>Feature sequence01 <1 1205 gene locus_tag LOCUS_00010 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941168.1:translational GTPase TypA 1212 1700 gene locus_tag LOCUS_00020 gene mscL 1212 1700 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_00020 1736 3742 gene locus_tag LOCUS_00030 1736 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6356 3729 gene locus_tag LOCUS_00040 gene clpB 6356 3729 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_00040 7051 6392 gene locus_tag LOCUS_00050 7051 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8114 7119 gene locus_tag LOCUS_00060 8114 7119 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_00060 9979 8111 gene locus_tag LOCUS_00070 gene selB 9979 8111 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_00070 11292 9982 gene locus_tag LOCUS_00080 gene selA 11292 9982 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_00080 11645 11319 gene locus_tag LOCUS_00090 gene trxA 11645 11319 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_00090 14363 11859 gene locus_tag LOCUS_00100 gene gyrA 14363 11859 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_00100 14759 14451 gene locus_tag LOCUS_00110 14759 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14775 15248 gene locus_tag LOCUS_00120 14775 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15245 15895 gene locus_tag LOCUS_00130 15245 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15895 16389 gene locus_tag LOCUS_00140 gene rimI 15895 16389 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_00140 16386 16967 gene locus_tag LOCUS_00150 16386 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17047 17364 gene locus_tag LOCUS_00160 gene rsfS 17047 17364 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816526.1 protein_id gnl|my_center|LOCUS_00160 17365 17520 gene locus_tag LOCUS_00170 17365 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17591 17791 gene locus_tag LOCUS_00180 17591 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17845 18840 gene locus_tag LOCUS_00190 17845 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18884 21892 gene locus_tag LOCUS_00200 18884 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00200 23365 21920 gene locus_tag LOCUS_00210 23365 21920 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_00210 23790 23518 gene locus_tag LOCUS_00220 23790 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24157 23792 gene locus_tag LOCUS_00230 24157 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25956 24154 gene locus_tag LOCUS_00240 25956 24154 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_00240 26606 26007 gene locus_tag LOCUS_00250 26606 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26682 29150 gene locus_tag LOCUS_00260 gene leuS 26682 29150 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_00260 29751 29957 gene locus_tag LOCUS_00270 29751 29957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30398 30009 gene locus_tag LOCUS_00280 30398 30009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31413 30469 gene locus_tag LOCUS_00290 31413 30469 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986613.1 protein_id gnl|my_center|LOCUS_00290 31469 33673 gene locus_tag LOCUS_00300 31469 33673 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_00300 34511 33618 gene locus_tag LOCUS_00310 34511 33618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35302 34550 gene locus_tag LOCUS_00320 35302 34550 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918285.1 protein_id gnl|my_center|LOCUS_00320 35803 35339 gene locus_tag LOCUS_00330 35803 35339 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143149.1 protein_id gnl|my_center|LOCUS_00330 36369 35815 gene locus_tag LOCUS_00340 36369 35815 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143150.1 protein_id gnl|my_center|LOCUS_00340 36613 36738 gene locus_tag LOCUS_00350 36613 36738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36973 36773 gene locus_tag LOCUS_00360 36973 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37748 37554 gene locus_tag LOCUS_00370 37748 37554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37962 38468 gene locus_tag LOCUS_00380 37962 38468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38465 38863 gene locus_tag LOCUS_00390 38465 38863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105252.1 protein_id gnl|my_center|LOCUS_00390 38865 39065 gene locus_tag LOCUS_00400 38865 39065 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_00400 39091 40071 gene locus_tag LOCUS_00410 39091 40071 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_00410 41767 40046 gene locus_tag LOCUS_00420 41767 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41826 42839 gene locus_tag LOCUS_00430 gene nadA 41826 42839 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_00430 42844 44376 gene locus_tag LOCUS_00440 42844 44376 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085328.1 protein_id gnl|my_center|LOCUS_00440 44369 45214 gene locus_tag LOCUS_00450 gene nadC 44369 45214 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_00450 45585 45211 gene locus_tag LOCUS_00460 45585 45211 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980551.1 protein_id gnl|my_center|LOCUS_00460 45629 46966 gene locus_tag LOCUS_00470 45629 46966 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_00470 47323 46985 gene locus_tag LOCUS_00480 47323 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 47399 47968 gene locus_tag LOCUS_00490 47399 47968 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_00490 47965 49350 gene locus_tag LOCUS_00500 47965 49350 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223436.1 protein_id gnl|my_center|LOCUS_00500 50687 49266 gene locus_tag LOCUS_00510 50687 49266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51025 50684 gene locus_tag LOCUS_00520 51025 50684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51657 51028 gene locus_tag LOCUS_00530 51657 51028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52511 51654 gene locus_tag LOCUS_00540 52511 51654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53374 52511 gene locus_tag LOCUS_00550 53374 52511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55446 53368 gene locus_tag LOCUS_00560 55446 53368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 56241 55450 gene locus_tag LOCUS_00570 gene cpaB 56241 55450 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_00570 56766 56254 gene locus_tag LOCUS_00580 56766 56254 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_00580 56995 56777 gene locus_tag LOCUS_00590 56995 56777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57137 56958 gene locus_tag LOCUS_00600 57137 56958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 57882 57178 gene locus_tag LOCUS_00610 57882 57178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 58086 59504 gene locus_tag LOCUS_00620 58086 59504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 59501 59698 gene locus_tag LOCUS_00630 59501 59698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59700 60623 gene locus_tag LOCUS_00640 59700 60623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60623 61660 gene locus_tag LOCUS_00650 60623 61660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 61648 62328 gene locus_tag LOCUS_00660 61648 62328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 63679 62330 gene locus_tag LOCUS_00670 63679 62330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 63731 64567 gene locus_tag LOCUS_00680 gene rsmI 63731 64567 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_00680 64591 66117 gene locus_tag LOCUS_00690 gene metG 64591 66117 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_00690 66117 67796 gene locus_tag LOCUS_00700 66117 67796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 67793 68560 gene locus_tag LOCUS_00710 67793 68560 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081106.1 protein_id gnl|my_center|LOCUS_00710 69390 68557 gene locus_tag LOCUS_00720 69390 68557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 69475 70200 gene locus_tag LOCUS_00730 gene ubiE 69475 70200 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_00730 70197 71141 gene locus_tag LOCUS_00740 70197 71141 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_00740 71161 71424 gene locus_tag LOCUS_00750 71161 71424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 71428 72198 gene locus_tag LOCUS_00760 gene tatC 71428 72198 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_00760 72211 73572 gene locus_tag LOCUS_00770 72211 73572 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393686.1 protein_id gnl|my_center|LOCUS_00770 73569 74438 gene locus_tag LOCUS_00780 gene ccsB 73569 74438 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_00780 74542 75207 gene locus_tag LOCUS_00790 74542 75207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 75226 76701 gene locus_tag LOCUS_00800 75226 76701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 78460 76769 gene locus_tag LOCUS_00810 78460 76769 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_00810 78459 79997 gene locus_tag LOCUS_00820 78459 79997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 79990 80322 gene locus_tag LOCUS_00830 79990 80322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 80319 81284 gene locus_tag LOCUS_00840 gene hemB 80319 81284 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_00840 81277 81858 gene locus_tag LOCUS_00850 81277 81858 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258361.1 protein_id gnl|my_center|LOCUS_00850 81855 83141 gene locus_tag LOCUS_00860 gene hemL 81855 83141 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_00860 83197 84501 gene locus_tag LOCUS_00870 gene hemA 83197 84501 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_00870 84491 86005 gene locus_tag LOCUS_00880 gene cobA 84491 86005 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_00880 86002 86784 gene locus_tag LOCUS_00890 86002 86784 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762947.1 protein_id gnl|my_center|LOCUS_00890 87009 86758 gene locus_tag LOCUS_00900 87009 86758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 87161 87748 gene locus_tag LOCUS_00910 87161 87748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88586 87777 gene locus_tag LOCUS_00920 88586 87777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 89686 88586 gene locus_tag LOCUS_00930 89686 88586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 90680 89811 gene locus_tag LOCUS_00940 gene rocF 90680 89811 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_00940 91120 90677 gene locus_tag LOCUS_00950 91120 90677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 91188 92210 gene locus_tag LOCUS_00960 91188 92210 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_00960 92207 93634 gene locus_tag LOCUS_00970 92207 93634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228438.1 protein_id gnl|my_center|LOCUS_00970 93631 94647 gene locus_tag LOCUS_00980 93631 94647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_00980 94644 95507 gene locus_tag LOCUS_00990 94644 95507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964024.1 protein_id gnl|my_center|LOCUS_00990 95504 96454 gene locus_tag LOCUS_01000 95504 96454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 97802 97032 gene locus_tag LOCUS_01010 97802 97032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 98908 97985 gene locus_tag LOCUS_01020 98908 97985 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_01020 98992 101244 gene locus_tag LOCUS_01030 98992 101244 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_01030 101376 102701 gene locus_tag LOCUS_01040 101376 102701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 102717 105842 gene locus_tag LOCUS_01050 gene fdh 102717 105842 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:103287..103289,aa:Sec) note codon on position 191 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01050 105843 106688 gene locus_tag LOCUS_01060 105843 106688 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145933610.1 protein_id gnl|my_center|LOCUS_01060 106692 107603 gene locus_tag LOCUS_01070 106692 107603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 107600 108475 gene locus_tag LOCUS_01080 gene fdhD 107600 108475 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_01080 109238 108450 gene locus_tag LOCUS_01090 gene pcaD 109238 108450 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113259.1 protein_id gnl|my_center|LOCUS_01090 110962 109235 gene locus_tag LOCUS_01100 gene polX 110962 109235 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_01100 110982 112106 gene locus_tag LOCUS_01110 110982 112106 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 protein_id gnl|my_center|LOCUS_01110 112675 112118 gene locus_tag LOCUS_01120 112675 112118 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142807.1 protein_id gnl|my_center|LOCUS_01120 113209 112700 gene locus_tag LOCUS_01130 113209 112700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113529 113206 gene locus_tag LOCUS_01140 113529 113206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 114297 113533 gene locus_tag LOCUS_01150 114297 113533 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 protein_id gnl|my_center|LOCUS_01150 114555 115286 gene locus_tag LOCUS_01160 114555 115286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115898 115326 gene locus_tag LOCUS_01170 115898 115326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 115956 116339 gene locus_tag LOCUS_01180 115956 116339 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 protein_id gnl|my_center|LOCUS_01180 116419 117174 gene locus_tag LOCUS_01190 gene fabG 116419 117174 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_01190 117174 118898 gene locus_tag LOCUS_01200 gene phaC 117174 118898 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_01200 118895 119245 gene locus_tag LOCUS_01210 118895 119245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 119313 119630 gene locus_tag LOCUS_01220 119313 119630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 121262 119670 gene locus_tag LOCUS_01230 121262 119670 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_01230 121748 122215 gene locus_tag LOCUS_01240 121748 122215 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_01240 122212 123270 gene locus_tag LOCUS_01250 gene kdd 122212 123270 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_01250 123291 124664 gene locus_tag LOCUS_01260 gene ablA 123291 124664 