32759 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694547.1 protein_id gnl|my_center|LOCUS_18750 32961 34325 gene locus_tag LOCUS_18760 gene fucP 32961 34325 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864166.1 protein_id gnl|my_center|LOCUS_18760 34381 35709 gene locus_tag LOCUS_18770 34381 35709 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_18770 35735 35935 gene locus_tag LOCUS_18780 35735 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 35962 37767 gene locus_tag LOCUS_18790 35962 37767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 37858 40299 gene locus_tag LOCUS_18800 37858 40299 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence039 1 735 gene locus_tag LOCUS_18810 1 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1186 2514 gene locus_tag LOCUS_18820 1186 2514 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_18820 2525 3370 gene locus_tag LOCUS_18830 2525 3370 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_18830 3461 3883 gene locus_tag LOCUS_18840 3461 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4934 3960 gene locus_tag LOCUS_18850 4934 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5290 4946 gene locus_tag LOCUS_18860 5290 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4976 4985 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7029 5368 gene locus_tag LOCUS_18870 7029 5368 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_18870 7918 7181 gene locus_tag LOCUS_18880 7918 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8706 7930 gene locus_tag LOCUS_18890 8706 7930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_18890 9527 8706 gene locus_tag LOCUS_18900 9527 8706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_18900 10632 9514 gene locus_tag LOCUS_18910 10632 9514 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775254.1 protein_id gnl|my_center|LOCUS_18910 11033 10629 gene locus_tag LOCUS_18920 11033 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 11383 11036 gene locus_tag LOCUS_18930 11383 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 11783 11520 gene locus_tag LOCUS_18940 11783 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 12312 11815 gene locus_tag LOCUS_18950 12312 11815 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_18950 12836 13777 gene locus_tag LOCUS_18960 12836 13777 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_18960 15174 13780 gene locus_tag LOCUS_18970 15174 13780 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_18970 16801 15386 gene locus_tag LOCUS_18980 16801 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 17014 19032 gene locus_tag LOCUS_18990 17014 19032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 21299 19029 gene locus_tag LOCUS_19000 21299 19029 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_19000 25899 21283 gene locus_tag LOCUS_19010 25899 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 26276 27208 gene locus_tag LOCUS_19020 26276 27208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 27214 27402 gene locus_tag LOCUS_19030 27214 27402 CDS product DUF6496 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958549.1 protein_id gnl|my_center|LOCUS_19030 27406 29784 gene locus_tag LOCUS_19040 27406 29784 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_19040 29982 30692 gene locus_tag LOCUS_19050 29982 30692 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_19050 31094 31396 gene locus_tag LOCUS_19060 31094 31396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 31842 33341 gene locus_tag LOCUS_19070 31842 33341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 35826 33400 gene locus_tag LOCUS_19080 35826 33400 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_19080 36539 35982 gene locus_tag LOCUS_19090 36539 35982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 36650 37087 gene locus_tag LOCUS_19100 36650 37087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 37107 37526 gene locus_tag LOCUS_19110 37107 37526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 37523 37705 gene locus_tag LOCUS_19120 37523 37705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 38829 37702 gene locus_tag LOCUS_19130 38829 37702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 <39564 38953 gene locus_tag LOCUS_19140 <39564 38953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974700.1:DNA polymerase IV >Feature sequence040 <1 1066 gene locus_tag LOCUS_19150 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791673.1:FecR family protein 1214 4564 gene locus_tag LOCUS_19160 1214 4564 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_19160 4577 6433 gene locus_tag LOCUS_19170 4577 6433 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_19170 6540 9665 gene locus_tag LOCUS_19180 6540 9665 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_19180 9804 11027 gene locus_tag LOCUS_19190 9804 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 13224 11071 gene locus_tag LOCUS_19200 13224 11071 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_19200 13730 14140 gene locus_tag LOCUS_19210 gene rpsL 13730 14140 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_19210 14164 14640 gene locus_tag LOCUS_19220 gene rpsG 14164 14640 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_19220 14703 16808 gene locus_tag LOCUS_19230 gene fusA 14703 16808 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_19230 16820 17125 gene locus_tag LOCUS_19240 gene rpsJ 16820 17125 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_19240 17150 17767 gene locus_tag LOCUS_19250 gene rplC 17150 17767 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_19250 17767 18387 gene locus_tag LOCUS_19260 gene rplD 17767 18387 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_19260 18411 18701 gene locus_tag LOCUS_19270 gene rplW 18411 18701 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_19270 18709 19533 gene locus_tag LOCUS_19280 gene rplB 18709 19533 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_19280 19555 19830 gene locus_tag LOCUS_19290 gene rpsS 19555 19830 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_19290 19860 20273 gene locus_tag LOCUS_19300 gene rplV 19860 20273 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_19300 20280 20981 gene locus_tag LOCUS_19310 gene rpsC 20280 20981 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_19310 21054 21431 gene locus_tag LOCUS_19320 gene rplP 21054 21431 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_19320 21446 21652 gene locus_tag LOCUS_19330 21446 21652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 21661 21918 gene locus_tag LOCUS_19340 gene rpsQ 21661 21918 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_19340 21921 22286 gene locus_tag LOCUS_19350 gene rplN 21921 22286 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_19350 22300 22623 gene locus_tag LOCUS_19360 gene rplX 22300 22623 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_19360 22623 23180 gene locus_tag LOCUS_19370 gene rplE 22623 23180 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_19370 23184 23453 gene locus_tag LOCUS_19380 gene rpsN 23184 23453 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_19380 23482 23880 gene locus_tag LOCUS_19390 gene rpsH 23482 23880 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_19390 23899 24456 gene locus_tag LOCUS_19400 gene rplF 23899 24456 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_19400 24475 24837 gene locus_tag LOCUS_19410 gene rplR 24475 24837 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659213.1 protein_id gnl|my_center|LOCUS_19410 24844 25359 gene locus_tag LOCUS_19420 gene rpsE 24844 25359 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_19420 25372 25548 gene locus_tag LOCUS_19430 gene rpmD 25372 25548 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670028.1 protein_id gnl|my_center|LOCUS_19430 25569 26018 gene locus_tag LOCUS_19440 gene rplO 25569 26018 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_19440 26023 27372 gene locus_tag LOCUS_19450 gene secY 26023 27372 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_19450 27396 28172 gene locus_tag LOCUS_19460 gene map 27396 28172 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_19460 28176 28394 gene locus_tag LOCUS_19470 gene infA 28176 28394 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_19470 28543 28920 gene locus_tag LOCUS_19480 gene rpsM 28543 28920 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_19480 28934 29323 gene locus_tag LOCUS_19490 gene rpsK 28934 29323 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_19490 29375 29983 gene locus_tag LOCUS_19500 gene rpsD 29375 29983 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_19500 29998 30990 gene locus_tag LOCUS_19510 29998 30990 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_19510 30995 31543 gene locus_tag LOCUS_19520 30995 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 31644 32924 gene locus_tag LOCUS_19530 gene eno 31644 32924 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_19530 33086 33304 gene locus_tag LOCUS_19540 33086 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 33397 33732 gene locus_tag LOCUS_19550 33397 33732 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_19550 37038 33805 gene locus_tag LOCUS_19560 37038 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 37471 37040 gene locus_tag LOCUS_19570 37471 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 37812 39131 gene locus_tag LOCUS_19580 37812 39131 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence041 259 543 gene locus_tag LOCUS_19590 259 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 546 1484 gene locus_tag LOCUS_19600 gene coxB 546 1484 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940897.1 protein_id gnl|my_center|LOCUS_19600 1764 1958 gene locus_tag LOCUS_19610 1764 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2234 3361 gene locus_tag LOCUS_19620 2234 3361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_19620 3654 3340 gene locus_tag LOCUS_19630 3654 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3895 4929 gene locus_tag LOCUS_19640 3895 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 6287 5190 gene locus_tag LOCUS_19650 6287 5190 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_19650 6793 6305 gene locus_tag LOCUS_19660 gene dfrA 6793 6305 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_19660 7599 6805 gene locus_tag LOCUS_19670 7599 6805 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_19670 8629 7700 gene locus_tag LOCUS_19680 8629 7700 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_19680 9085 8630 gene locus_tag LOCUS_19690 9085 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 9412 10248 gene locus_tag LOCUS_19700 9412 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 10561 11739 gene locus_tag LOCUS_19710 10561 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 11780 14770 gene locus_tag LOCUS_19720 11780 14770 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_19720 14844 16208 gene locus_tag LOCUS_19730 gene nrfD 14844 16208 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_19730 16277 16780 gene locus_tag LOCUS_19740 16277 16780 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_19740 16792 17358 gene locus_tag LOCUS_19750 16792 17358 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_19750 17382 18563 gene locus_tag LOCUS_19760 17382 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 18714 19460 gene locus_tag LOCUS_19770 18714 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 19476 20342 gene locus_tag LOCUS_19780 19476 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 20508 21326 gene locus_tag LOCUS_19790 20508 21326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 21343 21963 gene locus_tag LOCUS_19800 21343 21963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_19800 22004 22669 gene locus_tag LOCUS_19810 22004 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 22993 22691 gene locus_tag LOCUS_19820 22993 22691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 23220 22984 gene locus_tag LOCUS_19830 23220 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 24999 23392 gene locus_tag LOCUS_19840 24999 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 25204 25983 gene locus_tag LOCUS_19850 25204 25983 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103701.1 protein_id gnl|my_center|LOCUS_19850 26949 26155 gene locus_tag LOCUS_19860 26949 26155 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_19860 27915 27013 gene locus_tag LOCUS_19870 27915 27013 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_19870 28078 29001 gene locus_tag LOCUS_19880 28078 29001 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_19880 29030 30196 gene locus_tag LOCUS_19890 29030 30196 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_19890 30257 30520 gene locus_tag LOCUS_19900 30257 30520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 31890 30643 gene locus_tag LOCUS_19910 31890 30643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 protein_id gnl|my_center|LOCUS_19910 32549 32034 gene locus_tag LOCUS_19920 32549 32034 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545184.1 protein_id gnl|my_center|LOCUS_19920 33062 32697 gene locus_tag LOCUS_19930 33062 32697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 33659 35011 gene locus_tag LOCUS_19940 33659 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 35816 35028 gene locus_tag LOCUS_19950 35816 35028 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_19950 36247 35861 gene locus_tag LOCUS_19960 36247 35861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 37555 36539 gene locus_tag LOCUS_19970 37555 36539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19970 37747 39225 gene locus_tag LOCUS_19980 37747 39225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence042 1005 310 gene locus_tag LOCUS_19990 1005 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1345 1848 gene locus_tag LOCUS_20000 1345 1848 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103394.1 protein_id gnl|my_center|LOCUS_20000 1916 3022 gene locus_tag LOCUS_20010 1916 3022 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_20010 3321 6593 gene locus_tag LOCUS_20020 3321 6593 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202338.1 protein_id gnl|my_center|LOCUS_20020 6661 8184 gene locus_tag LOCUS_20030 6661 8184 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_20030 8269 10464 gene locus_tag LOCUS_20040 8269 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 10865 11578 gene locus_tag LOCUS_20050 10865 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 11739 12305 gene locus_tag LOCUS_20060 gene efp 11739 12305 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_20060 12382 13617 gene locus_tag LOCUS_20070 12382 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 14020 13622 gene locus_tag LOCUS_20080 14020 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 14142 14606 gene locus_tag LOCUS_20090 14142 14606 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_20090 14608 15723 gene locus_tag LOCUS_20100 14608 15723 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_20100 15788 16159 gene locus_tag LOCUS_20110 15788 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 16260 18146 gene locus_tag LOCUS_20120 16260 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 19419 18202 gene locus_tag LOCUS_20130 gene pfp 19419 18202 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_20130 19701 20312 gene locus_tag LOCUS_20140 19701 20312 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_20140 20543 21556 gene locus_tag LOCUS_20150 20543 21556 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_20150 21727 25287 gene locus_tag LOCUS_20160 21727 25287 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_20160 25363 27003 gene locus_tag LOCUS_20170 25363 27003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 27028 28254 gene locus_tag LOCUS_20180 27028 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 28280 30421 gene locus_tag LOCUS_20190 28280 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 30580 31566 gene locus_tag LOCUS_20200 30580 31566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 31735 31541 gene locus_tag LOCUS_20210 31735 31541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 31749 32558 gene locus_tag LOCUS_20220 31749 32558 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865299.1 protein_id gnl|my_center|LOCUS_20220 34069 33263 gene locus_tag LOCUS_20230 gene pgeF 34069 33263 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_20230 36470 34518 gene locus_tag LOCUS_20240 36470 34518 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_20240 <39045 36481 gene locus_tag LOCUS_20250 <39045 36481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226354.1:glycosyl hydrolase 115 family protein >Feature sequence043 606 2234 gene locus_tag LOCUS_20260 gene pruA 606 2234 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_20260 2805 2308 gene locus_tag LOCUS_20270 2805 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5485 3032 gene locus_tag LOCUS_20280 5485 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 5981 5511 gene locus_tag LOCUS_20290 5981 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8741 6174 gene locus_tag LOCUS_20300 8741 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9279 8764 gene locus_tag LOCUS_20310 9279 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 10685 9741 gene locus_tag LOCUS_20320 10685 9741 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_20320 12112 10706 gene locus_tag LOCUS_20330 12112 10706 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_20330 14519 12204 gene locus_tag LOCUS_20340 gene bglX 14519 12204 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_20340 14945 16246 gene locus_tag LOCUS_20350 14945 16246 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_20350 16494 16931 gene locus_tag LOCUS_20360 16494 16931 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_20360 17233 18045 gene locus_tag LOCUS_20370 gene chbG 17233 18045 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593465.1 protein_id gnl|my_center|LOCUS_20370 20483 18057 gene locus_tag LOCUS_20380 20483 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 20879 22048 gene locus_tag LOCUS_20390 20879 22048 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_20390 22048 23664 gene locus_tag LOCUS_20400 22048 23664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 23791 25800 gene locus_tag LOCUS_20410 23791 25800 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_20410 25823 27442 gene locus_tag LOCUS_20420 25823 27442 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_20420 27585 29465 gene locus_tag LOCUS_20430 gene yidC 27585 29465 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_20430 31271 29607 gene locus_tag LOCUS_20440 31271 29607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 31584 32777 gene locus_tag LOCUS_20450 31584 32777 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_20450 32937 34079 gene locus_tag LOCUS_20460 gene nspC 32937 34079 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_20460 34859 34275 gene locus_tag LOCUS_20470 34859 34275 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_20470 35547 34891 gene locus_tag LOCUS_20480 35547 34891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 36336 35566 gene locus_tag LOCUS_20490 36336 35566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 37160 36489 gene locus_tag LOCUS_20500 37160 36489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 38142 37198 gene locus_tag LOCUS_20510 38142 37198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 38511 38305 gene locus_tag LOCUS_20520 38511 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence044 1278 2675 gene locus_tag LOCUS_20530 1278 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2677 5784 gene locus_tag LOCUS_20540 2677 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5828 6859 gene locus_tag LOCUS_20550 5828 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 6860 8050 gene locus_tag LOCUS_20560 6860 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 8210 13087 gene locus_tag LOCUS_20570 8210 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 14146 13121 gene locus_tag LOCUS_20580 14146 13121 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013216.1 protein_id gnl|my_center|LOCUS_20580 15196 14285 gene locus_tag LOCUS_20590 15196 14285 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_20590 15325 15918 gene locus_tag LOCUS_20600 15325 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 15927 16361 gene locus_tag LOCUS_20610 15927 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 16387 17196 gene locus_tag LOCUS_20620 16387 17196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_20620 17237 18232 gene locus_tag LOCUS_20630 17237 18232 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_20630 19830 18409 gene locus_tag LOCUS_20640 19830 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 20525 19827 gene locus_tag LOCUS_20650 20525 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_20650 22330 20525 gene locus_tag LOCUS_20660 22330 20525 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_20660 24568 22499 gene locus_tag LOCUS_20670 24568 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 24720 25160 gene locus_tag LOCUS_20680 24720 25160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 25227 25706 gene locus_tag LOCUS_20690 25227 25706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 25706 27607 gene locus_tag LOCUS_20700 25706 27607 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_20700 28470 27604 gene locus_tag LOCUS_20710 28470 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 29096 28476 gene locus_tag LOCUS_20720 29096 28476 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_20720 29965 29093 gene locus_tag LOCUS_20730 29965 29093 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_20730 30452 33496 gene locus_tag LOCUS_20740 30452 33496 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_20740 33520 35097 gene locus_tag LOCUS_20750 33520 35097 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_20750 35251 36972 gene locus_tag LOCUS_20760 35251 36972 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074555177.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence045 267 842 gene locus_tag LOCUS_20770 267 842 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_20770 896 1993 gene locus_tag LOCUS_20780 896 1993 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_20780 2182 5367 gene locus_tag LOCUS_20790 2182 5367 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_20790 5390 6994 gene locus_tag LOCUS_20800 5390 6994 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762551.1 protein_id gnl|my_center|LOCUS_20800 7022 7549 gene locus_tag LOCUS_20810 7022 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 7717 11139 gene locus_tag LOCUS_20820 7717 11139 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_20820 11143 12690 gene locus_tag LOCUS_20830 11143 12690 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_20830 13053 14642 gene locus_tag LOCUS_20840 13053 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 16336 14702 gene locus_tag LOCUS_20850 gene groL 16336 14702 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_20850 16652 16374 gene locus_tag LOCUS_20860 16652 16374 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_20860 17315 16941 gene locus_tag LOCUS_20870 gene secG 17315 16941 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109227.1 protein_id gnl|my_center|LOCUS_20870 18205 17333 gene locus_tag LOCUS_20880 18205 17333 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_20880 18735 18238 gene locus_tag LOCUS_20890 18735 18238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 19957 18737 gene locus_tag LOCUS_20900 19957 18737 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_20900 20106 21275 gene locus_tag LOCUS_20910 20106 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 21324 22073 gene locus_tag LOCUS_20920 gene kdsB 21324 22073 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_20920 24515 22131 gene locus_tag LOCUS_20930 24515 22131 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_20930 25575 24589 gene locus_tag LOCUS_20940 25575 24589 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_20940 26419 25565 gene locus_tag LOCUS_20950 26419 25565 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_20950 27016 26645 gene locus_tag LOCUS_20960 27016 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 27243 27171 gene locus_tag LOCUS_t00130 27243 27171 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27368 27754 gene locus_tag LOCUS_20970 27368 27754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 27829 28668 gene locus_tag LOCUS_20980 27829 28668 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_20980 28732 29895 gene locus_tag LOCUS_20990 28732 29895 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_20990 29913 31223 gene locus_tag LOCUS_21000 gene rseP 29913 31223 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_21000 32407 31286 gene locus_tag LOCUS_21010 32407 31286 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_21010 34602 32515 gene locus_tag LOCUS_21020 34602 32515 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_21020 35690 34818 gene locus_tag LOCUS_21030 35690 34818 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_21030 <36851 35784 gene locus_tag LOCUS_21040 <36851 35784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:fibronectin type III domain-containing protein >Feature sequence046 <1 1003 gene locus_tag LOCUS_21050 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763318.1:peptide chain release factor 3 5264 1434 gene locus_tag LOCUS_21060 5264 1434 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227523.1 protein_id gnl|my_center|LOCUS_21060 7025 5343 gene locus_tag LOCUS_21070 7025 5343 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_21070 10381 7049 gene locus_tag LOCUS_21080 10381 7049 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_21080 11686 10550 gene locus_tag LOCUS_21090 11686 10550 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_21090 12326 11742 gene locus_tag LOCUS_21100 12326 11742 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_21100 14571 12526 gene locus_tag LOCUS_21110 14571 12526 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_21110 15068 14652 gene locus_tag LOCUS_21120 gene msrB 15068 14652 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_21120 15350 16495 gene locus_tag LOCUS_21130 15350 16495 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_21130 16507 17373 gene locus_tag LOCUS_21140 16507 17373 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_21140 17532 18566 gene locus_tag LOCUS_21150 17532 18566 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_21150 19271 18621 gene locus_tag LOCUS_21160 19271 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 19560 19369 gene locus_tag LOCUS_21170 19560 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 19511 20608 gene locus_tag LOCUS_21180 19511 20608 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 protein_id gnl|my_center|LOCUS_21180 20693 21055 gene locus_tag LOCUS_21190 20693 21055 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_21190 21183 21944 gene locus_tag LOCUS_21200 21183 21944 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_21200 22693 21941 gene locus_tag LOCUS_21210 22693 21941 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_21210 23077 22700 gene locus_tag LOCUS_21220 23077 22700 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_21220 24231 23281 gene locus_tag LOCUS_21230 gene mgrA 24231 23281 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_21230 24337 25536 gene locus_tag LOCUS_21240 24337 25536 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_21240 25938 27083 gene locus_tag LOCUS_21250 25938 27083 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_21250 27087 28043 gene locus_tag LOCUS_21260 27087 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 28036 29079 gene locus_tag LOCUS_21270 28036 29079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_21270 29433 30026 gene locus_tag LOCUS_21280 29433 30026 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_21280 30757 30080 gene locus_tag LOCUS_21290 30757 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 31682 30930 gene locus_tag LOCUS_21300 31682 30930 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_21300 32114 35194 gene locus_tag LOCUS_21310 32114 35194 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_21310 36242 35247 gene locus_tag LOCUS_21320 36242 35247 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence047 34 2793 gene locus_tag LOCUS_21330 34 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2799 4004 gene locus_tag LOCUS_21340 2799 4004 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_21340 4055 4405 gene locus_tag LOCUS_21350 gene glnK1 4055 4405 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870862.1 protein_id gnl|my_center|LOCUS_21350 4905 5789 gene locus_tag LOCUS_21360 4905 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5975 6325 gene locus_tag LOCUS_21370 5975 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6505 7044 gene locus_tag LOCUS_21380 6505 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 7041 9128 gene locus_tag LOCUS_21390 7041 9128 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_21390 9136 9483 gene locus_tag LOCUS_21400 9136 9483 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_21400 9661 9461 gene locus_tag LOCUS_21410 9661 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 10116 10745 gene locus_tag LOCUS_21420 10116 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 11245 11823 gene locus_tag LOCUS_21430 11245 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 11914 12300 gene locus_tag LOCUS_21440 11914 12300 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_21440 14409 12430 gene locus_tag LOCUS_21450 14409 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 18269 14412 gene locus_tag LOCUS_21460 18269 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 18928 18257 gene locus_tag LOCUS_21470 18928 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 19161 18928 gene locus_tag LOCUS_21480 19161 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 19933 19163 gene locus_tag LOCUS_21490 19933 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20158 19937 gene locus_tag LOCUS_21500 20158 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 20748 20155 gene locus_tag LOCUS_21510 20748 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 20930 20745 gene locus_tag LOCUS_21520 20930 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 21606 21013 gene locus_tag LOCUS_21530 21606 21013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 22640 21600 gene locus_tag LOCUS_21540 22640 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 22828 22640 gene locus_tag LOCUS_21550 22828 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 23669 22815 gene locus_tag LOCUS_21560 23669 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 24009 23644 gene locus_tag LOCUS_21570 24009 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 24775 24398 gene locus_tag LOCUS_21580 24775 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 25500 24772 gene locus_tag LOCUS_21590 25500 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 26192 25503 gene locus_tag LOCUS_21600 26192 25503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 26743 26222 gene locus_tag LOCUS_21610 26743 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 28643 26784 gene locus_tag LOCUS_21620 28643 26784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 29143 28643 gene locus_tag LOCUS_21630 29143 28643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 29355 29140 gene locus_tag LOCUS_21640 29355 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 29724 29476 gene locus_tag LOCUS_21650 29724 29476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 30552 31802 gene locus_tag LOCUS_21660 30552 31802 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_21660 32587 31808 gene locus_tag LOCUS_21670 32587 31808 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765472.1 protein_id gnl|my_center|LOCUS_21670 33227 34045 gene locus_tag LOCUS_21680 33227 34045 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_21680 34367 35137 gene locus_tag LOCUS_21690 34367 35137 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_21690 35137 35754 gene locus_tag LOCUS_21700 gene thiE 35137 35754 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence048 2201 903 gene locus_tag LOCUS_21710 2201 903 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494631.1 protein_id gnl|my_center|LOCUS_21710 2879 2409 gene locus_tag LOCUS_21720 2879 2409 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141212.1 protein_id gnl|my_center|LOCUS_21720 3273 2881 gene locus_tag LOCUS_21730 3273 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4100 3516 gene locus_tag LOCUS_21740 4100 3516 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_21740 5875 4208 gene locus_tag LOCUS_21750 5875 4208 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_21750 6357 5947 gene locus_tag LOCUS_21760 6357 5947 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_21760 6447 7088 gene locus_tag LOCUS_21770 6447 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7111 9504 gene locus_tag LOCUS_21780 7111 9504 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_21780 9602 10555 gene locus_tag LOCUS_21790 9602 10555 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_21790 11800 10715 gene locus_tag LOCUS_21800 gene pelA 11800 10715 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_21800 15304 11909 gene locus_tag LOCUS_21810 15304 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 16586 15318 gene locus_tag LOCUS_21820 16586 15318 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_21820 17008 18675 gene locus_tag LOCUS_21830 gene asnB 17008 18675 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_21830 19087 20472 gene locus_tag LOCUS_21840 19087 20472 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_21840 21301 20558 gene locus_tag LOCUS_21850 gene folE 21301 20558 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_21850 22428 21373 gene locus_tag LOCUS_21860 22428 21373 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869322.1 protein_id gnl|my_center|LOCUS_21860 22699 24591 gene locus_tag LOCUS_21870 gene acs 22699 24591 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_21870 24710 25114 gene locus_tag LOCUS_21880 24710 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 25186 26019 gene locus_tag LOCUS_21890 25186 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 26159 27565 gene locus_tag LOCUS_21900 26159 27565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 27576 28058 gene locus_tag LOCUS_21910 27576 28058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_21910 28377 28970 gene locus_tag LOCUS_21920 28377 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 29220 30233 gene locus_tag LOCUS_21930 29220 30233 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964450.1 protein_id gnl|my_center|LOCUS_21930 31613 32650 gene locus_tag LOCUS_21940 gene galT 31613 32650 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_21940 32782 34278 gene locus_tag LOCUS_21950 32782 34278 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_21950 34359 34577 gene locus_tag LOCUS_21960 34359 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 34640 35104 gene locus_tag LOCUS_21970 34640 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence049 1620 787 gene locus_tag LOCUS_21980 1620 787 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_21980 1822 2238 gene locus_tag LOCUS_21990 gene mraZ 1822 2238 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801871.1 protein_id gnl|my_center|LOCUS_21990 2235 3131 gene locus_tag LOCUS_22000 gene rsmH 2235 3131 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_22000 3175 3546 gene locus_tag LOCUS_22010 3175 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3548 5656 gene locus_tag LOCUS_22020 3548 5656 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_22020 5718 7172 gene locus_tag LOCUS_22030 5718 7172 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_22030 7185 8435 gene locus_tag LOCUS_22040 gene mraY 7185 8435 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_22040 8447 9790 gene locus_tag LOCUS_22050 gene murD 8447 9790 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_22050 9862 11070 gene locus_tag LOCUS_22060 9862 11070 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_22060 11075 12163 gene locus_tag LOCUS_22070 gene murG 11075 12163 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_22070 12156 13544 gene locus_tag LOCUS_22080 gene murC 12156 13544 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_22080 13544 14329 gene locus_tag LOCUS_22090 13544 14329 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_22090 14334 15707 gene locus_tag LOCUS_22100 gene ftsA 14334 15707 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_22100 15730 17187 gene locus_tag LOCUS_22110 15730 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 17310 17759 gene locus_tag LOCUS_22120 17310 17759 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_22120 17943 18254 gene locus_tag LOCUS_22130 17943 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 20426 18315 gene locus_tag LOCUS_22140 20426 18315 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_22140 20740 20549 gene locus_tag LOCUS_22150 20740 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 21299 20733 gene locus_tag LOCUS_22160 gene lptC 21299 20733 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_22160 22602 21307 gene locus_tag LOCUS_22170 22602 21307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_22170 23317 22595 gene locus_tag LOCUS_22180 23317 22595 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_22180 23958 23314 gene locus_tag LOCUS_22190 23958 23314 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_22190 24267 24704 gene locus_tag LOCUS_22200 24267 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 24899 25279 gene locus_tag LOCUS_22210 24899 25279 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_22210 25429 26862 gene locus_tag LOCUS_22220 25429 26862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 27497 26925 gene locus_tag LOCUS_22230 27497 26925 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203194.1 protein_id gnl|my_center|LOCUS_22230 28108 27512 gene locus_tag LOCUS_22240 28108 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 28353 30431 gene locus_tag LOCUS_22250 28353 30431 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_22250 30450 31367 gene locus_tag LOCUS_22260 30450 31367 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_22260 31461 33911 gene locus_tag LOCUS_22270 31461 33911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 33997 34308 gene locus_tag LOCUS_22280 33997 34308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 34318 34617 gene locus_tag LOCUS_22290 34318 34617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 35785 34721 gene locus_tag LOCUS_22300 35785 34721 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence050 2812 254 gene locus_tag LOCUS_22310 2812 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2986 4254 gene locus_tag LOCUS_22320 2986 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5225 4362 gene locus_tag LOCUS_22330 gene metF 5225 4362 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_22330 9068 5385 gene locus_tag LOCUS_22340 gene metH 9068 5385 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_22340 9553 9245 gene locus_tag LOCUS_22350 9553 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10730 9705 gene locus_tag LOCUS_22360 gene ricT 10730 9705 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_22360 10944 11159 gene locus_tag LOCUS_22370 10944 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 11561 11229 gene locus_tag LOCUS_22380 11561 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 12263 12745 gene locus_tag LOCUS_22390 12263 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943364.1 protein_id gnl|my_center|LOCUS_22390 13052 12834 gene locus_tag LOCUS_22400 13052 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 13072 13575 gene locus_tag LOCUS_22410 gene nuoE 13072 13575 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_22410 13580 16708 gene locus_tag LOCUS_22420 13580 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 16729 18501 gene locus_tag LOCUS_22430 16729 18501 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_22430 19855 18542 gene locus_tag LOCUS_22440 19855 18542 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_22440 21428 19884 gene locus_tag LOCUS_22450 21428 19884 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_22450 21791 23299 gene locus_tag LOCUS_22460 gene araA 21791 23299 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368279.1 protein_id gnl|my_center|LOCUS_22460 23428 24063 gene locus_tag LOCUS_22470 23428 24063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 24529 24074 gene locus_tag LOCUS_22480 24529 24074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 25965 24580 gene locus_tag LOCUS_22490 25965 24580 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_22490 27372 26032 gene locus_tag LOCUS_22500 gene trkA 27372 26032 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_22500 29284 27428 gene locus_tag LOCUS_22510 29284 27428 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_22510 29836 29591 gene locus_tag LOCUS_22520 29836 29591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 30108 30587 gene locus_tag LOCUS_22530 30108 30587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 30599 30802 gene locus_tag LOCUS_22540 30599 30802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 30857 31813 gene locus_tag LOCUS_22550 30857 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 31912 32958 gene locus_tag LOCUS_22560 31912 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 33026 33712 gene locus_tag LOCUS_22570 33026 33712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 33709 34569 gene locus_tag LOCUS_22580 33709 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 35041 34820 gene locus_tag LOCUS_22590 35041 34820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 35123 35311 gene locus_tag LOCUS_22600 35123 35311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence051 164 991 gene locus_tag LOCUS_22610 164 991 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_22610 995 2413 gene locus_tag LOCUS_22620 995 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2533 3489 gene locus_tag LOCUS_22630 2533 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 3508 6657 gene locus_tag LOCUS_22640 3508 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7251 6634 gene locus_tag LOCUS_22650 7251 6634 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765039.1 protein_id gnl|my_center|LOCUS_22650 7967 7254 gene locus_tag LOCUS_22660 7967 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 8490 7993 gene locus_tag LOCUS_22670 8490 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 9896 8589 gene locus_tag LOCUS_22680 gene der 9896 8589 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_22680 10868 9987 gene locus_tag LOCUS_22690 gene era 10868 9987 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_22690 11012 11701 gene locus_tag LOCUS_22700 11012 11701 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_22700 12411 11746 gene locus_tag LOCUS_22710 12411 11746 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263627.1 protein_id gnl|my_center|LOCUS_22710 13130 12417 gene locus_tag LOCUS_22720 13130 12417 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577184.1 protein_id gnl|my_center|LOCUS_22720 13371 14183 gene locus_tag LOCUS_22730 13371 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 14192 16036 gene locus_tag LOCUS_22740 14192 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 16038 17090 gene locus_tag LOCUS_22750 16038 17090 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_22750 17233 19377 gene locus_tag LOCUS_22760 17233 19377 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_22760 21525 19435 gene locus_tag LOCUS_22770 21525 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 21750 23168 gene locus_tag LOCUS_22780 21750 23168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 24666 23254 gene locus_tag LOCUS_22790 24666 23254 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_22790 25072 24767 gene locus_tag LOCUS_22800 25072 24767 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_22800 26201 25074 gene locus_tag LOCUS_22810 26201 25074 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_22810 28570 26303 gene locus_tag LOCUS_22820 28570 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 28836 29888 gene locus_tag LOCUS_22830 gene rlmN 28836 29888 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_22830 31411 29984 gene locus_tag LOCUS_22840 gene rlmD 31411 29984 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_22840 32800 31472 gene locus_tag LOCUS_22850 32800 31472 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_22850 <35045 32880 gene locus_tag LOCUS_22860 <35045 32880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920520.1:ATP-binding protein >Feature sequence052 1124 2392 gene locus_tag LOCUS_22870 1124 2392 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_22870 2415 3095 gene locus_tag LOCUS_22880 2415 3095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_22880 3110 3406 gene locus_tag LOCUS_22890 3110 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3435 4778 gene locus_tag LOCUS_22900 3435 4778 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_22900 5385 4843 gene locus_tag LOCUS_22910 5385 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5731 7002 gene locus_tag LOCUS_22920 5731 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_22920 6999 8027 gene locus_tag LOCUS_22930 6999 8027 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_22930 8172 9047 gene locus_tag LOCUS_22940 8172 9047 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_22940 9061 9615 gene locus_tag LOCUS_22950 gene gmk 9061 9615 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_22950 9617 10189 gene locus_tag LOCUS_22960 gene nadD 9617 10189 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_22960 11772 10348 gene locus_tag LOCUS_22970 gene hydG 11772 10348 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_22970 13569 11929 gene locus_tag LOCUS_22980 13569 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 14184 13702 gene locus_tag LOCUS_22990 14184 13702 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_22990 14632 14333 gene locus_tag LOCUS_23000 14632 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 14850 14614 gene locus_tag LOCUS_23010 14850 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 14988 15605 gene locus_tag LOCUS_23020 gene bluB 14988 15605 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846372.1 protein_id gnl|my_center|LOCUS_23020 16466 15609 gene locus_tag LOCUS_23030 16466 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 16666 20058 gene locus_tag LOCUS_23040 16666 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 20579 20130 gene locus_tag LOCUS_23050 20579 20130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 21766 20600 gene locus_tag LOCUS_23060 21766 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 22404 21763 gene locus_tag LOCUS_23070 22404 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 22846 23934 gene locus_tag LOCUS_23080 gene gcvT 22846 23934 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764743.1 protein_id gnl|my_center|LOCUS_23080 24130 24843 gene locus_tag LOCUS_23090 24130 24843 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_23090 25783 24902 gene locus_tag LOCUS_23100 25783 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 26915 26226 gene locus_tag LOCUS_23110 26915 26226 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_23110 28132 27035 gene locus_tag LOCUS_23120 28132 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 28958 28500 gene locus_tag LOCUS_23130 28958 28500 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 protein_id gnl|my_center|LOCUS_23130 30662 29223 gene locus_tag LOCUS_23140 30662 29223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 31773 30862 gene locus_tag LOCUS_23150 31773 30862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 34096 31949 gene locus_tag LOCUS_23160 34096 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443220.