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902142.1 protein_id gnl|my_center|LOCUS_01260 124760 125581 gene locus_tag LOCUS_01270 124760 125581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 125626 126597 gene locus_tag LOCUS_01280 125626 126597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 127682 126594 gene locus_tag LOCUS_01290 127682 126594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 128723 128013 gene locus_tag LOCUS_01300 128723 128013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 129090 128755 gene locus_tag LOCUS_01310 gene yciH 129090 128755 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096377.1 protein_id gnl|my_center|LOCUS_01310 129138 129683 gene locus_tag LOCUS_01320 129138 129683 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_01320 130103 129684 gene locus_tag LOCUS_01330 130103 129684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 130532 130113 gene locus_tag LOCUS_01340 130532 130113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 131091 130633 gene locus_tag LOCUS_01350 131091 130633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 131429 131085 gene locus_tag LOCUS_01360 131429 131085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 135681 131458 gene locus_tag LOCUS_01370 135681 131458 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_01370 136804 135803 gene locus_tag LOCUS_01380 136804 135803 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_01380 137635 136823 gene locus_tag LOCUS_01390 137635 136823 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123168.1 protein_id gnl|my_center|LOCUS_01390 138342 137635 gene locus_tag LOCUS_01400 138342 137635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 139225 138380 gene locus_tag LOCUS_01410 139225 138380 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_01410 139334 140248 gene locus_tag LOCUS_01420 139334 140248 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114438.1 protein_id gnl|my_center|LOCUS_01420 140245 141087 gene locus_tag LOCUS_01430 140245 141087 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228182.1 protein_id gnl|my_center|LOCUS_01430 141084 142346 gene locus_tag LOCUS_01440 141084 142346 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_01440 142921 142370 gene locus_tag LOCUS_01450 142921 142370 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811316.1 protein_id gnl|my_center|LOCUS_01450 144240 142936 gene locus_tag LOCUS_01460 144240 142936 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_01460 144133 144843 gene locus_tag LOCUS_01470 gene ftsE 144133 144843 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173889.1 protein_id gnl|my_center|LOCUS_01470 144875 145690 gene locus_tag LOCUS_01480 gene ftsX 144875 145690 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_01480 145687 146625 gene locus_tag LOCUS_01490 145687 146625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 146622 147818 gene locus_tag LOCUS_01500 146622 147818 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_01500 147856 149205 gene locus_tag LOCUS_01510 147856 149205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 149206 150603 gene locus_tag LOCUS_01520 149206 150603 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391791.1 protein_id gnl|my_center|LOCUS_01520 152470 151289 gene locus_tag LOCUS_01530 152470 151289 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_01530 153253 152747 gene locus_tag LOCUS_01540 153253 152747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 154048 153317 gene locus_tag LOCUS_01550 154048 153317 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368457.1 protein_id gnl|my_center|LOCUS_01550 154130 156271 gene locus_tag LOCUS_01560 154130 156271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 156905 156243 gene locus_tag LOCUS_01570 156905 156243 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 protein_id gnl|my_center|LOCUS_01570 159609 156910 gene locus_tag LOCUS_01580 159609 156910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 160805 159756 gene locus_tag LOCUS_01590 160805 159756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 161929 160802 gene locus_tag LOCUS_01600 gene rodA 161929 160802 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_01600 166096 162920 gene locus_tag LOCUS_01610 166096 162920 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_01610 166394 166984 gene locus_tag LOCUS_01620 166394 166984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 167797 167219 gene locus_tag LOCUS_01630 167797 167219 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 protein_id gnl|my_center|LOCUS_01630 168206 167814 gene locus_tag LOCUS_01640 168206 167814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 169054 168206 gene locus_tag LOCUS_01650 gene minD 169054 168206 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_01650 169684 169061 gene locus_tag LOCUS_01660 169684 169061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 169580 169888 gene locus_tag LOCUS_01670 169580 169888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 170658 169852 gene locus_tag LOCUS_01680 gene minC 170658 169852 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_01680 170802 172826 gene locus_tag LOCUS_01690 170802 172826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 172819 173817 gene locus_tag LOCUS_01700 172819 173817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 174345 173770 gene locus_tag LOCUS_01710 174345 173770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 174409 175392 gene locus_tag LOCUS_01720 174409 175392 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_01720 176701 175370 gene locus_tag LOCUS_01730 176701 175370 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259740.1 protein_id gnl|my_center|LOCUS_01730 177641 176694 gene locus_tag LOCUS_01740 177641 176694 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113004.1 protein_id gnl|my_center|LOCUS_01740 178729 177638 gene locus_tag LOCUS_01750 178729 177638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 179499 178726 gene locus_tag LOCUS_01760 179499 178726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 180435 179506 gene locus_tag LOCUS_01770 180435 179506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 180539 181168 gene locus_tag LOCUS_01780 180539 181168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 181210 181854 gene locus_tag LOCUS_01790 181210 181854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 181969 182547 gene locus_tag LOCUS_01800 181969 182547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 183166 182558 gene locus_tag LOCUS_01810 gene recR 183166 182558 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_01810 183475 183167 gene locus_tag LOCUS_01820 183475 183167 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_01820 185082 183472 gene locus_tag LOCUS_01830 185082 183472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 185191 186873 gene locus_tag LOCUS_01840 185191 186873 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_01840 187122 186826 gene locus_tag LOCUS_01850 187122 186826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 187064 188509 gene locus_tag LOCUS_01860 187064 188509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 189555 188518 gene locus_tag LOCUS_01870 189555 188518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 190394 189552 gene locus_tag LOCUS_01880 190394 189552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 191448 190408 gene locus_tag LOCUS_01890 191448 190408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 191926 191537 gene locus_tag LOCUS_01900 191926 191537 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142305.1 protein_id gnl|my_center|LOCUS_01900 192903 191923 gene locus_tag LOCUS_01910 192903 191923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 194018 192903 gene locus_tag LOCUS_01920 gene lptG 194018 192903 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_01920 194755 194015 gene locus_tag LOCUS_01930 gene lptB 194755 194015 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143254.1 protein_id gnl|my_center|LOCUS_01930 195297 194752 gene locus_tag LOCUS_01940 195297 194752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 196496 195294 gene locus_tag LOCUS_01950 196496 195294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 197635 196493 gene locus_tag LOCUS_01960 197635 196493 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_01960 198363 197635 gene locus_tag LOCUS_01970 198363 197635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 199472 198360 gene locus_tag LOCUS_01980 gene lpxB 199472 198360 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_01980 200238 199474 gene locus_tag LOCUS_01990 gene lpxA 200238 199474 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_01990 200708 200235 gene locus_tag LOCUS_02000 gene fabZ 200708 200235 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_02000 201539 200712 gene locus_tag LOCUS_02010 gene lpxC 201539 200712 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_02010 202566 201532 gene locus_tag LOCUS_02020 gene lpxD 202566 201532 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521195.1 protein_id gnl|my_center|LOCUS_02020 202988 202584 gene locus_tag LOCUS_02030 202988 202584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 204253 202985 gene locus_tag LOCUS_02040 204253 202985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 205061 204258 gene locus_tag LOCUS_02050 205061 204258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 207342 205084 gene locus_tag LOCUS_02060 207342 205084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 212556 207418 gene locus_tag LOCUS_02070 212556 207418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 214526 212625 gene locus_tag LOCUS_02080 gene gyrB 214526 212625 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_02080 215362 214538 gene locus_tag LOCUS_02090 215362 214538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 216462 215359 gene locus_tag LOCUS_02100 gene recF 216462 215359 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_02100 217584 216469 gene locus_tag LOCUS_02110 gene dnaN 217584 216469 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_02110 219189 217828 gene locus_tag LOCUS_02120 gene dnaA 219189 217828 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_02120 219619 219753 gene locus_tag LOCUS_02130 gene rpmH 219619 219753 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_02130 219819 220085 gene locus_tag LOCUS_02140 219819 220085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 220320 221135 gene locus_tag LOCUS_02150 220320 221135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 221141 221767 gene locus_tag LOCUS_02160 221141 221767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 221911 223104 gene locus_tag LOCUS_02170 gene mnmE 221911 223104 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_02170 223105 224949 gene locus_tag LOCUS_02180 gene mnmG 223105 224949 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_02180 224946 225626 gene locus_tag LOCUS_02190 gene rsmG 224946 225626 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886662.1 protein_id gnl|my_center|LOCUS_02190 225790 227196 gene locus_tag LOCUS_02200 225790 227196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 227379 227975 gene locus_tag LOCUS_02210 gene soj 227379 227975 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_02210 227972 228862 gene locus_tag LOCUS_02220 227972 228862 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_02220 229810 230274 gene locus_tag LOCUS_02230 229810 230274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 230415 230972 gene locus_tag LOCUS_02240 230415 230972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 231132 231317 gene locus_tag LOCUS_02250 231132 231317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 231290 231943 gene locus_tag LOCUS_02260 gene thiE 231290 231943 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879566.1 protein_id gnl|my_center|LOCUS_02260 231940 232707 gene locus_tag LOCUS_02270 gene thiD 231940 232707 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_02270 232704 233693 gene locus_tag LOCUS_02280 gene trpS 232704 233693 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_02280 234217 233708 gene locus_tag LOCUS_02290 234217 233708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147157153.1 protein_id gnl|my_center|LOCUS_02290 235655 234459 gene locus_tag LOCUS_02300 235655 234459 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_02300 235713 238916 gene locus_tag LOCUS_02310 235713 238916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 238913 239317 gene locus_tag LOCUS_02320 238913 239317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 239356 242739 gene locus_tag LOCUS_02330 239356 242739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 242726 243163 gene locus_tag LOCUS_02340 242726 243163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 245000 243123 gene locus_tag LOCUS_02350 gene mrdA 245000 243123 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02350 245518 244997 gene locus_tag LOCUS_02360 245518 244997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 246269 245508 gene locus_tag LOCUS_02370 gene mreC 246269 245508 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_02370 246951 246355 gene locus_tag LOCUS_02380 246951 246355 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_02380 247355 246948 gene locus_tag LOCUS_02390 247355 246948 CDS product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711645.1 protein_id gnl|my_center|LOCUS_02390 247956 247348 gene locus_tag LOCUS_02400 gene nadD 247956 247348 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_02400 249215 247953 gene locus_tag LOCUS_02410 gene obgE 249215 247953 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_02410 249628 249314 gene locus_tag LOCUS_02420 gene rpmA 249628 249314 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 protein_id gnl|my_center|LOCUS_02420 249712 250074 gene locus_tag LOCUS_02430 249712 250074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 250151 251395 gene locus_tag LOCUS_02440 gene fabF 250151 251395 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405457.1 protein_id gnl|my_center|LOCUS_02440 251408 252109 gene locus_tag LOCUS_02450 gene rnc 251408 252109 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_02450 252106 255678 gene locus_tag LOCUS_02460 gene smc 252106 255678 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_02460 255671 257239 gene locus_tag LOCUS_02470 gene purH 255671 257239 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817232.1 protein_id gnl|my_center|LOCUS_02470 258209 257268 gene locus_tag LOCUS_02480 258209 257268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 258272 258661 gene locus_tag LOCUS_02490 gene gloA 258272 258661 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237787.1 protein_id gnl|my_center|LOCUS_02490 258752 260023 gene locus_tag LOCUS_02500 gene hisS 258752 260023 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_02500 260023 260451 gene locus_tag LOCUS_02510 260023 260451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 260451 261038 gene locus_tag LOCUS_02520 gene gmhA 260451 261038 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_02520 261035 262024 gene locus_tag LOCUS_02530 gene rfaE1 261035 262024 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_02530 262128 262514 gene locus_tag LOCUS_02540 262128 262514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 262511 263722 gene locus_tag LOCUS_02550 262511 263722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_02550 263726 264610 gene locus_tag LOCUS_02560 263726 264610 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_02560 264603 265622 gene locus_tag LOCUS_02570 264603 265622 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032807985.1 protein_id gnl|my_center|LOCUS_02570 265619 266539 gene locus_tag LOCUS_02580 265619 266539 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_02580 266544 267533 gene locus_tag LOCUS_02590 266544 267533 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495222.1 protein_id gnl|my_center|LOCUS_02590 267514 268413 gene locus_tag LOCUS_02600 267514 268413 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_02600 268424 270205 gene locus_tag LOCUS_02610 gene aspS 268424 270205 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_02610 270195 270605 gene locus_tag LOCUS_02620 270195 270605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 270575 270961 gene locus_tag LOCUS_02630 270575 270961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 270964 272139 gene locus_tag LOCUS_02640 270964 272139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114987.1 protein_id gnl|my_center|LOCUS_02640 272634 272116 gene locus_tag LOCUS_02650 272634 272116 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_02650 273503 272631 gene locus_tag LOCUS_02660 273503 272631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 275112 273505 gene locus_tag LOCUS_02670 275112 273505 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_02670 276110 275115 gene locus_tag LOCUS_02680 276110 275115 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_02680 277192 276179 gene locus_tag LOCUS_02690 277192 276179 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_02690 277191 278711 gene locus_tag LOCUS_02700 277191 278711 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_02700 279153 278689 gene locus_tag LOCUS_02710 279153 278689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 280181 279483 gene locus_tag LOCUS_02720 280181 279483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 280227 280736 gene locus_tag LOCUS_02730 gene rpiB 280227 280736 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_02730 280736 281983 gene locus_tag LOCUS_02740 gene glyA 280736 281983 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_02740 281970 283037 gene locus_tag LOCUS_02750 281970 283037 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_02750 283034 283540 gene locus_tag LOCUS_02760 283034 283540 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 protein_id gnl|my_center|LOCUS_02760 286378 283895 gene locus_tag LOCUS_02770 286378 283895 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_02770 286528 287187 gene locus_tag LOCUS_02780 286528 287187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 287184 287624 gene locus_tag LOCUS_02790 287184 287624 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_02790 287621 288646 gene locus_tag LOCUS_02800 287621 288646 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_02800 288648 289769 gene locus_tag LOCUS_02810 gene wecB 288648 289769 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306792.1 protein_id gnl|my_center|LOCUS_02810 289786 289953 gene locus_tag LOCUS_02820 289786 289953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 289954 290256 gene locus_tag LOCUS_02830 289954 290256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 290263 290991 gene locus_tag LOCUS_02840 gene atpB 290263 290991 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_02840 291013 291297 gene locus_tag LOCUS_02850 291013 291297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 291308 291739 gene locus_tag LOCUS_02860 291308 291739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 291736 292221 gene locus_tag LOCUS_02870 291736 292221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 292222 292764 gene locus_tag LOCUS_02880 gene atpH 292222 292764 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_02880 292789 294288 gene locus_tag LOCUS_02890 gene atpA 292789 294288 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_02890 294304 295179 gene locus_tag LOCUS_02900 294304 295179 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_02900 295207 296670 gene locus_tag LOCUS_02910 gene atpD 295207 296670 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02910 296692 297063 gene locus_tag LOCUS_02920 296692 297063 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_02920 297109 297513 gene locus_tag LOCUS_02930 297109 297513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 297503 298855 gene locus_tag LOCUS_02940 gene murA 297503 298855 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_02940 298881 299861 gene locus_tag LOCUS_02950 298881 299861 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_02950 299873 300526 gene locus_tag LOCUS_02960 299873 300526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 300526 301170 gene locus_tag LOCUS_02970 300526 301170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 301176 302447 gene locus_tag LOCUS_02980 301176 302447 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_02980 302444 303595 gene locus_tag LOCUS_02990 gene nifS 302444 303595 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_02990 303653 304066 gene locus_tag LOCUS_03000 303653 304066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 304079 304414 gene locus_tag LOCUS_03010 304079 304414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 304407 304769 gene locus_tag LOCUS_03020 gene bldG 304407 304769 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_03020 304766 305179 gene locus_tag LOCUS_03030 gene rsbW 304766 305179 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_03030 305176 305925 gene locus_tag LOCUS_03040 305176 305925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 305963 306457 gene locus_tag LOCUS_03050 305963 306457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 306500 309109 gene locus_tag LOCUS_03060 gene alaS 306500 309109 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191158.1 protein_id gnl|my_center|LOCUS_03060 309106 309810 gene locus_tag LOCUS_03070 309106 309810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 309816 311258 gene locus_tag LOCUS_03080 309816 311258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 311233 312432 gene locus_tag LOCUS_03090 311233 312432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 313151 312444 gene locus_tag LOCUS_03100 313151 312444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 314881 313172 gene locus_tag LOCUS_03110 314881 313172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 316059 314878 gene locus_tag LOCUS_03120 316059 314878 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_03120 316163 316249 gene locus_tag LOCUS_t00010 316163 316249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 317026 317334 gene locus_tag LOCUS_03130 317026 317334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 317321 317965 gene locus_tag LOCUS_03140 317321 317965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 319147 318269 gene locus_tag LOCUS_03150 319147 318269 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence02 1018 1242 gene locus_tag LOCUS_03160 1018 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1615 1340 gene locus_tag LOCUS_03170 1615 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3282 1615 gene locus_tag LOCUS_03180 gene ettA 3282 1615 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_03180 3403 4443 gene locus_tag LOCUS_03190 3403 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4520 6052 gene locus_tag LOCUS_03200 4520 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6195 7223 gene locus_tag LOCUS_03210 6195 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7370 7672 gene locus_tag LOCUS_03220 7370 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 7747 7947 gene locus_tag LOCUS_03230 7747 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03230 7944 10070 gene locus_tag LOCUS_03240 7944 10070 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_03240 10942 10067 gene locus_tag LOCUS_03250 10942 10067 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_03250 11288 11100 gene locus_tag LOCUS_03260 11288 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11717 25849 gene locus_tag LOCUS_03270 11717 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 25842 26708 gene locus_tag LOCUS_03280 25842 26708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 26692 27720 gene locus_tag LOCUS_03290 26692 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 27839 28084 gene locus_tag LOCUS_03300 27839 28084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 28122 29021 gene locus_tag LOCUS_03310 28122 29021 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706023.1 protein_id gnl|my_center|LOCUS_03310 29067 30401 gene locus_tag LOCUS_03320 29067 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 30409 30972 gene locus_tag LOCUS_03330 30409 30972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 31678 30935 gene locus_tag LOCUS_03340 31678 30935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 32135 31731 gene locus_tag LOCUS_03350 32135 31731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 32220 32295 gene locus_tag LOCUS_t00020 32220 32295 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32322 33107 gene locus_tag LOCUS_03360 32322 33107 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_03360 33108 35105 gene locus_tag LOCUS_03370 33108 35105 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_03370 35116 36204 gene locus_tag LOCUS_03380 gene csaB 35116 36204 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_03380 36201 38948 gene locus_tag LOCUS_03390 gene ileS 36201 38948 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_03390 40045 38945 gene locus_tag LOCUS_03400 gene tgt 40045 38945 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_03400 40957 40061 gene locus_tag LOCUS_03410 40957 40061 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840103.1 protein_id gnl|my_center|LOCUS_03410 41408 40935 gene locus_tag LOCUS_03420 gene lspA 41408 40935 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529575.1 protein_id gnl|my_center|LOCUS_03420 42114 41386 gene locus_tag LOCUS_03430 42114 41386 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_03430 42158 42997 gene locus_tag LOCUS_03440 gene lgt 42158 42997 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948555.1 protein_id gnl|my_center|LOCUS_03440 43004 43669 gene locus_tag LOCUS_03450 43004 43669 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703455.1 protein_id gnl|my_center|LOCUS_03450 43706 44116 gene locus_tag LOCUS_03460 43706 44116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 44120 44629 gene locus_tag LOCUS_03470 44120 44629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 44679 45689 gene locus_tag LOCUS_03480 gene leuB 44679 45689 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 protein_id gnl|my_center|LOCUS_03480 45746 46348 gene locus_tag LOCUS_03490 gene flgG 45746 46348 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974468.1 protein_id gnl|my_center|LOCUS_03490 46329 47084 gene locus_tag LOCUS_03500 gene flgG 46329 47084 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_03500 47077 47244 gene locus_tag LOCUS_03510 47077 47244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 47234 47914 gene locus_tag LOCUS_03520 47234 47914 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460743.1 protein_id gnl|my_center|LOCUS_03520 47898 48203 gene locus_tag LOCUS_03530 47898 48203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 49571 48759 gene locus_tag LOCUS_03540 49571 48759 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417233.1 protein_id gnl|my_center|LOCUS_03540 51118 49568 gene locus_tag LOCUS_03550 gene gpmI 51118 49568 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140758.1 protein_id gnl|my_center|LOCUS_03550 51863 51108 gene locus_tag LOCUS_03560 gene tpiA 51863 51108 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_03560 53038 51860 gene locus_tag LOCUS_03570 53038 51860 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_03570 53975 53028 gene locus_tag LOCUS_03580 gene gap 53975 53028 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_03580 54958 54044 gene locus_tag LOCUS_03590 54958 54044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 55227 54955 gene locus_tag LOCUS_03600 55227 54955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 55290 56663 gene locus_tag LOCUS_03610 55290 56663 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804157.1 protein_id gnl|my_center|LOCUS_03610 57373 56984 gene locus_tag LOCUS_03620 57373 56984 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_03620 58572 57370 gene locus_tag LOCUS_03630 58572 57370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 59610 58651 gene locus_tag LOCUS_03640 gene prsA 59610 58651 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710058.1 protein_id gnl|my_center|LOCUS_03640 60112 59720 gene locus_tag LOCUS_03650 60112 59720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 61676 60480 gene locus_tag LOCUS_03660 61676 60480 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_03660 62231 61686 gene locus_tag LOCUS_03670 62231 61686 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929422.1 protein_id gnl|my_center|LOCUS_03670 62264 62941 gene locus_tag LOCUS_03680 62264 62941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 62938 63420 gene locus_tag LOCUS_03690 62938 63420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 63430 