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence053 250 858 gene locus_tag LOCUS_23170 250 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 818 1561 gene locus_tag LOCUS_23180 818 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4806 1651 gene locus_tag LOCUS_23190 4806 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 5725 6177 gene locus_tag LOCUS_23200 5725 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 6452 7708 gene locus_tag LOCUS_23210 gene arcA 6452 7708 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682329.1 protein_id gnl|my_center|LOCUS_23210 8880 7939 gene locus_tag LOCUS_23220 8880 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 10031 9135 gene locus_tag LOCUS_23230 10031 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 10934 10077 gene locus_tag LOCUS_23240 10934 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 11940 10963 gene locus_tag LOCUS_23250 11940 10963 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_23250 12852 12364 gene locus_tag LOCUS_23260 12852 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 13750 12845 gene locus_tag LOCUS_23270 gene miaA 13750 12845 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_23270 16204 13757 gene locus_tag LOCUS_23280 gene pheT 16204 13757 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_23280 17037 16342 gene locus_tag LOCUS_23290 17037 16342 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_23290 17195 17614 gene locus_tag LOCUS_23300 17195 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 18301 17615 gene locus_tag LOCUS_23310 18301 17615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 18517 19092 gene locus_tag LOCUS_23320 18517 19092 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_23320 19877 19167 gene locus_tag LOCUS_23330 19877 19167 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_23330 20415 19939 gene locus_tag LOCUS_23340 20415 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_23340 20590 23823 gene locus_tag LOCUS_23350 20590 23823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 23934 24656 gene locus_tag LOCUS_23360 gene ygiD 23934 24656 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212189.1 protein_id gnl|my_center|LOCUS_23360 24736 26112 gene locus_tag LOCUS_23370 24736 26112 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_23370 27322 26204 gene locus_tag LOCUS_23380 27322 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 28403 27438 gene locus_tag LOCUS_23390 gene arcC 28403 27438 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_23390 29941 28556 gene locus_tag LOCUS_23400 29941 28556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 31646 29952 gene locus_tag LOCUS_23410 31646 29952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 33156 31738 gene locus_tag LOCUS_23420 33156 31738 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_23420 <34174 33319 gene locus_tag LOCUS_23430 <34174 33319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766873.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence054 1954 1880 gene locus_tag LOCUS_t00140 1954 1880 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2060 2719 gene locus_tag LOCUS_23440 2060 2719 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_23440 4674 2752 gene locus_tag LOCUS_23450 4674 2752 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_23450 6010 4757 gene locus_tag LOCUS_23460 gene metK 6010 4757 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_23460 7138 6278 gene locus_tag LOCUS_23470 7138 6278 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_23470 7321 8520 gene locus_tag LOCUS_23480 7321 8520 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788030.1 protein_id gnl|my_center|LOCUS_23480 8705 10657 gene locus_tag LOCUS_23490 8705 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 10807 13677 gene locus_tag LOCUS_23500 10807 13677 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_23500 13873 15369 gene locus_tag LOCUS_23510 13873 15369 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_23510 15791 15366 gene locus_tag LOCUS_23520 15791 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 19992 15877 gene locus_tag LOCUS_23530 19992 15877 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_23530 20285 23329 gene locus_tag LOCUS_23540 20285 23329 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_23540 23362 25023 gene locus_tag LOCUS_23550 23362 25023 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_23550 25030 26721 gene locus_tag LOCUS_23560 25030 26721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 26918 29041 gene locus_tag LOCUS_23570 26918 29041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 29308 30777 gene locus_tag LOCUS_23580 29308 30777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 30835 31809 gene locus_tag LOCUS_23590 gene mgrA 30835 31809 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 protein_id gnl|my_center|LOCUS_23590 31915 33066 gene locus_tag LOCUS_23600 31915 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 33380 33210 gene locus_tag LOCUS_23610 33380 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 <34060 33454 gene locus_tag LOCUS_23620 <34060 33454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:efflux RND transporter permease subunit >Feature sequence055 756 397 gene locus_tag LOCUS_23630 756 397 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_23630 2641 848 gene locus_tag LOCUS_23640 gene nuoF 2641 848 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766746.1 protein_id gnl|my_center|LOCUS_23640 3049 2651 gene locus_tag LOCUS_23650 3049 2651 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_23650 3772 3224 gene locus_tag LOCUS_23660 3772 3224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_23660 4503 3769 gene locus_tag LOCUS_23670 4503 3769 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_23670 4914 4576 gene locus_tag LOCUS_23680 4914 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_23680 6309 4933 gene locus_tag LOCUS_23690 6309 4933 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_23690 6719 6306 gene locus_tag LOCUS_23700 6719 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 7068 6724 gene locus_tag LOCUS_23710 7068 6724 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_23710 7345 7443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8935 7478 gene locus_tag LOCUS_23720 8935 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 9261 10043 gene locus_tag LOCUS_23730 gene surE 9261 10043 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_23730 10057 10359 gene locus_tag LOCUS_23740 10057 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 13023 10381 gene locus_tag LOCUS_23750 13023 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 13202 14083 gene locus_tag LOCUS_23760 13202 14083 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841777.1 protein_id gnl|my_center|LOCUS_23760 15035 14226 gene locus_tag LOCUS_23770 15035 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15827 15045 gene locus_tag LOCUS_23780 15827 15045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530445.1 protein_id gnl|my_center|LOCUS_23780 17354 15831 gene locus_tag LOCUS_23790 17354 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 18370 17378 gene locus_tag LOCUS_23800 18370 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 19009 18374 gene locus_tag LOCUS_23810 19009 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 19439 19203 gene locus_tag LOCUS_23820 19439 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 20119 20892 gene locus_tag LOCUS_23830 20119 20892 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_23830 21531 20959 gene locus_tag LOCUS_23840 21531 20959 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_23840 21632 22492 gene locus_tag LOCUS_23850 21632 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 23901 22489 gene locus_tag LOCUS_23860 23901 22489 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_23860 24022 23852 gene locus_tag LOCUS_23870 24022 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 24017 24853 gene locus_tag LOCUS_23880 24017 24853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 24844 25374 gene locus_tag LOCUS_23890 24844 25374 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_23890 26116 26370 gene locus_tag LOCUS_23900 26116 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 28993 26651 gene locus_tag LOCUS_23910 28993 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 29662 28994 gene locus_tag LOCUS_23920 29662 28994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 31856 29856 gene locus_tag LOCUS_23930 31856 29856 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_23930 33150 32452 gene locus_tag LOCUS_23940 33150 32452 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_23940 33696 33772 gene locus_tag LOCUS_t00150 33696 33772 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 2713 2402 gene locus_tag LOCUS_23950 2713 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4243 3029 gene locus_tag LOCUS_23960 4243 3029 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_23960 5057 4245 gene locus_tag LOCUS_23970 5057 4245 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_23970 5480 5064 gene locus_tag LOCUS_23980 gene rbfA 5480 5064 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_23980 5520 6512 gene locus_tag LOCUS_23990 gene trpS 5520 6512 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 protein_id gnl|my_center|LOCUS_23990 7118 6591 gene locus_tag LOCUS_24000 7118 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 7572 7120 gene locus_tag LOCUS_24010 7572 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 8214 7639 gene locus_tag LOCUS_24020 8214 7639 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_24020 8467 10923 gene locus_tag LOCUS_24030 8467 10923 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_24030 11108 11485 gene locus_tag LOCUS_24040 11108 11485 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_24040 11489 13156 gene locus_tag LOCUS_24050 11489 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 14040 13270 gene locus_tag LOCUS_24060 14040 13270 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_24060 15075 14044 gene locus_tag LOCUS_24070 15075 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 15732 15085 gene locus_tag LOCUS_24080 15732 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 17916 15769 gene locus_tag LOCUS_24090 17916 15769 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_24090 19610 18387 gene locus_tag LOCUS_24100 19610 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_24100 19814 20392 gene locus_tag LOCUS_24110 19814 20392 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_24110 21468 20401 gene locus_tag LOCUS_24120 21468 20401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 21639 23744 gene locus_tag LOCUS_24130 21639 23744 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_24130 23821 24210 gene locus_tag LOCUS_24140 23821 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 26162 24288 gene locus_tag LOCUS_24150 26162 24288 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_24150 26640 26284 gene locus_tag LOCUS_24160 26640 26284 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_24160 26881 26612 gene locus_tag LOCUS_24170 26881 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 26861 27889 gene locus_tag LOCUS_24180 26861 27889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 27879 28970 gene locus_tag LOCUS_24190 27879 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 29059 30630 gene locus_tag LOCUS_24200 29059 30630 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_24200 30729 30935 gene locus_tag LOCUS_24210 30729 30935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 31315 30986 gene locus_tag LOCUS_24220 31315 30986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 31903 31370 gene locus_tag LOCUS_24230 31903 31370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 32157 33656 gene locus_tag LOCUS_24240 32157 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence057 1704 1024 gene locus_tag LOCUS_24250 1704 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_24250 2414 1800 gene locus_tag LOCUS_24260 2414 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3321 2425 gene locus_tag LOCUS_24270 3321 2425 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_24270 3848 3381 gene locus_tag LOCUS_24280 gene purE 3848 3381 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 protein_id gnl|my_center|LOCUS_24280 5766 3817 gene locus_tag LOCUS_24290 5766 3817 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_24290 6397 5846 gene locus_tag LOCUS_24300 6397 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 6546 7694 gene locus_tag LOCUS_24310 6546 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 8334 7729 gene locus_tag LOCUS_24320 8334 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 8826 8599 gene locus_tag LOCUS_24330 8826 8599 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_24330 8888 9484 gene locus_tag LOCUS_24340 8888 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 9892 9515 gene locus_tag LOCUS_24350 9892 9515 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_24350 10131 9889 gene locus_tag LOCUS_24360 10131 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 12833 10146 gene locus_tag LOCUS_24370 12833 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 14670 12901 gene locus_tag LOCUS_24380 14670 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 16505 14769 gene locus_tag LOCUS_24390 16505 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 18221 16599 gene locus_tag LOCUS_24400 18221 16599 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_24400 21551 18240 gene locus_tag LOCUS_24410 21551 18240 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_24410 22861 21800 gene locus_tag LOCUS_24420 22861 21800 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_24420 23535 22951 gene locus_tag LOCUS_24430 23535 22951 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_24430 23765 24973 gene locus_tag LOCUS_24440 23765 24973 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_24440 26028 25447 gene locus_tag LOCUS_24450 26028 25447 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_24450 27076 26042 gene locus_tag LOCUS_24460 27076 26042 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807789.1 protein_id gnl|my_center|LOCUS_24460 28748 27207 gene locus_tag LOCUS_24470 28748 27207 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_24470 32067 28771 gene locus_tag LOCUS_24480 32067 28771 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838102.1 protein_id gnl|my_center|LOCUS_24480 33390 32227 gene locus_tag LOCUS_24490 33390 32227 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence058 112 786 gene locus_tag LOCUS_24500 112 786 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765779.1 protein_id gnl|my_center|LOCUS_24500 790 2172 gene locus_tag LOCUS_24510 790 2172 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_24510 3962 2169 gene locus_tag LOCUS_24520 3962 2169 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_24520 4232 4600 gene locus_tag LOCUS_24530 4232 4600 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_24530 4622 5944 gene locus_tag LOCUS_24540 4622 5944 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 protein_id gnl|my_center|LOCUS_24540 6438 6058 gene locus_tag LOCUS_24550 6438 6058 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_24550 6781 6422 gene locus_tag LOCUS_24560 6781 6422 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_24560 6881 7153 gene locus_tag LOCUS_24570 6881 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 7415 7212 gene locus_tag LOCUS_24580 7415 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 7572 7853 gene locus_tag LOCUS_24590 7572 7853 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_24590 7871 9115 gene locus_tag LOCUS_24600 gene egtB 7871 9115 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_24600 9112 10053 gene locus_tag LOCUS_24610 gene egtD 9112 10053 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_24610 10078 11472 gene locus_tag LOCUS_24620 gene fumC 10078 11472 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_24620 11684 12139 gene locus_tag LOCUS_24630 11684 12139 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_24630 12318 13154 gene locus_tag LOCUS_24640 12318 13154 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_24640 13336 14469 gene locus_tag LOCUS_24650 13336 14469 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_24650 16791 14554 gene locus_tag LOCUS_24660 16791 14554 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_24660 17780 16809 gene locus_tag LOCUS_24670 17780 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 18560 17787 gene locus_tag LOCUS_24680 18560 17787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_24680 19349 18564 gene locus_tag LOCUS_24690 19349 18564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_24690 22010 19656 gene locus_tag LOCUS_24700 22010 19656 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_24700 22662 22306 gene locus_tag LOCUS_24710 22662 22306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 22856 24262 gene locus_tag LOCUS_24720 22856 24262 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_24720 27256 24266 gene locus_tag LOCUS_24730 27256 24266 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108785.1 protein_id gnl|my_center|LOCUS_24730 27472 27786 gene locus_tag LOCUS_24740 27472 27786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 28011 29609 gene locus_tag LOCUS_24750 28011 29609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 29698 30489 gene locus_tag LOCUS_24760 29698 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 30479 31570 gene locus_tag LOCUS_24770 30479 31570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 32569 31628 gene locus_tag LOCUS_24780 32569 31628 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_24780 <33554 32580 gene locus_tag LOCUS_24790 <33554 32580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118279.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence059 241 250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 412 759 gene locus_tag LOCUS_24800 412 759 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_24800 804 1430 gene locus_tag LOCUS_24810 804 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2011 1487 gene locus_tag LOCUS_24820 2011 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2925 2017 gene locus_tag LOCUS_24830 2925 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3490 4488 gene locus_tag LOCUS_24840 3490 4488 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 protein_id gnl|my_center|LOCUS_24840 5421 4618 gene locus_tag LOCUS_24850 5421 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6052 5450 gene locus_tag LOCUS_24860 6052 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 6722 6231 gene locus_tag LOCUS_24870 6722 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 7097 8290 gene locus_tag LOCUS_24880 7097 8290 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_24880 8443 9519 gene locus_tag LOCUS_24890 gene proB 8443 9519 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_24890 9526 10773 gene locus_tag LOCUS_24900 9526 10773 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_24900 10883 11233 gene locus_tag LOCUS_24910 10883 11233 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_24910 11423 12367 gene locus_tag LOCUS_24920 11423 12367 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_24920 12591 12857 gene locus_tag LOCUS_24930 12591 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 12857 13288 gene locus_tag LOCUS_24940 12857 13288 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_24940 13302 14354 gene locus_tag LOCUS_24950 13302 14354 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_24950 14413 15747 gene locus_tag LOCUS_24960 gene argH 14413 15747 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_24960 16409 15753 gene locus_tag LOCUS_24970 16409 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 16609 19827 gene locus_tag LOCUS_24980 gene carB 16609 19827 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_24980 21630 19993 gene locus_tag LOCUS_24990 21630 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 protein_id gnl|my_center|LOCUS_24990 22427 21636 gene locus_tag LOCUS_25000 22427 21636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_25000 23978 22515 gene locus_tag LOCUS_25010 23978 22515 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393930.1 protein_id gnl|my_center|LOCUS_25010 24400 24065 gene locus_tag LOCUS_25020 24400 24065 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762354.1 protein_id gnl|my_center|LOCUS_25020 26362 24404 gene locus_tag LOCUS_25030 26362 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 26722 27957 gene locus_tag LOCUS_25040 26722 27957 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_25040 28059 28853 gene locus_tag LOCUS_25050 28059 28853 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_25050 30749 28857 gene locus_tag LOCUS_25060 30749 28857 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106526748.1 protein_id gnl|my_center|LOCUS_25060 31354 30749 gene locus_tag LOCUS_25070 31354 30749 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_25070 32543 31401 gene locus_tag LOCUS_25080 32543 31401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence060 2119 566 gene locus_tag LOCUS_25090 2119 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2965 2474 gene locus_tag LOCUS_25100 2965 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2919 3761 gene locus_tag LOCUS_25110 2919 3761 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_25110 3981 4913 gene locus_tag LOCUS_25120 3981 4913 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_25120 5743 4910 gene locus_tag LOCUS_25130 gene cysQ 5743 4910 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146221485.1 protein_id gnl|my_center|LOCUS_25130 5821 7284 gene locus_tag LOCUS_25140 5821 7284 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_25140 7563 7396 gene locus_tag LOCUS_25150 7563 7396 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_25150 7822 8229 gene locus_tag LOCUS_25160 7822 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8307 8939 gene locus_tag LOCUS_25170 8307 8939 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_25170 9359 10696 gene locus_tag LOCUS_25180 gene tilS 9359 10696 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_25180 12173 10677 gene locus_tag LOCUS_25190 12173 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 13069 12296 gene locus_tag LOCUS_25200 13069 12296 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_25200 14163 13180 gene locus_tag LOCUS_25210 gene aroC 14163 13180 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_25210 14938 14297 gene locus_tag LOCUS_25220 gene aroD 14938 14297 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870974.1 protein_id gnl|my_center|LOCUS_25220 15956 14925 gene locus_tag LOCUS_25230 gene aroB 15956 14925 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_25230 17071 15956 gene locus_tag LOCUS_25240 17071 15956 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_25240 18156 17287 gene locus_tag LOCUS_25250 18156 17287 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_25250 18543 22598 gene locus_tag LOCUS_25260 18543 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 22723 24153 gene locus_tag LOCUS_25270 22723 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 24503 26347 gene locus_tag LOCUS_25280 24503 26347 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_25280 26530 27132 gene locus_tag LOCUS_25290 26530 27132 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_25290 27285 28343 gene locus_tag LOCUS_25300 27285 28343 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_25300 28549 31785 gene locus_tag LOCUS_25310 28549 31785 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence061 1798 359 gene locus_tag LOCUS_25320 1798 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2757 1795 gene locus_tag LOCUS_25330 2757 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3010 4932 gene locus_tag LOCUS_25340 3010 4932 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_25340 6339 5065 gene locus_tag LOCUS_25350 6339 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 9106 6347 gene locus_tag LOCUS_25360 9106 6347 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_25360 9642 9196 gene locus_tag LOCUS_25370 9642 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 10114 9629 gene locus_tag LOCUS_25380 10114 9629 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_25380 10563 11597 gene locus_tag LOCUS_25390 10563 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 12241 11780 gene locus_tag LOCUS_25400 12241 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 12703 13872 gene locus_tag LOCUS_25410 12703 13872 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_25410 13869 14342 gene locus_tag LOCUS_25420 13869 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 14332 15468 gene locus_tag LOCUS_25430 gene dprA 14332 15468 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_25430 15475 16251 gene locus_tag LOCUS_25440 15475 16251 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817413.1 protein_id gnl|my_center|LOCUS_25440 16253 17296 gene locus_tag LOCUS_25450 16253 17296 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_25450 17422 17510 gene locus_tag LOCUS_t00160 17422 17510 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19877 17880 gene locus_tag LOCUS_25460 19877 17880 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_25460 21203 19878 gene locus_tag LOCUS_25470 21203 19878 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_25470 21457 21663 gene locus_tag LOCUS_25480 21457 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 21833 24892 gene locus_tag LOCUS_25490 21833 24892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 25863 25093 gene locus_tag LOCUS_25500 25863 25093 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_25500 26775 25882 gene locus_tag LOCUS_25510 26775 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 27800 26724 gene locus_tag LOCUS_25520 27800 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 30142 28037 gene locus_tag LOCUS_25530 30142 28037 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_25530 31307 30201 gene locus_tag LOCUS_25540 31307 30201 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence062 <1 2220 gene locus_tag LOCUS_25550 <1 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201938.1:glycoside hydrolase family 38 C-terminal domain-containing protein 2263 3819 gene locus_tag LOCUS_25560 2263 3819 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132123697.1 protein_id gnl|my_center|LOCUS_25560 4008 5342 gene locus_tag LOCUS_25570 4008 5342 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_25570 5407 6648 gene locus_tag LOCUS_25580 5407 6648 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_25580 6834 7238 gene locus_tag LOCUS_25590 6834 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 9643 7292 gene locus_tag LOCUS_25600 9643 7292 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_25600 12261 9916 gene locus_tag LOCUS_25610 12261 9916 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_25610 12550 12975 gene locus_tag LOCUS_25620 12550 12975 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_25620 13191 12970 gene locus_tag LOCUS_25630 13191 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 13501 13283 gene locus_tag LOCUS_25640 13501 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 15504 13585 gene locus_tag LOCUS_25650 15504 13585 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_25650 17742 15667 gene locus_tag LOCUS_25660 17742 15667 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_25660 20354 18351 gene locus_tag LOCUS_25670 20354 18351 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_25670 20600 21085 gene locus_tag LOCUS_25680 20600 21085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 23418 21517 gene locus_tag LOCUS_25690 23418 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975232.1 protein_id gnl|my_center|LOCUS_25690 26727 23470 gene locus_tag LOCUS_25700 26727 23470 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_25700 28415 26934 gene locus_tag LOCUS_25710 28415 26934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 28634 29299 gene locus_tag LOCUS_25720 28634 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 29329 30645 gene locus_tag LOCUS_25730 29329 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 30776 31348 gene locus_tag LOCUS_25740 30776 31348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence063 359 114 gene locus_tag LOCUS_25750 359 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1383 559 gene locus_tag LOCUS_25760 1383 559 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225614.1 protein_id gnl|my_center|LOCUS_25760 2917 1397 gene locus_tag LOCUS_25770 2917 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4000 3047 gene locus_tag LOCUS_25780 4000 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 5970 4264 gene locus_tag LOCUS_25790 5970 4264 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_25790 8875 5957 gene locus_tag LOCUS_25800 8875 5957 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_25800 10762 8984 gene locus_tag LOCUS_25810 10762 8984 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_25810 13818 10762 gene locus_tag LOCUS_25820 13818 10762 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_25820 18116 14037 gene locus_tag LOCUS_25830 18116 14037 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_25830 18482 18763 gene locus_tag LOCUS_25840 18482 18763 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_25840 18827 20959 gene locus_tag LOCUS_25850 18827 20959 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_25850 23305 20984 gene locus_tag LOCUS_25860 23305 20984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 24373 23393 gene locus_tag LOCUS_25870 24373 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 24970 24380 gene locus_tag LOCUS_25880 24970 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25880 25225 26658 gene locus_tag LOCUS_25890 25225 26658 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_25890 27960 26722 gene locus_tag LOCUS_25900 27960 26722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 28452 27997 gene locus_tag LOCUS_25910 28452 27997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 28927 28436 gene locus_tag LOCUS_25920 28927 28436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 29261 31792 gene locus_tag LOCUS_25930 29261 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence064 264 2351 gene locus_tag LOCUS_25940 264 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2348 3295 gene locus_tag LOCUS_25950 2348 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3308 7699 gene locus_tag LOCUS_25960 3308 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 7799 8758 gene locus_tag LOCUS_25970 7799 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 8826 10838 gene locus_tag LOCUS_25980 8826 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 10855 11709 gene locus_tag LOCUS_25990 10855 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 11999 14419 gene locus_tag LOCUS_26000 11999 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 14968 16941 gene locus_tag LOCUS_26010 14968 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 17033 18553 gene locus_tag LOCUS_26020 17033 18553 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_26020 18689 19069 gene locus_tag LOCUS_26030 18689 19069 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_26030 19105 19623 gene locus_tag LOCUS_26040 19105 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 19879 20946 gene locus_tag LOCUS_26050 19879 20946 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_26050 21375 21025 gene locus_tag LOCUS_26060 21375 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 21821 21471 gene locus_tag LOCUS_26070 21821 21471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 21915 22112 gene locus_tag LOCUS_26080 21915 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 23725 22187 gene locus_tag LOCUS_26090 23725 22187 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_26090 24340 23831 gene locus_tag LOCUS_26100 24340 23831 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766266.1 protein_id gnl|my_center|LOCUS_26100 25863 24352 gene locus_tag LOCUS_26110 gene accC 25863 24352 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_26110 27381 26119 gene locus_tag LOCUS_26120 27381 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 27516 27653 gene locus_tag LOCUS_26130 27516 27653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 28249 27905 gene locus_tag LOCUS_26140 28249 27905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 29966 28575 gene locus_tag LOCUS_26150 29966 28575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 <31838 29971 gene locus_tag LOCUS_26160 <31838 29971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence065 1625 2488 gene locus_tag LOCUS_26170 gene dapF 1625 2488 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_26170 2598 4475 gene locus_tag LOCUS_26180 gene pepF 2598 4475 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_26180 4715 5047 gene locus_tag LOCUS_26190 4715 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 5347 5120 gene locus_tag LOCUS_26200 5347 5120 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_26200 6693 5344 gene locus_tag LOCUS_26210 6693 5344 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_26210 6999 8288 gene locus_tag LOCUS_26220 6999 8288 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963947.1 protein_id gnl|my_center|LOCUS_26220 8732 8295 gene locus_tag LOCUS_26230 8732 8295 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_26230 9136 8846 gene locus_tag LOCUS_26240 9136 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 10250 9138 gene locus_tag LOCUS_26250 gene recF 10250 9138 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_26250 13864 10565 gene locus_tag LOCUS_26260 gene secA 13864 10565 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_26260 14310 14774 gene locus_tag LOCUS_26270 14310 14774 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_26270 14777 15190 gene locus_tag LOCUS_26280 14777 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 15202 16320 gene locus_tag LOCUS_26290 15202 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202551.1 protein_id gnl|my_center|LOCUS_26290 16496 17509 gene locus_tag LOCUS_26300 16496 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 18103 17543 gene locus_tag LOCUS_26310 18103 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 18529 18143 gene locus_tag LOCUS_26320 18529 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 18666 19370 gene locus_tag LOCUS_26330 18666 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 19491 20189 gene locus_tag LOCUS_26340 19491 20189 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_26340 20210 21280 gene locus_tag LOCUS_26350 20210 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 21282 22298 gene locus_tag LOCUS_26360 21282 22298 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979941.1 protein_id gnl|my_center|LOCUS_26360 22303 22641 gene locus_tag LOCUS_26370 22303 22641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 22634 24493 gene locus_tag LOCUS_26380 22634 24493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 25206 24490 gene locus_tag LOCUS_26390 25206 24490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 26971 25211 gene locus_tag LOCUS_26400 26971 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_26400 28029 26980 gene locus_tag LOCUS_26410 28029 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 30727 28040 gene locus_tag LOCUS_26420 30727 28040 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_26420 <31513 30923 gene locus_tag LOCUS_26430 <31513 30923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793937.1:glucuronate isomerase >Feature sequence066 8575 3941 gene locus_tag LOCUS_26440 8575 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 10065 8845 gene locus_tag LOCUS_26450 10065 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 10838 10620 gene locus_tag LOCUS_26460 10838 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 10914 11954 gene locus_tag LOCUS_26470 10914 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 14248 12224 gene locus_tag LOCUS_26480 14248 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 14767 14300 gene locus_tag LOCUS_26490 14767 14300 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_26490 15078 15446 gene locus_tag LOCUS_26500 15078 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26500 15580 16524 gene locus_tag LOCUS_26510 15580 16524 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776006.1 protein_id gnl|my_center|LOCUS_26510 17595 16525 gene locus_tag LOCUS_26520 17595 16525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288760.1 protein_id gnl|my_center|LOCUS_26520 18920 17649 gene locus_tag LOCUS_26530 18920 17649 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966602.1 protein_id gnl|my_center|LOCUS_26530 19435 18986 gene locus_tag LOCUS_26540 19435 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 20887 19589 gene locus_tag LOCUS_26550 20887 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 21016 22173 gene locus_tag LOCUS_26560 21016 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 22197 22439 gene locus_tag LOCUS_26570 22197 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 22522 23880 gene locus_tag LOCUS_26580 22522 23880 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_26580 23891 25117 gene locus_tag LOCUS_26590 23891 25117 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974382.1 protein_id gnl|my_center|LOCUS_26590 25101 26435 gene locus_tag LOCUS_26600 25101 26435 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_26600 26608 28434 gene locus_tag LOCUS_26610 26608 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 28623 28997 gene locus_tag LOCUS_26620 28623 28997 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_26620 30395 29058 gene locus_tag LOCUS_26630 30395 29058 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_26630 30655 31242 gene locus_tag LOCUS_26640 30655 31242 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence067 2025 1162 gene locus_tag LOCUS_26650 gene rfbD 2025 1162 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_26650 2576 2028 gene locus_tag LOCUS_26660 gene rfbC 2576 2028 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_26660 3467 2577 gene locus_tag LOCUS_26670 gene rfbA 3467 2577 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_26670 4402 3464 gene locus_tag LOCUS_26680 4402 3464 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_26680 5775 4444 gene locus_tag LOCUS_26690 5775 4444 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_26690 5957 6334 gene locus_tag LOCUS_26700 5957 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 6449 8419 gene locus_tag LOCUS_26710 gene rpsA 6449 8419 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_26710 8451 8795 gene locus_tag LOCUS_26720 8451 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 8814 9725 gene locus_tag LOCUS_26730 8814 9725 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_26730 9791 11320 gene locus_tag LOCUS_26740 gene guaA 9791 11320 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_26740 11356 12957 gene locus_tag LOCUS_26750 11356 12957 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_26750 12961 13542 gene locus_tag LOCUS_26760 gene pnuC 12961 13542 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_26760 13542 14072 gene locus_tag LOCUS_26770 13542 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 14134 15309 gene locus_tag LOCUS_26780 14134 15309 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_26780 15509 16057 gene locus_tag LOCUS_26790 15509 16057 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_26790 16081 16458 gene locus_tag LOCUS_26800 16081 16458 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_26800 19544 16461 gene locus_tag LOCUS_26810 19544 16461 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_26810 19964 19560 gene locus_tag LOCUS_26820 19964 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 20851 19967 gene locus_tag LOCUS_26830 20851 19967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 22223 20973 gene locus_tag LOCUS_26840 22223 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 22388 25000 gene locus_tag LOCUS_26850 gene clpB 22388 25000 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_26850 25437 25099 gene locus_tag LOCUS_26860 25437 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 25796 25455 gene locus_tag LOCUS_26870 25796 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 25936 26973 gene locus_tag LOCUS_26880 25936 26973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 27051 29051 gene locus_tag LOCUS_26890 27051 29051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 29082 29813 gene locus_tag LOCUS_26900 29082 29813 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_26900 29810 30517 gene locus_tag LOCUS_26910 29810 30517 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence068 <1 1026 gene locus_tag LOCUS_26920 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109138.1:beta-galactosidase 1217 1765 gene locus_tag