64839 gene locus_tag LOCUS_03700 63430 64839 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 protein_id gnl|my_center|LOCUS_03700 64836 65825 gene locus_tag LOCUS_03710 gene egtD 64836 65825 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_03710 66431 65808 gene locus_tag LOCUS_03720 66431 65808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 67138 66428 gene locus_tag LOCUS_03730 67138 66428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 68121 67246 gene locus_tag LOCUS_03740 68121 67246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03740 68720 68118 gene locus_tag LOCUS_03750 68720 68118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721932.1 protein_id gnl|my_center|LOCUS_03750 68764 70866 gene locus_tag LOCUS_03760 gene ppk1 68764 70866 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_03760 70970 73888 gene locus_tag LOCUS_03770 70970 73888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 74967 74506 gene locus_tag LOCUS_03780 74967 74506 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141664.1 protein_id gnl|my_center|LOCUS_03780 75043 75534 gene locus_tag LOCUS_03790 75043 75534 CDS product 1-methylthio-xylulose 5-phosphate sulfo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_03790 76366 75512 gene locus_tag LOCUS_03800 76366 75512 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930841.1 protein_id gnl|my_center|LOCUS_03800 76725 76366 gene locus_tag LOCUS_03810 gene grxD 76725 76366 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_03810 76967 76722 gene locus_tag LOCUS_03820 76967 76722 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144400.1 protein_id gnl|my_center|LOCUS_03820 77233 76976 gene locus_tag LOCUS_03830 77233 76976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 77910 77275 gene locus_tag LOCUS_03840 77910 77275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 79274 77904 gene locus_tag LOCUS_03850 79274 77904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 79443 81719 gene locus_tag LOCUS_03860 79443 81719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 81723 82700 gene locus_tag LOCUS_03870 81723 82700 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_03870 83934 83005 gene locus_tag LOCUS_03880 83934 83005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_03880 84734 83931 gene locus_tag LOCUS_03890 84734 83931 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_03890 84868 85467 gene locus_tag LOCUS_03900 84868 85467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 85530 86324 gene locus_tag LOCUS_03910 85530 86324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 86321 87493 gene locus_tag LOCUS_03920 gene rnd 86321 87493 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391103.1 protein_id gnl|my_center|LOCUS_03920 87490 90219 gene locus_tag LOCUS_03930 gene acnA 87490 90219 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_03930 92976 90904 gene locus_tag LOCUS_03940 92976 90904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 94545 93034 gene locus_tag LOCUS_03950 gene aceF 94545 93034 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_03950 97251 94555 gene locus_tag LOCUS_03960 gene aceE 97251 94555 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095425939.1 protein_id gnl|my_center|LOCUS_03960 98176 97280 gene locus_tag LOCUS_03970 98176 97280 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_03970 99247 98210 gene locus_tag LOCUS_03980 99247 98210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 99442 101133 gene locus_tag LOCUS_03990 gene thiC 99442 101133 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038418.1 protein_id gnl|my_center|LOCUS_03990 101090 101584 gene locus_tag LOCUS_04000 101090 101584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 102555 101929 gene locus_tag LOCUS_04010 102555 101929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 102658 102792 gene locus_tag LOCUS_04020 102658 102792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 102820 103188 gene locus_tag LOCUS_04030 102820 103188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 103277 106471 gene locus_tag LOCUS_04040 103277 106471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_04040 106566 109682 gene locus_tag LOCUS_04050 106566 109682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_04050 109693 111015 gene locus_tag LOCUS_04060 109693 111015 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_04060 111012 111407 gene locus_tag LOCUS_04070 111012 111407 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_04070 111441 111827 gene locus_tag LOCUS_04080 111441 111827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 112065 111763 gene locus_tag LOCUS_04090 112065 111763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 112051 112686 gene locus_tag LOCUS_04100 112051 112686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 114470 112818 gene locus_tag LOCUS_04110 114470 112818 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_04110 114596 116080 gene locus_tag LOCUS_04120 114596 116080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 116549 116088 gene locus_tag LOCUS_04130 116549 116088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 117066 117971 gene locus_tag LOCUS_04140 117066 117971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 117990 118736 gene locus_tag LOCUS_04150 117990 118736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 118930 120078 gene locus_tag LOCUS_04160 118930 120078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 120830 120075 gene locus_tag LOCUS_04170 120830 120075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 121239 121997 gene locus_tag LOCUS_04180 121239 121997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 121994 122368 gene locus_tag LOCUS_04190 121994 122368 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_04190 122573 122376 gene locus_tag LOCUS_04200 122573 122376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 123799 122708 gene locus_tag LOCUS_04210 123799 122708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 124337 123789 gene locus_tag LOCUS_04220 124337 123789 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_04220 124381 124851 gene locus_tag LOCUS_04230 124381 124851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 125093 125758 gene locus_tag LOCUS_04240 125093 125758 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_04240 126061 126597 gene locus_tag LOCUS_04250 126061 126597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 128105 126705 gene locus_tag LOCUS_04260 gene lnt 128105 126705 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344846.1 protein_id gnl|my_center|LOCUS_04260 128241 128909 gene locus_tag LOCUS_04270 128241 128909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 128996 130165 gene locus_tag LOCUS_04280 128996 130165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 131692 130220 gene locus_tag LOCUS_04290 131692 130220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 132777 133835 gene locus_tag LOCUS_04300 132777 133835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 134722 134159 gene locus_tag LOCUS_04310 134722 134159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 135174 135722 gene locus_tag LOCUS_04320 135174 135722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 136155 136080 gene locus_tag LOCUS_t00030 136155 136080 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 136264 136647 gene locus_tag LOCUS_04330 136264 136647 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_04330 136638 137510 gene locus_tag LOCUS_04340 136638 137510 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870495.1 protein_id gnl|my_center|LOCUS_04340 137511 138296 gene locus_tag LOCUS_04350 137511 138296 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_04350 138293 139117 gene locus_tag LOCUS_04360 138293 139117 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_04360 140700 139609 gene locus_tag LOCUS_04370 140700 139609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 141925 140690 gene locus_tag LOCUS_04380 141925 140690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 141987 142469 gene locus_tag LOCUS_04390 gene purE 141987 142469 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722253.1 protein_id gnl|my_center|LOCUS_04390 142469 143602 gene locus_tag LOCUS_04400 gene purK 142469 143602 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196775.1 protein_id gnl|my_center|LOCUS_04400 145209 144064 gene locus_tag LOCUS_04410 145209 144064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 146362 145199 gene locus_tag LOCUS_04420 146362 145199 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_04420 147267 146362 gene locus_tag LOCUS_04430 147267 146362 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_04430 149217 147271 gene locus_tag LOCUS_04440 149217 147271 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258686.1 protein_id gnl|my_center|LOCUS_04440 149993 149214 gene locus_tag LOCUS_04450 149993 149214 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_04450 150057 150854 gene locus_tag LOCUS_04460 150057 150854 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126923991.1 protein_id gnl|my_center|LOCUS_04460 150851 151591 gene locus_tag LOCUS_04470 150851 151591 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126923992.1 protein_id gnl|my_center|LOCUS_04470 155308 151814 gene locus_tag LOCUS_04480 gene mfd 155308 151814 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989376.1 protein_id gnl|my_center|LOCUS_04480 155442 155828 gene locus_tag LOCUS_04490 155442 155828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 157676 156393 gene locus_tag LOCUS_04500 157676 156393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 157721 158977 gene locus_tag LOCUS_04510 157721 158977 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836881.1 protein_id gnl|my_center|LOCUS_04510 159911 158910 gene locus_tag LOCUS_04520 159911 158910 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_04520 160230 160529 gene locus_tag LOCUS_04530 160230 160529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 161377 160538 gene locus_tag LOCUS_04540 161377 160538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 163203 161374 gene locus_tag LOCUS_04550 163203 161374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 163272 164393 gene locus_tag LOCUS_04560 163272 164393 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_04560 164394 165074 gene locus_tag LOCUS_04570 164394 165074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 165142 166686 gene locus_tag LOCUS_04580 gene murJ 165142 166686 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_04580 166726 167496 gene locus_tag LOCUS_04590 gene rfbF 166726 167496 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_04590 167493 168464 gene locus_tag LOCUS_04600 167493 168464 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_04600 168495 169838 gene locus_tag LOCUS_04610 gene rfbH 168495 169838 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_04610 169845 172049 gene locus_tag LOCUS_04620 169845 172049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 172042 173307 gene locus_tag LOCUS_04630 172042 173307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 173312 174304 gene locus_tag LOCUS_04640 173312 174304 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705135.1 protein_id gnl|my_center|LOCUS_04640 174307 175491 gene locus_tag LOCUS_04650 174307 175491 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 protein_id gnl|my_center|LOCUS_04650 176303 175500 gene locus_tag LOCUS_04660 176303 175500 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_04660 177280 176300 gene locus_tag LOCUS_04670 177280 176300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_04670 179083 177281 gene locus_tag LOCUS_04680 gene ilvB 179083 177281 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182646.1 protein_id gnl|my_center|LOCUS_04680 180135 179080 gene locus_tag LOCUS_04690 180135 179080 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_04690 181335 180142 gene locus_tag LOCUS_04700 181335 180142 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942618.1 protein_id gnl|my_center|LOCUS_04700 182334 181351 gene locus_tag LOCUS_04710 182334 181351 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_04710 183010 182336 gene locus_tag LOCUS_04720 183010 182336 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_04720 184160 183000 gene locus_tag LOCUS_04730 gene neuC 184160 183000 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 protein_id gnl|my_center|LOCUS_04730 185206 184157 gene locus_tag LOCUS_04740 gene neuB 185206 184157 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_04740 186348 185203 gene locus_tag LOCUS_04750 186348 185203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 188627 186393 gene locus_tag LOCUS_04760 188627 186393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 190652 188631 gene locus_tag LOCUS_04770 190652 188631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 191265 190810 gene locus_tag LOCUS_04780 191265 190810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 192506 191289 gene locus_tag LOCUS_04790 192506 191289 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_04790 192613 192855 gene locus_tag LOCUS_04800 192613 192855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 192852 193322 gene locus_tag LOCUS_04810 192852 193322 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391796.1 protein_id gnl|my_center|LOCUS_04810 194204 193350 gene locus_tag LOCUS_04820 194204 193350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 194749 194204 gene locus_tag LOCUS_04830 194749 194204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 195362 194730 gene locus_tag LOCUS_04840 195362 194730 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_04840 195980 195417 gene locus_tag LOCUS_04850 gene rfbC 195980 195417 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403366.1 protein_id gnl|my_center|LOCUS_04850 196090 197418 gene locus_tag LOCUS_04860 196090 197418 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021808.1 protein_id gnl|my_center|LOCUS_04860 197408 198271 gene locus_tag LOCUS_04870 gene rfbD 197408 198271 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_04870 198307 198657 gene locus_tag LOCUS_04880 198307 198657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 198733 200295 gene locus_tag LOCUS_04890 198733 200295 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_04890 200292 201032 gene locus_tag LOCUS_04900 200292 201032 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_04900 