LOCUS_26930 1217 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1882 2952 gene locus_tag LOCUS_26940 1882 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3134 5173 gene locus_tag LOCUS_26950 3134 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 5692 5177 gene locus_tag LOCUS_26960 5692 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26960 6222 5713 gene locus_tag LOCUS_26970 6222 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 6409 7557 gene locus_tag LOCUS_26980 6409 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 7570 9234 gene locus_tag LOCUS_26990 7570 9234 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_26990 9416 11386 gene locus_tag LOCUS_27000 9416 11386 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_27000 11571 13367 gene locus_tag LOCUS_27010 11571 13367 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_27010 13580 15565 gene locus_tag LOCUS_27020 13580 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 15623 16951 gene locus_tag LOCUS_27030 15623 16951 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_27030 17319 18845 gene locus_tag LOCUS_27040 17319 18845 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_27040 18848 20440 gene locus_tag LOCUS_27050 18848 20440 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_27050 20667 21254 gene locus_tag LOCUS_27060 20667 21254 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_27060 21317 22471 gene locus_tag LOCUS_27070 21317 22471 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_27070 22675 26178 gene locus_tag LOCUS_27080 22675 26178 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203530.1 protein_id gnl|my_center|LOCUS_27080 26236 28197 gene locus_tag LOCUS_27090 26236 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 28341 29693 gene locus_tag LOCUS_27100 28341 29693 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_27100 <30627 30000 gene locus_tag LOCUS_27110 <30627 30000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767018.1:family 16 glycosylhydrolase >Feature sequence069 3607 197 gene locus_tag LOCUS_27120 3607 197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_27120 4789 3755 gene locus_tag LOCUS_27130 4789 3755 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_27130 5390 4827 gene locus_tag LOCUS_27140 5390 4827 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763953.1 protein_id gnl|my_center|LOCUS_27140 8210 5658 gene locus_tag LOCUS_27150 8210 5658 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_27150 10643 8343 gene locus_tag LOCUS_27160 10643 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_27160 12005 10650 gene locus_tag LOCUS_27170 12005 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 12889 12089 gene locus_tag LOCUS_27180 12889 12089 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_27180 14608 12962 gene locus_tag LOCUS_27190 14608 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27190 15718 14690 gene locus_tag LOCUS_27200 15718 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27200 16722 15769 gene locus_tag LOCUS_27210 16722 15769 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_27210 18677 16731 gene locus_tag LOCUS_27220 18677 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 20872 18695 gene locus_tag LOCUS_27230 20872 18695 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_27230 23366 20883 gene locus_tag LOCUS_27240 23366 20883 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_27240 25146 23377 gene locus_tag LOCUS_27250 25146 23377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_27250 26254 25148 gene locus_tag LOCUS_27260 26254 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 28114 26273 gene locus_tag LOCUS_27270 28114 26273 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_27270 29923 28262 gene locus_tag LOCUS_27280 29923 28262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence070 464 57 gene locus_tag LOCUS_27290 464 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 814 6576 gene locus_tag LOCUS_27300 814 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 7255 6725 gene locus_tag LOCUS_27310 7255 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 9041 7377 gene locus_tag LOCUS_27320 9041 7377 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_27320 9234 9049 gene locus_tag LOCUS_27330 9234 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 9786 9310 gene locus_tag LOCUS_27340 9786 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10323 10024 gene locus_tag LOCUS_27350 10323 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 12673 10352 gene locus_tag LOCUS_27360 12673 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 13541 12759 gene locus_tag LOCUS_27370 13541 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 15147 13522 gene locus_tag LOCUS_27380 15147 13522 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 protein_id gnl|my_center|LOCUS_27380 16027 15332 gene locus_tag LOCUS_27390 16027 15332 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_27390 17135 16014 gene locus_tag LOCUS_27400 17135 16014 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 protein_id gnl|my_center|LOCUS_27400 17928 17119 gene locus_tag LOCUS_27410 17928 17119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 18215 18033 gene locus_tag LOCUS_27420 18215 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 18748 18218 gene locus_tag LOCUS_27430 18748 18218 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963082.1 protein_id gnl|my_center|LOCUS_27430 19231 19920 gene locus_tag LOCUS_27440 19231 19920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_27440 20068 22434 gene locus_tag LOCUS_27450 20068 22434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_27450 22482 24872 gene locus_tag LOCUS_27460 22482 24872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_27460 24894 27227 gene locus_tag LOCUS_27470 24894 27227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_27470 27720 27235 gene locus_tag LOCUS_27480 27720 27235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 28047 28319 gene locus_tag LOCUS_27490 28047 28319 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_27490 28724 28416 gene locus_tag LOCUS_27500 28724 28416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27500 28866 28705 gene locus_tag LOCUS_27510 28866 28705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 29979 28918 gene locus_tag LOCUS_27520 29979 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence071 1065 25 gene locus_tag LOCUS_27530 1065 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2389 1076 gene locus_tag LOCUS_27540 2389 1076 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_27540 3086 2634 gene locus_tag LOCUS_27550 3086 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 4385 3096 gene locus_tag LOCUS_27560 4385 3096 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_27560 4515 5714 gene locus_tag LOCUS_27570 4515 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 5786 6094 gene locus_tag LOCUS_27580 gene lsrG 5786 6094 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 protein_id gnl|my_center|LOCUS_27580 6310 7248 gene locus_tag LOCUS_27590 6310 7248 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_27590 7271 8800 gene locus_tag LOCUS_27600 7271 8800 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_27600 9311 8802 gene locus_tag LOCUS_27610 9311 8802 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_27610 9437 10462 gene locus_tag LOCUS_27620 9437 10462 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_27620 10576 11583 gene locus_tag LOCUS_27630 10576 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 11589 11972 gene locus_tag LOCUS_27640 11589 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 12126 12962 gene locus_tag LOCUS_27650 12126 12962 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963736.1 protein_id gnl|my_center|LOCUS_27650 13086 13856 gene locus_tag LOCUS_27660 13086 13856 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_27660 14383 14015 gene locus_tag LOCUS_27670 14383 14015 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254762.1 protein_id gnl|my_center|LOCUS_27670 14538 15419 gene locus_tag LOCUS_27680 14538 15419 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_27680 15460 16005 gene locus_tag LOCUS_27690 15460 16005 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_27690 16011 16433 gene locus_tag LOCUS_27700 16011 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 17414 16449 gene locus_tag LOCUS_27710 17414 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 17959 17417 gene locus_tag LOCUS_27720 17959 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 19271 18045 gene locus_tag LOCUS_27730 19271 18045 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_27730 19325 20407 gene locus_tag LOCUS_27740 19325 20407 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_27740 21752 20496 gene locus_tag LOCUS_27750 21752 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 21845 22252 gene locus_tag LOCUS_27760 21845 22252 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence072 536 1843 gene locus_tag LOCUS_27770 536 1843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_27770 3627 1840 gene locus_tag LOCUS_27780 3627 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 4207 3620 gene locus_tag LOCUS_27790 4207 3620 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943021.1 protein_id gnl|my_center|LOCUS_27790 5235 4222 gene locus_tag LOCUS_27800 5235 4222 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943022.1 protein_id gnl|my_center|LOCUS_27800 5918 5247 gene locus_tag LOCUS_27810 5918 5247 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943023.1 protein_id gnl|my_center|LOCUS_27810 6141 7418 gene locus_tag LOCUS_27820 gene tyrS 6141 7418 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_27820 7605 8603 gene locus_tag LOCUS_27830 7605 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 8607 10067 gene locus_tag LOCUS_27840 8607 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 11026 10193 gene locus_tag LOCUS_27850 11026 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 11270 12034 gene locus_tag LOCUS_27860 11270 12034 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876764.1 protein_id gnl|my_center|LOCUS_27860 12467 12087 gene locus_tag LOCUS_27870 12467 12087 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_27870 12624 13829 gene locus_tag LOCUS_27880 12624 13829 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_27880 13840 14400 gene locus_tag LOCUS_27890 13840 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 15793 14612 gene locus_tag LOCUS_27900 15793 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 15986 16237 gene locus_tag LOCUS_27910 15986 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 16783 16262 gene locus_tag LOCUS_27920 16783 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 18550 16796 gene locus_tag LOCUS_27930 18550 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 19009 20109 gene locus_tag LOCUS_27940 19009 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 20222 21439 gene locus_tag LOCUS_27950 20222 21439 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_27950 24031 21668 gene locus_tag LOCUS_27960 24031 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 24401 25039 gene locus_tag LOCUS_27970 24401 25039 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_27970 25173 25982 gene locus_tag LOCUS_27980 25173 25982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_27980 26370 26155 gene locus_tag LOCUS_27990 26370 26155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 26369 26758 gene locus_tag LOCUS_28000 26369 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 26755 27135 gene locus_tag LOCUS_28010 26755 27135 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_28010 27110 27778 gene locus_tag LOCUS_28020 27110 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 28199 27792 gene locus_tag LOCUS_28030 28199 27792 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_28030 28573 28352 gene locus_tag LOCUS_28040 28573 28352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence073 1242 775 gene locus_tag LOCUS_28050 1242 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2067 1267 gene locus_tag LOCUS_28060 2067 1267 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948918.1 protein_id gnl|my_center|LOCUS_28060 2187 4124 gene locus_tag LOCUS_28070 2187 4124 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_28070 4272 5483 gene locus_tag LOCUS_28080 4272 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 5583 6299 gene locus_tag LOCUS_28090 5583 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 7903 6362 gene locus_tag LOCUS_28100 gene dnaB 7903 6362 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_28100 8192 10096 gene locus_tag LOCUS_28110 8192 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 10140 11015 gene locus_tag LOCUS_28120 10140 11015 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_28120 11109 11648 gene locus_tag LOCUS_28130 11109 11648 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_28130 11931 12638 gene locus_tag LOCUS_28140 11931 12638 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_28140 12756 14195 gene locus_tag LOCUS_28150 12756 14195 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_28150 14318 14245 gene locus_tag LOCUS_t00170 14318 14245 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14540 15760 gene locus_tag LOCUS_28160 14540 15760 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_28160 15767 16405 gene locus_tag LOCUS_28170 15767 16405 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_28170 16630 17520 gene locus_tag LOCUS_28180 16630 17520 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_28180 17958 18461 gene locus_tag LOCUS_28190 17958 18461 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_28190 18784 18545 gene locus_tag LOCUS_28200 18784 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 19104 18796 gene locus_tag LOCUS_28210 19104 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 19917 19174 gene locus_tag LOCUS_28220 19917 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 20030 20611 gene locus_tag LOCUS_28230 20030 20611 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_28230 20615 21973 gene locus_tag LOCUS_28240 20615 21973 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_28240 22469 24658 gene locus_tag LOCUS_28250 22469 24658 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_28250 24992 24714 gene locus_tag LOCUS_28260 24992 24714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 25136 27898 gene locus_tag LOCUS_28270 25136 27898 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_28270 28060 28761 gene locus_tag LOCUS_28280 28060 28761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence074 1577 258 gene locus_tag LOCUS_28290 1577 258 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_28290 2214 1696 gene locus_tag LOCUS_28300 2214 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2787 2317 gene locus_tag LOCUS_28310 2787 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2980 3954 gene locus_tag LOCUS_28320 2980 3954 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_28320 5573 4020 gene locus_tag LOCUS_28330 5573 4020 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_28330 6316 5717 gene locus_tag LOCUS_28340 6316 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 6594 8174 gene locus_tag LOCUS_28350 gene nadB 6594 8174 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_28350 8221 10665 gene locus_tag LOCUS_28360 gene galB 8221 10665 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_28360 11215 10673 gene locus_tag LOCUS_28370 11215 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 12248 11235 gene locus_tag LOCUS_28380 gene dusB 12248 11235 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_28380 12344 13294 gene locus_tag LOCUS_28390 12344 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 14028 13282 gene locus_tag LOCUS_28400 14028 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108112.1 protein_id gnl|my_center|LOCUS_28400 14247 15635 gene locus_tag LOCUS_28410 14247 15635 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_28410 16523 15714 gene locus_tag LOCUS_28420 16523 15714 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_28420 17359 16520 gene locus_tag LOCUS_28430 17359 16520 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_28430 17609 18184 gene locus_tag LOCUS_28440 17609 18184 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366547.1 protein_id gnl|my_center|LOCUS_28440 18532 18756 gene locus_tag LOCUS_28450 18532 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 18944 20026 gene locus_tag LOCUS_28460 18944 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 20124 20342 gene locus_tag LOCUS_28470 20124 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 20327 20659 gene locus_tag LOCUS_28480 20327 20659 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_28480 21662 20676 gene locus_tag LOCUS_28490 21662 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787556.1 protein_id gnl|my_center|LOCUS_28490 21892 23229 gene locus_tag LOCUS_28500 21892 23229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 24482 23283 gene locus_tag LOCUS_28510 24482 23283 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_28510 25214 24558 gene locus_tag LOCUS_28520 25214 24558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 26223 25348 gene locus_tag LOCUS_28530 26223 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 27134 26424 gene locus_tag LOCUS_28540 27134 26424 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_28540 27709 27266 gene locus_tag LOCUS_28550 27709 27266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 28693 27782 gene locus_tag LOCUS_28560 28693 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence075 1637 1161 gene locus_tag LOCUS_28570 1637 1161 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_28570 2464 1643 gene locus_tag LOCUS_28580 2464 1643 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_28580 3031 3267 gene locus_tag LOCUS_28590 3031 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 5805 3451 gene locus_tag LOCUS_28600 5805 3451 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744482.1 protein_id gnl|my_center|LOCUS_28600 7130 7321 gene locus_tag LOCUS_28610 7130 7321 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_28610 8010 7387 gene locus_tag LOCUS_28620 8010 7387 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_28620 8151 10055 gene locus_tag LOCUS_28630 8151 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10654 12438 gene locus_tag LOCUS_28640 10654 12438 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_28640 12899 13468 gene locus_tag LOCUS_28650 12899 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 13534 14532 gene locus_tag LOCUS_28660 13534 14532 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791368.1 protein_id gnl|my_center|LOCUS_28660 14732 18259 gene locus_tag LOCUS_28670 14732 18259 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_28670 18278 19969 gene locus_tag LOCUS_28680 18278 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 20080 22824 gene locus_tag LOCUS_28690 20080 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 22852 24780 gene locus_tag LOCUS_28700 22852 24780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 24813 26609 gene locus_tag LOCUS_28710 24813 26609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence076 3404 1809 gene locus_tag LOCUS_28720 3404 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3749 4306 gene locus_tag LOCUS_28730 3749 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 4562 5191 gene locus_tag LOCUS_28740 4562 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 5161 5955 gene locus_tag LOCUS_28750 5161 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 5965 6624 gene locus_tag LOCUS_28760 5965 6624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_28760 7113 6775 gene locus_tag LOCUS_28770 7113 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 7309 7103 gene locus_tag LOCUS_28780 7309 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 7492 7408 gene locus_tag LOCUS_t00180 7492 7408 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7638 7554 gene locus_tag LOCUS_t00190 7638 7554 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8414 12592 gene locus_tag LOCUS_28790 8414 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 12592 13254 gene locus_tag LOCUS_28800 gene nreC 12592 13254 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_28800 13412 14767 gene locus_tag LOCUS_28810 gene gdhA 13412 14767 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_28810 14867 17158 gene locus_tag LOCUS_28820 14867 17158 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_28820 19154 17217 gene locus_tag LOCUS_28830 19154 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 19910 19224 gene locus_tag LOCUS_28840 19910 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 21404 19929 gene locus_tag LOCUS_28850 gene proS 21404 19929 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_28850 22017 22259 gene locus_tag LOCUS_28860 22017 22259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 22974 22810 gene locus_tag LOCUS_28870 22974 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 22952 24391 gene locus_tag LOCUS_28880 22952 24391 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_28880 24699 24388 gene locus_tag LOCUS_28890 24699 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 25828 25082 gene locus_tag LOCUS_28900 gene larB 25828 25082 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_28900 27092 25830 gene locus_tag LOCUS_28910 gene larC 27092 25830 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_28910 27287 28201 gene locus_tag LOCUS_28920 27287 28201 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence077 1315 3042 gene locus_tag LOCUS_28930 1315 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3048 4253 gene locus_tag LOCUS_28940 3048 4253 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081668.1 protein_id gnl|my_center|LOCUS_28940 5181 4306 gene locus_tag LOCUS_28950 5181 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6702 5344 gene locus_tag LOCUS_28960 6702 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 6867 9299 gene locus_tag LOCUS_28970 6867 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 10126 9296 gene locus_tag LOCUS_28980 10126 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 11908 10130 gene locus_tag LOCUS_28990 11908 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 12795 12055 gene locus_tag LOCUS_29000 gene bla2 12795 12055 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799227.1 protein_id gnl|my_center|LOCUS_29000 12939 13898 gene locus_tag LOCUS_29010 12939 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 13988 15142 gene locus_tag LOCUS_29020 13988 15142 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405736.1 protein_id gnl|my_center|LOCUS_29020 15606 15199 gene locus_tag LOCUS_29030 15606 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 17334 15736 gene locus_tag LOCUS_29040 17334 15736 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_29040 19987 17573 gene locus_tag LOCUS_29050 19987 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 20192 22165 gene locus_tag LOCUS_29060 20192 22165 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_29060 23198 22224 gene locus_tag LOCUS_29070 23198 22224 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_29070 23324 25786 gene locus_tag LOCUS_29080 23324 25786 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_29080 26635 25853 gene locus_tag LOCUS_29090 gene rlmB 26635 25853 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_29090 26828 27235 gene locus_tag LOCUS_29100 26828 27235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767450.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence078 189 632 gene locus_tag LOCUS_29110 189 632 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_29110 639 2687 gene locus_tag LOCUS_29120 639 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3863 2709 gene locus_tag LOCUS_29130 3863 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 5919 3895 gene locus_tag LOCUS_29140 5919 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 6996 6163 gene locus_tag LOCUS_29150 6996 6163 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_29150 8603 6999 gene locus_tag LOCUS_29160 8603 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 12541 8600 gene locus_tag LOCUS_29170 12541 8600 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079042.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29170 12922 12554 gene locus_tag LOCUS_29180 12922 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 14543 13095 gene locus_tag LOCUS_29190 14543 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 17428 14558 gene locus_tag LOCUS_29200 17428 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 19877 17709 gene locus_tag LOCUS_29210 19877 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 20465 23650 gene locus_tag LOCUS_29220 20465 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 26386 23651 gene locus_tag LOCUS_29230 26386 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 <27988 26552 gene locus_tag LOCUS_29240 <27988 26552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658063.1:glycoside hydrolase family 127 protein >Feature sequence079 1702 317 gene locus_tag LOCUS_29250 1702 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3231 1846 gene locus_tag LOCUS_29260 gene glmM 3231 1846 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_29260 3426 7514 gene locus_tag LOCUS_29270 3426 7514 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_29270 7991 9187 gene locus_tag LOCUS_29280 7991 9187 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_29280 9204 10844 gene locus_tag LOCUS_29290 9204 10844 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_29290 10851 11813 gene locus_tag LOCUS_29300 10851 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 11831 13510 gene locus_tag LOCUS_29310 11831 13510 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_29310 13638 13850 gene locus_tag LOCUS_29320 13638 13850 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964571.1 protein_id gnl|my_center|LOCUS_29320 14331 13855 gene locus_tag LOCUS_29330 14331 13855 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_29330 16083 14356 gene locus_tag LOCUS_29340 16083 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 17071 16433 gene locus_tag LOCUS_29350 17071 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 17748 17083 gene locus_tag LOCUS_29360 17748 17083 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_29360 17960 17751 gene locus_tag LOCUS_29370 17960 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 18307 17972 gene locus_tag LOCUS_29380 18307 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 20270 18444 gene locus_tag LOCUS_29390 20270 18444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023577041.1 protein_id gnl|my_center|LOCUS_29390 22610 20289 gene locus_tag LOCUS_29400 22610 20289 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022354.1 protein_id gnl|my_center|LOCUS_29400 23086 22814 gene locus_tag LOCUS_29410 23086 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 23740 23294 gene locus_tag LOCUS_29420 23740 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 25066 23876 gene locus_tag LOCUS_29430 25066 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 26548 25130 gene locus_tag LOCUS_29440 26548 25130 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence080 1750 872 gene locus_tag LOCUS_29450 1750 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2055 4292 gene locus_tag LOCUS_29460 2055 4292 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_29460 4435 5619 gene locus_tag LOCUS_29470 4435 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 5624 7939 gene locus_tag LOCUS_29480 5624 7939 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_29480 9216 7999 gene locus_tag LOCUS_29490 9216 7999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_29490 9378 11015 gene locus_tag LOCUS_29500 9378 11015 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761073.1 protein_id gnl|my_center|LOCUS_29500 11172 12800 gene locus_tag LOCUS_29510 11172 12800 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_29510 12935 13465 gene locus_tag LOCUS_29520 12935 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 13467 13616 gene locus_tag LOCUS_29530 13467 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 14841 13735 gene locus_tag LOCUS_29540 14841 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_29540 15957 14854 gene locus_tag LOCUS_29550 15957 14854 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_29550 17830 16049 gene locus_tag LOCUS_29560 17830 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 19543 17852 gene locus_tag LOCUS_29570 19543 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 19740 20255 gene locus_tag LOCUS_29580 19740 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 21492 20581 gene locus_tag LOCUS_29590 gene rarD 21492 20581 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_29590 21636 22574 gene locus_tag LOCUS_29600 21636 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 <27563 22657 gene locus_tag LOCUS_29610 <27563 22657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence081 164 997 gene locus_tag LOCUS_29620 164 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1075 1377 gene locus_tag LOCUS_29630 1075 1377 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_29630 1407 2645 gene locus_tag LOCUS_29640 1407 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2707 3222 gene locus_tag LOCUS_29650 2707 3222 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_29650 3382 4464 gene locus_tag LOCUS_29660 3382 4464 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_29660 7638 4483 gene locus_tag LOCUS_29670 7638 4483 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_29670 8556 7714 gene locus_tag LOCUS_29680 8556 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 9172 8708 gene locus_tag LOCUS_29690 9172 8708 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705037.1 protein_id gnl|my_center|LOCUS_29690 9408 9713 gene locus_tag LOCUS_29700 gene trxA 9408 9713 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_29700 9755 10144 gene locus_tag LOCUS_29710 9755 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 10634 10188 gene locus_tag LOCUS_29720 10634 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 protein_id gnl|my_center|LOCUS_29720 10949 10862 gene locus_tag LOCUS_t00200 10949 10862 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11043 11456 gene locus_tag LOCUS_29730 11043 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 11505 12185 gene locus_tag LOCUS_29740 11505 12185 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_29740 12340 13047 gene locus_tag LOCUS_29750 12340 13047 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_29750 13126 14004 gene locus_tag LOCUS_29760 13126 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 14140 16188 gene locus_tag LOCUS_29770 gene htpG 14140 16188 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_29770 16797 16279 gene locus_tag LOCUS_29780 16797 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_29780 17028 18167 gene locus_tag LOCUS_29790 17028 18167 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_29790 19046 18492 gene locus_tag LOCUS_29800 19046 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 19819 19304 gene locus_tag LOCUS_29810 19819 19304 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_29810 22408 19889 gene locus_tag LOCUS_29820 22408 19889 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_29820 23172 22423 gene locus_tag LOCUS_29830 23172 22423 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_29830 23847 23185 gene locus_tag LOCUS_29840 23847 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 24638 23847 gene locus_tag LOCUS_29850 24638 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 25583 24702 gene locus_tag LOCUS_29860 25583 24702 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_29860 26266 25601 gene locus_tag LOCUS_29870 26266 25601 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_29870 26351 27070 gene locus_tag LOCUS_29880 26351 27070 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence082 442 1929 gene locus_tag LOCUS_29890 442 1929 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_29890 1964 3268 gene locus_tag LOCUS_29900 1964 3268 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_29900 3347 4660 gene locus_tag LOCUS_29910 3347 4660 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974182.1 protein_id gnl|my_center|LOCUS_29910 5339 4677 gene locus_tag LOCUS_29920 5339 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 6051 5377 gene locus_tag LOCUS_29930 6051 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6820 6074 gene locus_tag LOCUS_29940 6820 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 7012 9168 gene locus_tag LOCUS_29950 7012 9168 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_29950 9319 10545 gene locus_tag LOCUS_29960 9319 10545 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948227.1 protein_id gnl|my_center|LOCUS_29960 10556 13639 gene locus_tag LOCUS_29970 10556 13639 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546332.1 protein_id gnl|my_center|LOCUS_29970 14100 13702 gene locus_tag LOCUS_29980 14100 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 14392 14186 gene locus_tag LOCUS_29990 14392 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 15697 14516 gene locus_tag LOCUS_30000 15697 14516 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 protein_id gnl|my_center|LOCUS_30000 17909 15744 gene locus_tag LOCUS_30010 17909 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 19287 17992 gene locus_tag LOCUS_30020 19287 17992 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568152.1 protein_id gnl|my_center|LOCUS_30020 20759 19626 gene locus_tag LOCUS_30030 gene glf 20759 19626 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 protein_id gnl|my_center|LOCUS_30030 21237 20797 gene locus_tag LOCUS_30040 21237 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 21700 22818 gene locus_tag LOCUS_30050 21700 22818 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975137.1 protein_id gnl|my_center|LOCUS_30050 22925 24061 gene locus_tag LOCUS_30060 22925 24061 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969522.1 protein_id gnl|my_center|LOCUS_30060 24067 25083 gene locus_tag LOCUS_30070 24067 25083 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975138.1 protein_id gnl|my_center|LOCUS_30070 25343 26371 gene locus_tag LOCUS_30080 25343 26371 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969519.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence083 1051 689 gene locus_tag LOCUS_30090 1051 689 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_30090 2291 1281 gene locus_tag LOCUS_30100 gene murB 2291 1281 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_30100 2990 2355 gene locus_tag LOCUS_30110 2990 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3085 5028 gene locus_tag LOCUS_30120 3085 5028 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108748.1 protein_id gnl|my_center|LOCUS_30120 6098 5100 gene locus_tag LOCUS_30130 6098 5100 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_30130 6286 6777 gene locus_tag LOCUS_30140 6286 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 9857 7110 gene locus_tag LOCUS_30150 9857 7110 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_30150 10794 9862 gene locus_tag LOCUS_30160 10794 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 12003 11164 gene locus_tag LOCUS_30170 12003 11164 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169648.1 protein_id gnl|my_center|LOCUS_30170 12578 12015 gene locus_tag LOCUS_30180 12578 12015 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258315.1 protein_id gnl|my_center|LOCUS_30180 13101 12667 gene locus_tag LOCUS_30190 13101 12667 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_30190 14054 13170 gene locus_tag LOCUS_30200 14054 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 14553 15644 gene locus_tag LOCUS_30210 14553 15644 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_30210 15713 17074 gene locus_tag LOCUS_30220 15713 17074 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_30220 17064 18395 gene locus_tag LOCUS_30230 17064 18395 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_30230 19738 18425 gene locus_tag LOCUS_30240 19738 18425 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_30240 20734 19799 gene locus_tag LOCUS_30250 20734 19799 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_30250 21772 20822 gene locus_tag LOCUS_30260 21772 20822 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_30260 23725 21938 gene locus_tag LOCUS_30270 gene lepA 23725 21938 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_30270 24100 24495 gene locus_tag LOCUS_30280 24100 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 25521 24553 gene locus_tag LOCUS_30290 25521 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 25978 25667 gene locus_tag LOCUS_30300 25978 25667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 26211 25969 gene locus_tag LOCUS_30310 26211 25969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 <27308 26289 gene locus_tag LOCUS_30320 <27308 26289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286016.1:glycoside hydrolase family 88 protein >Feature sequence084 927 1925 gene locus_tag LOCUS_30330 927 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2205 3698 gene locus_tag LOCUS_30340 2205 3698 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_30340 4653 3766 gene locus_tag LOCUS_30350 4653 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 5062 6858 gene locus_tag LOCUS_30360 gene argS 5062 6858 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_30360 6913 8241 gene locus_tag LOCUS_30370 gene ffh 6913 8241 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_30370 8251 9123 gene locus_tag LOCUS_30380 gene folD 8251 9123 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_30380 9188 9418 gene locus_tag LOCUS_30390 9188 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 9420 9719 gene locus_tag LOCUS_30400 9420 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 9868 11274 gene locus_tag LOCUS_30410 9868 11274 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_30410 11315 12100 gene locus_tag LOCUS_30420 11315 12100 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_30420 12214 12468 gene locus_tag LOCUS_30430 12214 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 12549 13295 gene locus_tag LOCUS_30440 12549 13295 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_30440 13325 14053 gene locus_tag LOCUS_30450 13325 14053 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_30450 14114 15436 gene locus_tag LOCUS_30460 14114 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 19264 16091 gene locus_tag LOCUS_30470 19264 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 20055 19543 gene locus_tag LOCUS_30480 20055 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 21601 20087 gene locus_tag LOCUS_30490 21601 20087 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_30490 24820 21620 gene locus_tag LOCUS_30500 24820 21620 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_30500 25935 25099 gene locus_tag LOCUS_30510 25935 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 <26682 25961 gene locus_tag LOCUS_30520 <26682 25961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405561.1:SusD/RagB family nutrient-binding outer membrane lipoprotein >Feature sequence085 2993 2049 gene locus_tag LOCUS_30530 2993 2049 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_30530 3218 3997 gene locus_tag LOCUS_30540 3218 3997 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_30540 4722 7379 gene locus_tag LOCUS_30550 4722 7379 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_30550 7405 9690 gene locus_tag LOCUS_30560 7405 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 9701 11971 gene locus_tag LOCUS_30570 9701 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 12041 13006 gene locus_tag LOCUS_30580 12041 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 13166 13858 gene locus_tag LOCUS_30590 13166 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 14728 13910 gene locus_tag LOCUS_30600 14728 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30600 15463 14747 gene locus_tag LOCUS_30610 15463 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30610 16128 15547 gene locus_tag LOCUS_30620 16128 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 16304 16444 gene locus_tag LOCUS_30630 16304 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 17623 16544 gene locus_tag LOCUS_30640 17623 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 18386 17769 gene locus_tag LOCUS_30650 18386 17769 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_30650 19462 18395 gene locus_tag LOCUS_30660 19462 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 22370 20244 gene locus_tag LOCUS_30670 22370 20244 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_30670 23656 22586 gene locus_tag LOCUS_30680 gene recA 23656 22586 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_30680 24147 23683 gene locus_tag LOCUS_30690 gene bcp 24147 23683 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_30690 24369 26162 gene locus_tag LOCUS_30700 24369 26162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence086 71 1201 gene locus_tag LOCUS_30710 71 1201 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969524.1 protein_id gnl|my_center|LOCUS_30710 1472 2545 gene locus_tag LOCUS_30720 1472 2545 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969525.1 protein_id gnl|my_center|LOCUS_30720 2561 3658 gene locus_tag LOCUS_30730 2561 3658 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969526.1 protein_id gnl|my_center|LOCUS_30730 4517 3735 gene locus_tag LOCUS_30740 4517 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 5139 4519 gene locus_tag LOCUS_30750 5139 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 6188 5151 gene locus_tag LOCUS_30760 6188 5151 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_30760 7359 6739 gene locus_tag LOCUS_30770 gene recR 7359 6739 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_30770 8841 7498 gene locus_tag LOCUS_30780 8841 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 9421 8879 gene locus_tag LOCUS_30790 9421 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 9962 11419 gene locus_tag LOCUS_30800 9962 11419 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_30800 12230 11394 gene locus_tag LOCUS_30810 12230 11394 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021858.1 protein_id gnl|my_center|LOCUS_30810 12493 13566 gene locus_tag LOCUS_30820 12493 13566 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_30820 14630 13560 gene locus_tag LOCUS_30830 14630 13560 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_30830 15673 14627 gene locus_tag LOCUS_30840 15673 14627 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_30840 16533 15685 gene locus_tag LOCUS_30850 gene menA 16533 15685 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_30850 17601 16780 gene locus_tag LOCUS_30860 gene menB 17601 16780 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_30860 19280 17598 gene locus_tag LOCUS_30870 gene menD 19280 17598 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_30870 20413 19277 gene locus_tag LOCUS_30880 20413 19277 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_30880 20834 20421 gene locus_tag LOCUS_30890 20834 20421 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_30890 21142 22080 gene locus_tag LOCUS_30900 21142 22080 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_30900 23368 22112 gene locus_tag LOCUS_30910 23368 22112 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_30910 24425 23712 gene locus_tag LOCUS_30920 24425 23712 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_30920 25344 24427 gene locus_tag LOCUS_30930 25344 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence087 503 81 gene locus_tag LOCUS_30940 503 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 922 506 gene locus_tag LOCUS_30950 922 506 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_30950 1716 1099 gene locus_tag LOCUS_30960 1716 1099 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_30960 2560 1877 gene locus_tag LOCUS_30970 2560 1877 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626248.1 protein_id gnl|my_center|LOCUS_30970 2772 4010 gene locus_tag LOCUS_30980 2772 4010 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_30980 4021 4686 gene locus_tag LOCUS_30990 4021 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4856 5167 gene locus_tag LOCUS_31000 4856 5167 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_31000 5196 5702 gene locus_tag LOCUS_31010 5196 5702 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_31010 6189 5782 gene locus_tag LOCUS_31020 6189 5782 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765767.1 protein_id gnl|my_center|LOCUS_31020 6582 7571 gene locus_tag LOCUS_31030 6582 7571 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_31030 8975 7563 gene locus_tag LOCUS_31040 8975 7563 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_31040 9170 10570 gene locus_tag LOCUS_31050 9170 10570 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_31050 11550 11119 gene locus_tag LOCUS_31060 11550 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 11979 11629 gene locus_tag LOCUS_31070 11979 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 12574 12263 gene locus_tag LOCUS_31080 12574 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 18443 12594 gene locus_tag LOCUS_31090 18443 12594 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179297780.1 protein_id gnl|my_center|LOCUS_31090 19629 18472 gene locus_tag LOCUS_31100 19629 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 20135 19722 gene locus_tag LOCUS_31110 20135 19722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 21190 21540 gene locus_tag LOCUS_31120 gene rpsF 21190 21540 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_31120 21544 21813 gene locus_tag LOCUS_31130 gene rpsR 21544 21813 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_31130 21832 22281 gene locus_tag LOCUS_31140 gene rplI 21832 22281 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_31140 22806 22429 gene locus_tag LOCUS_31150 22806 22429 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_31150 24018 22984 gene locus_tag LOCUS_31160 gene asnA 24018 22984 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_31160 25120 24359 gene locus_tag LOCUS_31170 25120 24359 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_31170 25210 25911 gene locus_tag LOCUS_31180 25210 25911 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence088 327 1130 gene locus_tag LOCUS_31190 327 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1255 2076 gene locus_tag LOCUS_31200 1255 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3399 2146 gene locus_tag LOCUS_31210 3399 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 4251 3499 gene locus_tag LOCUS_31220 4251 3499 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_31220 4787 8017 gene locus_tag LOCUS_31230 4787 8017 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_31230 8046 9881 gene locus_tag LOCUS_31240 8046 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 10022 11320 gene locus_tag LOCUS_31250 10022 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 11463 11612 gene locus_tag LOCUS_31260 11463 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 12025 11810 gene locus_tag LOCUS_31270 12025 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 11976 13595 gene locus_tag LOCUS_31280 11976 13595 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_31280 16573 14168 gene locus_tag LOCUS_31290 16573 14168 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_31290 17352 16612 gene locus_tag LOCUS_31300 17352 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 19024 17480 gene locus_tag LOCUS_31310 19024 17480 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_31310 21865 19271 gene locus_tag LOCUS_31320 21865 19271 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_31320 24328 21902 gene locus_tag LOCUS_31330 24328 21902 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_31330 25685 24522 gene locus_tag LOCUS_31340 25685 24522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence089 2015 2506 gene locus_tag LOCUS_31350 2015 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2845 3894 gene locus_tag LOCUS_31360 2845 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3891 4643 gene locus_tag LOCUS_31370 3891 4643 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_31370 5355 4894 gene locus_tag LOCUS_31380 gene tnpA 5355 4894 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_31380 5850 8459 gene locus_tag LOCUS_31390 5850 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 8505 9284 gene locus_tag LOCUS_31400 8505 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 9330 9764 gene locus_tag LOCUS_31410 9330 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 9911 10768 gene locus_tag LOCUS_31420 9911 10768 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_31420 10963 11412 gene locus_tag LOCUS_31430 10963 11412 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039007.1 protein_id gnl|my_center|LOCUS_31430 13296 11656 gene locus_tag LOCUS_31440 13296 11656 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_31440 15379 13334 gene locus_tag LOCUS_31450 gene ganA 15379 13334 CDS product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 protein_id gnl|my_center|LOCUS_31450 17256 15415 gene locus_tag LOCUS_31460 17256 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 19106 17601 gene locus_tag LOCUS_31470 19106 17601 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039046.1 protein_id gnl|my_center|LOCUS_31470 19617 24320 gene locus_tag LOCUS_31480 19617 24320 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_31480 25603 24563 gene locus_tag LOCUS_31490 25603 24563 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_31490 25761 26063 gene locus_tag LOCUS_31500 25761 26063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence090 74 2230 gene locus_tag LOCUS_31510 74 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 2482 6522 gene locus_tag LOCUS_31520 2482 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 7499 6594 gene locus_tag LOCUS_31530 7499 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 8834 7617 gene locus_tag LOCUS_31540 8834 7617 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962531.1 protein_id gnl|my_center|LOCUS_31540 10325 8856 gene locus_tag LOCUS_31550 10325 8856 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_31550 13002 10393 gene locus_tag LOCUS_31560 13002 10393 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_31560 14412 13438 gene locus_tag LOCUS_31570 14412 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 15553 14417 gene locus_tag LOCUS_31580 15553 14417 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262601.1 protein_id gnl|my_center|LOCUS_31580 16190 15621 gene locus_tag LOCUS_31590 16190 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 17247 16336 gene locus_tag LOCUS_31600 17247 16336 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_31600 17465 18037 gene locus_tag LOCUS_31610 17465 18037 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_31610 18859 18128 gene locus_tag LOCUS_31620 18859 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 19053 19508 gene locus_tag LOCUS_31630 19053 19508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 19619 20419 gene locus_tag LOCUS_31640 19619 20419 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525218.1 protein_id gnl|my_center|LOCUS_31640 20482 21393 gene locus_tag LOCUS_31650 20482 21393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 21451 21621 gene locus_tag LOCUS_31660 21451 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 21746 23782 gene locus_tag LOCUS_31670 21746 23782 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_31670 25464 23938 gene locus_tag LOCUS_31680 25464 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 25873 25484 gene locus_tag LOCUS_31690 25873 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence091 4110 3052 gene locus_tag LOCUS_31700 4110 3052 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_31700 4854 4288 gene locus_tag LOCUS_31710 4854 4288 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_31710 6209 5133 gene locus_tag LOCUS_31720 6209 5133 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_31720 7459 6407 gene locus_tag LOCUS_31730 7459 6407 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_31730 9576 7612 gene locus_tag LOCUS_31740 9576 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 10612 9596 gene locus_tag LOCUS_31750 10612 9596 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217731.1 protein_id gnl|my_center|LOCUS_31750 12349 10805 gene locus_tag LOCUS_31760 12349 10805 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_31760 15686 12366 gene locus_tag LOCUS_31770 15686 12366 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_31770 16972 15890 gene locus_tag LOCUS_31780 16972 15890 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_31780 17926 17366 gene locus_tag LOCUS_31790 17926 17366 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_31790 18700 19500 gene locus_tag LOCUS_31800 18700 19500 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_31800 19579 21141 gene locus_tag LOCUS_31810 19579 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 21204 22067 gene locus_tag LOCUS_31820 21204 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 22842 22072 gene locus_tag LOCUS_31830 22842 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 22975 23406 gene locus_tag LOCUS_31840 22975 23406 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_31840 23418 24404 gene locus_tag LOCUS_31850 23418 24404 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence092 552 163 gene locus_tag LOCUS_31860 552 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 1061 510 gene locus_tag LOCUS_31870 1061 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2212 1127 gene locus_tag LOCUS_31880 2212 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2618 2181 gene locus_tag LOCUS_31890 2618 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3367 2618 gene locus_tag LOCUS_31900 3367 2618 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_31900 3609 3370 gene locus_tag LOCUS_31910 3609 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 4050 3619 gene locus_tag LOCUS_31920 4050 3619 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_31920 4989 4087 gene locus_tag LOCUS_31930 4989 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 5931 4993 gene locus_tag LOCUS_31940 5931 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 7133 5931 gene locus_tag LOCUS_31950 7133 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 7443 7135 gene locus_tag LOCUS_31960 7443 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 7764 7522 gene locus_tag LOCUS_31970 7764 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 8057 7746 gene locus_tag LOCUS_31980 8057 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 8229 8576 gene locus_tag LOCUS_31990 8229 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 9862 8687 gene locus_tag LOCUS_32000 9862 8687 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202365.1 protein_id gnl|my_center|LOCUS_32000 10127 10053 gene locus_tag LOCUS_t00210 10127 10053 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12854 10275 gene locus_tag LOCUS_32010 12854 10275 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_32010 12929 14143 gene locus_tag LOCUS_32020 12929 14143 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_32020 14161 15093 gene locus_tag LOCUS_32030 14161 15093 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_32030 15427 16848 gene locus_tag LOCUS_32040 gene dnaA 15427 16848 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_32040 16912 17547 gene locus_tag LOCUS_32050 16912 17547 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_32050 17550 18458 gene locus_tag LOCUS_32060 gene pyrB 17550 18458 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_32060 18470 18925 gene locus_tag LOCUS_32070 gene pyrI 18470 18925 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_32070 19443 18991 gene locus_tag LOCUS_32080 19443 18991 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_32080 19620 20492 gene locus_tag LOCUS_32090 19620 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 20623 23970 gene locus_tag LOCUS_32100 20623 23970 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_32100 >Feature sequence093 235 2004 gene locus_tag LOCUS_32110 235 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 2018 3013 gene locus_tag LOCUS_32120 2018 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 3070 3720 gene locus_tag LOCUS_32130 3070 3720 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_32130 3790 4413 gene locus_tag LOCUS_32140 3790 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_32140 4417 5247 gene locus_tag LOCUS_32150 4417 5247 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_32150 5357 6577 gene locus_tag LOCUS_32160 5357 6577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114846.1 protein_id gnl|my_center|LOCUS_32160 6589 7968 gene locus_tag LOCUS_32170 6589 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 7965 8795 gene locus_tag LOCUS_32180 7965 8795 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_32180 8874 10022 gene locus_tag LOCUS_32190 8874 10022 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968364.1 protein_id gnl|my_center|LOCUS_32190 10026 10796 gene locus_tag LOCUS_32200 10026 10796 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_32200 11598 10855 gene locus_tag LOCUS_32210 11598 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 11722 12987 gene locus_tag LOCUS_32220 11722 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 13671 13114 gene locus_tag LOCUS_32230 13671 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 13894 15036 gene locus_tag LOCUS_32240 13894 15036 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_32240 15056 17668 gene locus_tag LOCUS_32250 15056 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 17784 19700 gene locus_tag LOCUS_32260 17784 19700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 19903 21483 gene locus_tag LOCUS_32270 19903 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 21633 23906 gene locus_tag LOCUS_32280 21633 23906 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_32280 <24713 23971 gene locus_tag LOCUS_32290 <24713 23971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941949.1:methyl-accepting chemotaxis protein >Feature sequence094 1226 474 gene locus_tag LOCUS_32300 1226 474 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 protein_id gnl|my_center|LOCUS_32300 2012 1272 gene locus_tag LOCUS_32310 2012 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329945.1 protein_id gnl|my_center|LOCUS_32310 3844 2033 gene locus_tag LOCUS_32320 gene treZ 3844 2033 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_32320 5474 3882 gene locus_tag LOCUS_32330 5474 3882 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_32330 6310 5537 gene locus_tag LOCUS_32340 6310 5537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_32340 6948 6376 gene locus_tag LOCUS_32350 6948 6376 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_32350 7399 6953 gene locus_tag LOCUS_32360 7399 6953 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225950675.1 protein_id gnl|my_center|LOCUS_32360 8045 7410 gene locus_tag LOCUS_32370 8045 7410 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702318.1 protein_id gnl|my_center|LOCUS_32370 8907 8080 gene locus_tag LOCUS_32380 8907 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 9920 9024 gene locus_tag LOCUS_32390 9920 9024 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_32390 10266 9886 gene locus_tag LOCUS_32400 10266 9886 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 protein_id gnl|my_center|LOCUS_32400 10814 10377 gene locus_tag LOCUS_32410 10814 10377 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_32410 11943 10894 gene locus_tag LOCUS_32420 gene ilvC 11943 10894 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_32420 12594 12049 gene locus_tag LOCUS_32430 gene ilvN 12594 12049 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_32430 14387 12648 gene locus_tag LOCUS_32440 gene ilvB 14387 12648 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_32440 16189 14405 gene locus_tag LOCUS_32450 gene ilvD 16189 14405 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_32450 16647 16720 gene locus_tag LOCUS_t00220 16647 16720 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17208 18530 gene locus_tag LOCUS_32460 17208 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 18648 19058 gene locus_tag LOCUS_32470 18648 19058 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_32470 19062 19910 gene locus_tag LOCUS_32480 19062 19910 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_32480 19907 20902 gene locus_tag LOCUS_32490 19907 20902 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_32490 21990 21214 gene locus_tag LOCUS_32500 21990 21214 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948734.1 protein_id gnl|my_center|LOCUS_32500 22068 22817 gene locus_tag LOCUS_32510 22068 22817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 23652 22819 gene locus_tag LOCUS_32520 gene murI 23652 22819 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108947.1 protein_id gnl|my_center|LOCUS_32520 24154 23687 gene locus_tag LOCUS_32530 24154 23687 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence095 <1 4335 gene locus_tag LOCUS_32540 <1 4335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202408.1:MG2 domain-containing protein 4410 6758 gene locus_tag LOCUS_32550 gene pbpC 4410 6758 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_32550 7356 6964 gene locus_tag LOCUS_32560 gene rnpA 7356 6964 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_32560 8161 7361 gene locus_tag LOCUS_32570 8161 7361 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_32570 9366 8197 gene locus_tag LOCUS_32580 9366 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 9779 9444 gene locus_tag LOCUS_32590 9779 9444 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_32590 10228 9779 gene locus_tag LOCUS_32600 gene dtd 10228 9779 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_32600 13197 10228 gene locus_tag LOCUS_32610 13197 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 15813 13426 gene locus_tag LOCUS_32620 15813 13426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_32620 16519 15833 gene locus_tag LOCUS_32630 16519 15833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_32630 16671 18035 gene locus_tag LOCUS_32640 16671 18035 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_32640 18025 19371 gene locus_tag LOCUS_32650 18025 19371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_32650 19565 19819 gene locus_tag LOCUS_32660 19565 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_32660 19977 21578 gene locus_tag LOCUS_32670 19977 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 21589 21981 gene locus_tag LOCUS_32680 21589 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 22654 21938 gene locus_tag LOCUS_32690 22654 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 23079 22651 gene locus_tag LOCUS_32700 23079 22651 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_32700 23935 23087 gene locus_tag LOCUS_32710 23935 23087 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence096 1156 407 gene locus_tag LOCUS_32720 1156 407 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_32720 2667 1165 gene locus_tag LOCUS_32730 2667 1165 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_32730 4096 2669 gene locus_tag LOCUS_32740 4096 2669 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_32740 4739 4110 gene locus_tag LOCUS_32750 4739 4110 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_32750 5668 4751 gene locus_tag LOCUS_32760 5668 4751 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_32760 7695 5671 gene locus_tag LOCUS_32770 7695 5671 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_32770 9268 7700 gene locus_tag LOCUS_32780 9268 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 9405 9716 gene locus_tag LOCUS_32790 9405 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 10004 11389 gene locus_tag LOCUS_32800 10004 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 11466 12014 gene locus_tag LOCUS_32810 11466 12014 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_32810 12057 12509 gene locus_tag LOCUS_32820 12057 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 12511 12969 gene locus_tag LOCUS_32830 12511 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_32830 14445 13090 gene locus_tag LOCUS_32840 gene hisS 14445 13090 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_32840 16315 14639 gene locus_tag LOCUS_32850 gene ettA 16315 14639 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_32850 16395 17426 gene locus_tag LOCUS_32860 16395 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 18330 17476 gene locus_tag LOCUS_32870 18330 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 19379 18522 gene locus_tag LOCUS_32880 19379 18522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 20151 19390 gene locus_tag LOCUS_32890 20151 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 20340 22079 gene locus_tag LOCUS_32900 20340 22079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 <24129 22229 gene locus_tag LOCUS_32910 <24129 22229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence097 316 1731 gene locus_tag LOCUS_32920 316 1731 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_32920 3402 1786 gene locus_tag LOCUS_32930 3402 1786 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_32930 4009 10203 gene locus_tag LOCUS_32940 4009 10203 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_32940 10296 10685 gene locus_tag LOCUS_32950 10296 10685 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_32950 11092 11742 gene locus_tag LOCUS_32960 11092 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 13814 11958 gene locus_tag LOCUS_32970 13814 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 14067 14381 gene locus_tag LOCUS_32980 14067 14381 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_32980 14987 14382 gene locus_tag LOCUS_32990 14987 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 15467 15072 gene locus_tag LOCUS_33000 15467 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 15735 16928 gene locus_tag LOCUS_33010 15735 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 16994 17698 gene locus_tag LOCUS_33020 16994 17698 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107771.1 protein_id gnl|my_center|LOCUS_33020 17872 18429 gene locus_tag LOCUS_33030 17872 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 18612 21551 gene locus_tag LOCUS_33040 18612 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 21560 22012 gene locus_tag LOCUS_33050 21560 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 22022 22786 gene locus_tag LOCUS_33060 22022 22786 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence098 4352 2544 gene locus_tag LOCUS_33070 4352 2544 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_33070 7857 4357 gene locus_tag LOCUS_33080 7857 4357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_33080 9154 8039 gene locus_tag LOCUS_33090 9154 8039 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_33090 9771 9208 gene locus_tag LOCUS_33100 9771 9208 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797529.1 protein_id gnl|my_center|LOCUS_33100 10663 9953 gene locus_tag LOCUS_33110 10663 9953 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_33110 10904 13981 gene locus_tag LOCUS_33120 10904 13981 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_33120 14018 15691 gene locus_tag LOCUS_33130 14018 15691 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_33130 17072 15696 gene locus_tag LOCUS_33140 17072 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 17037 17213 gene locus_tag LOCUS_33150 17037 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 17361 17807 gene locus_tag LOCUS_33160 17361 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 18053 20020 gene locus_tag LOCUS_33170 gene gyrB 18053 20020 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_33170 21326 20076 gene locus_tag LOCUS_33180 21326 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 21454 21891 gene locus_tag LOCUS_33190 21454 21891 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209946.1 protein_id gnl|my_center|LOCUS_33190 22361 21888 gene locus_tag LOCUS_33200 22361 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 22555 22986 gene locus_tag LOCUS_33210 22555 22986 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_33210 22998 23612 gene locus_tag LOCUS_33220 22998 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence099 838 440 gene locus_tag LOCUS_33230 838 440 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_33230 1484 909 gene locus_tag LOCUS_33240 1484 909 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_33240 1860 2237 gene locus_tag LOCUS_33250 1860 2237 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_33250 2404 3804 gene locus_tag LOCUS_33260 2404 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3809 5005 gene locus_tag LOCUS_33270 3809 5005 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766015.1 protein_id gnl|my_center|LOCUS_33270 5141 6178 gene locus_tag LOCUS_33280 5141 6178 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_33280 6153 7406 gene locus_tag LOCUS_33290 6153 7406 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_33290 7410 8360 gene locus_tag LOCUS_33300 gene fmt 7410 8360 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109030.1 protein_id gnl|my_center|LOCUS_33300 8659 9981 gene locus_tag LOCUS_33310 gene creD 8659 9981 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_33310 10850 10044 gene locus_tag LOCUS_33320 10850 10044 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764605.1 protein_id gnl|my_center|LOCUS_33320 12461 10953 gene locus_tag LOCUS_33330 12461 10953 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_33330 13537 12599 gene locus_tag LOCUS_33340 13537 12599 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_33340 14439 13564 gene locus_tag LOCUS_33350 gene cntI 14439 13564 CDS product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_33350 15563 14562 gene locus_tag LOCUS_33360 15563 14562 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_33360 17054 15570 gene locus_tag LOCUS_33370 17054 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33370 17890 17051 gene locus_tag LOCUS_33380 17890 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33380 18605 18000 gene locus_tag LOCUS_33390 18605 18000 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_33390 19206 18706 gene locus_tag LOCUS_33400 gene tpx 19206 18706 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_33400 19484 20011 gene locus_tag LOCUS_33410 19484 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 20209 21588 gene locus_tag LOCUS_33420 20209 21588 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence100 1733 264 gene locus_tag LOCUS_33430 1733 264 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_33430 1804 2019 gene locus_tag LOCUS_33440 1804 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 4391 2466 gene locus_tag LOCUS_33450 4391 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 7121 4413 gene locus_tag LOCUS_33460 7121 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 10076 7254 gene locus_tag LOCUS_33470 10076 7254 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_33470 10280 10789 gene locus_tag LOCUS_33480 10280 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 10904 11581 gene locus_tag LOCUS_33490 10904 11581 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_33490 12340 11687 gene locus_tag LOCUS_33500 12340 11687 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947229.1 protein_id gnl|my_center|LOCUS_33500 12490 12966 gene locus_tag LOCUS_33510 12490 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 13073 13597 gene locus_tag LOCUS_33520 13073 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 13603 14172 gene locus_tag LOCUS_33530 13603 14172 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_33530 14375 14944 gene locus_tag LOCUS_33540 14375 14944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 14960 16477 gene locus_tag LOCUS_33550 14960 16477 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_33550 16613 17080 gene locus_tag LOCUS_33560 16613 17080 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_33560 17151 18917 gene locus_tag LOCUS_33570 17151 18917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 protein_id gnl|my_center|LOCUS_33570 19015 19521 gene locus_tag LOCUS_33580 19015 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 19525 19938 gene locus_tag LOCUS_33590 gene arfB 19525 19938 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_33590 20046 21038 gene locus_tag LOCUS_33600 20046 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 22087 21116 gene locus_tag LOCUS_33610 22087 21116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 23141 22149 gene locus_tag LOCUS_33620 23141 22149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_33620 23416 23489 gene locus_tag LOCUS_t00230 23416 23489 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 149 784 gene locus_tag LOCUS_33630 149 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 890 1642 gene locus_tag LOCUS_33640 890 1642 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_33640 1666 3864 gene locus_tag LOCUS_33650 1666 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3879 5084 gene locus_tag LOCUS_33660 3879 5084 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 protein_id gnl|my_center|LOCUS_33660 5118 8399 gene locus_tag LOCUS_33670 5118 8399 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076455918.1 protein_id gnl|my_center|LOCUS_33670 8418 9935 gene locus_tag LOCUS_33680 8418 9935 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_33680 10117 12387 gene locus_tag LOCUS_33690 10117 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 13043 12384 gene locus_tag LOCUS_33700 gene elbB 13043 12384 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174227.1 protein_id gnl|my_center|LOCUS_33700 14174 13068 gene locus_tag LOCUS_33710 14174 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 14337 15539 gene locus_tag LOCUS_33720 14337 15539 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_33720 16066 17535 gene locus_tag LOCUS_33730 16066 17535 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_33730 17544 18671 gene locus_tag LOCUS_33740 17544 18671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 18705 20192 gene locus_tag LOCUS_33750 18705 20192 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_33750 20485 21822 gene locus_tag LOCUS_33760 20485 21822 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_33760 21865 22236 gene locus_tag LOCUS_33770 21865 22236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 22795 22310 gene locus_tag LOCUS_33780 22795 22310 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence102 158 1228 gene locus_tag LOCUS_33790 158 1228 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_33790 2104 1217 gene locus_tag LOCUS_33800 2104 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256555.1 protein_id gnl|my_center|LOCUS_33800 2257 5037 gene locus_tag LOCUS_33810 2257 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_33810 5821 5204 gene locus_tag LOCUS_33820 5821 5204 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 protein_id gnl|my_center|LOCUS_33820 6358 5924 gene locus_tag LOCUS_33830 6358 5924 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_33830 6527 8587 gene locus_tag LOCUS_33840 6527 8587 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_33840 9194 9619 gene locus_tag LOCUS_33850 9194 9619 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_33850 9796 11019 gene locus_tag LOCUS_33860 9796 11019 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_33860 11120 12436 gene locus_tag LOCUS_33870 11120 12436 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_33870 12792 13862 gene locus_tag LOCUS_33880 12792 13862 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_33880 13867 14649 gene locus_tag LOCUS_33890 13867 14649 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_33890 14661 15221 gene locus_tag LOCUS_33900 14661 15221 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_33900 15853 15299 gene locus_tag LOCUS_33910 15853 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 16142 16651 gene locus_tag LOCUS_33920 16142 16651 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_33920 16644 17249 gene locus_tag LOCUS_33930 16644 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 17399 17794 gene locus_tag LOCUS_33940 17399 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 18301 17819 gene locus_tag LOCUS_33950 18301 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 18651 18304 gene locus_tag LOCUS_33960 18651 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 19319 18726 gene locus_tag LOCUS_33970 19319 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 19912 19304 gene locus_tag LOCUS_33980 19912 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 20497 20015 gene locus_tag LOCUS_33990 20497 20015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 22368 20515 gene locus_tag LOCUS_34000 22368 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence103 1951 746 gene locus_tag LOCUS_34010 gene pstC 1951 746 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788582.1 protein_id gnl|my_center|LOCUS_34010 2802 1972 gene locus_tag LOCUS_34020 2802 1972 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_34020 4151 2850 gene locus_tag LOCUS_34030 4151 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4362 5954 gene locus_tag LOCUS_34040 4362 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 6399 7169 gene locus_tag LOCUS_34050 6399 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 7188 8006 gene locus_tag LOCUS_34060 7188 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 9292 8132 gene locus_tag LOCUS_34070 9292 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 9387 9821 gene locus_tag LOCUS_34080 9387 9821 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_34080 9821 10465 gene locus_tag LOCUS_34090 gene folE 9821 10465 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_34090 10531 12369 gene locus_tag LOCUS_34100 10531 12369 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107187.1 protein_id gnl|my_center|LOCUS_34100 12469 12855 gene locus_tag LOCUS_34110 12469 12855 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 protein_id gnl|my_center|LOCUS_34110 12840 13523 gene locus_tag LOCUS_34120 12840 13523 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_34120 13539 14345 gene locus_tag LOCUS_34130 13539 14345 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_34130 14526 14981 gene locus_tag LOCUS_34140 14526 14981 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904694.1 protein_id gnl|my_center|LOCUS_34140 16805 15087 gene locus_tag LOCUS_34150 16805 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 18184 16871 gene locus_tag LOCUS_34160 gene hutI 18184 16871 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_34160 18850 18437 gene locus_tag LOCUS_34170 18850 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 20671 18965 gene locus_tag LOCUS_34180 gene hutU 20671 18965 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_34180 <22205 20640 gene locus_tag LOCUS_34190 <22205 20640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838340.1:histidine ammonia-lyase >Feature sequence104 683 360 gene locus_tag LOCUS_34200 683 360 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_34200 1491 706 gene locus_tag LOCUS_34210 gene bamD 1491 706 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_34210 2173 1649 gene locus_tag LOCUS_34220 2173 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3655 2285 gene locus_tag LOCUS_34230 3655 2285 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_34230 3906 4319 gene locus_tag LOCUS_34240 3906 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 5142 4339 gene locus_tag LOCUS_34250 5142 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 6410 5298 gene locus_tag LOCUS_34260 gene ald 6410 5298 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_34260 7258 6878 gene locus_tag LOCUS_34270 7258 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 9634 7538 gene locus_tag LOCUS_34280 9634 7538 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_34280 10157 9819 gene locus_tag LOCUS_34290 10157 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 10922 11929 gene locus_tag LOCUS_34300 10922 11929 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727112.1 protein_id gnl|my_center|LOCUS_34300 11942 12445 gene locus_tag LOCUS_34310 11942 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 13210 12509 gene locus_tag LOCUS_34320 13210 12509 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_34320 13432 16752 gene locus_tag LOCUS_34330 13432 16752 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202526.1 protein_id gnl|my_center|LOCUS_34330 16818 18350 gene locus_tag LOCUS_34340 16818 18350 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659443.1 protein_id gnl|my_center|LOCUS_34340 18542 20152 gene locus_tag LOCUS_34350 18542 20152 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786655.1 protein_id gnl|my_center|LOCUS_34350 20181 21095 gene locus_tag LOCUS_34360 20181 21095 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_34360 >Feature sequence105 472 1407 gene locus_tag LOCUS_34370 472 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 1513 3870 gene locus_tag LOCUS_34380 1513 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4726 3926 gene locus_tag LOCUS_34390 gene lpxA 4726 3926 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_34390 6151 4751 gene locus_tag LOCUS_34400 6151 4751 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_34400 7287 6259 gene locus_tag LOCUS_34410 gene lpxD 7287 6259 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_34410 7514 8203 gene locus_tag LOCUS_34420 7514 8203 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_34420 10215 8263 gene locus_tag LOCUS_34430 10215 8263 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_34430 10470 12158 gene locus_tag LOCUS_34440 10470 12158 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870510.1 protein_id gnl|my_center|LOCUS_34440 12169 13923 gene locus_tag LOCUS_34450 12169 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 14364 13945 gene locus_tag LOCUS_34460 14364 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 14935 14354 gene locus_tag LOCUS_34470 14935 14354 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_34470 15068 15394 gene locus_tag LOCUS_34480 15068 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 16690 15449 gene locus_tag LOCUS_34490 16690 15449 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785125.1 protein_id gnl|my_center|LOCUS_34490 16829 17257 gene locus_tag LOCUS_34500 16829 17257 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_34500 17355 17660 gene locus_tag LOCUS_34510 17355 17660 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_34510 17716 18636 gene locus_tag LOCUS_34520 gene queG 17716 18636 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_34520 18688 19614 gene locus_tag LOCUS_34530 18688 19614 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_34530 21038 19974 gene locus_tag LOCUS_34540 gene rsgA 21038 19974 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107648.