201089 201766 gene locus_tag LOCUS_04910 201089 201766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 201915 202883 gene locus_tag LOCUS_04920 gene gmd 201915 202883 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_04920 202885 203829 gene locus_tag LOCUS_04930 gene rmd 202885 203829 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114107.1 protein_id gnl|my_center|LOCUS_04930 203829 204425 gene locus_tag LOCUS_04940 203829 204425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 204461 205804 gene locus_tag LOCUS_04950 204461 205804 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_04950 205808 206650 gene locus_tag LOCUS_04960 205808 206650 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_04960 206654 207814 gene locus_tag LOCUS_04970 206654 207814 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_04970 208213 209379 gene locus_tag LOCUS_04980 gene sucC 208213 209379 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881049.1 protein_id gnl|my_center|LOCUS_04980 209394 210272 gene locus_tag LOCUS_04990 gene sucD 209394 210272 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_04990 210454 214416 gene locus_tag LOCUS_05000 210454 214416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 214507 214713 gene locus_tag LOCUS_05010 214507 214713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 215056 214778 gene locus_tag LOCUS_05020 215056 214778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 215281 215913 gene locus_tag LOCUS_05030 gene lexA 215281 215913 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_05030 215867 217063 gene locus_tag LOCUS_05040 215867 217063 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032280.1 protein_id gnl|my_center|LOCUS_05040 217060 218313 gene locus_tag LOCUS_05050 217060 218313 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392633.1 protein_id gnl|my_center|LOCUS_05050 218342 218680 gene locus_tag LOCUS_05060 218342 218680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 219261 219055 gene locus_tag LOCUS_05070 219261 219055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 219370 219663 gene locus_tag LOCUS_05080 219370 219663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 219670 220491 gene locus_tag LOCUS_05090 gene panC 219670 220491 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_05090 220488 221678 gene locus_tag LOCUS_05100 gene coaBC 220488 221678 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_05100 221678 222445 gene locus_tag LOCUS_05110 221678 222445 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_05110 222575 223627 gene locus_tag LOCUS_05120 222575 223627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 223860 225047 gene locus_tag LOCUS_05130 223860 225047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence03 3744 907 gene locus_tag LOCUS_05140 3744 907 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_05140 5702 3753 gene locus_tag LOCUS_05150 gene tkt 5702 3753 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_05150 6008 8575 gene locus_tag LOCUS_05160 6008 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 8624 9460 gene locus_tag LOCUS_05170 8624 9460 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_05170 9462 10595 gene locus_tag LOCUS_05180 9462 10595 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_05180 13364 11187 gene locus_tag LOCUS_05190 13364 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 13776 13462 gene locus_tag LOCUS_05200 13776 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 13873 14118 gene locus_tag LOCUS_05210 13873 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 14108 15256 gene locus_tag LOCUS_05220 14108 15256 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_05220 15253 18690 gene locus_tag LOCUS_05230 15253 18690 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_05230 18683 19999 gene locus_tag LOCUS_05240 18683 19999 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_05240 20035 21477 gene locus_tag LOCUS_05250 20035 21477 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_05250 22702 21638 gene locus_tag LOCUS_05260 22702 21638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 23170 22769 gene locus_tag LOCUS_05270 23170 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 24360 23341 gene locus_tag LOCUS_05280 24360 23341 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530060.1 protein_id gnl|my_center|LOCUS_05280 25212 24658 gene locus_tag LOCUS_05290 25212 24658 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_05290 26697 25288 gene locus_tag LOCUS_05300 26697 25288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 26912 28117 gene locus_tag LOCUS_05310 26912 28117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 29056 28133 gene locus_tag LOCUS_05320 29056 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 29482 29111 gene locus_tag LOCUS_05330 29482 29111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444835.1 protein_id gnl|my_center|LOCUS_05330 29879 29493 gene locus_tag LOCUS_05340 29879 29493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 30352 30134 gene locus_tag LOCUS_05350 30352 30134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 30681 30349 gene locus_tag LOCUS_05360 30681 30349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 30825 31334 gene locus_tag LOCUS_05370 30825 31334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 32863 31367 gene locus_tag LOCUS_05380 32863 31367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 33408 32992 gene locus_tag LOCUS_05390 33408 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 33625 33550 gene locus_tag LOCUS_t00040 33625 33550 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 33700 33627 gene locus_tag LOCUS_t00050 33700 33627 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33716 33886 gene locus_tag LOCUS_05400 33716 33886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 34030 35082 gene locus_tag LOCUS_05410 34030 35082 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_05410 35084 36268 gene locus_tag LOCUS_05420 35084 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 36272 37297 gene locus_tag LOCUS_05430 36272 37297 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_05430 37335 39497 gene locus_tag LOCUS_05440 gene pcrA 37335 39497 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_05440 39500 40231 gene locus_tag LOCUS_05450 gene dapB 39500 40231 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936082.1 protein_id gnl|my_center|LOCUS_05450 40228 41226 gene locus_tag LOCUS_05460 gene asd 40228 41226 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_05460 41223 42440 gene locus_tag LOCUS_05470 gene dapG 41223 42440 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392581.1 protein_id gnl|my_center|LOCUS_05470 42444 43319 gene locus_tag LOCUS_05480 gene dapA 42444 43319 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583510.1 protein_id gnl|my_center|LOCUS_05480 43316 44068 gene locus_tag LOCUS_05490 43316 44068 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_05490 44071 45102 gene locus_tag LOCUS_05500 44071 45102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 45387 45587 gene locus_tag LOCUS_05510 45387 45587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 45731 46807 gene locus_tag LOCUS_05520 gene ribD 45731 46807 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05520 46842 47399 gene locus_tag LOCUS_05530 46842 47399 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_05530 47396 47860 gene locus_tag LOCUS_05540 47396 47860 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_05540 47851 48873 gene locus_tag LOCUS_05550 47851 48873 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545565.1 protein_id gnl|my_center|LOCUS_05550 48882 49907 gene locus_tag LOCUS_05560 48882 49907 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_05560 50908 49904 gene locus_tag LOCUS_05570 50908 49904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 51067 51396 gene locus_tag LOCUS_05580 51067 51396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 51383 52360 gene locus_tag LOCUS_05590 gene arsB 51383 52360 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_05590 52357 52788 gene locus_tag LOCUS_05600 52357 52788 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_05600 53968 52742 gene locus_tag LOCUS_05610 53968 52742 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494218.1 protein_id gnl|my_center|LOCUS_05610 54241 55653 gene locus_tag LOCUS_05620 54241 55653 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_05620 55650 56147 gene locus_tag LOCUS_05630 gene ribE 55650 56147 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_05630 56475 57566 gene locus_tag LOCUS_05640 gene mtnA 56475 57566 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_05640 57563 58564 gene locus_tag LOCUS_05650 57563 58564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 58610 60046 gene locus_tag LOCUS_05660 gene purB 58610 60046 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_05660 60059 61249 gene locus_tag LOCUS_05670 60059 61249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 61242 63527 gene locus_tag LOCUS_05680 gene purL 61242 63527 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947405.1 protein_id gnl|my_center|LOCUS_05680 63524 64294 gene locus_tag LOCUS_05690 gene purQ 63524 64294 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868862.1 protein_id gnl|my_center|LOCUS_05690 64291 64653 gene locus_tag LOCUS_05700 64291 64653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 64650 65675 gene locus_tag LOCUS_05710 64650 65675 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147266.1 protein_id gnl|my_center|LOCUS_05710 65672 66820 gene locus_tag LOCUS_05720 65672 66820 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249158.1 protein_id gnl|my_center|LOCUS_05720 66865 67407 gene locus_tag LOCUS_05730 gene tpx 66865 67407 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_05730 67416 68957 gene locus_tag LOCUS_05740 gene guaA 67416 68957 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_05740 68959 70260 gene locus_tag LOCUS_05750 gene purD 68959 70260 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_05750 70296 70946 gene locus_tag LOCUS_05760 70296 70946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 70952 72325 gene locus_tag LOCUS_05770 gene purF 70952 72325 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_05770 72962 72456 gene locus_tag LOCUS_05780 72962 72456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 73523 73017 gene locus_tag LOCUS_05790 73523 73017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 74368 73520 gene locus_tag LOCUS_05800 74368 73520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037429.1 protein_id gnl|my_center|LOCUS_05800 75801 74386 gene locus_tag LOCUS_05810 75801 74386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 76490 75867 gene locus_tag LOCUS_05820 gene bluB 76490 75867 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_05820 77317 76487 gene locus_tag LOCUS_05830 gene panB 77317 76487 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_05830 78806 77307 gene locus_tag LOCUS_05840 78806 77307 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266820.1 protein_id gnl|my_center|LOCUS_05840 78842 79903 gene locus_tag LOCUS_05850 gene purM 78842 79903 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257146.1 protein_id gnl|my_center|LOCUS_05850 79900 81003 gene locus_tag LOCUS_05860 79900 81003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 82200 81037 gene locus_tag LOCUS_05870 gene ahbC 82200 81037 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_05870 83188 82193 gene locus_tag LOCUS_05880 83188 82193 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_05880 84445 83504 gene locus_tag LOCUS_05890 84445 83504 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887517.1 protein_id gnl|my_center|LOCUS_05890 85740 84442 gene locus_tag LOCUS_05900 85740 84442 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_05900 86897 85737 gene locus_tag LOCUS_05910 86897 85737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 88018 87125 gene locus_tag LOCUS_05920 gene thrB 88018 87125 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_05920 89201 88008 gene locus_tag LOCUS_05930 gene thrC 89201 88008 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_05930 90097 89444 gene locus_tag LOCUS_05940 90097 89444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 90635 91894 gene locus_tag LOCUS_05950 90635 91894 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_05950 93075 91891 gene locus_tag LOCUS_05960 93075 91891 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965252.1 protein_id gnl|my_center|LOCUS_05960 94304 93072 gene locus_tag LOCUS_05970 gene argJ 94304 93072 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_05970 95250 94282 gene locus_tag LOCUS_05980 gene argC 95250 94282 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_05980 96665 95247 gene locus_tag LOCUS_05990 gene argH 96665 95247 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908327.1 protein_id gnl|my_center|LOCUS_05990 97891 96674 gene locus_tag LOCUS_06000 97891 96674 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068275.1 protein_id gnl|my_center|LOCUS_06000 98361 97888 gene locus_tag LOCUS_06010 gene argR 98361 97888 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_06010 99161 98358 gene locus_tag LOCUS_06020 gene argF 99161 98358 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_06020 99189 99359 gene locus_tag LOCUS_06030 99189 99359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 99343 100203 gene locus_tag LOCUS_06040 gene argB 99343 100203 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_06040 102128 100533 gene locus_tag LOCUS_06050 102128 100533 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 protein_id gnl|my_center|LOCUS_06050 103658 102624 gene locus_tag LOCUS_06060 gene tsaD 103658 102624 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_06060 104932 103667 gene locus_tag LOCUS_06070 104932 103667 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_06070 105834 104929 gene locus_tag LOCUS_06080 105834 104929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 107564 105831 gene locus_tag LOCUS_06090 gene thrS 107564 105831 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_06090 107648 107911 gene locus_tag LOCUS_06100 107648 107911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 109004 108063 gene locus_tag LOCUS_06110 109004 108063 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329145.1 protein_id gnl|my_center|LOCUS_06110 109452 