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence106 <1 3293 gene locus_tag LOCUS_34550 <1 3293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080135.1:beta-galactosidase LacZ 4190 7369 gene locus_tag LOCUS_34560 4190 7369 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767190.1 protein_id gnl|my_center|LOCUS_34560 7388 9313 gene locus_tag LOCUS_34570 7388 9313 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109121.1 protein_id gnl|my_center|LOCUS_34570 9334 10512 gene locus_tag LOCUS_34580 9334 10512 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_34580 10542 11210 gene locus_tag LOCUS_34590 10542 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 11316 11918 gene locus_tag LOCUS_34600 11316 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 12082 15060 gene locus_tag LOCUS_34610 12082 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 15100 17577 gene locus_tag LOCUS_34620 15100 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 17574 20906 gene locus_tag LOCUS_34630 17574 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence107 4669 2363 gene locus_tag LOCUS_34640 4669 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 6404 4680 gene locus_tag LOCUS_34650 6404 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 8383 6416 gene locus_tag LOCUS_34660 8383 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 9649 8420 gene locus_tag LOCUS_34670 9649 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 11637 9925 gene locus_tag LOCUS_34680 11637 9925 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_34680 14942 11649 gene locus_tag LOCUS_34690 14942 11649 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_34690 16315 15176 gene locus_tag LOCUS_34700 16315 15176 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_34700 16992 16381 gene locus_tag LOCUS_34710 16992 16381 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_34710 17157 18209 gene locus_tag LOCUS_34720 17157 18209 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_34720 18249 18821 gene locus_tag LOCUS_34730 18249 18821 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_34730 18888 20039 gene locus_tag LOCUS_34740 18888 20039 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence108 174 100 gene locus_tag LOCUS_t00240 174 100 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 463 918 gene locus_tag LOCUS_34750 463 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1328 1771 gene locus_tag LOCUS_34760 1328 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1894 2187 gene locus_tag LOCUS_34770 1894 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2174 2608 gene locus_tag LOCUS_34780 2174 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2624 3250 gene locus_tag LOCUS_34790 2624 3250 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_34790 4063 3383 gene locus_tag LOCUS_34800 4063 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787535.1 protein_id gnl|my_center|LOCUS_34800 5605 4184 gene locus_tag LOCUS_34810 5605 4184 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_34810 5893 6255 gene locus_tag LOCUS_34820 5893 6255 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902663.1 protein_id gnl|my_center|LOCUS_34820 6307 7866 gene locus_tag LOCUS_34830 6307 7866 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635474.1 protein_id gnl|my_center|LOCUS_34830 8014 9063 gene locus_tag LOCUS_34840 8014 9063 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_34840 9197 10057 gene locus_tag LOCUS_34850 9197 10057 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_34850 10196 12886 gene locus_tag LOCUS_34860 10196 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 12893 13711 gene locus_tag LOCUS_34870 12893 13711 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025991008.1 protein_id gnl|my_center|LOCUS_34870 13712 14269 gene locus_tag LOCUS_34880 13712 14269 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_34880 14272 15054 gene locus_tag LOCUS_34890 14272 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 15044 17656 gene locus_tag LOCUS_34900 15044 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 17682 18266 gene locus_tag LOCUS_34910 17682 18266 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_34910 18280 18657 gene locus_tag LOCUS_34920 18280 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence109 360 692 gene locus_tag LOCUS_34930 360 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 693 989 gene locus_tag LOCUS_34940 693 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2179 1319 gene locus_tag LOCUS_34950 2179 1319 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_34950 3694 2303 gene locus_tag LOCUS_34960 3694 2303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839972.1 protein_id gnl|my_center|LOCUS_34960 4107 3691 gene locus_tag LOCUS_34970 4107 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 4688 4116 gene locus_tag LOCUS_34980 4688 4116 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963063.1 protein_id gnl|my_center|LOCUS_34980 4861 4685 gene locus_tag LOCUS_34990 4861 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 5173 6435 gene locus_tag LOCUS_35000 5173 6435 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_35000 6540 6935 gene locus_tag LOCUS_35010 6540 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 7103 8596 gene locus_tag LOCUS_35020 7103 8596 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_35020 9768 8722 gene locus_tag LOCUS_35030 9768 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 10555 9809 gene locus_tag LOCUS_35040 10555 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 11609 10548 gene locus_tag LOCUS_35050 11609 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 11997 12464 gene locus_tag LOCUS_35060 gene ybaK 11997 12464 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_35060 12721 15486 gene locus_tag LOCUS_35070 12721 15486 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_35070 15557 17026 gene locus_tag LOCUS_35080 15557 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 17086 18018 gene locus_tag LOCUS_35090 17086 18018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_35090 18057 19715 gene locus_tag LOCUS_35100 18057 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 19803 21236 gene locus_tag LOCUS_35110 19803 21236 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108267.1 protein_id gnl|my_center|LOCUS_35110 >Feature sequence110 1227 2132 gene locus_tag LOCUS_35120 gene rbsK 1227 2132 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_35120 2174 3175 gene locus_tag LOCUS_35130 2174 3175 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_35130 3182 4804 gene locus_tag LOCUS_35140 3182 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 4808 5806 gene locus_tag LOCUS_35150 4808 5806 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_35150 6080 5871 gene locus_tag LOCUS_35160 6080 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 6480 6136 gene locus_tag LOCUS_35170 6480 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 6760 8424 gene locus_tag LOCUS_35180 6760 8424 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_35180 8431 10026 gene locus_tag LOCUS_35190 8431 10026 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_35190 10031 10735 gene locus_tag LOCUS_35200 10031 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 11463 10732 gene locus_tag LOCUS_35210 11463 10732 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_35210 12102 11470 gene locus_tag LOCUS_35220 12102 11470 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_35220 12265 13143 gene locus_tag LOCUS_35230 12265 13143 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_35230 13276 13713 gene locus_tag LOCUS_35240 13276 13713 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_35240 15102 13804 gene locus_tag LOCUS_35250 15102 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_35250 16547 15465 gene locus_tag LOCUS_35260 16547 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 18081 16561 gene locus_tag LOCUS_35270 18081 16561 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_35270 18363 20168 gene locus_tag LOCUS_35280 18363 20168 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_35280 <21473 20811 gene locus_tag LOCUS_35290 <21473 20811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258817.1:pyruvate, water dikinase regulatory protein >Feature sequence111 254 263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 470 1423 gene locus_tag LOCUS_35300 470 1423 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_35300 1428 1970 gene locus_tag LOCUS_35310 1428 1970 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_35310 2044 2889 gene locus_tag LOCUS_35320 2044 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 3262 4191 gene locus_tag LOCUS_35330 3262 4191 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763680.1 protein_id gnl|my_center|LOCUS_35330 5639 4188 gene locus_tag LOCUS_35340 gene rmuC 5639 4188 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_35340 5824 6741 gene locus_tag LOCUS_35350 5824 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 6754 7194 gene locus_tag LOCUS_35360 6754 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 8154 7246 gene locus_tag LOCUS_35370 8154 7246 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_35370 8668 8342 gene locus_tag LOCUS_35380 8668 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_35380 11842 8717 gene locus_tag LOCUS_35390 11842 8717 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_35390 12880 11876 gene locus_tag LOCUS_35400 12880 11876 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_35400 14252 12951 gene locus_tag LOCUS_35410 14252 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 14857 14249 gene locus_tag LOCUS_35420 14857 14249 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460044.1 protein_id gnl|my_center|LOCUS_35420 15506 14907 gene locus_tag LOCUS_35430 15506 14907 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_35430 15710 16117 gene locus_tag LOCUS_35440 15710 16117 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788296.1 protein_id gnl|my_center|LOCUS_35440 17346 16144 gene locus_tag LOCUS_35450 17346 16144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 19993 17384 gene locus_tag LOCUS_35460 19993 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 20631 20188 gene locus_tag LOCUS_35470 20631 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence112 2466 118 gene locus_tag LOCUS_35480 2466 118 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_35480 2583 4895 gene locus_tag LOCUS_35490 gene topA 2583 4895 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_35490 4902 6044 gene locus_tag LOCUS_35500 4902 6044 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_35500 6236 7201 gene locus_tag LOCUS_35510 6236 7201 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_35510 7409 8617 gene locus_tag LOCUS_35520 gene gldK 7409 8617 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_35520 8652 9530 gene locus_tag LOCUS_35530 8652 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 9540 11162 gene locus_tag LOCUS_35540 gene gldM 9540 11162 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_35540 11181 12059 gene locus_tag LOCUS_35550 gene gldN 11181 12059 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_35550 13167 12112 gene locus_tag LOCUS_35560 13167 12112 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_35560 13406 14071 gene locus_tag LOCUS_35570 13406 14071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_35570 14068 14826 gene locus_tag LOCUS_35580 14068 14826 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_35580 17235 14815 gene locus_tag LOCUS_35590 17235 14815 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_35590 17557 17315 gene locus_tag LOCUS_35600 17557 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 19079 17622 gene locus_tag LOCUS_35610 19079 17622 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_35610 20712 19081 gene locus_tag LOCUS_35620 20712 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence113 <1 1259 gene locus_tag LOCUS_35630 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202946.1:excinuclease ABC subunit UvrB 1975 1436 gene locus_tag LOCUS_35640 1975 1436 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_35640 2763 2095 gene locus_tag LOCUS_35650 2763 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3548 2781 gene locus_tag LOCUS_35660 3548 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 3754 3545 gene locus_tag LOCUS_35670 3754 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3858 4358 gene locus_tag LOCUS_35680 3858 4358 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783529.1 protein_id gnl|my_center|LOCUS_35680 4348 4959 gene locus_tag LOCUS_35690 4348 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 5918 4995 gene locus_tag LOCUS_35700 5918 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 6521 5931 gene locus_tag LOCUS_35710 6521 5931 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_35710 8489 6528 gene locus_tag LOCUS_35720 8489 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 9090 9830 gene locus_tag LOCUS_35730 9090 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 9903 10934 gene locus_tag LOCUS_35740 9903 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 10931 12880 gene locus_tag LOCUS_35750 10931 12880 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_35750 12867 13985 gene locus_tag LOCUS_35760 12867 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_35760 14094 16232 gene locus_tag LOCUS_35770 14094 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 16229 17491 gene locus_tag LOCUS_35780 16229 17491 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_35780 17498 17770 gene locus_tag LOCUS_35790 17498 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 17778 18809 gene locus_tag LOCUS_35800 17778 18809 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_35800 18811 19830 gene locus_tag LOCUS_35810 18811 19830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_35810 19832 20119 gene locus_tag LOCUS_35820 19832 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 20339 20148 gene locus_tag LOCUS_35830 20339 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence114 <1 1007 gene locus_tag LOCUS_35840 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763530.1:hybrid sensor histidine kinase/response regulator 1118 1756 gene locus_tag LOCUS_35850 1118 1756 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_35850 2304 1762 gene locus_tag LOCUS_35860 2304 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 2664 3392 gene locus_tag LOCUS_35870 2664 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 7855 3542 gene locus_tag LOCUS_35880 7855 3542 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_35880 8019 8552 gene locus_tag LOCUS_35890 gene msrA 8019 8552 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_35890 9291 11087 gene locus_tag LOCUS_35900 9291 11087 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388575.1 protein_id gnl|my_center|LOCUS_35900 11299 16086 gene locus_tag LOCUS_35910 11299 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 16668 18602 gene locus_tag LOCUS_35920 16668 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 18599 20341 gene locus_tag LOCUS_35930 18599 20341 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence115 515 3241 gene locus_tag LOCUS_35940 gene ppdK 515 3241 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_35940 4758 3376 gene locus_tag LOCUS_35950 4758 3376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_35950 4993 4763 gene locus_tag LOCUS_35960 4993 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 6333 5068 gene locus_tag LOCUS_35970 gene nhaD 6333 5068 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_35970 6384 7064 gene locus_tag LOCUS_35980 6384 7064 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_35980 7429 7980 gene locus_tag LOCUS_35990 7429 7980 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_35990 7992 8846 gene locus_tag LOCUS_36000 7992 8846 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_36000 8851 10854 gene locus_tag LOCUS_36010 8851 10854 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_36010 10856 11287 gene locus_tag LOCUS_36020 10856 11287 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_36020 11359 12159 gene locus_tag LOCUS_36030 11359 12159 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932917.1 protein_id gnl|my_center|LOCUS_36030 12161 13192 gene locus_tag LOCUS_36040 12161 13192 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_36040 13218 14057 gene locus_tag LOCUS_36050 13218 14057 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_36050 15458 14067 gene locus_tag LOCUS_36060 15458 14067 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_36060 17445 15688 gene locus_tag LOCUS_36070 17445 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 17707 17450 gene locus_tag LOCUS_36080 17707 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 18573 17797 gene locus_tag LOCUS_36090 18573 17797 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_36090 20553 18697 gene locus_tag LOCUS_36100 20553 18697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence116 <1 1746 gene locus_tag LOCUS_36110 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485364.1:ABC transporter ATP-binding protein 1890 2597 gene locus_tag LOCUS_36120 1890 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766161.1 protein_id gnl|my_center|LOCUS_36120 3003 2605 gene locus_tag LOCUS_36130 3003 2605 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_36130 3200 2982 gene locus_tag LOCUS_36140 3200 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 4046 3717 gene locus_tag LOCUS_36150 4046 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 4178 4858 gene locus_tag LOCUS_36160 4178 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 5634 6233 gene locus_tag LOCUS_36170 5634 6233 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_36170 6302 7402 gene locus_tag LOCUS_36180 6302 7402 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_36180 7628 11047 gene locus_tag LOCUS_36190 7628 11047 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_36190 11057 12718 gene locus_tag LOCUS_36200 11057 12718 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_36200 12844 13716 gene locus_tag LOCUS_36210 12844 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 14936 14139 gene locus_tag LOCUS_36220 14936 14139 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531001.1 protein_id gnl|my_center|LOCUS_36220 15076 18165 gene locus_tag LOCUS_36230 15076 18165 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080241138.1 protein_id gnl|my_center|LOCUS_36230 18201 19535 gene locus_tag LOCUS_36240 18201 19535 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence117 276 204 gene locus_tag LOCUS_t00250 276 204 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 861 343 gene locus_tag LOCUS_36250 861 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 1006 2019 gene locus_tag LOCUS_36260 1006 2019 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_36260 2634 2071 gene locus_tag LOCUS_36270 gene frr 2634 2071 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_36270 3432 2722 gene locus_tag LOCUS_36280 gene pyrH 3432 2722 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_36280 4433 3591 gene locus_tag LOCUS_36290 gene tsf 4433 3591 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_36290 5333 4458 gene locus_tag LOCUS_36300 gene rpsB 5333 4458 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_36300 5827 5441 gene locus_tag LOCUS_36310 gene rpsI 5827 5441 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_36310 6288 5833 gene locus_tag LOCUS_36320 gene rplM 6288 5833 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_36320 6530 8089 gene locus_tag LOCUS_36330 6530 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 8076 8615 gene locus_tag LOCUS_36340 8076 8615 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_36340 8913 8617 gene locus_tag LOCUS_36350 8913 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 9154 8894 gene locus_tag LOCUS_36360 9154 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 10389 9217 gene locus_tag LOCUS_36370 10389 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_36370 10641 13736 gene locus_tag LOCUS_36380 10641 13736 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108712.1 protein_id gnl|my_center|LOCUS_36380 13753 14364 gene locus_tag LOCUS_36390 13753 14364 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_36390 15487 14315 gene locus_tag LOCUS_36400 gene hflX 15487 14315 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_36400 15761 16129 gene locus_tag LOCUS_36410 15761 16129 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458981.1 protein_id gnl|my_center|LOCUS_36410 16146 16571 gene locus_tag LOCUS_36420 16146 16571 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_36420 16568 16888 gene locus_tag LOCUS_36430 16568 16888 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545235.1 protein_id gnl|my_center|LOCUS_36430 16895 17317 gene locus_tag LOCUS_36440 16895 17317 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_36440 17983 17336 gene locus_tag LOCUS_36450 17983 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 18155 18523 gene locus_tag LOCUS_36460 18155 18523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 18560 19108 gene locus_tag LOCUS_36470 18560 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 19297 19545 gene locus_tag LOCUS_36480 19297 19545 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_36480 19634 20092 gene locus_tag LOCUS_36490 19634 20092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 20314 20323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 <1 615 gene locus_tag LOCUS_36500 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202528.1:TonB-dependent receptor 638 2089 gene locus_tag LOCUS_36510 638 2089 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_36510 2206 3945 gene locus_tag LOCUS_36520 2206 3945 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_36520 3879 3888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3951 5117 gene locus_tag LOCUS_36530 3951 5117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_36530 6320 5172 gene locus_tag LOCUS_36540 6320 5172 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_36540 7416 6571 gene locus_tag LOCUS_36550 7416 6571 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_36550 9182 7518 gene locus_tag LOCUS_36560 gene recN 9182 7518 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_36560 12298 9536 gene locus_tag LOCUS_36570 gene ligD 12298 9536 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337655.1 protein_id gnl|my_center|LOCUS_36570 12554 13939 gene locus_tag LOCUS_36580 12554 13939 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_36580 14146 14976 gene locus_tag LOCUS_36590 14146 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 15145 17112 gene locus_tag LOCUS_36600 15145 17112 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_36600 17251 17658 gene locus_tag LOCUS_36610 17251 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 17699 18343 gene locus_tag LOCUS_36620 17699 18343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598709.1 protein_id gnl|my_center|LOCUS_36620 18878 18687 gene locus_tag LOCUS_36630 18878 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 <20568 19046 gene locus_tag LOCUS_36640 <20568 19046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927081.1:TonB-dependent receptor >Feature sequence119 764 1189 gene locus_tag LOCUS_36650 gene rnk 764 1189 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_36650 1344 2231 gene locus_tag LOCUS_36660 1344 2231 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_36660 2305 3264 gene locus_tag LOCUS_36670 2305 3264 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486366.1 protein_id gnl|my_center|LOCUS_36670 3986 3384 gene locus_tag LOCUS_36680 3986 3384 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203366.1 protein_id gnl|my_center|LOCUS_36680 4225 4524 gene locus_tag LOCUS_36690 4225 4524 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_36690 4581 4820 gene locus_tag LOCUS_36700 4581 4820 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292400.1 protein_id gnl|my_center|LOCUS_36700 4831 5238 gene locus_tag LOCUS_36710 4831 5238 CDS product nitrophenyl compound nitroreductase subunit ArsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292399.1 protein_id gnl|my_center|LOCUS_36710 5240 5938 gene locus_tag LOCUS_36720 5240 5938 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_36720 6060 7082 gene locus_tag LOCUS_36730 6060 7082 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_36730 7086 7862 gene locus_tag LOCUS_36740 7086 7862 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061259.1 protein_id gnl|my_center|LOCUS_36740 7904 8278 gene locus_tag LOCUS_36750 7904 8278 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_36750 8335 8715 gene locus_tag LOCUS_36760 8335 8715 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_36760 8853 9203 gene locus_tag LOCUS_36770 8853 9203 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_36770 9326 10378 gene locus_tag LOCUS_36780 gene arsB 9326 10378 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_36780 10379 10930 gene locus_tag LOCUS_36790 gene sigZ 10379 10930 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_36790 11552 11346 gene locus_tag LOCUS_36800 11552 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 11491 12291 gene locus_tag LOCUS_36810 11491 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 12429 12851 gene locus_tag LOCUS_36820 12429 12851 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_36820 12966 13520 gene locus_tag LOCUS_36830 12966 13520 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240088.1 protein_id gnl|my_center|LOCUS_36830 14700 13843 gene locus_tag LOCUS_36840 14700 13843 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_36840 16518 14947 gene locus_tag LOCUS_36850 16518 14947 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_36850 19131 16945 gene locus_tag LOCUS_36860 19131 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 <20441 19258 gene locus_tag LOCUS_36870 <20441 19258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922755.1:DUF1593 domain-containing protein >Feature sequence120 809 222 gene locus_tag LOCUS_36880 809 222 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_36880 1444 809 gene locus_tag LOCUS_36890 1444 809 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_36890 3405 1501 gene locus_tag LOCUS_36900 3405 1501 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_36900 3612 5699 gene locus_tag LOCUS_36910 3612 5699 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_36910 5683 6561 gene locus_tag LOCUS_36920 5683 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 6565 7905 gene locus_tag LOCUS_36930 6565 7905 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_36930 7913 9424 gene locus_tag LOCUS_36940 7913 9424 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_36940 10263 9853 gene locus_tag LOCUS_36950 10263 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 11351 10440 gene locus_tag LOCUS_36960 gene yedA 11351 10440 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212216.1 protein_id gnl|my_center|LOCUS_36960 12841 11663 gene locus_tag LOCUS_36970 12841 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 13319 14146 gene locus_tag LOCUS_36980 gene lgt 13319 14146 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_36980 14512 14991 gene locus_tag LOCUS_36990 14512 14991 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 protein_id gnl|my_center|LOCUS_36990 15034 15600 gene locus_tag LOCUS_37000 15034 15600 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_37000 15662 16225 gene locus_tag LOCUS_37010 15662 16225 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240088.1 protein_id gnl|my_center|LOCUS_37010 16397 16813 gene locus_tag LOCUS_37020 16397 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 17321 17743 gene locus_tag LOCUS_37030 17321 17743 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 protein_id gnl|my_center|LOCUS_37030 17792 18235 gene locus_tag LOCUS_37040 17792 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 18256 18891 gene locus_tag LOCUS_37050 18256 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 19312 20241 gene locus_tag LOCUS_37060 19312 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence121 2313 475 gene locus_tag LOCUS_37070 2313 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 3033 2323 gene locus_tag LOCUS_37080 3033 2323 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_37080 4076 3198 gene locus_tag LOCUS_37090 4076 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 4185 4775 gene locus_tag LOCUS_37100 4185 4775 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398109.1 protein_id gnl|my_center|LOCUS_37100 5121 4810 gene locus_tag LOCUS_37110 5121 4810 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_37110 5468 5130 gene locus_tag LOCUS_37120 5468 5130 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555815.1 protein_id gnl|my_center|LOCUS_37120 6331 5576 gene locus_tag LOCUS_37130 6331 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37130 8347 6344 gene locus_tag LOCUS_37140 8347 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37140 8606 9889 gene locus_tag LOCUS_37150 gene nhaD 8606 9889 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_37150 10307 9957 gene locus_tag LOCUS_37160 10307 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 10522 11340 gene locus_tag LOCUS_37170 10522 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 13267 11432 gene locus_tag LOCUS_37180 13267 11432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_37180 14663 13320 gene locus_tag LOCUS_37190 gene purB 14663 13320 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_37190 14868 16286 gene locus_tag LOCUS_37200 14868 16286 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_37200 16312 17736 gene locus_tag LOCUS_37210 gene pyk 16312 17736 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_37210 17746 18579 gene locus_tag LOCUS_37220 17746 18579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 19840 18590 gene locus_tag LOCUS_37230 19840 18590 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_37230 >Feature sequence122 <1 554 gene locus_tag LOCUS_37240 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839780.1:glycoside hydrolase family 13 protein 926 1552 gene locus_tag LOCUS_37250 926 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 1661 2287 gene locus_tag LOCUS_37260 1661 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 3766 2288 gene locus_tag LOCUS_37270 3766 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4397 3939 gene locus_tag LOCUS_37280 4397 3939 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_37280 5699 4488 gene locus_tag LOCUS_37290 5699 4488 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_37290 6748 5768 gene locus_tag LOCUS_37300 6748 5768 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_37300 7205 8224 gene locus_tag LOCUS_37310 7205 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_37310 8181 10448 gene locus_tag LOCUS_37320 8181 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144336993.1 protein_id gnl|my_center|LOCUS_37320 11113 10484 gene locus_tag LOCUS_37330 11113 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 11867 11106 gene locus_tag LOCUS_37340 11867 11106 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_37340 12913 11864 gene locus_tag LOCUS_37350 12913 11864 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 protein_id gnl|my_center|LOCUS_37350 13446 12934 gene locus_tag LOCUS_37360 13446 12934 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_37360 14058 13636 gene locus_tag LOCUS_37370 14058 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 14057 14254 gene locus_tag LOCUS_37380 14057 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 14624 14175 gene locus_tag LOCUS_37390 14624 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 15571 14807 gene locus_tag LOCUS_37400 15571 14807 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_37400 15807 16271 gene locus_tag LOCUS_37410 15807 16271 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974893.1 protein_id gnl|my_center|LOCUS_37410 18188 16263 gene locus_tag LOCUS_37420 18188 16263 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_37420 >Feature sequence123 <1 1287 gene locus_tag LOCUS_37430 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039140.1:L-fucose:H+ symporter permease 1292 1666 gene locus_tag LOCUS_37440 1292 1666 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_37440 1681 2514 gene locus_tag LOCUS_37450 1681 2514 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_37450 2685 3716 gene locus_tag LOCUS_37460 2685 3716 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_37460 3734 5293 gene locus_tag LOCUS_37470 3734 5293 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_37470 5407 5868 gene locus_tag LOCUS_37480 gene tnpA 5407 5868 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_37480 6428 7267 gene locus_tag LOCUS_37490 6428 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 7995 7270 gene locus_tag LOCUS_37500 7995 7270 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 protein_id gnl|my_center|LOCUS_37500 8660 7992 gene locus_tag LOCUS_37510 8660 7992 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405053.1 protein_id gnl|my_center|LOCUS_37510 9433 8735 gene locus_tag LOCUS_37520 9433 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 10024 9506 gene locus_tag LOCUS_37530 10024 9506 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_37530 10176 10829 gene locus_tag LOCUS_37540 10176 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 10898 12217 gene locus_tag LOCUS_37550 10898 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 12990 12289 gene locus_tag LOCUS_37560 12990 12289 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_37560 13880 13212 gene locus_tag LOCUS_37570 13880 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 13942 14982 gene locus_tag LOCUS_37580 gene gldB 13942 14982 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_37580 15250 16386 gene locus_tag LOCUS_37590 15250 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 17477 16383 gene locus_tag LOCUS_37600 17477 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 17648 17899 gene locus_tag LOCUS_37610 17648 17899 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_37610 17899 18324 gene locus_tag LOCUS_37620 17899 18324 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence124 1576 755 gene locus_tag LOCUS_37630 1576 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 2244 1750 gene locus_tag LOCUS_37640 2244 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2510 2241 gene locus_tag LOCUS_37650 2510 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 2776 2513 gene locus_tag LOCUS_37660 2776 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 2999 2841 gene locus_tag LOCUS_37670 2999 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 4553 3054 gene locus_tag LOCUS_37680 4553 3054 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_37680 5573 4614 gene locus_tag LOCUS_37690 5573 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 6799 5570 gene locus_tag LOCUS_37700 6799 5570 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_37700 7733 7200 gene locus_tag LOCUS_37710 7733 7200 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_37710 8806 7730 gene locus_tag LOCUS_37720 8806 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 10718 8820 gene locus_tag LOCUS_37730 10718 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 13547 10722 gene locus_tag LOCUS_37740 13547 10722 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_37740 14044 13544 gene locus_tag LOCUS_37750 14044 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 15428 14118 gene locus_tag LOCUS_37760 15428 14118 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223432.1 protein_id gnl|my_center|LOCUS_37760 17067 15538 gene locus_tag LOCUS_37770 17067 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 17553 17194 gene locus_tag LOCUS_37780 17553 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 18626 17766 gene locus_tag LOCUS_37790 18626 17766 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence125 <1 713 gene locus_tag LOCUS_37800 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120353.1:DEAD/DEAH box helicase 2066 717 gene locus_tag LOCUS_37810 2066 717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_37810 3417 2056 gene locus_tag LOCUS_37820 3417 2056 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_37820 3890 4606 gene locus_tag LOCUS_37830 3890 4606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_37830 4684 5877 gene locus_tag LOCUS_37840 4684 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 5899 8310 gene locus_tag LOCUS_37850 5899 8310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_37850 8512 10866 gene locus_tag LOCUS_37860 8512 10866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_37860 11107 13473 gene locus_tag LOCUS_37870 11107 13473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_37870 13650 15959 gene locus_tag LOCUS_37880 13650 15959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_37880 16073 16273 gene locus_tag LOCUS_37890 16073 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 16486 17025 gene locus_tag LOCUS_37900 16486 17025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 17035 17700 gene locus_tag LOCUS_37910 17035 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 17868 18515 gene locus_tag LOCUS_37920 17868 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 18880 19362 gene locus_tag LOCUS_37930 18880 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence126 <1 1519 gene locus_tag LOCUS_37940 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083002.1:ABC transporter ATP-binding protein 1748 2182 gene locus_tag LOCUS_37950 1748 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 2194 4179 gene locus_tag LOCUS_37960 2194 4179 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_37960 4204 4710 gene locus_tag LOCUS_37970 4204 4710 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795285.1 protein_id gnl|my_center|LOCUS_37970 4697 6511 gene locus_tag LOCUS_37980 4697 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 7343 6699 gene locus_tag LOCUS_37990 7343 6699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964764.1 protein_id gnl|my_center|LOCUS_37990 12031 7352 gene locus_tag LOCUS_38000 12031 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 12757 13359 gene locus_tag LOCUS_38010 12757 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 13637 14917 gene locus_tag LOCUS_38020 13637 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 15918 17927 gene locus_tag LOCUS_38030 15918 17927 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_38030 17939 18412 gene locus_tag LOCUS_38040 17939 18412 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_38040 >Feature sequence127 <1 872 gene locus_tag LOCUS_38050 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048696320.1:DNA gyrase/topoisomerase IV subunit A 985 2106 gene locus_tag LOCUS_38060 985 2106 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_38060 3056 2244 gene locus_tag LOCUS_38070 gene larE 3056 2244 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_38070 4173 3112 gene locus_tag LOCUS_38080 4173 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38080 4592 4170 gene locus_tag LOCUS_38090 4592 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38090 4755 5372 gene locus_tag LOCUS_38100 4755 5372 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761105.1 protein_id gnl|my_center|LOCUS_38100 5402 6709 gene locus_tag LOCUS_38110 gene murA 5402 6709 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_38110 6754 7299 gene locus_tag LOCUS_38120 6754 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 7440 8072 gene locus_tag LOCUS_38130 7440 8072 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_38130 8106 9263 gene locus_tag LOCUS_38140 gene dnaJ 8106 9263 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_38140 9328 10251 gene locus_tag LOCUS_38150 9328 10251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_38150 10258 11616 gene locus_tag LOCUS_38160 10258 11616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_38160 11656 12237 gene locus_tag LOCUS_38170 11656 12237 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_38170 12293 13273 gene locus_tag LOCUS_38180 12293 13273 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_38180 13280 14818 gene locus_tag LOCUS_38190 13280 14818 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760358.1 protein_id gnl|my_center|LOCUS_38190 15860 14889 gene locus_tag LOCUS_38200 15860 14889 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_38200 16084 16863 gene locus_tag LOCUS_38210 16084 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 19074 16870 gene locus_tag LOCUS_38220 19074 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence128 160 2286 gene locus_tag LOCUS_38230 160 2286 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_38230 2312 3640 gene locus_tag LOCUS_38240 gene xylA 2312 3640 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_38240 3736 5388 gene locus_tag LOCUS_38250 gene xylE 3736 5388 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_38250 5590 5859 gene locus_tag LOCUS_38260 gene rpsO 5590 5859 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_38260 5952 8207 gene locus_tag LOCUS_38270 gene pnp 5952 8207 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_38270 8765 10483 gene locus_tag LOCUS_38280 8765 10483 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_38280 10704 13547 gene locus_tag LOCUS_38290 10704 13547 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_38290 13725 14996 gene locus_tag LOCUS_38300 gene odhB 13725 14996 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_38300 14999 15664 gene locus_tag LOCUS_38310 14999 15664 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_38310 17321 15846 gene locus_tag LOCUS_38320 17321 15846 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_38320 17763 17404 gene locus_tag LOCUS_38330 17763 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_38330 17944 18285 gene locus_tag LOCUS_38340 gene ssb 17944 18285 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_38340 <19106 18460 gene locus_tag LOCUS_38350 <19106 18460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963527.1:response regulator transcription factor >Feature sequence129 465 1841 gene locus_tag LOCUS_38360 465 1841 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_38360 1852 2589 gene locus_tag LOCUS_38370 1852 2589 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_38370 3617 2640 gene locus_tag LOCUS_38380 3617 2640 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_38380 4297 3851 gene locus_tag LOCUS_38390 gene arr 4297 3851 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_38390 5241 4891 gene locus_tag LOCUS_38400 5241 4891 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_38400 5765 5322 gene locus_tag LOCUS_38410 5765 5322 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967274.1 protein_id gnl|my_center|LOCUS_38410 7338 6142 gene locus_tag LOCUS_38420 7338 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 8097 11381 gene locus_tag LOCUS_38430 8097 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 11782 12348 gene locus_tag LOCUS_38440 11782 12348 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_38440 12418 13503 gene locus_tag LOCUS_38450 12418 13503 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_38450 13760 17032 gene locus_tag LOCUS_38460 13760 17032 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_38460 17046 18617 gene locus_tag LOCUS_38470 17046 18617 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence130 2361 1741 gene locus_tag LOCUS_38480 2361 1741 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_38480 2807 2457 gene locus_tag LOCUS_38490 2807 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 4391 3486 gene locus_tag LOCUS_38500 4391 3486 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_38500 4798 4469 gene locus_tag LOCUS_38510 4798 4469 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_38510 5009 4785 gene locus_tag LOCUS_38520 5009 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 5087 5311 gene locus_tag LOCUS_38530 5087 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 5480 5407 gene locus_tag LOCUS_t00260 5480 5407 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5668 6864 gene locus_tag LOCUS_38540 5668 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 7639 6941 gene locus_tag LOCUS_38550 7639 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 8080 7865 gene locus_tag LOCUS_38560 8080 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 9282 8281 gene locus_tag LOCUS_38570 gene rfaE1 9282 8281 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_38570 11773 9317 gene locus_tag LOCUS_38580 gene priA 11773 9317 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_38580 12893 12018 gene locus_tag LOCUS_38590 12893 12018 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108114.1 protein_id gnl|my_center|LOCUS_38590 13585 12890 gene locus_tag LOCUS_38600 gene cmk 13585 12890 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_38600 14511 13636 gene locus_tag LOCUS_38610 14511 13636 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786129.1 protein_id gnl|my_center|LOCUS_38610 15665 14574 gene locus_tag LOCUS_38620 15665 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 16631 15672 gene locus_tag LOCUS_38630 16631 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 17166 18833 gene locus_tag LOCUS_38640 17166 18833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083000.