109012 gene locus_tag LOCUS_06120 109452 109012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 109633 110688 gene locus_tag LOCUS_06130 gene pstS 109633 110688 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_06130 110690 111724 gene locus_tag LOCUS_06140 gene pstC 110690 111724 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_06140 111721 112575 gene locus_tag LOCUS_06150 gene pstA 111721 112575 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_06150 112721 112900 gene locus_tag LOCUS_06160 112721 112900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 113012 113218 gene locus_tag LOCUS_06170 113012 113218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 113309 113737 gene locus_tag LOCUS_06180 113309 113737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 113823 114461 gene locus_tag LOCUS_06190 113823 114461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 114571 115161 gene locus_tag LOCUS_06200 114571 115161 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523127.1 protein_id gnl|my_center|LOCUS_06200 115158 115910 gene locus_tag LOCUS_06210 115158 115910 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_06210 115914 116747 gene locus_tag LOCUS_06220 gene menB 115914 116747 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_06220 116744 117787 gene locus_tag LOCUS_06230 116744 117787 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730444.1 protein_id gnl|my_center|LOCUS_06230 117784 118965 gene locus_tag LOCUS_06240 gene hadC 117784 118965 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_06240 118977 120245 gene locus_tag LOCUS_06250 118977 120245 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_06250 120242 121033 gene locus_tag LOCUS_06260 120242 121033 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_06260 121049 121837 gene locus_tag LOCUS_06270 121049 121837 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_06270 121834 122352 gene locus_tag LOCUS_06280 121834 122352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 122817 124217 gene locus_tag LOCUS_06290 122817 124217 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_06290 124416 124634 gene locus_tag LOCUS_06300 124416 124634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 125043 125279 gene locus_tag LOCUS_06310 125043 125279 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264174.1 protein_id gnl|my_center|LOCUS_06310 125276 125506 gene locus_tag LOCUS_06320 125276 125506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 125599 126675 gene locus_tag LOCUS_06330 125599 126675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 126887 127198 gene locus_tag LOCUS_06340 126887 127198 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_06340 128127 127216 gene locus_tag LOCUS_06350 128127 127216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 128285 128800 gene locus_tag LOCUS_06360 128285 128800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 128797 130266 gene locus_tag LOCUS_06370 gene ctaD 128797 130266 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102008.1 protein_id gnl|my_center|LOCUS_06370 130263 131003 gene locus_tag LOCUS_06380 130263 131003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 131473 131009 gene locus_tag LOCUS_06390 131473 131009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 132112 131522 gene locus_tag LOCUS_06400 132112 131522 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_06400 132374 133984 gene locus_tag LOCUS_06410 132374 133984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 135667 133985 gene locus_tag LOCUS_06420 135667 133985 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_06420 136117 135905 gene locus_tag LOCUS_06430 136117 135905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 136157 136606 gene locus_tag LOCUS_06440 136157 136606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 136623 137381 gene locus_tag LOCUS_06450 136623 137381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 137381 138106 gene locus_tag LOCUS_06460 137381 138106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 138103 139170 gene locus_tag LOCUS_06470 138103 139170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 139201 146109 gene locus_tag LOCUS_06480 139201 146109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 146109 147386 gene locus_tag LOCUS_06490 146109 147386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 147383 148225 gene locus_tag LOCUS_06500 147383 148225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 148222 149073 gene locus_tag LOCUS_06510 148222 149073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence04 869 1123 gene locus_tag LOCUS_06520 869 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1995 1231 gene locus_tag LOCUS_06530 1995 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2669 2199 gene locus_tag LOCUS_06540 2669 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4862 2679 gene locus_tag LOCUS_06550 4862 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5145 5513 gene locus_tag LOCUS_06560 5145 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5743 5510 gene locus_tag LOCUS_06570 5743 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7143 7418 gene locus_tag LOCUS_06580 7143 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7616 8056 gene locus_tag LOCUS_06590 7616 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8025 8222 gene locus_tag LOCUS_06600 8025 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8895 9917 gene locus_tag LOCUS_06610 gene bfmBAA 8895 9917 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_06610 9927 10955 gene locus_tag LOCUS_06620 gene bfmBAA 9927 10955 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 protein_id gnl|my_center|LOCUS_06620 10946 11953 gene locus_tag LOCUS_06630 10946 11953 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_06630 12114 13499 gene locus_tag LOCUS_06640 gene bfmBB 12114 13499 CDS product branched-chain alpha-keto dehydrogenase complex dihydrolipoyllysine-residue (2-methylpropanoyl)transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230323.1 protein_id gnl|my_center|LOCUS_06640 13863 13507 gene locus_tag LOCUS_06650 13863 13507 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 protein_id gnl|my_center|LOCUS_06650 14071 13844 gene locus_tag LOCUS_06660 14071 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 14988 14122 gene locus_tag LOCUS_06670 14988 14122 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_06670 15021 15386 gene locus_tag LOCUS_06680 gene queD 15021 15386 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082502.1 protein_id gnl|my_center|LOCUS_06680 15392 15967 gene locus_tag LOCUS_06690 15392 15967 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_06690 15964 16581 gene locus_tag LOCUS_06700 15964 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 16571 17407 gene locus_tag LOCUS_06710 16571 17407 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_06710 17404 18639 gene locus_tag LOCUS_06720 17404 18639 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_06720 19160 18648 gene locus_tag LOCUS_06730 19160 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 19223 20599 gene locus_tag LOCUS_06740 19223 20599 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_06740 20599 21831 gene locus_tag LOCUS_06750 20599 21831 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_06750 21824 22882 gene locus_tag LOCUS_06760 21824 22882 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391704.1 protein_id gnl|my_center|LOCUS_06760 22901 24757 gene locus_tag LOCUS_06770 22901 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 24761 26077 gene locus_tag LOCUS_06780 gene pepP 24761 26077 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444958.1 protein_id gnl|my_center|LOCUS_06780 26074 26919 gene locus_tag LOCUS_06790 26074 26919 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_06790 28230 26908 gene locus_tag LOCUS_06800 28230 26908 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_06800 30258 28255 gene locus_tag LOCUS_06810 30258 28255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 30872 30285 gene locus_tag LOCUS_06820 30872 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 31927 30995 gene locus_tag LOCUS_06830 gene trxB 31927 30995 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032139808.1 protein_id gnl|my_center|LOCUS_06830 31987 32826 gene locus_tag LOCUS_06840 31987 32826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 32823 33500 gene locus_tag LOCUS_06850 32823 33500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 33503 34300 gene locus_tag LOCUS_06860 33503 34300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 34990 34217 gene locus_tag LOCUS_06870 34990 34217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354811.1 protein_id gnl|my_center|LOCUS_06870 35904 34987 gene locus_tag LOCUS_06880 35904 34987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768225.1 protein_id gnl|my_center|LOCUS_06880 36626 35901 gene locus_tag LOCUS_06890 36626 35901 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_06890 37470 36634 gene locus_tag LOCUS_06900 37470 36634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 39806 37467 gene locus_tag LOCUS_06910 39806 37467 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_06910 40505 39813 gene locus_tag LOCUS_06920 40505 39813 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_06920 41939 40515 gene locus_tag LOCUS_06930 41939 40515 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_06930 43279 41942 gene locus_tag LOCUS_06940 gene pmbA 43279 41942 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_06940 44663 43272 gene locus_tag LOCUS_06950 gene tldD 44663 43272 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_06950 46039 44678 gene locus_tag LOCUS_06960 gene dacB 46039 44678 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_06960 48287 46005 gene locus_tag LOCUS_06970 48287 46005 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_06970 48282 48584 gene locus_tag LOCUS_06980 48282 48584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 49315 48581 gene locus_tag LOCUS_06990 49315 48581 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974439.1 protein_id gnl|my_center|LOCUS_06990 52918 49319 gene locus_tag LOCUS_07000 52918 49319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 53502 53789 gene locus_tag LOCUS_07010 53502 53789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 54812 54381 gene locus_tag LOCUS_07020 54812 54381 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990797.1 protein_id gnl|my_center|LOCUS_07020 55604 54978 gene locus_tag LOCUS_07030 55604 54978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 55771 55685 gene locus_tag LOCUS_t00060 55771 55685 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55859 56707 gene locus_tag LOCUS_07040 55859 56707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 57658 56717 gene locus_tag LOCUS_07050 57658 56717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089451.1 protein_id gnl|my_center|LOCUS_07050 58597 57668 gene locus_tag LOCUS_07060 58597 57668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_07060 59522 58674 gene locus_tag LOCUS_07070 59522 58674 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_07070 61182 59566 gene locus_tag LOCUS_07080 61182 59566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 62069 61179 gene locus_tag LOCUS_07090 62069 61179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 62643 62083 gene locus_tag LOCUS_07100 62643 62083 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039144.1 protein_id gnl|my_center|LOCUS_07100 63091 62657 gene locus_tag LOCUS_07110 63091 62657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 63122 63889 gene locus_tag LOCUS_07120 63122 63889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 63901 64794 gene locus_tag LOCUS_07130 63901 64794 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403322.1 protein_id gnl|my_center|LOCUS_07130 64794 65243 gene locus_tag LOCUS_07140 gene dtd 64794 65243 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_07140 66710 65235 gene locus_tag LOCUS_07150 66710 65235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 66799 67554 gene locus_tag LOCUS_07160 66799 67554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 67573 68259 gene locus_tag LOCUS_07170 67573 68259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 69462 68269 gene locus_tag LOCUS_07180 gene rpoD 69462 68269 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_07180 71267 69483 gene locus_tag LOCUS_07190 71267 69483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 71350 72564 gene locus_tag LOCUS_07200 71350 72564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 72567 73544 gene locus_tag LOCUS_07210 72567 73544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 73544 74356 gene locus_tag LOCUS_07220 73544 74356 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_07220 74360 76192 gene locus_tag LOCUS_07230 gene cysC 74360 76192 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_07230 77535 76195 gene locus_tag LOCUS_07240 77535 76195 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_07240 78198 77725 gene locus_tag LOCUS_07250 78198 77725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 78898 78254 gene locus_tag LOCUS_07260 78898 78254 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532259.1 protein_id gnl|my_center|LOCUS_07260 80026 78935 gene locus_tag LOCUS_07270 gene rlmN 80026 78935 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_07270 80693 80040 gene locus_tag LOCUS_07280 80693 80040 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_07280 81049 80690 gene locus_tag LOCUS_07290 81049 80690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 81048 82001 gene locus_tag LOCUS_07300 81048 82001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 83304 81955 gene locus_tag LOCUS_07310 83304 81955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 84167 83304 gene locus_tag LOCUS_07320 gene prfB 84167 83304 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 84114 84392 gene locus_tag LOCUS_07330 84114 84392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 84512 85405 gene locus_tag LOCUS_07340 84512 85405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 88049 85428 gene locus_tag LOCUS_07350 gene secA 88049 85428 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_07350 90558 88099 gene locus_tag LOCUS_07360 90558 88099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 91726 90599 gene locus_tag LOCUS_07370 91726 90599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 91933 91751 gene locus_tag LOCUS_07380 91933 91751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 92756 91947 gene locus_tag LOCUS_07390 92756 91947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 94087 92762 gene locus_tag LOCUS_07400 94087 92762 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172674.1 protein_id gnl|my_center|LOCUS_07400 95516 94140 gene locus_tag LOCUS_07410 gene rimO 95516 94140 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_07410 96021 95530 gene locus_tag LOCUS_07420 96021 95530 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_07420 96837 96046 gene locus_tag LOCUS_07430 96837 96046 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144381.1 protein_id gnl|my_center|LOCUS_07430 96915 97967 gene locus_tag LOCUS_07440 gene mnmA 96915 97967 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_07440 99059 97971 gene locus_tag LOCUS_07450 gene mqnC 99059 97971 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_07450 99885 99043 gene locus_tag LOCUS_07460 99885 99043 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_07460 101035 99878 gene locus_tag LOCUS_07470 gene mqnE 101035 99878 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_07470 101695 101099 gene locus_tag LOCUS_07480 101695 101099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 103923 101692 gene locus_tag LOCUS_07490 103923 101692 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_07490 103959 105050 gene locus_tag LOCUS_07500 103959 105050 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971927.1 protein_id gnl|my_center|LOCUS_07500 105063 105914 gene locus_tag LOCUS_07510 105063 105914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 106829 106113 gene locus_tag LOCUS_07520 106829 106113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 108490 106937 gene locus_tag LOCUS_07530 108490 106937 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_07530 108374 108619 gene locus_tag LOCUS_07540 108374 108619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 108665 108955 gene locus_tag LOCUS_07550 108665 108955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 109078 108842 gene locus_tag LOCUS_07560 109078 108842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 109062 109634 gene locus_tag LOCUS_07570 109062 109634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 109631 110338 gene locus_tag LOCUS_07580 109631 110338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 110335 111744 gene locus_tag LOCUS_07590 gene adeK 110335 111744 CDS product multidrug efflux RND transporter outer membrane channel subunit AdeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_07590 111749 113050 gene locus_tag LOCUS_07600 111749 113050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 113055 114257 gene locus_tag LOCUS_07610 113055 114257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_07610 114257 115453 gene locus_tag LOCUS_07620 114257 115453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 115446 116153 gene locus_tag LOCUS_07630 115446 116153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140495.1 protein_id gnl|my_center|LOCUS_07630 116159 117430 gene locus_tag LOCUS_07640 116159 117430 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_07640 117763 119613 gene locus_tag LOCUS_07650 gene dnaK 117763 119613 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_07650 119699 120220 gene locus_tag LOCUS_07660 119699 120220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 120225 121235 gene locus_tag LOCUS_07670 120225 121235 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_07670 121290 123101 gene locus_tag LOCUS_07680 121290 123101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_07680 123111 123815 gene locus_tag LOCUS_07690 123111 123815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048140.1 protein_id gnl|my_center|LOCUS_07690 123819 125372 gene locus_tag LOCUS_07700 123819 125372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 125985 125725 gene locus_tag LOCUS_07710 125985 125725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 126747 126079 gene locus_tag LOCUS_07720 126747 126079 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_07720 127334 126765 gene locus_tag LOCUS_07730 127334 126765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 127221 127502 gene locus_tag LOCUS_07740 127221 127502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 127611 128780 gene locus_tag LOCUS_07750 gene acdA 127611 128780 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_07750 128892 129413 gene locus_tag LOCUS_07760 128892 129413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 130304 129504 gene locus_tag LOCUS_07770 130304 129504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 130407 130916 gene locus_tag LOCUS_07780 130407 130916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 132441 131590 gene locus_tag LOCUS_07790 132441 131590 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_07790 133931 132492 gene locus_tag LOCUS_07800 133931 132492 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298365.1 protein_id gnl|my_center|LOCUS_07800 134039 136177 gene locus_tag LOCUS_07810 134039 136177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 136224 137669 gene locus_tag LOCUS_07820 gene lpdA 136224 137669 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888996.1 protein_id gnl|my_center|LOCUS_07820 137681 140401 gene locus_tag LOCUS_07830 137681 140401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 140405 141079 gene locus_tag LOCUS_07840 gene lipB 140405 141079 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_07840 141103 141999 gene locus_tag LOCUS_07850 gene lipA 141103 141999 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_07850 142024 145227 gene locus_tag LOCUS_07860 142024 145227 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_07860 145387 146586 gene locus_tag LOCUS_07870 145387 146586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence05 51 866 gene locus_tag LOCUS_07880 gene rlmB 51 866 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_07880 1003 1653 gene locus_tag LOCUS_07890 gene sigH 1003 1653 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_07890 2410 2078 gene locus_tag LOCUS_07900 2410 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2510 2435 gene locus_tag LOCUS_t00070 2510 2435 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2632 2719 gene locus_tag LOCUS_t00080 2632 2719 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2733 2806 gene locus_tag LOCUS_t00090 2733 2806 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2817 2891 gene locus_tag LOCUS_t00100 2817 2891 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4016 2973 gene locus_tag LOCUS_07910 4016 2973 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_07910 4112 5410 gene locus_tag LOCUS_07920 gene lysA 4112 5410 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_07920 6471 5407 gene locus_tag LOCUS_07930 6471 5407 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_07930 7090 6461 gene locus_tag LOCUS_07940 7090 6461 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_07940 8270 7083 gene locus_tag LOCUS_07950 8270 7083 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889455.1 protein_id gnl|my_center|LOCUS_07950 9613 8288 gene locus_tag LOCUS_07960 9613 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 10357 9620 gene locus_tag LOCUS_07970 10357 9620 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_07970 11543 10386 gene locus_tag LOCUS_07980 11543 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13096 12176 gene locus_tag LOCUS_07990 13096 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 13195 14802 gene locus_tag LOCUS_08000 13195 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 14817 14893 gene locus_tag LOCUS_t00110 14817 14893 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15180 15255 gene locus_tag LOCUS_t00120 15180 15255 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15281 15520 gene locus_tag LOCUS_08010 15281 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 15527 16135 gene locus_tag LOCUS_08020 gene nusG 15527 16135 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_08020 16235 16660 gene locus_tag LOCUS_08030 gene rplK 16235 16660 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_08030 16662 17363 gene locus_tag LOCUS_08040 gene rplA 16662 17363 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_08040 17612 18142 gene locus_tag LOCUS_08050 gene rplJ 17612 18142 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_08050 18167 18535 gene locus_tag LOCUS_08060 gene rplL 18167 18535 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_08060 18657 21068 gene locus_tag LOCUS_08070 18657 21068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 21855 21058 gene locus_tag LOCUS_08080 gene ygiD 21855 21058 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212189.1 protein_id gnl|my_center|LOCUS_08080 21933 22442 gene locus_tag LOCUS_08090 21933 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 23199 22423 gene locus_tag LOCUS_08100 23199 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 23695 23249 gene locus_tag LOCUS_08110 23695 23249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 25902 23797 gene locus_tag LOCUS_08120 25902 23797 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_08120 26584 26051 gene locus_tag LOCUS_08130 26584 26051 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_08130 26626 27837 gene locus_tag LOCUS_08140 26626 27837 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257953.1 protein_id gnl|my_center|LOCUS_08140 27838 28674 gene locus_tag LOCUS_08150 27838 28674 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_08150 28661 29773 gene locus_tag LOCUS_08160 28661 29773 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_08160 29842 30663 gene locus_tag LOCUS_08170 gene whiG 29842 30663 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_08170 30714 31034 gene locus_tag LOCUS_08180 30714 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 31041 32741 gene locus_tag LOCUS_08190 31041 32741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 32738 33067 gene locus_tag LOCUS_08200 32738 33067 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390454.1 protein_id gnl|my_center|LOCUS_08200 33119 35680 gene locus_tag LOCUS_08210 33119 35680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 35728 36636 gene locus_tag LOCUS_08220 gene ftsY 35728 36636 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_08220 36723 37763 gene locus_tag LOCUS_08230 gene recA 36723 37763 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_08230 37766 38272 gene locus_tag LOCUS_08240 37766 38272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 38217 38927 gene locus_tag LOCUS_08250 38217 38927 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_08250 39073 40074 gene locus_tag LOCUS_08260 39073 40074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 39986 40528 gene locus_tag LOCUS_08270 gene hpt 39986 40528 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_08270 40519 41823 gene locus_tag LOCUS_08280 40519 41823 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369315.1 protein_id gnl|my_center|LOCUS_08280 41820 43082 gene locus_tag LOCUS_08290 41820 43082 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 protein_id gnl|my_center|LOCUS_08290 43126 44799 gene locus_tag LOCUS_08300 gene fliF 43126 44799 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_08300 44809 45879 gene locus_tag LOCUS_08310 gene fliG 44809 45879 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556889.1 protein_id gnl|my_center|LOCUS_08310 45886 46746 gene locus_tag LOCUS_08320 45886 46746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 46756 48066 gene locus_tag LOCUS_08330 gene fliI 46756 48066 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_08330 48066 48524 gene locus_tag LOCUS_08340 48066 48524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 48521 49183 gene locus_tag LOCUS_08350 48521 49183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 49311 50495 gene locus_tag LOCUS_08360 49311 50495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 50492 51067 gene locus_tag LOCUS_08370 50492 51067 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776675.1 protein_id gnl|my_center|LOCUS_08370 52704 51064 gene locus_tag LOCUS_08380 52704 51064 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 protein_id gnl|my_center|LOCUS_08380 52947 53378 gene locus_tag LOCUS_08390 52947 53378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 53582 54397 gene locus_tag LOCUS_08400 53582 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 54404 55933 gene locus_tag LOCUS_08410 54404 55933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 55942 56415 gene locus_tag LOCUS_08420 55942 56415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 56420 56824 gene locus_tag LOCUS_08430 56420 56824 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_08430 56924 58765 gene locus_tag LOCUS_08440 gene flgE 56924 58765 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_08440 58778 59062 gene locus_tag LOCUS_08450 58778 59062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 59144 59983 gene locus_tag LOCUS_08460 59144 59983 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_08460 59983 60750 gene locus_tag LOCUS_08470 59983 60750 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_08470 60758 61768 gene locus_tag LOCUS_08480 gene fliM 60758 61768 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_08480 61765 62673 gene locus_tag LOCUS_08490 61765 62673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 62683 63036 gene locus_tag LOCUS_08500 62683 63036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 63033 63845 gene locus_tag LOCUS_08510 gene fliP 63033 63845 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_08510 63846 64115 gene locus_tag LOCUS_08520 gene fliQ 63846 64115 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_08520 64125 64904 gene locus_tag LOCUS_08530 gene fliR 64125 64904 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_08530 65947 64934 gene locus_tag LOCUS_08540 65947 64934 CDS product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029662.1 protein_id gnl|my_center|LOCUS_08540 66204 67160 gene locus_tag LOCUS_08550 gene flhB 66204 67160 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_08550 67166 69268 gene locus_tag LOCUS_08560 gene flhA 67166 69268 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_08560 69271 69936 gene locus_tag LOCUS_08570 69271 69936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 