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence131 589 242 gene locus_tag LOCUS_38650 589 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38650 2525 606 gene locus_tag LOCUS_38660 2525 606 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_38660 3674 2580 gene locus_tag LOCUS_38670 3674 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 5071 3680 gene locus_tag LOCUS_38680 5071 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 7020 5323 gene locus_tag LOCUS_38690 7020 5323 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_38690 10111 7040 gene locus_tag LOCUS_38700 10111 7040 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_38700 12459 10180 gene locus_tag LOCUS_38710 12459 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 14123 12453 gene locus_tag LOCUS_38720 14123 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 14316 15335 gene locus_tag LOCUS_38730 14316 15335 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_38730 15479 16471 gene locus_tag LOCUS_38740 15479 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 18609 16807 gene locus_tag LOCUS_38750 18609 16807 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393461.1 protein_id gnl|my_center|LOCUS_38750 >Feature sequence132 1339 191 gene locus_tag LOCUS_38760 1339 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 1748 2212 gene locus_tag LOCUS_38770 1748 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 2225 2674 gene locus_tag LOCUS_38780 2225 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2664 4007 gene locus_tag LOCUS_38790 2664 4007 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_38790 4004 6379 gene locus_tag LOCUS_38800 gene gshAB 4004 6379 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990064.1 protein_id gnl|my_center|LOCUS_38800 7538 6696 gene locus_tag LOCUS_38810 7538 6696 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_38810 8449 7571 gene locus_tag LOCUS_38820 gene ygiD 8449 7571 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_38820 9082 8519 gene locus_tag LOCUS_38830 9082 8519 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_38830 9795 9217 gene locus_tag LOCUS_38840 9795 9217 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_38840 10543 9935 gene locus_tag LOCUS_38850 10543 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 11053 10661 gene locus_tag LOCUS_38860 11053 10661 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964329.1 protein_id gnl|my_center|LOCUS_38860 11490 11846 gene locus_tag LOCUS_38870 11490 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 11891 12256 gene locus_tag LOCUS_38880 11891 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 12297 12581 gene locus_tag LOCUS_38890 12297 12581 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_38890 14380 12731 gene locus_tag LOCUS_38900 14380 12731 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_38900 15004 17817 gene locus_tag LOCUS_38910 15004 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 18241 17810 gene locus_tag LOCUS_38920 18241 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence133 <1 590 gene locus_tag LOCUS_38930 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802006.1:TIGR00730 family Rossman fold protein 4430 597 gene locus_tag LOCUS_38940 4430 597 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_38940 4941 8024 gene locus_tag LOCUS_38950 4941 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 8037 9548 gene locus_tag LOCUS_38960 8037 9548 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_38960 9561 10274 gene locus_tag LOCUS_38970 9561 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 10312 11301 gene locus_tag LOCUS_38980 10312 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 11407 13167 gene locus_tag LOCUS_38990 11407 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 13799 15418 gene locus_tag LOCUS_39000 13799 15418 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_39000 15469 17883 gene locus_tag LOCUS_39010 15469 17883 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_39010 >Feature sequence134 347 607 gene locus_tag LOCUS_39020 347 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 594 776 gene locus_tag LOCUS_39030 594 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 773 1294 gene locus_tag LOCUS_39040 773 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 1296 1772 gene locus_tag LOCUS_39050 1296 1772 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786945.1 protein_id gnl|my_center|LOCUS_39050 1777 1849 gene locus_tag LOCUS_t00270 1777 1849 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1894 2361 gene locus_tag LOCUS_39060 1894 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 2365 3678 gene locus_tag LOCUS_39070 2365 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3645 4409 gene locus_tag LOCUS_39080 3645 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 4413 4871 gene locus_tag LOCUS_39090 4413 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 4943 6553 gene locus_tag LOCUS_39100 4943 6553 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_39100 6565 7977 gene locus_tag LOCUS_39110 6565 7977 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_39110 7985 8332 gene locus_tag LOCUS_39120 7985 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 8362 9387 gene locus_tag LOCUS_39130 8362 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 9534 9605 gene locus_tag LOCUS_t00280 9534 9605 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10492 10656 gene locus_tag LOCUS_39140 10492 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 10660 10881 gene locus_tag LOCUS_39150 10660 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 11015 11470 gene locus_tag LOCUS_39160 11015 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 11640 12329 gene locus_tag LOCUS_39170 11640 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 12348 12950 gene locus_tag LOCUS_39180 12348 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 12967 14055 gene locus_tag LOCUS_39190 12967 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 14066 14368 gene locus_tag LOCUS_39200 14066 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 14362 14664 gene locus_tag LOCUS_39210 14362 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 14655 15107 gene locus_tag LOCUS_39220 14655 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 15104 15502 gene locus_tag LOCUS_39230 15104 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 15581 16030 gene locus_tag LOCUS_39240 15581 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 16098 16661 gene locus_tag LOCUS_39250 16098 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence135 2595 1576 gene locus_tag LOCUS_39260 2595 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 2776 4530 gene locus_tag LOCUS_39270 gene aspS 2776 4530 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_39270 4606 5235 gene locus_tag LOCUS_39280 4606 5235 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_39280 5402 7216 gene locus_tag LOCUS_39290 5402 7216 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_39290 10267 7226 gene locus_tag LOCUS_39300 10267 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 11492 10437 gene locus_tag LOCUS_39310 11492 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 12363 11830 gene locus_tag LOCUS_39320 12363 11830 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_39320 12755 12360 gene locus_tag LOCUS_39330 12755 12360 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_39330 13398 12835 gene locus_tag LOCUS_39340 gene pth 13398 12835 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_39340 13990 13409 gene locus_tag LOCUS_39350 13990 13409 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_39350 14980 14042 gene locus_tag LOCUS_39360 14980 14042 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_39360 15738 15127 gene locus_tag LOCUS_39370 gene yihA 15738 15127 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_39370 16723 15728 gene locus_tag LOCUS_39380 16723 15728 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_39380 16778 17512 gene locus_tag LOCUS_39390 16778 17512 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence136 1285 590 gene locus_tag LOCUS_39400 1285 590 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_39400 2045 1251 gene locus_tag LOCUS_39410 2045 1251 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_39410 2461 2048 gene locus_tag LOCUS_39420 2461 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 5560 2588 gene locus_tag LOCUS_39430 5560 2588 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_39430 6925 5888 gene locus_tag LOCUS_39440 6925 5888 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_39440 8772 6928 gene locus_tag LOCUS_39450 8772 6928 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_39450 8985 9575 gene locus_tag LOCUS_39460 8985 9575 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_39460 12738 9583 gene locus_tag LOCUS_39470 12738 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 13712 12738 gene locus_tag LOCUS_39480 13712 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 15565 13709 gene locus_tag LOCUS_39490 15565 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 16489 15575 gene locus_tag LOCUS_39500 16489 15575 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_39500 <17814 16489 gene locus_tag LOCUS_39510 <17814 16489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence137 7289 3576 gene locus_tag LOCUS_39520 7289 3576 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_39520 7759 7292 gene locus_tag LOCUS_39530 gene rlmH 7759 7292 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_39530 7836 8276 gene locus_tag LOCUS_39540 7836 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 8269 9114 gene locus_tag LOCUS_39550 gene nadC 8269 9114 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_39550 9184 9825 gene locus_tag LOCUS_39560 gene pdxH 9184 9825 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222336.1 protein_id gnl|my_center|LOCUS_39560 11811 9826 gene locus_tag LOCUS_39570 11811 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 11903 12367 gene locus_tag LOCUS_39580 11903 12367 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819814.1 protein_id gnl|my_center|LOCUS_39580 12784 12563 gene locus_tag LOCUS_39590 12784 12563 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_39590 14095 12896 gene locus_tag LOCUS_39600 14095 12896 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_39600 14749 14342 gene locus_tag LOCUS_39610 14749 14342 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence138 393 2060 gene locus_tag LOCUS_39620 393 2060 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_39620 2415 3086 gene locus_tag LOCUS_39630 2415 3086 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_39630 3180 4184 gene locus_tag LOCUS_39640 3180 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 6478 4193 gene locus_tag LOCUS_39650 6478 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144336993.1 protein_id gnl|my_center|LOCUS_39650 7544 6438 gene locus_tag LOCUS_39660 7544 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_39660 7660 8421 gene locus_tag LOCUS_39670 7660 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_39670 9766 8729 gene locus_tag LOCUS_39680 9766 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 11014 9869 gene locus_tag LOCUS_39690 11014 9869 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_39690 12207 11017 gene locus_tag LOCUS_39700 12207 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 12885 12211 gene locus_tag LOCUS_39710 12885 12211 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 protein_id gnl|my_center|LOCUS_39710 14456 12903 gene locus_tag LOCUS_39720 14456 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 16701 14569 gene locus_tag LOCUS_39730 16701 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence139 2126 2055 gene locus_tag LOCUS_t00290 2126 2055 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4287 2188 gene locus_tag LOCUS_39740 4287 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4635 4297 gene locus_tag LOCUS_39750 4635 4297 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_39750 5099 4647 gene locus_tag LOCUS_39760 5099 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 6099 5353 gene locus_tag LOCUS_39770 6099 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 7649 6162 gene locus_tag LOCUS_39780 7649 6162 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_39780 7893 8489 gene locus_tag LOCUS_39790 7893 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 9268 8555 gene locus_tag LOCUS_39800 9268 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 9408 10172 gene locus_tag LOCUS_39810 9408 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 10715 10176 gene locus_tag LOCUS_39820 10715 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 11910 10717 gene locus_tag LOCUS_39830 11910 10717 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_39830 12883 11972 gene locus_tag LOCUS_39840 12883 11972 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_39840 <17043 12972 gene locus_tag LOCUS_39850 <17043 12972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein >Feature sequence140 <1 1777 gene locus_tag LOCUS_39860 <1 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957997.1:PAS domain-containing hybrid sensor histidine kinase/response regulator 2717 1800 gene locus_tag LOCUS_39870 2717 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119158.1 protein_id gnl|my_center|LOCUS_39870 4756 2738 gene locus_tag LOCUS_39880 4756 2738 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_39880 7049 4761 gene locus_tag LOCUS_39890 7049 4761 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_39890 8202 7219 gene locus_tag LOCUS_39900 8202 7219 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_39900 9083 8214 gene locus_tag LOCUS_39910 9083 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 10583 9159 gene locus_tag LOCUS_39920 10583 9159 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_39920 13480 10598 gene locus_tag LOCUS_39930 13480 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 15215 13608 gene locus_tag LOCUS_39940 15215 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 16156 15215 gene locus_tag LOCUS_39950 16156 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 <16913 16283 gene locus_tag LOCUS_39960 <16913 16283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767847.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence141 509 1024 gene locus_tag LOCUS_39970 509 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 1180 3603 gene locus_tag LOCUS_39980 1180 3603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39980 6291 3862 gene locus_tag LOCUS_39990 gene thrA 6291 3862 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_39990 7303 6644 gene locus_tag LOCUS_40000 7303 6644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_40000 8278 7310 gene locus_tag LOCUS_40010 8278 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 8381 8692 gene locus_tag LOCUS_40020 8381 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 9948 8689 gene locus_tag LOCUS_40030 9948 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 10624 10001 gene locus_tag LOCUS_40040 10624 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 11659 10703 gene locus_tag LOCUS_40050 11659 10703 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_40050 <16808 11912 gene locus_tag LOCUS_40060 <16808 11912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence142 324 1409 gene locus_tag LOCUS_40070 324 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 1409 3073 gene locus_tag LOCUS_40080 1409 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_40080 3073 3804 gene locus_tag LOCUS_40090 3073 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 4574 3807 gene locus_tag LOCUS_40100 4574 3807 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_40100 5830 4568 gene locus_tag LOCUS_40110 5830 4568 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802486.1 protein_id gnl|my_center|LOCUS_40110 6617 6087 gene locus_tag LOCUS_40120 6617 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 6792 7463 gene locus_tag LOCUS_40130 6792 7463 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268934.1 protein_id gnl|my_center|LOCUS_40130 7609 8916 gene locus_tag LOCUS_40140 gene miaB 7609 8916 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_40140 9109 10362 gene locus_tag LOCUS_40150 gene mtaB 9109 10362 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_40150 10558 13689 gene locus_tag LOCUS_40160 gene ccsA 10558 13689 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_40160 13757 14617 gene locus_tag LOCUS_40170 gene cyoE 13757 14617 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946161.1 protein_id gnl|my_center|LOCUS_40170 14621 15271 gene locus_tag LOCUS_40180 14621 15271 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_40180 15719 15264 gene locus_tag LOCUS_40190 15719 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 15826 16518 gene locus_tag LOCUS_40200 15826 16518 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878919.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence143 <1 1145 gene locus_tag LOCUS_40210 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962377.1:beta-ketoacyl-ACP synthase II 1799 1233 gene locus_tag LOCUS_40220 1799 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 2788 1799 gene locus_tag LOCUS_40230 gene obgE 2788 1799 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_40230 3375 2797 gene locus_tag LOCUS_40240 3375 2797 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_40240 4429 3428 gene locus_tag LOCUS_40250 4429 3428 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 protein_id gnl|my_center|LOCUS_40250 6200 4476 gene locus_tag LOCUS_40260 gene lysS 6200 4476 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_40260 6554 7189 gene locus_tag LOCUS_40270 6554 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_40270 7186 7485 gene locus_tag LOCUS_40280 7186 7485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_40280 7538 10063 gene locus_tag LOCUS_40290 7538 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 10175 11482 gene locus_tag LOCUS_40300 10175 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 11580 11825 gene locus_tag LOCUS_40310 11580 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 11829 12125 gene locus_tag LOCUS_40320 11829 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 13428 12175 gene locus_tag LOCUS_40330 13428 12175 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_40330 13732 15063 gene locus_tag LOCUS_40340 13732 15063 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_40340 15136 16023 gene locus_tag LOCUS_40350 15136 16023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 <16749 16047 gene locus_tag LOCUS_40360 <16749 16047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962484.1:mevalonate kinase >Feature sequence144 381 1403 gene locus_tag LOCUS_40370 381 1403 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405476.1 protein_id gnl|my_center|LOCUS_40370 2418 1693 gene locus_tag LOCUS_40380 2418 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 2711 2475 gene locus_tag LOCUS_40390 2711 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4625 2892 gene locus_tag LOCUS_40400 4625 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 6813 5032 gene locus_tag LOCUS_40410 6813 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 8243 6813 gene locus_tag LOCUS_40420 8243 6813 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657265.1 protein_id gnl|my_center|LOCUS_40420 12091 8246 gene locus_tag LOCUS_40430 12091 8246 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_40430 12544 12212 gene locus_tag LOCUS_40440 12544 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 13150 12728 gene locus_tag LOCUS_40450 13150 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 <16721 13281 gene locus_tag LOCUS_40460 <16721 13281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:PAS domain S-box protein >Feature sequence145 1449 2795 gene locus_tag LOCUS_40470 1449 2795 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_40470 5178 3025 gene locus_tag LOCUS_40480 5178 3025 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_40480 7438 5477 gene locus_tag LOCUS_40490 7438 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 7908 7477 gene locus_tag LOCUS_40500 7908 7477 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087061.1 protein_id gnl|my_center|LOCUS_40500 9994 7922 gene locus_tag LOCUS_40510 9994 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 10245 15467 gene locus_tag LOCUS_40520 10245 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence146 3658 815 gene locus_tag LOCUS_40530 3658 815 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_40530 5003 3669 gene locus_tag LOCUS_40540 5003 3669 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_40540 5118 5996 gene locus_tag LOCUS_40550 5118 5996 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_40550 6112 6486 gene locus_tag LOCUS_40560 6112 6486 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_40560 6873 8198 gene locus_tag LOCUS_40570 6873 8198 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_40570 9425 8745 gene locus_tag LOCUS_40580 9425 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 9874 9566 gene locus_tag LOCUS_40590 9874 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 10766 9948 gene locus_tag LOCUS_40600 10766 9948 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_40600 11399 10827 gene locus_tag LOCUS_40610 11399 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 11653 12663 gene locus_tag LOCUS_40620 11653 12663 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_40620 12957 13226 gene locus_tag LOCUS_40630 12957 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 13934 13473 gene locus_tag LOCUS_40640 gene rnhA 13934 13473 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044664291.1 protein_id gnl|my_center|LOCUS_40640 14079 14324 gene locus_tag LOCUS_40650 14079 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 14296 14643 gene locus_tag LOCUS_40660 14296 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 15166 14690 gene locus_tag LOCUS_40670 15166 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 15108 15326 gene locus_tag LOCUS_40680 15108 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence147 162 833 gene locus_tag LOCUS_40690 162 833 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_40690 1657 830 gene locus_tag LOCUS_40700 1657 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 1902 2918 gene locus_tag LOCUS_40710 1902 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 5117 2910 gene locus_tag LOCUS_40720 5117 2910 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_40720 6343 5234 gene locus_tag LOCUS_40730 6343 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 6483 7742 gene locus_tag LOCUS_40740 6483 7742 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_40740 7804 8625 gene locus_tag LOCUS_40750 gene kdsA 7804 8625 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_40750 8978 9301 gene locus_tag LOCUS_40760 8978 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 11787 9340 gene locus_tag LOCUS_40770 11787 9340 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_40770 12485 11793 gene locus_tag LOCUS_40780 12485 11793 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_40780 14434 12587 gene locus_tag LOCUS_40790 14434 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 15150 14644 gene locus_tag LOCUS_40800 15150 14644 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766151.1 protein_id gnl|my_center|LOCUS_40800 <16143 15163 gene locus_tag LOCUS_40810 <16143 15163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766152.1:alpha-ketoacid dehydrogenase subunit alpha/beta >Feature sequence148 4840 9177 gene locus_tag LOCUS_40820 4840 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 9348 9695 gene locus_tag LOCUS_40830 9348 9695 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_40830 10108 9758 gene locus_tag LOCUS_40840 10108 9758 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_40840 10410 10111 gene locus_tag LOCUS_40850 10410 10111 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_40850 10700 12082 gene locus_tag LOCUS_40860 gene potA 10700 12082 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_40860 12094 12894 gene locus_tag LOCUS_40870 12094 12894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_40870 12891 13682 gene locus_tag LOCUS_40880 12891 13682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_40880 13679 15016 gene locus_tag LOCUS_40890 13679 15016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202988.1 protein_id gnl|my_center|LOCUS_40890 15027 15632 gene locus_tag LOCUS_40900 15027 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 >Feature sequence149 4569 415 gene locus_tag LOCUS_40910 4569 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 5695 5156 gene locus_tag LOCUS_40920 5695 5156 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_40920 6305 5826 gene locus_tag LOCUS_40930 6305 5826 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833877.1 protein_id gnl|my_center|LOCUS_40930 6872 6471 gene locus_tag LOCUS_40940 6872 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 7581 6970 gene locus_tag LOCUS_40950 7581 6970 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_40950 8458 7682 gene locus_tag LOCUS_40960 8458 7682 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_40960 9651 8521 gene locus_tag LOCUS_40970 gene dnaN 9651 8521 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_40970 10731 9760 gene locus_tag LOCUS_40980 10731 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 12444 10738 gene locus_tag LOCUS_40990 gene gldG 12444 10738 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_40990 13188 12460 gene locus_tag LOCUS_41000 gene gldF 13188 12460 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_41000 13946 13542 gene locus_tag LOCUS_41010 13946 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 14391 15800 gene locus_tag LOCUS_41020 14391 15800 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_41020 >Feature sequence150 158 1378 gene locus_tag LOCUS_41030 gene hydF 158 1378 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_41030 1375 2451 gene locus_tag LOCUS_41040 gene hydE 1375 2451 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_41040 2685 3569 gene locus_tag LOCUS_41050 2685 3569 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_41050 4638 3751 gene locus_tag LOCUS_41060 4638 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 5062 5745 gene locus_tag LOCUS_41070 gene cas6 5062 5745 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_41070 5757 6428 gene locus_tag LOCUS_41080 5757 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 6540 8582 gene locus_tag LOCUS_41090 6540 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 8585 9604 gene locus_tag LOCUS_41100 gene cas7i 8585 9604 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_41100 9601 10278 gene locus_tag LOCUS_41110 9601 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 10278 12554 gene locus_tag LOCUS_41120 10278 12554 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_41120 12579 12776 gene locus_tag LOCUS_41130 12579 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 12837 13448 gene locus_tag LOCUS_41140 12837 13448 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114586.1 protein_id gnl|my_center|LOCUS_41140 13508 14014 gene locus_tag LOCUS_41150 gene cas4 13508 14014 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_41150 14087 15091 gene locus_tag LOCUS_41160 gene cas1b 14087 15091 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_41160 15092 15355 gene locus_tag LOCUS_41170 gene cas2 15092 15355 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_41170 15577 15868 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcccaatcgaaccatagtggaattgaaat >Feature sequence151 1128 3500 gene locus_tag LOCUS_41180 1128 3500 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_41180 4949 3867 gene locus_tag LOCUS_41190 4949 3867 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_41190 5170 7461 gene locus_tag LOCUS_41200 5170 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 7486 8610 gene locus_tag LOCUS_41210 7486 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 10681 9068 gene locus_tag LOCUS_41220 10681 9068 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_41220 11962 10688 gene locus_tag LOCUS_41230 11962 10688 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_41230 12903 12313 gene locus_tag LOCUS_41240 12903 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 14015 12909 gene locus_tag LOCUS_41250 14015 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_41250 >Feature sequence152 425 1336 gene locus_tag LOCUS_41260 gene xylF 425 1336 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209591.1 protein_id gnl|my_center|LOCUS_41260 1477 4182 gene locus_tag LOCUS_41270 1477 4182 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_41270 4221 5270 gene locus_tag LOCUS_41280 4221 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 5270 6928 gene locus_tag LOCUS_41290 5270 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 6925 7599 gene locus_tag LOCUS_41300 6925 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 7674 8363 gene locus_tag LOCUS_41310 7674 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 12016 8840 gene locus_tag LOCUS_41320 12016 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 14396 12033 gene locus_tag LOCUS_41330 14396 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 15529 14483 gene locus_tag LOCUS_41340 gene ribD 15529 14483 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_41340 >Feature sequence153 <1 1212 gene locus_tag LOCUS_41350 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795608.1:endonuclease MutS2 1659 1219 gene locus_tag LOCUS_41360 1659 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 1803 3377 gene locus_tag LOCUS_41370 1803 3377 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_41370 3401 4234 gene locus_tag LOCUS_41380 3401 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 4343 5107 gene locus_tag LOCUS_41390 4343 5107 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002084071.1 protein_id gnl|my_center|LOCUS_41390 6267 5161 gene locus_tag LOCUS_41400 6267 5161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_41400 7233 6280 gene locus_tag LOCUS_41410 7233 6280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052498.1 protein_id gnl|my_center|LOCUS_41410 7923 7234 gene locus_tag LOCUS_41420 7923 7234 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084901.1 protein_id gnl|my_center|LOCUS_41420 9365 8031 gene locus_tag LOCUS_41430 9365 8031 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_41430 12441 9358 gene locus_tag LOCUS_41440 12441 9358 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_41440 13523 12438 gene locus_tag LOCUS_41450 13523 12438 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_41450 15050 13707 gene locus_tag LOCUS_41460 15050 13707 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_41460 >Feature sequence154 2581 161 gene locus_tag LOCUS_41470 2581 161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_41470 2869 4401 gene locus_tag LOCUS_41480 2869 4401 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_41480 4519 5616 gene locus_tag LOCUS_41490 4519 5616 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_41490 5655 6308 gene locus_tag LOCUS_41500 5655 6308 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_41500 6426 8519 gene locus_tag LOCUS_41510 6426 8519 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_41510 9814 8825 gene locus_tag LOCUS_41520 9814 8825 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_41520 9940 10272 gene locus_tag LOCUS_41530 9940 10272 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_41530 10291 11094 gene locus_tag LOCUS_41540 10291 11094 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_41540 <15485 11166 gene locus_tag LOCUS_41550 <15485 11166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086345.1:VCBS domain-containing protein >Feature sequence155 5133 1762 gene locus_tag LOCUS_41560 5133 1762 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_41560 6487 5330 gene locus_tag LOCUS_41570 6487 5330 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_41570 7276 6623 gene locus_tag LOCUS_41580 7276 6623 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_41580 7787 8551 gene locus_tag LOCUS_41590 7787 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 9356 8562 gene locus_tag LOCUS_41600 9356 8562 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 protein_id gnl|my_center|LOCUS_41600 9891 11504 gene locus_tag LOCUS_41610 9891 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 12628 11597 gene locus_tag LOCUS_41620 12628 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 12920 14974 gene locus_tag LOCUS_41630 12920 14974 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_41630 15000 15428 gene locus_tag LOCUS_41640 15000 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 >Feature sequence156 369 16 gene locus_tag LOCUS_41650 369 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 1248 472 gene locus_tag LOCUS_41660 1248 472 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766786.1 protein_id gnl|my_center|LOCUS_41660 2129 1257 gene locus_tag LOCUS_41670 2129 1257 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_41670 2634 2215 gene locus_tag LOCUS_41680 2634 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 3208 2756 gene locus_tag LOCUS_41690 3208 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 4229 3279 gene locus_tag LOCUS_41700 4229 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 4593 6263 gene locus_tag LOCUS_41710 4593 6263 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_41710 6410 7906 gene locus_tag LOCUS_41720 6410 7906 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_41720 9836 7944 gene locus_tag LOCUS_41730 gene speA 9836 7944 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_41730 10957 9998 gene locus_tag LOCUS_41740 10957 9998 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_41740 12210 10957 gene locus_tag LOCUS_41750 12210 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 12465 14837 gene locus_tag LOCUS_41760 12465 14837 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963024.1 protein_id gnl|my_center|LOCUS_41760 14839 15351 gene locus_tag LOCUS_41770 14839 15351 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_41770 >Feature sequence157 3096 1171 gene locus_tag LOCUS_41780 3096 1171 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_41780 4401 3097 gene locus_tag LOCUS_41790 gene hemL 4401 3097 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_41790 5465 4425 gene locus_tag LOCUS_41800 gene hemB 5465 4425 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_41800 7410 5437 gene locus_tag LOCUS_41810 7410 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 8399 7497 gene locus_tag LOCUS_41820 gene hemA 8399 7497 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869638.1 protein_id gnl|my_center|LOCUS_41820 8856 8386 gene locus_tag LOCUS_41830 8856 8386 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927175.1 protein_id gnl|my_center|LOCUS_41830 9073 8846 gene locus_tag LOCUS_41840 9073 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 9462 10094 gene locus_tag LOCUS_41850 9462 10094 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_41850 10103 11473 gene locus_tag LOCUS_41860 10103 11473 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_41860 11477 12604 gene locus_tag LOCUS_41870 11477 12604 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence158 <1 1076 gene locus_tag LOCUS_41880 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760004.1:class I SAM-dependent rRNA methyltransferase 1210 2025 gene locus_tag LOCUS_41890 gene panB 1210 2025 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_41890 2025 2699 gene locus_tag LOCUS_41900 2025 2699 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_41900 2706 3731 gene locus_tag LOCUS_41910 2706 3731 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_41910 3921 4253 gene locus_tag LOCUS_41920 3921 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 4509 6425 gene locus_tag LOCUS_41930 4509 6425 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_41930 6662 7978 gene locus_tag LOCUS_41940 6662 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 7978 8508 gene locus_tag LOCUS_41950 7978 8508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_41950 8952 8491 gene locus_tag LOCUS_41960 8952 8491 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_41960 9048 10052 gene locus_tag LOCUS_41970 gene holA 9048 10052 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_41970 10927 11469 gene locus_tag LOCUS_41980 10927 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 11473 11691 gene locus_tag LOCUS_41990 11473 11691 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_41990 12108 12659 gene locus_tag LOCUS_42000 12108 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 12827 13309 gene locus_tag LOCUS_42010 12827 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 13579 14316 gene locus_tag LOCUS_42020 13579 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 14465 14632 gene locus_tag LOCUS_42030 14465 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 15037 15258 gene locus_tag LOCUS_42040 15037 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 >Feature sequence159 614 1981 gene locus_tag LOCUS_42050 614 1981 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_42050 2006 3946 gene locus_tag LOCUS_42060 2006 3946 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_42060 5488 4040 gene locus_tag LOCUS_42070 5488 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 6851 5493 gene locus_tag LOCUS_42080 6851 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 7086 8201 gene locus_tag LOCUS_42090 7086 8201 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594900.1 protein_id gnl|my_center|LOCUS_42090 8325 9302 gene locus_tag LOCUS_42100 8325 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 10319 11296 gene locus_tag LOCUS_42110 10319 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 12085 12897 gene locus_tag LOCUS_42120 12085 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 13045 13623 gene locus_tag LOCUS_42130 13045 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 13745 14977 gene locus_tag LOCUS_42140 13745 14977 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_42140 >Feature sequence160 1735 476 gene locus_tag LOCUS_42150 1735 476 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_42150 2096 2022 gene locus_tag LOCUS_t00300 2096 2022 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2231 3229 gene locus_tag LOCUS_42160 gene trxB 2231 3229 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_42160 3424 4626 gene locus_tag LOCUS_42170 3424 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 9045 4693 gene locus_tag LOCUS_42180 9045 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 9286 10197 gene locus_tag LOCUS_42190 9286 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 10184 12304 gene locus_tag LOCUS_42200 10184 12304 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_42200 12315 13154 gene locus_tag LOCUS_42210 12315 13154 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_42210 14087 13164 gene locus_tag LOCUS_42220 14087 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 14560 14144 gene locus_tag LOCUS_42230 14560 14144 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_42230 <15157 14567 gene locus_tag LOCUS_42240 <15157 14567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786230.1:phospho-sugar mutase >Feature sequence161 6991 2918 gene locus_tag LOCUS_42250 6991 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 7425 6988 gene locus_tag LOCUS_42260 7425 6988 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_42260 7758 7438 gene locus_tag LOCUS_42270 7758 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 9461 7764 gene locus_tag LOCUS_42280 9461 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 10246 9461 gene locus_tag LOCUS_42290 10246 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 10440 10249 gene locus_tag LOCUS_42300 10440 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 10907 10443 gene locus_tag LOCUS_42310 10907 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 11516 11034 gene locus_tag LOCUS_42320 11516 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 13360 11543 gene locus_tag LOCUS_42330 13360 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 14424 13372 gene locus_tag LOCUS_42340 14424 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 14987 14427 gene locus_tag LOCUS_42350 14987 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 >Feature sequence162 1722 2879 gene locus_tag LOCUS_42360 1722 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 2887 3678 gene locus_tag LOCUS_42370 2887 3678 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_42370 4947 3850 gene locus_tag LOCUS_42380 4947 3850 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_42380 7561 5108 gene locus_tag LOCUS_42390 7561 5108 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_42390 8537 7860 gene locus_tag LOCUS_42400 8537 7860 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_42400 8596 9282 gene locus_tag LOCUS_42410 8596 9282 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_42410 9647 9279 gene locus_tag LOCUS_42420 9647 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 10304 9801 gene locus_tag LOCUS_42430 10304 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 11904 10417 gene locus_tag LOCUS_42440 11904 10417 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_42440 12659 11931 gene locus_tag LOCUS_42450 12659 11931 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_42450 12986 13942 gene locus_tag LOCUS_42460 12986 13942 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731124.1 protein_id gnl|my_center|LOCUS_42460 13947 14651 gene locus_tag LOCUS_42470 13947 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence163 2984 1104 gene locus_tag LOCUS_42480 2984 1104 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_42480 3857 3159 gene locus_tag LOCUS_42490 3857 3159 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677254.1 protein_id gnl|my_center|LOCUS_42490 4033 5820 gene locus_tag LOCUS_42500 4033 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 5980 7167 gene locus_tag LOCUS_42510 5980 7167 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_42510 7212 7925 gene locus_tag LOCUS_42520 7212 7925 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_42520 7938 8894 gene locus_tag LOCUS_42530 7938 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 10025 8937 gene locus_tag LOCUS_42540 10025 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 10882 10253 gene locus_tag LOCUS_42550 10882 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 12269 10893 gene locus_tag LOCUS_42560 gene hemG 12269 10893 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202640.1 protein_id gnl|my_center|LOCUS_42560 13680 12271 gene locus_tag LOCUS_42570 gene hemN 13680 12271 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202641.1 protein_id gnl|my_center|LOCUS_42570 <14774 13667 gene locus_tag LOCUS_42580 <14774 13667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202642.1:MFS transporter >Feature sequence164 685 131 gene locus_tag LOCUS_42590 685 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963940.1 protein_id gnl|my_center|LOCUS_42590 2716 713 gene locus_tag LOCUS_42600 gene ligA 2716 713 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_42600 2880 3863 gene locus_tag LOCUS_42610 gene xylF 2880 3863 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693436.1 protein_id gnl|my_center|LOCUS_42610 4646 3870 gene locus_tag LOCUS_42620 gene xth 4646 3870 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969370.1 protein_id gnl|my_center|LOCUS_42620 5338 4790 gene locus_tag LOCUS_42630 5338 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 5864 5232 gene locus_tag LOCUS_42640 5864 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 7068 5959 gene locus_tag LOCUS_42650 7068 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 7307 7747 gene locus_tag LOCUS_42660 7307 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 11174 7878 gene locus_tag LOCUS_42670 11174 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 12298 11378 gene locus_tag LOCUS_42680 12298 11378 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_42680 12875 12657 gene locus_tag LOCUS_42690 12875 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 14340 13033 gene locus_tag LOCUS_42700 14340 13033 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_42700 >Feature sequence165 1250 186 gene locus_tag LOCUS_42710 gene mvaD 1250 186 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_42710 1835 1383 gene locus_tag LOCUS_42720 gene tnpA 1835 1383 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_42720 3008 2007 gene locus_tag LOCUS_42730 3008 2007 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_42730 4313 3012 gene locus_tag LOCUS_42740 4313 3012 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_42740 5307 4315 gene locus_tag LOCUS_42750 gene fni 5307 4315 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_42750 6462 5317 gene locus_tag LOCUS_42760 6462 5317 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_42760 8496 6502 gene locus_tag LOCUS_42770 8496 6502 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444411.1 protein_id gnl|my_center|LOCUS_42770 9362 8568 gene locus_tag LOCUS_42780 9362 8568 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 protein_id gnl|my_center|LOCUS_42780 11075 9468 gene locus_tag LOCUS_42790 11075 9468 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087192.1 protein_id gnl|my_center|LOCUS_42790 11724 12734 gene locus_tag LOCUS_42800 11724 12734 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_42800 12927 13928 gene locus_tag LOCUS_42810 12927 13928 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_42810 >Feature sequence166 <1 2152 gene locus_tag LOCUS_42820 <1 2152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086495.1:VCBS domain-containing protein 2482 3402 gene locus_tag LOCUS_42830 2482 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 5917 3428 gene locus_tag LOCUS_42840 5917 3428 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_42840 6678 5932 gene locus_tag LOCUS_42850 6678 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 8154 6697 gene locus_tag LOCUS_42860 8154 6697 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_42860 8708 8298 gene locus_tag LOCUS_42870 8708 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 8879 9325 gene locus_tag LOCUS_42880 8879 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 10430 9327 gene locus_tag LOCUS_42890 10430 9327 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_42890 11547 10432 gene locus_tag LOCUS_42900 gene gmd 11547 10432 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048190.1 protein_id gnl|my_center|LOCUS_42900 11807 13831 gene locus_tag LOCUS_42910 11807 13831 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_42910 <14589 13906 gene locus_tag LOCUS_42920 <14589 13906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107692.1:glycosyltransferase family 1 protein >Feature sequence167 2338 3660 gene locus_tag LOCUS_42930 2338 3660 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_42930 3650 4651 gene locus_tag LOCUS_42940 3650 4651 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_42940 4742 5122 gene locus_tag LOCUS_42950 4742 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 5391 5164 gene locus_tag LOCUS_42960 5391 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 5565 5407 gene locus_tag LOCUS_42970 5565 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 6285 5758 gene locus_tag LOCUS_42980 6285 5758 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_42980 6657 6313 gene locus_tag LOCUS_42990 6657 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 7548 6814 gene locus_tag LOCUS_43000 7548 6814 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_43000 7788 8588 gene locus_tag LOCUS_43010 7788 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 9518 8655 gene locus_tag LOCUS_43020 9518 8655 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_43020 11858 9651 gene locus_tag LOCUS_43030 11858 9651 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_43030 12060 13124 gene locus_tag LOCUS_43040 12060 13124 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_43040 13121 13594 gene locus_tag LOCUS_43050 13121 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 14270 13773 gene locus_tag LOCUS_43060 14270 13773 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence168 <1 527 gene locus_tag LOCUS_43070 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941952.1:methyl-accepting chemotaxis protein 1382 747 gene locus_tag LOCUS_43080 gene nreC 1382 747 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 protein_id gnl|my_center|LOCUS_43080 4282 1568 gene locus_tag LOCUS_43090 4282 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5089 4349 gene locus_tag LOCUS_43100 5089 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 5261 6307 gene locus_tag LOCUS_43110 5261 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 6638 6330 gene locus_tag LOCUS_43120 6638 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43120 7005 6649 gene locus_tag LOCUS_43130 7005 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43130 6663 6672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7726 7007 gene locus_tag LOCUS_43140 7726 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 10752 8305 gene locus_tag LOCUS_43150 10752 8305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_43150 11059 11541 gene locus_tag LOCUS_43160 11059 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 14017 11513 gene locus_tag LOCUS_43170 14017 11513 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107414.1 protein_id gnl|my_center|LOCUS_43170 14016 14156 gene locus_tag LOCUS_43180 14016 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 >Feature sequence169 3617 1395 gene locus_tag LOCUS_43190 3617 1395 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_43190 4389 3727 gene locus_tag LOCUS_43200 gene pgmB 4389 3727 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_43200 5707 4382 gene locus_tag LOCUS_43210 5707 4382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_43210 7163 6141 gene locus_tag LOCUS_43220 7163 6141 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_43220 7458 10415 gene locus_tag LOCUS_43230 7458 10415 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_43230 10436 12052 gene locus_tag LOCUS_43240 10436 12052 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_43240 12071 13105 gene locus_tag LOCUS_43250 12071 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 >Feature sequence170 <1 2437 gene locus_tag LOCUS_43260 <1 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233825.1:rhamnogalacturonan acetylesterase 2546 3946 gene locus_tag LOCUS_43270 2546 3946 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_43270 4224 4805 gene locus_tag LOCUS_43280 4224 4805 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_43280 4861 6027 gene locus_tag LOCUS_43290 4861 6027 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_43290 6183 9854 gene locus_tag LOCUS_43300 6183 9854 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_43300 9941 11677 gene locus_tag LOCUS_43310 9941 11677 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_43310 11805 14231 gene locus_tag LOCUS_43320 11805 14231 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073096256.1 protein_id gnl|my_center|LOCUS_43320 >Feature sequence171 791 1030 gene locus_tag LOCUS_43330 791 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 1035 1355 gene locus_tag LOCUS_43340 1035 1355 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964042.1 protein_id gnl|my_center|LOCUS_43340 1327 1824 gene locus_tag LOCUS_43350 1327 1824 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_43350 2494 1922 gene locus_tag LOCUS_43360 2494 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 2792 4060 gene locus_tag LOCUS_43370 2792 4060 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_43370 4633 4061 gene locus_tag LOCUS_43380 4633 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 5162 4611 gene locus_tag LOCUS_43390 5162 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 5720 5184 gene locus_tag LOCUS_43400 5720 5184 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_43400 6307 5804 gene locus_tag LOCUS_43410 6307 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 7080 6469 gene locus_tag LOCUS_43420 7080 6469 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_43420 7577 7077 gene locus_tag LOCUS_43430 7577 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 8100 7744 gene locus_tag LOCUS_43440 8100 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 8378 8100 gene locus_tag LOCUS_43450 8378 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 9167 8412 gene locus_tag LOCUS_43460 9167 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 10331 9207 gene locus_tag LOCUS_43470 10331 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_43470 11226 10309 gene locus_tag LOCUS_43480 11226 10309 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_43480 11385 14159 gene locus_tag LOCUS_43490 11385 14159 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_43490 >Feature sequence172 201 304 gene locus_tag LOCUS_r00010 201 304 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3411 529 gene locus_tag LOCUS_43500 3411 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 5572 3524 gene locus_tag LOCUS_43510 5572 3524 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_43510 5831 6559 gene locus_tag LOCUS_43520 5831 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 7866 6556 gene locus_tag LOCUS_43530 7866 6556 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_43530 8571 8092 gene locus_tag LOCUS_43540 gene trxA 8571 8092 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_43540 9242 8592 gene locus_tag LOCUS_43550 9242 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 9457 9239 gene locus_tag LOCUS_43560 9457 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 9642 10745 gene locus_tag LOCUS_43570 gene ychF 9642 10745 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_43570 10808 12472 gene locus_tag LOCUS_43580 10808 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 13208 12486 gene locus_tag LOCUS_43590 13208 12486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_43590 <14015 13220 gene locus_tag LOCUS_43600 <14015 13220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_079703094.1:DUF5687 family protein >Feature sequence173 1508 213 gene locus_tag LOCUS_43610 1508 213 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_43610 2914 1682 gene locus_tag LOCUS_43620 2914 1682 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_43620 3459 2911 gene locus_tag LOCUS_43630 gene rfbC 3459 2911 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_43630 4502 3456 gene locus_tag LOCUS_43640 4502 3456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 protein_id gnl|my_center|LOCUS_43640 5454 4678 gene locus_tag LOCUS_43650 gene rfbF 5454 4678 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987009.1 protein_id gnl|my_center|LOCUS_43650 5769 6674 gene locus_tag LOCUS_43660 5769 6674 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_43660 6711 8132 gene locus_tag LOCUS_43670 gene ahcY 6711 8132 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_43670 8680 8255 gene locus_tag LOCUS_43680 8680 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 8742 9041 gene locus_tag LOCUS_43690 8742 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 9044 9568 gene locus_tag LOCUS_43700 9044 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 9746 10216 gene locus_tag LOCUS_43710 gene greA 9746 10216 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_43710 10221 10613 gene locus_tag LOCUS_43720 10221 10613 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_43720 11166 10618 gene locus_tag LOCUS_43730 gene ruvC 11166 10618 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_43730 12059 11163 gene locus_tag LOCUS_43740 12059 11163 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_43740 12187 13305 gene locus_tag LOCUS_43750 12187 13305 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_43750 13298 13939 gene locus_tag LOCUS_43760 13298 13939 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_43760 >Feature sequence174 88 2676 gene locus_tag LOCUS_43770 88 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 2771 3343 gene locus_tag LOCUS_43780 2771 3343 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_43780 3418 4512 gene locus_tag LOCUS_43790 3418 4512 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_43790 4672 8166 gene locus_tag LOCUS_43800 4672 8166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_43800 8185 9744 gene locus_tag LOCUS_43810 8185 9744 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_43810 9956 10891 gene locus_tag LOCUS_43820 9956 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 11379 12245 gene locus_tag LOCUS_43830 11379 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 >Feature sequence175 249 52 gene locus_tag LOCUS_43840 249 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 218 862 gene locus_tag LOCUS_43850 218 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 3245 987 gene locus_tag LOCUS_43860 3245 987 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 protein_id gnl|my_center|LOCUS_43860 4139 3333 gene locus_tag LOCUS_43870 4139 3333 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_43870 6623 4335 gene locus_tag LOCUS_43880 6623 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 7099 6644 gene locus_tag LOCUS_43890 7099 6644 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114482.1 protein_id gnl|my_center|LOCUS_43890 9133 7115 gene locus_tag LOCUS_43900 9133 7115 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_43900 9564 9160 gene locus_tag LOCUS_43910 9564 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 10630 9599 gene locus_tag LOCUS_43920 10630 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 11555 10920 gene locus_tag LOCUS_43930 11555 10920 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722886.1 protein_id gnl|my_center|LOCUS_43930 <13321 11600 gene locus_tag LOCUS_43940 <13321 11600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021845.1:PAS domain-containing protein >Feature sequence176 <1 1293 gene locus_tag LOCUS_43950 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198886.1:acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta 1382 2596 gene locus_tag LOCUS_43960 1382 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 2599 4563 gene locus_tag LOCUS_43970 2599 4563 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_43970 4786 6063 gene locus_tag LOCUS_43980 4786 6063 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853214.1 protein_id gnl|my_center|LOCUS_43980 7245 6508 gene locus_tag LOCUS_43990 7245 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 7722 7252 gene locus_tag LOCUS_44000 7722 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 8684 7728 gene locus_tag LOCUS_44010 8684 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 9149 8688 gene locus_tag LOCUS_44020 9149 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 10037 9156 gene locus_tag LOCUS_44030 10037 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 10171 10599 gene locus_tag LOCUS_44040 10171 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 10706 11182 gene locus_tag LOCUS_44050 10706 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 11194 11910 gene locus_tag LOCUS_44060 11194 11910 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_44060 >Feature sequence177 160 606 gene locus_tag LOCUS_44070 160 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 688 1080 gene locus_tag LOCUS_44080 688 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 1235 2428 gene locus_tag LOCUS_44090 1235 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 2511 3362 gene locus_tag LOCUS_44100 2511 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 3568 6567 gene locus_tag LOCUS_44110 3568 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 6628 6951 gene locus_tag LOCUS_44120 6628 6951 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975561.1 protein_id gnl|my_center|LOCUS_44120 8327 7410 gene locus_tag LOCUS_44130 8327 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 8756 9853 gene locus_tag LOCUS_44140 8756 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 9990 12407 gene locus_tag LOCUS_44150 9990 12407 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186922643.1 protein_id gnl|my_center|LOCUS_44150 13188 12454 gene locus_tag LOCUS_44160 13188 12454 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_44160 >Feature sequence178 45 782 gene locus_tag LOCUS_44170 45 782 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_44170 2114 816 gene locus_tag LOCUS_44180 2114 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 4160 2175 gene locus_tag LOCUS_44190 4160 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 4930 4202 gene locus_tag LOCUS_44200 4930 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 5463 5095 gene locus_tag LOCUS_44210 5463 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44210 5867 5478 gene locus_tag LOCUS_44220 5867 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44220 6755 5922 gene locus_tag LOCUS_44230 6755 5922 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_44230 6892 7305 gene locus_tag LOCUS_44240 6892 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 7429 9810 gene locus_tag LOCUS_44250 7429 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 9845 11194 gene locus_tag LOCUS_44260 9845 11194 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_44260 12746 11202 gene locus_tag LOCUS_44270 12746 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 >Feature sequence179 1126 317 gene locus_tag LOCUS_44280 1126 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038889.1 protein_id gnl|my_center|LOCUS_44280 1840 1214 gene locus_tag LOCUS_44290 1840 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 2643 1864 gene locus_tag LOCUS_44300 2643 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 3511 2723 gene locus_tag LOCUS_44310 3511 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 4033 3515 gene locus_tag LOCUS_44320 4033 3515 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_44320 5179 4199 gene locus_tag LOCUS_44330 5179 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 6568 5408 gene locus_tag LOCUS_44340 6568 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 7858 6857 gene locus_tag LOCUS_44350 7858 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 8323 9024 gene locus_tag LOCUS_44360 8323 9024 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_44360 9095 9586 gene locus_tag LOCUS_44370 gene ribH 9095 9586 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_44370 9780 9589 gene locus_tag LOCUS_44380 9780 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 9891 11891 gene locus_tag LOCUS_44390 9891 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 12151 13047 gene locus_tag LOCUS_44400 12151 13047 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_44400 >Feature sequence180 <1 596 gene locus_tag LOCUS_44410 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817866.1:DEAD/DEAH box helicase 802 1146 gene locus_tag LOCUS_44420 802 1146 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921943.1 protein_id gnl|my_center|LOCUS_44420 2243 1293 gene locus_tag LOCUS_44430 2243 1293 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_44430 2326 2919 gene locus_tag LOCUS_44440 2326 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44440 2881 2890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2966 3574 gene locus_tag LOCUS_44450 2966 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44450 5067 3712 gene locus_tag LOCUS_44460 5067 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 5499 5098 gene locus_tag LOCUS_44470 5499 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 7763 5700 gene locus_tag LOCUS_44480 7763 5700 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_44480 8537 7791 gene locus_tag LOCUS_44490 8537 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 9246 8650 gene locus_tag LOCUS_44500 9246 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 9575 9354 gene locus_tag LOCUS_44510 9575 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 9746 10183 gene locus_tag LOCUS_44520 9746 10183 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_44520 10245 10955 gene locus_tag LOCUS_44530 10245 10955 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_44530 12090 11167 gene locus_tag LOCUS_44540 12090 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 12317 13144 gene locus_tag LOCUS_44550 12317 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 >Feature sequence181 1890 1414 gene locus_tag LOCUS_44560 1890 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 3129 1897 gene locus_tag LOCUS_44570 3129 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 3340 3624 gene locus_tag LOCUS_44580 3340 3624 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545871.1 protein_id gnl|my_center|LOCUS_44580 3621 5183 gene locus_tag LOCUS_44590 gene actP 3621 5183 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546484.1 protein_id gnl|my_center|LOCUS_44590 5629 5189 gene locus_tag LOCUS_44600 5629 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 6128 5658 gene locus_tag LOCUS_44610 6128 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 8651 6369 gene locus_tag LOCUS_44620 8651 6369 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_44620 9395 8928 gene locus_tag LOCUS_44630 9395 8928 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_44630 9780 9460 gene locus_tag LOCUS_44640 9780 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 10439 9852 gene locus_tag LOCUS_44650 10439 9852 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_44650 11103 10534 gene locus_tag LOCUS_44660 11103 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 11890 11105 gene locus_tag LOCUS_44670 11890 11105 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_44670 12654 12064 gene locus_tag LOCUS_44680 12654 12064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005924132.1 protein_id gnl|my_center|LOCUS_44680 >Feature sequence182 2763 589 gene locus_tag LOCUS_44690 2763 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 3890 2904 gene locus_tag LOCUS_44700 3890 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 4404 3970 gene locus_tag LOCUS_44710 4404 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 5947 4628 gene locus_tag LOCUS_44720 5947 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 6124 6636 gene locus_tag LOCUS_44730 6124 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 6703 8538 gene locus_tag LOCUS_44740 6703 8538 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_44740 8562 10598 gene locus_tag LOCUS_44750 8562 10598 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_44750 10595 11221 gene locus_tag LOCUS_44760 10595 11221 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_44760 11910 11227 gene locus_tag LOCUS_44770 gene nth 11910 11227 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_44770 <12975 12255 gene locus_tag LOCUS_44780 <12975 12255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202857.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence183 2106 799 gene locus_tag LOCUS_44790 2106 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 4448 2511 gene locus_tag LOCUS_44800 4448 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 6067 4748 gene locus_tag LOCUS_44810 6067 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 6916 6182 gene locus_tag LOCUS_44820 6916 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 8831 6942 gene locus_tag LOCUS_44830 8831 6942 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_44830 12002 8844 gene locus_tag LOCUS_44840 12002 8844 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_44840 >Feature sequence184 1123 686 gene locus_tag LOCUS_44850 1123 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2111 1215 gene locus_tag LOCUS_44860 2111 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 3015 2143 gene locus_tag LOCUS_44870 3015 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 3650 3111 gene locus_tag LOCUS_44880 3650 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 4045 4704 gene locus_tag LOCUS_44890 4045 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 4701 4940 gene locus_tag LOCUS_44900 4701 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 5145 6167 gene locus_tag LOCUS_44910 5145 6167 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094570644.1 protein_id gnl|my_center|LOCUS_44910 6228 8897 gene locus_tag LOCUS_44920 6228 8897 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_44920 8947 9597 gene locus_tag LOCUS_44930 8947 9597 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801072.1 protein_id gnl|my_center|LOCUS_44930 10439 9909 gene locus_tag LOCUS_44940 gene nuoE 10439 9909 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_44940 12304 10502 gene locus_tag LOCUS_44950 12304 10502 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_44950 <12842 12304 gene locus_tag LOCUS_44960 <12842 12304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868905.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence185 1728 454 gene locus_tag LOCUS_44970 1728 454 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_44970 2580 1813 gene locus_tag LOCUS_44980 2580 1813 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_44980 3094 4113 gene locus_tag LOCUS_44990 3094 4113 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_44990 4197 4403 gene locus_tag LOCUS_45000 4197 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 4408 4680 gene locus_tag LOCUS_45010 4408 4680 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_45010 4891 6795 gene locus_tag LOCUS_45020 4891 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 6792 9416 gene locus_tag LOCUS_45030 6792 9416 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_45030 9797 10264 gene locus_tag LOCUS_45040 9797 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 10266 10616 gene locus_tag LOCUS_45050 10266 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 11701 10613 gene locus_tag LOCUS_45060 11701 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence186 <1 851 gene locus_tag LOCUS_45070 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107968.1:GH92 family glycosyl hydrolase 877 2109 gene locus_tag LOCUS_45080 877 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 2233 3024 gene locus_tag LOCUS_45090 2233 3024 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_45090 3039 4646 gene locus_tag LOCUS_45100 3039 4646 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_45100 4653 5957 gene locus_tag LOCUS_45110 4653 5957 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_45110 5939 7561 gene locus_tag LOCUS_45120 5939 7561 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 protein_id gnl|my_center|LOCUS_45120 7582 9177 gene locus_tag LOCUS_45130 7582 9177 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_45130 9190 11424 gene locus_tag LOCUS_45140 9190 11424 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_45140 11453 11677 gene locus_tag LOCUS_45150 11453 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 >Feature sequence187 <1 835 gene locus_tag LOCUS_45160 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583496.1:ABC transporter substrate-binding protein 1023 1769 gene locus_tag LOCUS_45170 1023 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 2009 1800 gene locus_tag LOCUS_45180 2009 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 3389 2016 gene locus_tag LOCUS_45190 gene xseA 3389 2016 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_45190 5028 3391 gene locus_tag LOCUS_45200 5028 3391 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_45200 5814 5038 gene locus_tag LOCUS_45210 5814 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 7003 5933 gene locus_tag LOCUS_45220 7003 5933 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_45220 8633 7005 gene locus_tag LOCUS_45230 8633 7005 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_45230 8854 9144 gene locus_tag LOCUS_45240 8854 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109256.1 protein_id gnl|my_center|LOCUS_45240 9155 9457 gene locus_tag LOCUS_45250 9155 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 9700 11271 gene locus_tag LOCUS_45260 gene rny 9700 11271 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_45260 11381 12433 gene locus_tag LOCUS_45270 11381 12433 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_45270 >Feature sequence188 <1 1483 gene locus_tag LOCUS_45280 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404001.1:Gldg family protein 1476 2405 gene locus_tag LOCUS_45290 1476 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 3311 4438 gene locus_tag LOCUS_45300 3311 4438 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_45300 4540 6423 gene locus_tag LOCUS_45310 4540 6423 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_45310 6625 7806 gene locus_tag LOCUS_45320 6625 7806 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_45320 8002 9792 gene locus_tag LOCUS_45330 8002 9792 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_45330 9945 10838 gene locus_tag LOCUS_45340 9945 10838 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_45340 12288 11542 gene locus_tag LOCUS_45350 gene gpmA 12288 11542 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_45350 >Feature sequence189 2237 1518 gene locus_tag LOCUS_45360 2237 1518 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_45360 2470 5640 gene locus_tag LOCUS_45370 2470 5640 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_45370 5659 7098 gene locus_tag LOCUS_45380 5659 7098 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_45380 7109 7828 gene locus_tag LOCUS_45390 7109 7828 CDS product DUF5012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108196.1 protein_id gnl|my_center|LOCUS_45390 7866 8321 gene locus_tag LOCUS_45400 7866 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 8633 9406 gene locus_tag LOCUS_45410 gene mazG 8633 9406 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_45410 9905 9462 gene locus_tag LOCUS_45420 9905 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 10673 9948 gene locus_tag LOCUS_45430 10673 9948 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_45430 11259 10675 gene locus_tag LOCUS_45440 gene coaE 11259 10675 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_45440 >Feature sequence190 334 1332 gene locus_tag LOCUS_45450 gene gap 334 1332 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357093.1 protein_id gnl|my_center|LOCUS_45450 2388 1399 gene locus_tag LOCUS_45460 2388 1399 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141824.1 protein_id gnl|my_center|LOCUS_45460 3247 2657 gene locus_tag LOCUS_45470 3247 2657 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_45470 3731 3318 gene locus_tag LOCUS_45480 3731 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 5278 3839 gene locus_tag LOCUS_45490 5278 3839 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918393.1 protein_id gnl|my_center|LOCUS_45490 6176 5322 gene locus_tag LOCUS_45500 6176 5322 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_45500 6904 6338 gene locus_tag LOCUS_45510 6904 6338 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_45510 7045 7464 gene locus_tag LOCUS_45520 gene tsaE 7045 7464 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_45520 7535 8755 gene locus_tag LOCUS_45530 7535 8755 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_45530 8828 9361 gene locus_tag LOCUS_45540 8828 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 9375 10154 gene locus_tag LOCUS_45550 9375 10154 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_45550 10869 10444 gene locus_tag LOCUS_45560 10869 10444 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449464.1 protein_id gnl|my_center|LOCUS_45560 11038 11637 gene locus_tag LOCUS_45570 11038 11637 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_45570 >Feature sequence191 2210 2887 gene locus_tag LOCUS_45580 gene ung 2210 2887 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_45580 2968 3606 gene locus_tag LOCUS_45590 2968 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5336 3885 gene locus_tag LOCUS_45600 5336 3885 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_45600 6195 5470 gene locus_tag LOCUS_45610 6195 5470 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_45610 7253 6201 gene locus_tag LOCUS_45620 7253 6201 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107986.1 protein_id gnl|my_center|LOCUS_45620 8732 7512 gene locus_tag LOCUS_45630 8732 7512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_45630 9561 8812 gene locus_tag LOCUS_45640 9561 8812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_45640 10835 9558 gene locus_tag LOCUS_45650 10835 9558 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_45650 12076 10862 gene locus_tag LOCUS_45660 12076 10862 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_45660 >Feature sequence192 1 1059 gene locus_tag LOCUS_45670 1 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 1350 2147 gene locus_tag LOCUS_45680 1350 2147 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_45680 2378 3379 gene locus_tag LOCUS_45690 2378 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 3398 4306 gene locus_tag LOCUS_45700 3398 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45700 4511 5947 gene locus_tag LOCUS_45710 4511 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 7384 6248 gene locus_tag LOCUS_45720 7384 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 8237 7479 gene locus_tag LOCUS_45730 8237 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 9261 8263 gene locus_tag LOCUS_45740 9261 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 10746 9364 gene locus_tag LOCUS_45750 10746 9364 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_45750 11914 10895 gene locus_tag LOCUS_45760 11914 10895 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_45760 >Feature sequence193 599 174 gene locus_tag LOCUS_45770 599 174 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_45770 3274 596 gene locus_tag LOCUS_45780 3274 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 4126 3404 gene locus_tag LOCUS_45790 4126 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 5114 4131 gene locus_tag LOCUS_45800 5114 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 5618 6235 gene locus_tag LOCUS_45810 5618 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 8963 6357 gene locus_tag LOCUS_45820 8963 6357 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055271316.1 protein_id gnl|my_center|LOCUS_45820 9165 10424 gene locus_tag LOCUS_45830 9165 10424 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_45830 10766 10440 gene locus_tag LOCUS_45840 10766 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence194 1023 2846 gene locus_tag LOCUS_45850 1023 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 4257 2863 gene locus_tag LOCUS_45860 4257 2863 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002328947.1 protein_id gnl|my_center|LOCUS_45860 4488 5384 gene locus_tag LOCUS_45870 4488 5384 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_45870 7834 5450 gene locus_tag LOCUS_45880 7834 5450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_45880 7983 9359 gene locus_tag LOCUS_45890 7983 9359 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_45890 9349 10683 gene locus_tag LOCUS_45900 9349 10683 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_45900 11362 10691 gene locus_tag LOCUS_45910 11362 10691 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048406.1 protein_id gnl|my_center|LOCUS_45910 <12094 11405 gene locus_tag LOCUS_45920 <12094 11405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964071.1:FAD-dependent oxidoreductase >Feature sequence195 1226 2125 gene locus_tag LOCUS_45930 1226 2125 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_45930 2203 3369 gene locus_tag LOCUS_45940 2203 3369 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_45940 4536 3655 gene locus_tag LOCUS_45950 4536 3655 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_45950 4748 4951 gene locus_tag LOCUS_45960 4748 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5139 6197 gene locus_tag LOCUS_45970 gene wecB 5139 6197 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_45970 6299 7444 gene locus_tag LOCUS_45980 6299 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 7441 7995 gene locus_tag LOCUS_45990 7441 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence196 1210 638 gene locus_tag LOCUS_46000 1210 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 2102 1212 gene locus_tag LOCUS_46010 2102 1212 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_46010 2925 2125 gene locus_tag LOCUS_46020 2925 2125 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_46020 4205 3105 gene locus_tag LOCUS_46030 4205 3105 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_46030 4627 4202 gene locus_tag LOCUS_46040 4627 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_46040 5096 5725 gene locus_tag LOCUS_46050 gene pssA 5096 5725 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_46050 7092 5965 gene locus_tag LOCUS_46060 7092 5965 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_46060 8659 7094 gene locus_tag LOCUS_46070 8659 7094 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_46070 8881 8672 gene locus_tag LOCUS_46080 8881 8672 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859764.1 protein_id gnl|my_center|LOCUS_46080 9181 9960 gene locus_tag LOCUS_46090 9181 9960 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_46090 10070 11569 gene locus_tag LOCUS_46100 gene ctaD 10070 11569 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939102.1 protein_id gnl|my_center|LOCUS_46100 11584 11925 gene locus_tag LOCUS_46110 11584 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 >Feature sequence197 802 1596 gene locus_tag LOCUS_46120 802 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 2345 1650 gene locus_tag LOCUS_46130 2345 1650 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_46130 5572 2342 gene locus_tag LOCUS_46140 5572 2342 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_46140 6531 5728 gene locus_tag LOCUS_46150 6531 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 7756 6533 gene locus_tag LOCUS_46160 7756 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 9102 7753 gene locus_tag LOCUS_46170 9102 7753 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108327.1 protein_id gnl|my_center|LOCUS_46170 10688 9114 gene locus_tag LOCUS_46180 10688 9114 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038026.1 protein_id gnl|my_center|LOCUS_46180 11289 10678 gene locus_tag LOCUS_46190 11289 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 >Feature sequence198 <1 607 gene locus_tag LOCUS_46200 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767657.1:DUF1080 domain-containing protein 630 1988 gene locus_tag LOCUS_46210 630 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 2093 3115 gene locus_tag LOCUS_46220 2093 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 3594 3157 gene locus_tag LOCUS_46230 3594 3157 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_46230 4132 6660 gene locus_tag LOCUS_46240 gene hrpB 4132 6660 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275159.1 protein_id gnl|my_center|LOCUS_46240 7706 6663 gene locus_tag LOCUS_46250 7706 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 >Feature sequence199 1 1446 gene locus_tag LOCUS_46260 1 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 1613 2398 gene locus_tag LOCUS_46270 1613 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 3766 2942 gene locus_tag LOCUS_46280 gene traN 3766 2942 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485412.1 protein_id gnl|my_center|LOCUS_46280 4715 3771 gene locus_tag LOCUS_46290 gene traM 4715 3771 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842181.1 protein_id gnl|my_center|LOCUS_46290 5354 4728 gene locus_tag LOCUS_46300 5354 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 6175 5351 gene locus_tag LOCUS_46310 6175 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 6742 6179 gene locus_tag LOCUS_46320 6742 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 9126 6739 gene locus_tag LOCUS_46330 9126 6739 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_46330 9355 9110 gene locus_tag LOCUS_46340 9355 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 9664 9419 gene locus_tag LOCUS_46350 9664 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 10335 9727 gene locus_tag LOCUS_46360 10335 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 >Feature sequence200 1851 550 gene locus_tag LOCUS_46370 1851 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 2789 1959 gene locus_tag LOCUS_46380 2789 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 2974 3591 gene locus_tag LOCUS_46390 2974 3591 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_46390 4823 3597 gene locus_tag LOCUS_46400 4823 3597 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933933.1 protein_id gnl|my_center|LOCUS_46400 5136 4882 gene locus_tag LOCUS_46410 5136 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 5870 5214 gene locus_tag LOCUS_46420 5870 5214 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_46420 6695 5874 gene locus_tag LOCUS_46430 6695 5874 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_46430 8794 6734 gene locus_tag LOCUS_46440 gene ftsH 8794 6734 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695721.1 protein_id gnl|my_center|LOCUS_46440 9192 8812 gene locus_tag LOCUS_46450 gene rsfS 9192 8812 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_46450 9433 10182 gene locus_tag LOCUS_46460 9433 10182 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_46460 10720 10310 gene locus_tag LOCUS_46470 10720 10310 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766985.1 protein_id gnl|my_center|LOCUS_46470 >Feature sequence201 2225 198 gene locus_tag LOCUS_46480 gene metG 2225 198 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_46480 2438 2794 gene locus_tag LOCUS_46490 2438 2794 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_46490 2784 3089 gene locus_tag LOCUS_46500 2784 3089 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_46500 3290 4195 gene locus_tag LOCUS_46510 3290 4195 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_46510 5101 4259 gene locus_tag LOCUS_46520 5101 4259 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_46520 5280 7976 gene locus_tag LOCUS_46530 gene cphA 5280 7976 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_46530 7980 8876 gene locus_tag LOCUS_46540 7980 8876 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_46540 8866 9222 gene locus_tag LOCUS_46550 8866 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 10074 9223 gene locus_tag LOCUS_46560 10074 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 10428 10574 gene locus_tag LOCUS_46570 10428 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 >Feature sequence202 468 1715 gene locus_tag LOCUS_46580 468 1715 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_46580 1743 3401 gene locus_tag LOCUS_46590 1743 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 3440 3763 gene locus_tag LOCUS_46600 3440 3763 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_46600 4762 3815 gene locus_tag LOCUS_46610 4762 3815 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_46610 5727 4765 gene locus_tag LOCUS_46620 5727 4765 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_46620 5905 6699 gene locus_tag LOCUS_46630 5905 6699 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_46630 7938 6706 gene locus_tag LOCUS_46640 7938 6706 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_46640 8155 7949 gene locus_tag LOCUS_46650 8155 7949 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_46650 8292 8657 gene locus_tag LOCUS_46660 8292 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 8782 10896 gene locus_tag LOCUS_46670 8782 10896 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202643.1 protein_id gnl|my_center|LOCUS_46670 >Feature sequence203 <1 1028 gene locus_tag LOCUS_46680 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546862.1:MBL fold metallo-hydrolase 1099 1599 gene locus_tag LOCUS_46690 1099 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 1530 1733 gene locus_tag LOCUS_46700 1530 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 1709 2023 gene locus_tag LOCUS_46710 1709 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 2020 2511 gene locus_tag LOCUS_46720 2020 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 4559 2517 gene locus_tag LOCUS_46730 4559 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 4795 5616 gene locus_tag LOCUS_46740 4795 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 5692 6135 gene locus_tag LOCUS_46750 5692 6135 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_46750 6271 7197 gene locus_tag LOCUS_46760 6271 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 7199 7645 gene locus_tag LOCUS_46770 7199 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 7655 8146 gene locus_tag LOCUS_46780 7655 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 8261 8698 gene locus_tag LOCUS_46790 8261 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 8737 9723 gene locus_tag LOCUS_46800 8737 9723 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 protein_id gnl|my_center|LOCUS_46800 <10532 9808 gene locus_tag LOCUS_46810 <10532 9808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978446.1:NAD(P)-dependent alcohol dehydrogenase >Feature sequence204 536 1144 gene locus_tag LOCUS_46820 536 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 1306 1614 gene locus_tag LOCUS_46830 1306 1614 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_46830 1611 2033 gene locus_tag LOCUS_46840 1611 2033 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_46840 2199 2843 gene locus_tag LOCUS_46850 2199 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 2976 3599 gene locus_tag LOCUS_46860 2976 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 4036 4248 gene locus_tag LOCUS_46870 4036 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 4372 6576 gene locus_tag LOCUS_46880 4372 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 8501 6654 gene locus_tag LOCUS_46890 8501 6654 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_46890 <10338 8513 gene locus_tag LOCUS_46900 <10338 8513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108526.1:TonB-dependent receptor >Feature sequence205 211 918 gene locus_tag LOCUS_46910 211 918 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_46910 3296 1656 gene locus_tag LOCUS_46920 3296 1656 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 protein_id gnl|my_center|LOCUS_46920 3990 3286 gene locus_tag LOCUS_46930 3990 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_46930 5108 3987 gene locus_tag LOCUS_46940 5108 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 6412 5105 gene locus_tag LOCUS_46950 6412 5105 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_46950 6599 6417 gene locus_tag LOCUS_46960 6599 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 7938 6601 gene locus_tag LOCUS_46970 7938 6601 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_46970 9242 7935 gene locus_tag LOCUS_46980 9242 7935 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_46980 9963 9247 gene locus_tag LOCUS_46990 9963 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 >Feature sequence206 1192 4179 gene locus_tag LOCUS_47000 1192 4179 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_47000 4190 5674 gene locus_tag LOCUS_47010 4190 5674 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_47010 5811 6701 gene locus_tag LOCUS_47020 5811 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 6782 8425 gene locus_tag LOCUS_47030 6782 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 >Feature sequence207 464 2218 gene locus_tag LOCUS_47040 464 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 2275 4218 gene locus_tag LOCUS_47050 2275 4218 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_47050 6541 4316 gene locus_tag LOCUS_47060 6541 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 8417 6585 gene locus_tag LOCUS_47070 8417 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 >Feature sequence208 1611 91 gene locus_tag LOCUS_47080 gene gpmI 1611 91 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108817.1 protein_id gnl|my_center|LOCUS_47080 8250 1825 gene locus_tag LOCUS_47090 8250 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 8354 8743 gene locus_tag LOCUS_47100 8354 8743 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461503.1 protein_id gnl|my_center|LOCUS_47100 8954 8745 gene locus_tag LOCUS_47110 8954 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 9879 8965 gene locus_tag LOCUS_47120 9879 8965 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_47120 >Feature sequence209 1736 399 gene locus_tag LOCUS_47130 1736 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 3189 2185 gene locus_tag LOCUS_47140 3189 2185 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990087.1 protein_id gnl|my_center|LOCUS_47140 4473 3199 gene locus_tag LOCUS_47150 4473 3199 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_47150 5750 4506 gene locus_tag LOCUS_47160 5750 4506 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_47160 6690 5761 gene locus_tag LOCUS_47170 6690 5761 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_47170 9389 6696 gene locus_tag LOCUS_47180 9389 6696 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_47180 >Feature sequence210 1195 2271 gene locus_tag LOCUS_47190 1195 2271 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_47190 3326 2268 gene locus_tag LOCUS_47200 3326 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 4439 3342 gene locus_tag LOCUS_47210 gene pgl 4439 3342 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_47210 4609 5583 gene locus_tag LOCUS_47220 4609 5583 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118362.1 protein_id gnl|my_center|LOCUS_47220 5815 9753 gene locus_tag LOCUS_47230 5815 9753 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_47230 >Feature sequence211 2654 1149 gene locus_tag LOCUS_47240 2654 1149 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920949.1 protein_id gnl|my_center|LOCUS_47240 3320 4372 gene locus_tag LOCUS_47250 3320 4372 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_47250 4587 6386 gene locus_tag LOCUS_47260 4587 6386 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_47260 6536 7306 gene locus_tag LOCUS_47270 6536 7306 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_47270 8387 7380 gene locus_tag LOCUS_47280 8387 7380 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_47280 8919 8506 gene locus_tag LOCUS_47290 8919 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 <9764 8957 gene locus_tag LOCUS_47300 <9764 8957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530887.1:thiamine pyrophosphate-requiring protein >Feature sequence212 3 1079 gene locus_tag LOCUS_47310 3 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 1166 2176 gene locus_tag LOCUS_47320 1166 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 2328 3515 gene locus_tag LOCUS_47330 2328 3515 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_47330 3637 5655 gene locus_tag LOCUS_47340 3637 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 5666 7822 gene locus_tag LOCUS_47350 5666 7822 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767251.1 protein_id gnl|my_center|LOCUS_47350 >Feature sequence213 860 2065 gene locus_tag LOCUS_47360 860 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 2058 2774 gene locus_tag LOCUS_47370 2058 2774 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_47370 2870 3616 gene locus_tag LOCUS_47380 2870 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 3679 4119 gene locus_tag LOCUS_47390 3679 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 4088 4097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4122 6341 gene locus_tag LOCUS_47400 4122 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 7233 7769 gene locus_tag LOCUS_47410 7233 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 8325 7837 gene locus_tag LOCUS_47420 8325 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 9383 8505 gene locus_tag LOCUS_47430 9383 8505 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_47430 >Feature sequence214 383 718 gene locus_tag LOCUS_47440 383 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 931 791 gene locus_tag LOCUS_47450 931 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 1299 1123 gene locus_tag LOCUS_47460 1299 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 2189 1362 gene locus_tag LOCUS_47470 gene ispE 2189 1362 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_47470 2251 2811 gene locus_tag LOCUS_47480 gene thpR 2251 2811 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267029.1 protein_id gnl|my_center|LOCUS_47480 4226 2850 gene locus_tag LOCUS_47490 4226 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 5154 4246 gene locus_tag LOCUS_47500 5154 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 5255 5905 gene locus_tag LOCUS_47510 5255 5905 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_47510 5907 6557 gene locus_tag LOCUS_47520 5907 6557 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_47520 >Feature sequence215 48 2393 gene locus_tag LOCUS_47530 48 2393 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_47530 2402 3289 gene locus_tag LOCUS_47540 2402 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 3668 5164 gene locus_tag LOCUS_47550 3668 5164 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_47550 5226 6626 gene locus_tag LOCUS_47560 gene leuC 5226 6626 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_47560 6652 7242 gene locus_tag LOCUS_47570 gene leuD 6652 7242 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_47570 7351 8871 gene locus_tag LOCUS_47580 7351 8871 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_47580 8963 9316 gene locus_tag LOCUS_47590 8963 9316 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_47590 >Feature sequence216 202 822 gene locus_tag LOCUS_47600 202 822 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_47600 2369 942 gene locus_tag LOCUS_47610 2369 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 2764 2366 gene locus_tag LOCUS_47620 gene coaD 2764 2366 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 protein_id gnl|my_center|LOCUS_47620 3488 2949 gene locus_tag LOCUS_47630 3488 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 6042 3583 gene locus_tag LOCUS_47640 gene lon 6042 3583 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_47640 7352 6165 gene locus_tag LOCUS_47650 7352 6165 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_47650 7705 7445 gene locus_tag LOCUS_47660 7705 7445 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_47660 9053 7785 gene locus_tag LOCUS_47670 9053 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 9252 9326 gene locus_tag LOCUS_t00310 9252 9326 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence217 2717 849 gene locus_tag LOCUS_47680 2717 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 3424 2714 gene locus_tag LOCUS_47690 3424 2714 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_47690 5820 4306 gene locus_tag LOCUS_47700 5820 4306 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_47700 7004 5817 gene locus_tag LOCUS_47710 7004 5817 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_47710 8475 6994 gene locus_tag LOCUS_47720 8475 6994 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_47720 <9456 8517 gene locus_tag LOCUS_47730 <9456 8517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784844.1:lytic transglycosylase domain-containing protein >Feature sequence218 645 1382 gene locus_tag LOCUS_47740 645 1382 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_47740 1738 2220 gene locus_tag LOCUS_47750 1738 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 2612 2959 gene locus_tag LOCUS_47760 2612 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 2971 3588 gene locus_tag LOCUS_47770 2971 3588 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_47770 3605 3838 gene locus_tag LOCUS_47780 3605 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 3863 4096 gene locus_tag LOCUS_47790 3863 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 4174 5157 gene locus_tag LOCUS_47800 4174 5157 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_47800 5314 5847 gene locus_tag LOCUS_47810 5314 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 5885 7450 gene locus_tag LOCUS_47820 gene amyS 5885 7450 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_47820 7940 8401 gene locus_tag LOCUS_47830 gene tnpA 7940 8401 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_47830 >Feature sequence219 3002 2358 gene locus_tag LOCUS_47840 3002 2358 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_47840 3583 3074 gene locus_tag LOCUS_47850 3583 3074 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391304.1 protein_id gnl|my_center|LOCUS_47850 4035 3631 gene locus_tag LOCUS_47860 4035 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 4670 4083 gene locus_tag LOCUS_47870 4670 4083 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861927.1 protein_id gnl|my_center|LOCUS_47870 5828 4752 gene locus_tag LOCUS_47880 5828 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 8485 5825 gene locus_tag LOCUS_47890 8485 5825 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109093.1 protein_id gnl|my_center|LOCUS_47890 8959 8738 gene locus_tag LOCUS_47900 8959 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence220 208 1473 gene locus_tag LOCUS_47910 208 1473 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_47910 1598 2956 gene locus_tag LOCUS_47920 1598 2956 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533604.1 protein_id gnl|my_center|LOCUS_47920 3073 6069 gene locus_tag LOCUS_47930 3073 6069 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_47930 6207 7532 gene locus_tag LOCUS_47940 6207 7532 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_47940 >Feature sequence221 1247 423 gene locus_tag LOCUS_47950 1247 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 1409 1942 gene locus_tag LOCUS_47960 gene hpt 1409 1942 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_47960 1964 3325 gene locus_tag LOCUS_47970 1964 3325 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_47970 3412 4323 gene locus_tag LOCUS_47980 3412 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 4387 6846 gene locus_tag LOCUS_47990 4387 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 6972 7916 gene locus_tag LOCUS_48000 6972 7916 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_48000 8223 8783 gene locus_tag LOCUS_48010 8223 8783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_48010 >Feature sequence222 2136 799 gene locus_tag LOCUS_48020 2136 799 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_48020 3508 2126 gene locus_tag LOCUS_48030 3508 2126 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_48030 3707 4387 gene locus_tag LOCUS_48040 3707 4387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_48040 4526 6880 gene locus_tag LOCUS_48050 4526 6880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_48050 7401 6967 gene locus_tag LOCUS_48060 7401 6967 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_48060 8240 7497 gene locus_tag LOCUS_48070 8240 7497 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_48070 <8876 8242 gene locus_tag LOCUS_48080 <8876 8242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627701.1:sensor histidine kinase >Feature sequence223 1462 383 gene locus_tag LOCUS_48090 1462 383 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 protein_id gnl|my_center|LOCUS_48090 2231 1467 gene locus_tag LOCUS_48100 2231 1467 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_48100 2344 3045 gene locus_tag LOCUS_48110 gene ubiE 2344 3045 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_48110 3081 3788 gene locus_tag LOCUS_48120 3081 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 3792 5339 gene locus_tag LOCUS_48130 3792 5339 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_48130 6108 5323 gene locus_tag LOCUS_48140 6108 5323 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_48140 6279 8492 gene locus_tag LOCUS_48150 6279 8492 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_48150 >Feature sequence224 <1 1064 gene locus_tag LOCUS_48160 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660365.1:permease 1069 1293 gene locus_tag LOCUS_48170 1069 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 1530 2612 gene locus_tag LOCUS_48180 1530 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 2771 2980 gene locus_tag LOCUS_48190 2771 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48190 3998 3060 gene locus_tag LOCUS_48200 3998 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 4478 4284 gene locus_tag LOCUS_48210 4478 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 5780 6103 gene locus_tag LOCUS_48220 5780 6103 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_48220 6117 6350 gene locus_tag LOCUS_48230 6117 6350 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_48230 6361 6765 gene locus_tag LOCUS_48240 6361 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 6769 7467 gene locus_tag LOCUS_48250 6769 7467 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_48250 7522 8544 gene locus_tag LOCUS_48260 7522 8544 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_48260 8730 8524 gene locus_tag LOCUS_48270 8730 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence225 231 240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 539 1387 gene locus_tag LOCUS_48280 539 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 1466 1669 gene locus_tag LOCUS_48290 1466 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 1666 2103 gene locus_tag LOCUS_48300 1666 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 2883 2107 gene locus_tag LOCUS_48310 gene trpA 2883 2107 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_48310 4262 3078 gene locus_tag LOCUS_48320 gene trpB 4262 3078 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_48320 4556 4266 gene locus_tag LOCUS_48330 4556 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 5176 4553 gene locus_tag LOCUS_48340 5176 4553 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765047.1 protein_id gnl|my_center|LOCUS_48340 5961 5173 gene locus_tag LOCUS_48350 gene trpC 5961 5173 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_48350 6947 5958 gene locus_tag LOCUS_48360 gene trpD 6947 5958 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_48360 7644 7075 gene locus_tag LOCUS_48370 7644 7075 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_48370 8522 7656 gene locus_tag LOCUS_48380 8522 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 >Feature sequence226 1701 1015 gene locus_tag LOCUS_48390 gene clpP 1701 1015 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_48390 3125 1758 gene locus_tag LOCUS_48400 gene tig 3125 1758 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_48400 3301 3219 gene locus_tag LOCUS_t00320 3301 3219 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3431 4300 gene locus_tag LOCUS_48410 3431 4300 CDS product gluconolaconase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537577.1 protein_id gnl|my_center|LOCUS_48410 5703 4429 gene locus_tag LOCUS_48420 gene serS 5703 4429 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_48420 6141 5881 gene locus_tag LOCUS_48430 gene rpmA 6141 5881 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_48430 6474 6163 gene locus_tag LOCUS_48440 6474 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 6721 7335 gene locus_tag LOCUS_48450 6721 7335 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_48450 >Feature sequence227 3290 1398 gene locus_tag LOCUS_48460 3290 1398 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_48460 4076 3384 gene locus_tag LOCUS_48470 4076 3384 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764129.1 protein_id gnl|my_center|LOCUS_48470 6178 4148 gene locus_tag LOCUS_48480 6178 4148 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_48480 <8207 6201 gene locus_tag LOCUS_48490 <8207 6201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764127.1:TonB-dependent receptor >Feature sequence228 2990 2193 gene locus_tag LOCUS_48500 2990 2193 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_48500 3303 5303 gene locus_tag LOCUS_48510 3303 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 5453 6376 gene locus_tag LOCUS_48520 5453 6376 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_48520 7716 6514 gene locus_tag LOCUS_48530 7716 6514 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583929.1 protein_id gnl|my_center|LOCUS_48530 >Feature sequence229 1555 878 gene locus_tag LOCUS_48540 1555 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 2040 1819 gene locus_tag LOCUS_48550 2040 1819 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_48550 2661 2113 gene locus_tag LOCUS_48560 2661 2113 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_48560 3481 2777 gene locus_tag LOCUS_48570 3481 2777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_48570 4373 3684 gene locus_tag LOCUS_48580 4373 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 4490 6595 gene locus_tag LOCUS_48590 gene recG 4490 6595 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_48590 6691 7485 gene locus_tag LOCUS_48600 6691 7485 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_48600 >Feature sequence230 <1 1105 gene locus_tag LOCUS_48610 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887835.1:App1 family protein 1328 1909 gene locus_tag LOCUS_48620 1328 1909 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957754.1 protein_id gnl|my_center|LOCUS_48620 2012 3454 gene locus_tag LOCUS_48630 2012 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 3457 4113 gene locus_tag LOCUS_48640 3457 4113 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_48640 4252 4776 gene locus_tag LOCUS_48650 4252 4776 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_48650 6965 4866 gene locus_tag LOCUS_48660 6965 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 >Feature sequence231 <1 1975 gene locus_tag LOCUS_48670 <1 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291394.1:TonB-dependent receptor 244 253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2018 3865 gene locus_tag LOCUS_48680 2018 3865 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_48680 3870 4568 gene locus_tag LOCUS_48690 3870 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 4751 7213 gene locus_tag LOCUS_48700 4751 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 >Feature sequence232 657 1571 gene locus_tag LOCUS_48710 657 1571 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_48710 2366 3034 gene locus_tag LOCUS_48720 2366 3034 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_48720 3036 4019 gene locus_tag LOCUS_48730 gene argC 3036 4019 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_48730 4038 5195 gene locus_tag LOCUS_48740 4038 5195 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_48740 5206 5991 gene locus_tag LOCUS_48750 gene argB 5206 5991 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_48750 6062 6856 gene locus_tag LOCUS_48760 gene proC 6062 6856 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_48760 >Feature sequence233 1651 872 gene locus_tag LOCUS_48770 gene sufC 1651 872 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_48770 3241 1793 gene locus_tag LOCUS_48780 gene sufB 3241 1793 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_48780 3369 4421 gene locus_tag LOCUS_48790 gene thiL 3369 4421 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_48790 5122 4418 gene locus_tag LOCUS_48800 5122 4418 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_48800 6073 5123 gene locus_tag LOCUS_48810 6073 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 6665 6150 gene locus_tag LOCUS_48820 6665 6150 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 protein_id gnl|my_center|LOCUS_48820 7095 6655 gene locus_tag LOCUS_48830 7095 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 >Feature sequence234 258 521 gene locus_tag LOCUS_48840 258 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 514 1755 gene locus_tag LOCUS_48850 514 1755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822181.1 protein_id gnl|my_center|LOCUS_48850 2420 1752 gene locus_tag LOCUS_48860 2420 1752 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_48860 3463 2423 gene locus_tag LOCUS_48870 3463 2423 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_48870 3706 4719 gene locus_tag LOCUS_48880 3706 4719 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_48880 4823 6727 gene locus_tag LOCUS_48890 4823 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 >Feature sequence235 1792 1265 gene locus_tag LOCUS_48900 1792 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 2413 1796 gene locus_tag LOCUS_48910 2413 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 6885 2416 gene locus_tag LOCUS_48920 6885 2416 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096580277.1 protein_id gnl|my_center|LOCUS_48920 >Feature sequence236 2313 580 gene locus_tag LOCUS_48930 2313 580 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_48930 4010 2874 gene locus_tag LOCUS_48940 4010 2874 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_48940 5530 4076 gene locus_tag LOCUS_48950 5530 4076 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_48950 5687 6142 gene locus_tag LOCUS_48960 5687 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 6830 6156 gene locus_tag LOCUS_48970 6830 6156 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_48970 >Feature sequence237 208 2625 gene locus_tag LOCUS_48980 gene galB 208 2625 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_48980 2724 3554 gene locus_tag LOCUS_48990 2724 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 5548 3581 gene locus_tag LOCUS_49000 5548 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 5784 5545 gene locus_tag LOCUS_49010 5784 5545 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_49010 6232 5786 gene locus_tag LOCUS_49020 6232 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 <7271 6611 gene locus_tag LOCUS_49030 <7271 6611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence238 <1 1385 gene locus_tag LOCUS_49040 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109145.1:beta-galactosidase 1394 4684 gene locus_tag LOCUS_49050 1394 4684 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_49050 6092 5214 gene locus_tag LOCUS_49060 6092 5214 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_49060 6738 6220 gene locus_tag LOCUS_49070 6738 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 >Feature sequence239 491 90 gene locus_tag LOCUS_49080 491 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 1712 573 gene locus_tag LOCUS_49090 1712 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 3631 1763 gene locus_tag LOCUS_49100 3631 1763 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_49100 6922 3710 gene locus_tag LOCUS_49110 6922 3710 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 protein_id gnl|my_center|LOCUS_49110 >Feature sequence240 2742 4619 gene locus_tag LOCUS_49120 gene mutA 2742 4619 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_49120 4619 6754 gene locus_tag LOCUS_49130 gene scpA 4619 6754 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759796.1 protein_id gnl|my_center|LOCUS_49130 >Feature sequence241 <1 1791 gene locus_tag LOCUS_49140 <1 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thioredoxin family protein 2633 1932 gene locus_tag LOCUS_49150 2633 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 3422 2691 gene locus_tag LOCUS_49160 3422 2691 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_49160 4523 3462 gene locus_tag LOCUS_49170 4523 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 5250 4621 gene locus_tag LOCUS_49180 5250 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 5800 5243 gene locus_tag LOCUS_49190 5800 5243 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086475.1 protein_id gnl|my_center|LOCUS_49190 5963 6850 gene locus_tag LOCUS_49200 5963 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 >Feature sequence242 351 599 gene locus_tag LOCUS_49210 351 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 703 1380 gene locus_tag LOCUS_49220 703 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 1636 1415 gene locus_tag LOCUS_49230 1636 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 1763 1978 gene locus_tag LOCUS_49240 1763 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 2771 2127 gene locus_tag LOCUS_49250 2771 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 3705 2776 gene locus_tag LOCUS_49260 3705 2776 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_49260 <6893 3712 gene locus_tag LOCUS_49270 <6893 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein >Feature sequence243 48 1577 gene locus_tag LOCUS_49280 48 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 1710 2264 gene locus_tag LOCUS_49290 1710 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 2359 3186 gene locus_tag LOCUS_49300 2359 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 3283 5433 gene locus_tag LOCUS_49310 3283 5433 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107937.1 protein_id gnl|my_center|LOCUS_49310 5585 6730 gene locus_tag LOCUS_49320 gene rhlE 5585 6730 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007135.1 protein_id gnl|my_center|LOCUS_49320 >Feature sequence244 1221 757 gene locus_tag LOCUS_49330 1221 757 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704963.1 protein_id gnl|my_center|LOCUS_49330 1656 2420 gene locus_tag LOCUS_49340 1656 2420 CDS product divalent heavy-metal cations transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775812.1 protein_id gnl|my_center|LOCUS_49340 2825 2457 gene locus_tag LOCUS_49350 2825 2457 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776732.1 protein_id gnl|my_center|LOCUS_49350 2975 3214 gene locus_tag LOCUS_49360 2975 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 3453 5150 gene locus_tag LOCUS_49370 gene kaiC 3453 5150 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_49370 5150 5470 gene locus_tag LOCUS_49380 5150 5470 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725098.1 protein_id gnl|my_center|LOCUS_49380 5475 5831 gene locus_tag LOCUS_49390 5475 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 >Feature sequence245 1763 213 gene locus_tag LOCUS_49400 1763 213 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_49400 2276 1992 gene locus_tag LOCUS_49410 2276 1992 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_49410 2412 3491 gene locus_tag LOCUS_49420 gene mutY 2412 3491 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_49420 3535 3963 gene locus_tag LOCUS_49430 gene ssb 3535 3963 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137264126.1 protein_id gnl|my_center|LOCUS_49430 3986 5317 gene locus_tag LOCUS_49440 3986 5317 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_49440 5314 5883 gene locus_tag LOCUS_49450 gene gldD 5314 5883 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_49450 >Feature sequence246 <1 928 gene locus_tag LOCUS_49460 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202520.1:endolytic transglycosylase MltG 1758 958 gene locus_tag LOCUS_49470 1758 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 3323 2097 gene locus_tag LOCUS_49480 gene aroA 3323 2097 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_49480 3518 4759 gene locus_tag LOCUS_49490 3518 4759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_49490 4852 5496 gene locus_tag LOCUS_49500 4852 5496 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_49500 6497 5472 gene locus_tag LOCUS_49510 6497 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 >Feature sequence247 3693 2422 gene locus_tag LOCUS_49520 3693 2422 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_49520 5011 3707 gene locus_tag LOCUS_49530 5011 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 >Feature sequence248 <1 1268 gene locus_tag LOCUS_49540 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767207.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1437 2021 gene locus_tag LOCUS_49550 1437 2021 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_49550 2184 3218 gene locus_tag LOCUS_49560 2184 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 >Feature sequence249 <1 773 gene locus_tag LOCUS_49570 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704837.1:beta-aspartyl-peptidase 1427 795 gene locus_tag LOCUS_49580 1427 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 1520 1885 gene locus_tag LOCUS_49590 1520 1885 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_49590 2038 2391 gene locus_tag LOCUS_49600 2038 2391 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_49600 2453 3067 gene locus_tag LOCUS_49610 2453 3067 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_49610 3474 3130 gene locus_tag LOCUS_49620 3474 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 3647 3474 gene locus_tag LOCUS_49630 3647 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 >Feature sequence250 <1 756 gene locus_tag LOCUS_49640 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657461.1:efflux RND transporter periplasmic adaptor subunit 815 3913 gene locus_tag LOCUS_49650 815 3913 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_49650 3910 5085 gene locus_tag LOCUS_49660 3910 5085 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_49660 5937 5089 gene locus_tag LOCUS_49670 5937 5089 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_49670 >Feature sequence251 1294 302 gene locus_tag LOCUS_49680 1294 302 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_49680 1526 3448 gene locus_tag LOCUS_49690 gene dxs 1526 3448 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_49690 3467 4192 gene locus_tag LOCUS_49700 gene recO 3467 4192 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_49700 4288 5349 gene locus_tag LOCUS_49710 gene prfB 4288 5349 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_49710 5593 5351 gene locus_tag LOCUS_49720 5593 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 5793 5590 gene locus_tag LOCUS_49730 5793 5590 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_49730 >Feature sequence252 <1 2891 gene locus_tag LOCUS_49740 <1 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029446868.1:two-component regulator propeller domain-containing protein 3243 5162 gene locus_tag LOCUS_49750 3243 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 >Feature sequence253 289 1272 gene locus_tag LOCUS_49760 289 1272 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 protein_id gnl|my_center|LOCUS_49760 1333 1977 gene locus_tag LOCUS_49770 1333 1977 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_49770 2142 3986 gene locus_tag LOCUS_49780 2142 3986 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_49780 >Feature sequence254 1308 22 gene locus_tag LOCUS_49790 1308 22 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_49790 1501 1872 gene locus_tag LOCUS_49800 1501 1872 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963525.1 protein_id gnl|my_center|LOCUS_49800 2060 2656 gene locus_tag LOCUS_49810 2060 2656 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_49810 3837 3151 gene locus_tag LOCUS_49820 3837 3151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020896.1 protein_id gnl|my_center|LOCUS_49820 4850 3930 gene locus_tag LOCUS_49830 4850 3930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064981.1 protein_id gnl|my_center|LOCUS_49830 5506 4898 gene locus_tag LOCUS_49840 5506 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 >Feature sequence255 1 261 gene locus_tag LOCUS_49850 1 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 258 611 gene locus_tag LOCUS_49860 258 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 669 1103 gene locus_tag LOCUS_49870 669 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 1316 2032 gene locus_tag LOCUS_49880 1316 2032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_49880 2040 2951 gene locus_tag LOCUS_49890 2040 2951 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_49890 3153 5555 gene locus_tag LOCUS_49900 3153 5555 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203530.1 protein_id gnl|my_center|LOCUS_49900 >Feature sequence256 553 107 gene locus_tag LOCUS_49910 553 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 1008 556 gene locus_tag LOCUS_49920 1008 556 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_49920 1213 2586 gene locus_tag LOCUS_49930 1213 2586 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_49930 <5528 2591 gene locus_tag LOCUS_49940 <5528 2591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173072481.1:ATP-binding cassette domain-containing protein >Feature sequence257 4718 3687 gene locus_tag LOCUS_49950 4718 3687 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_49950 5357 4770 gene locus_tag LOCUS_49960 5357 4770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897162.1 protein_id gnl|my_center|LOCUS_49960 >Feature sequence258 3476 2139 gene locus_tag LOCUS_49970 3476 2139 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_49970 4833 3547 gene locus_tag LOCUS_49980 4833 3547 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_49980 >Feature sequence259 968 396 gene locus_tag LOCUS_49990 968 396 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123673.1 protein_id gnl|my_center|LOCUS_49990 1158 979 gene locus_tag LOCUS_50000 1158 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 1191 1841 gene locus_tag LOCUS_50010 1191 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 <5210 1913 gene locus_tag LOCUS_50020 <5210 1913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941949.1:methyl-accepting chemotaxis protein >Feature sequence260 431 1996 gene locus_tag LOCUS_50030 431 1996 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_50030 2499 2128 gene locus_tag LOCUS_50040 2499 2128 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969671.1 protein_id gnl|my_center|LOCUS_50040 3003 2527 gene locus_tag LOCUS_50050 3003 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 3755 3000 gene locus_tag LOCUS_50060 3755 3000 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_50060 3922 4089 gene locus_tag LOCUS_50070 3922 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 >Feature sequence261 1104 2807 gene locus_tag LOCUS_50080 1104 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 2852 5101 gene locus_tag LOCUS_50090 2852 5101 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168127696.1 protein_id gnl|my_center|LOCUS_50090 >Feature sequence262 <1 888 gene locus_tag LOCUS_50100 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787540.1:serine hydroxymethyltransferase 1110 2282 gene locus_tag LOCUS_50110 1110 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 2571 2368 gene locus_tag LOCUS_50120 2571 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 2483 3292 gene locus_tag LOCUS_50130 2483 3292 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_50130 3855 3289 gene locus_tag LOCUS_50140 3855 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 4267 3845 gene locus_tag LOCUS_50150 4267 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 4880 4299 gene locus_tag LOCUS_50160 4880 4299 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_50160 >Feature sequence263 114 998 gene locus_tag LOCUS_50170 114 998 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_50170 1500 2006 gene locus_tag LOCUS_50180 1500 2006 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_50180 2376 2068 gene locus_tag LOCUS_50190 2376 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 3210 2962 gene locus_tag LOCUS_50200 3210 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 3448 3663 gene locus_tag LOCUS_50210 3448 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 4053 3814 gene locus_tag LOCUS_50220 4053 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 4154 4068 gene locus_tag LOCUS_t00330 4154 4068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4278 4205 gene locus_tag LOCUS_t00340 4278 4205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence264 <1 935 gene locus_tag LOCUS_50230 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107739.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 937 1848 gene locus_tag LOCUS_50240 937 1848 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_50240 2944 1973 gene locus_tag LOCUS_50250 2944 1973 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_50250 3760 3083 gene locus_tag LOCUS_50260 3760 3083 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 protein_id gnl|my_center|LOCUS_50260 4108 4659 gene locus_tag LOCUS_50270 4108 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 >Feature sequence265 3827 3000 gene locus_tag LOCUS_50280 3827 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 >Feature sequence266 124 1779 gene locus_tag LOCUS_50290 124 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 2883 1816 gene locus_tag LOCUS_50300 2883 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 3144 4025 gene locus_tag LOCUS_50310 3144 4025 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_50310 >Feature sequence267 2553 1201 gene locus_tag LOCUS_50320 gene lpdA 2553 1201 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_50320 3890 2562 gene locus_tag LOCUS_50330 gene sucB 3890 2562 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_50330 >Feature sequence268 1554 529 gene locus_tag LOCUS_50340 gene rhaT 1554 529 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_50340 3218 1845 gene locus_tag LOCUS_50350 gene murC 3218 1845 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972052.1 protein_id gnl|my_center|LOCUS_50350 >Feature sequence269 <1 1706 gene locus_tag LOCUS_50360 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760859.1:single-stranded-DNA-specific exonuclease RecJ 1925 2932 gene locus_tag LOCUS_50370 1925 2932 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_50370 <4551 2935 gene locus_tag LOCUS_50380 <4551 2935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108682.1:helix-hairpin-helix domain-containing protein >Feature sequence270 2334 1024 gene locus_tag LOCUS_50390 2334 1024 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_50390 <4480 2342 gene locus_tag LOCUS_50400 <4480 2342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107129.1:heparinase II/III family protein >Feature sequence271 2485 467 gene locus_tag LOCUS_50410 2485 467 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926991.1 protein_id gnl|my_center|LOCUS_50410 3243 2623 gene locus_tag LOCUS_50420 3243 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 3458 4231 gene locus_tag LOCUS_50430 3458 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390709.1 protein_id gnl|my_center|LOCUS_50430 >Feature sequence272 655 251 gene locus_tag LOCUS_50440 655 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 1714 782 gene locus_tag LOCUS_50450 1714 782 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_50450 2381 1716 gene locus_tag LOCUS_50460 gene hxpB 2381 1716 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_50460 2813 2394 gene locus_tag LOCUS_50470 2813 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 <4407 2826 gene locus_tag LOCUS_50480 <4407 2826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403289.1:ATP-dependent helicase >Feature sequence273 770 294 gene locus_tag LOCUS_50490 770 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 1791 850 gene locus_tag LOCUS_50500 gene mdh 1791 850 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791692.1 protein_id gnl|my_center|LOCUS_50500 3331 1877 gene locus_tag LOCUS_50510 3331 1877 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_50510 <4344 3372 gene locus_tag LOCUS_50520 <4344 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941165.1:ABC transporter permease >Feature sequence274 504 3293 gene locus_tag LOCUS_50530 504 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 >Feature sequence275 <1 564 gene locus_tag LOCUS_50540 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162903181.1:PKD domain-containing protein 949 3024 gene locus_tag LOCUS_50550 949 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 3292 3675 gene locus_tag LOCUS_50560 gene ndhC 3292 3675 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_50560 >Feature sequence276 >Feature sequence277 <1 1320 gene locus_tag LOCUS_50570 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937562.1:FAD-binding and (Fe-S)-binding domain-containing protein 1639 3465 gene locus_tag LOCUS_50580 1639 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 >Feature sequence278 238 247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 279 740 gene locus_tag LOCUS_50590 279 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50590 870 1481 gene locus_tag LOCUS_50600 870 1481 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 protein_id gnl|my_center|LOCUS_50600 1716 1483 gene locus_tag LOCUS_50610 1716 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 <3700 1898 gene locus_tag LOCUS_50620 <3700 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303083.1:alpha-galactosidase >Feature sequence279 1580 114 gene locus_tag LOCUS_50630 1580 114 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_50630 1809 2474 gene locus_tag LOCUS_50640 1809 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107993.1 protein_id gnl|my_center|LOCUS_50640 >Feature sequence280 53 553 gene locus_tag LOCUS_50650 53 553 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906354.1 protein_id gnl|my_center|LOCUS_50650 1942 581 gene locus_tag LOCUS_50660 gene mgtE 1942 581 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_50660 2727 1951 gene locus_tag LOCUS_50670 gene rsmA 2727 1951 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_50670 >Feature sequence281 524 1318 gene locus_tag LOCUS_50680 gene chbG 524 1318 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722720.1 protein_id gnl|my_center|LOCUS_50680 1396 3555 gene locus_tag LOCUS_50690 1396 3555 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_50690 >Feature sequence282 >Feature sequence283 2506 2243 gene locus_tag LOCUS_50700 2506 2243 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_50700 3484 2519 gene locus_tag LOCUS_50710 3484 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 >Feature sequence284 1634 2332 gene locus_tag LOCUS_50720 1634 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 2575 3210 gene locus_tag LOCUS_50730 2575 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 >Feature sequence285 850 251 gene locus_tag LOCUS_50740 850 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 <3410 963 gene locus_tag LOCUS_50750 <3410 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939885.1:PAS domain S-box protein >Feature sequence286 1019 132 gene locus_tag LOCUS_50760 gene fabD 1019 132 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_50760 1632 1144 gene locus_tag LOCUS_50770 1632 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 2045 1743 gene locus_tag LOCUS_50780 2045 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 <3407 2100 gene locus_tag LOCUS_50790 <3407 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108281.1:threonine synthase >Feature sequence287 354 2381 gene locus_tag LOCUS_50800 354 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 >Feature sequence288 684 52 gene locus_tag LOCUS_50810 684 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 1161 784 gene locus_tag LOCUS_50820 1161 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 1922 1164 gene locus_tag LOCUS_50830 1922 1164 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_50830 2444 2268 gene locus_tag LOCUS_50840 2444 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 2872 2465 gene locus_tag LOCUS_50850 2872 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 3375 2896 gene locus_tag LOCUS_50860 3375 2896 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360775.1 protein_id gnl|my_center|LOCUS_50860 >Feature sequence289 <1 1273 gene locus_tag LOCUS_50870 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767027.1:glycoside hydrolase family 127 protein 1390 2619 gene locus_tag LOCUS_50880 1390 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 2773 3321 gene locus_tag LOCUS_50890 2773 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 >Feature sequence290 1833 961 gene locus_tag LOCUS_50900 1833 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 2354 1830 gene locus_tag LOCUS_50910 2354 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 <3211 2357 gene locus_tag LOCUS_50920 <3211 2357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760868.1:DHH family phosphoesterase >Feature sequence291 610 65 gene locus_tag LOCUS_50930 610 65 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_50930 803 1798 gene locus_tag LOCUS_50940 803 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 1801 2688 gene locus_tag LOCUS_50950 gene galU 1801 2688 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_50950 >Feature sequence292 62 199 gene locus_tag LOCUS_50960 62 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 2368 227 gene locus_tag LOCUS_50970 2368 227 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172660227.1 protein_id gnl|my_center|LOCUS_50970 >Feature sequence293 776 1636 gene locus_tag LOCUS_50980 776 1636 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_50980 2035 1679 gene locus_tag LOCUS_50990 2035 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 >Feature sequence294 1193 30 gene locus_tag LOCUS_51000 1193 30 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_51000 >Feature sequence295 >Feature sequence296 1094 30 gene locus_tag LOCUS_51010 1094 30 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328062.1 protein_id gnl|my_center|LOCUS_51010 >Feature sequence297 263 >1195 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccactatggttcgattgggag >Feature sequence298 >Feature sequence299 5 >737 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccactatggttcgattgggag >Feature sequence300 >Feature sequence301 >Feature sequence302 >Feature sequence303 >Feature sequence304 264 188 gene locus_tag LOCUS_t00350 264 188 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 350 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence305 >Feature sequence306 <1 650 gene locus_tag LOCUS_51020 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918393.1:DUF1593 domain-containing protein >Feature sequence307 >Feature sequence308 >Feature sequence309 293 382 gene locus_tag LOCUS_t00360 293 382 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence310 >Feature sequence311 366 442 gene locus_tag LOCUS_t00370 366 442 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence312 <1 615 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccactatggttcgattgggag >Feature sequence313 >Feature sequence314 <1 >610 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccactatggttcgattgggag >Feature sequence315 >Feature sequence316 >Feature sequence317 257 182 gene locus_tag LOCUS_t00380 257 182 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence318 >Feature sequence319 >Feature sequence320 <1 551 gene locus_tag LOCUS_51030 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224948.1:amidohydrolase family protein >Feature sequence321 >Feature sequence322 >Feature sequence323 >Feature sequence324 >Feature sequence325 >Feature sequence326