70016 70378 gene locus_tag LOCUS_08580 gene cheY 70016 70378 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_08580 70375 70986 gene locus_tag LOCUS_08590 70375 70986 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_08590 71023 72972 gene locus_tag LOCUS_08600 71023 72972 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_08600 72977 73480 gene locus_tag LOCUS_08610 72977 73480 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_08610 73545 74390 gene locus_tag LOCUS_08620 73545 74390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 74450 75115 gene locus_tag LOCUS_08630 74450 75115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 75115 76374 gene locus_tag LOCUS_08640 75115 76374 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 protein_id gnl|my_center|LOCUS_08640 76450 79581 gene locus_tag LOCUS_08650 gene dnaE2 76450 79581 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908228.1 protein_id gnl|my_center|LOCUS_08650 80605 79595 gene locus_tag LOCUS_08660 80605 79595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 81508 80708 gene locus_tag LOCUS_08670 81508 80708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 81554 82108 gene locus_tag LOCUS_08680 81554 82108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 82922 82137 gene locus_tag LOCUS_08690 gene wtpA 82922 82137 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684400.1 protein_id gnl|my_center|LOCUS_08690 83013 83249 gene locus_tag LOCUS_08700 83013 83249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 83227 84726 gene locus_tag LOCUS_08710 gene rlmD 83227 84726 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105019.1 protein_id gnl|my_center|LOCUS_08710 84707 85000 gene locus_tag LOCUS_08720 gene gatC 84707 85000 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_08720 85002 86486 gene locus_tag LOCUS_08730 gene gatA 85002 86486 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_08730 86483 87946 gene locus_tag LOCUS_08740 gene gatB 86483 87946 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_08740 87959 90310 gene locus_tag LOCUS_08750 87959 90310 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_08750 90307 91500 gene locus_tag LOCUS_08760 gene tyrS 90307 91500 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_08760 91515 91763 gene locus_tag LOCUS_08770 91515 91763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 92627 91725 gene locus_tag LOCUS_08780 gene hslO 92627 91725 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_08780 92679 93107 gene locus_tag LOCUS_08790 gene aroQ 92679 93107 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_08790 93227 93583 gene locus_tag LOCUS_08800 93227 93583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 93644 93721 gene locus_tag LOCUS_t00130 93644 93721 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 93968 96529 gene locus_tag LOCUS_08810 93968 96529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 96571 96930 gene locus_tag LOCUS_08820 96571 96930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 97054 97506 gene locus_tag LOCUS_08830 97054 97506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 97503 98171 gene locus_tag LOCUS_08840 97503 98171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 98497 98105 gene locus_tag LOCUS_08850 98497 98105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 98724 98476 gene locus_tag LOCUS_08860 98724 98476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 99209 98874 gene locus_tag LOCUS_08870 99209 98874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 99297 99860 gene locus_tag LOCUS_08880 99297 99860 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_08880 101111 99885 gene locus_tag LOCUS_08890 101111 99885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 101710 101225 gene locus_tag LOCUS_08900 101710 101225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 101756 102223 gene locus_tag LOCUS_08910 101756 102223 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_08910 102279 104426 gene locus_tag LOCUS_08920 102279 104426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 104426 106351 gene locus_tag LOCUS_08930 104426 106351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 108272 106776 gene locus_tag LOCUS_08940 108272 106776 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_08940 109798 108746 gene locus_tag LOCUS_08950 109798 108746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 111265 109811 gene locus_tag LOCUS_08960 111265 109811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 111327 112052 gene locus_tag LOCUS_08970 111327 112052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 112082 113080 gene locus_tag LOCUS_08980 112082 113080 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275492.1 protein_id gnl|my_center|LOCUS_08980 113600 113812 gene locus_tag LOCUS_08990 113600 113812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 113877 114224 gene locus_tag LOCUS_09000 113877 114224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 114221 115144 gene locus_tag LOCUS_09010 114221 115144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 115362 115520 gene locus_tag LOCUS_09020 115362 115520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 116567 115584 gene locus_tag LOCUS_09030 gene cydB 116567 115584 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_09030 117892 116564 gene locus_tag LOCUS_09040 117892 116564 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence06 <1 960 gene locus_tag LOCUS_09050 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053104362.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 921 1826 gene locus_tag LOCUS_09060 921 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1823 2773 gene locus_tag LOCUS_09070 1823 2773 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666315.1 protein_id gnl|my_center|LOCUS_09070 2770 3597 gene locus_tag LOCUS_09080 2770 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3594 4514 gene locus_tag LOCUS_09090 3594 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4496 5146 gene locus_tag LOCUS_09100 gene pdxH 4496 5146 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_09100 5213 6883 gene locus_tag LOCUS_09110 5213 6883 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_09110 6929 10126 gene locus_tag LOCUS_09120 gene carB 6929 10126 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_09120 10123 10848 gene locus_tag LOCUS_09130 10123 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 10845 12248 gene locus_tag LOCUS_09140 10845 12248 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_09140 12245 14317 gene locus_tag LOCUS_09150 gene pknB 12245 14317 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_09150 14314 14790 gene locus_tag LOCUS_09160 gene ruvC 14314 14790 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_09160 14790 15410 gene locus_tag LOCUS_09170 gene ruvA 14790 15410 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_09170 15407 16474 gene locus_tag LOCUS_09180 gene ruvB 15407 16474 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_09180 16485 17474 gene locus_tag LOCUS_09190 16485 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 17365 17844 gene locus_tag LOCUS_09200 17365 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 17987 17841 gene locus_tag LOCUS_09210 17987 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 18075 18896 gene locus_tag LOCUS_09220 18075 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 18913 19500 gene locus_tag LOCUS_09230 18913 19500 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_09230 20860 19505 gene locus_tag LOCUS_09240 20860 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 20927 21544 gene locus_tag LOCUS_09250 gene gmk 20927 21544 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_09250 21582 21854 gene locus_tag LOCUS_09260 21582 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 21873 23738 gene locus_tag LOCUS_09270 gene glmS 21873 23738 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480280.1 protein_id gnl|my_center|LOCUS_09270 23742 24470 gene locus_tag LOCUS_09280 gene rph 23742 24470 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_09280 24463 24804 gene locus_tag LOCUS_09290 24463 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 24801 25577 gene locus_tag LOCUS_09300 24801 25577 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_09300 25577 26332 gene locus_tag LOCUS_09310 25577 26332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_09310 26347 27813 gene locus_tag LOCUS_09320 26347 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 27830 28735 gene locus_tag LOCUS_09330 27830 28735 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_09330 28751 29644 gene locus_tag LOCUS_09340 28751 29644 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531349.1 protein_id gnl|my_center|LOCUS_09340 30368 29652 gene locus_tag LOCUS_09350 30368 29652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 31302 30373 gene locus_tag LOCUS_09360 gene xerC 31302 30373 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_09360 31472 32719 gene locus_tag LOCUS_09370 31472 32719 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315676.1 protein_id gnl|my_center|LOCUS_09370 33045 33638 gene locus_tag LOCUS_09380 33045 33638 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_09380 34518 33619 gene locus_tag LOCUS_09390 34518 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 34648 34830 gene locus_tag LOCUS_09400 34648 34830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 35284 34814 gene locus_tag LOCUS_09410 35284 34814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 35456 36694 gene locus_tag LOCUS_09420 35456 36694 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_09420 37011 36640 gene locus_tag LOCUS_09430 gene bldG 37011 36640 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_09430 37376 37020 gene locus_tag LOCUS_09440 37376 37020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 37475 37404 gene locus_tag LOCUS_t00140 37475 37404 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37804 37505 gene locus_tag LOCUS_09450 37804 37505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 38487 37870 gene locus_tag LOCUS_09460 38487 37870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 39338 38799 gene locus_tag LOCUS_09470 39338 38799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 40139 39531 gene locus_tag LOCUS_09480 40139 39531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 40309 41877 gene locus_tag LOCUS_09490 40309 41877 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886094.1 protein_id gnl|my_center|LOCUS_09490 41928 43109 gene locus_tag LOCUS_09500 41928 43109 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_09500 43073 43465 gene locus_tag LOCUS_09510 43073 43465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 44126 43881 gene locus_tag LOCUS_09520 44126 43881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 44442 44711 gene locus_tag LOCUS_09530 44442 44711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 45044 44601 gene locus_tag LOCUS_09540 45044 44601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 45211 45570 gene locus_tag LOCUS_09550 45211 45570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 45567 46040 gene locus_tag LOCUS_09560 45567 46040 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210981.1 protein_id gnl|my_center|LOCUS_09560 46078 47358 gene locus_tag LOCUS_09570 46078 47358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 48886 47456 gene locus_tag LOCUS_09580 48886 47456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 48955 49200 gene locus_tag LOCUS_09590 48955 49200 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037381694.1 protein_id gnl|my_center|LOCUS_09590 49200 49622 gene locus_tag LOCUS_09600 49200 49622 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_09600 49935 49657 gene locus_tag LOCUS_09610 49935 49657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 50551 50258 gene locus_tag LOCUS_09620 50551 50258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 50761 50618 gene locus_tag LOCUS_09630 50761 50618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 51173 50967 gene locus_tag LOCUS_09640 51173 50967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 51695 51216 gene locus_tag LOCUS_09650 51695 51216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 53234 51885 gene locus_tag LOCUS_09660 gene glmM 53234 51885 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_09660 53899 53231 gene locus_tag LOCUS_09670 53899 53231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 54764 53868 gene locus_tag LOCUS_09680 gene cdaA 54764 53868 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_09680 55119 54757 gene locus_tag LOCUS_09690 55119 54757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 55470 55153 gene locus_tag LOCUS_09700 55470 55153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 55375 56046 gene locus_tag LOCUS_09710 55375 56046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09710 56144 56473 gene locus_tag LOCUS_09720 56144 56473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 56503 57738 gene locus_tag LOCUS_09730 56503 57738 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123082.1 protein_id gnl|my_center|LOCUS_09730 60365 58026 gene locus_tag LOCUS_09740 gene priA 60365 58026 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926999.1 protein_id gnl|my_center|LOCUS_09740 61495 60392 gene locus_tag LOCUS_09750 gene aroB 61495 60392 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439850.1 protein_id gnl|my_center|LOCUS_09750 61989 61459 gene locus_tag LOCUS_09760 gene aroK 61989 61459 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018629.1 protein_id gnl|my_center|LOCUS_09760 63011 61986 gene locus_tag LOCUS_09770 gene aroC 63011 61986 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 62913 63146 gene locus_tag LOCUS_09780 62913 63146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 64421 63162 gene locus_tag LOCUS_09790 gene clpX 64421 63162 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_09790 65057 64443 gene locus_tag LOCUS_09800 gene clpP 65057 64443 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_09800 66439 65120 gene locus_tag LOCUS_09810 gene tig 66439 65120 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_09810 66551 66477 gene locus_tag LOCUS_t00150 66551 66477 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 66693 66609 gene locus_tag LOCUS_t00160 66693 66609 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67693 66716 gene locus_tag LOCUS_09820 67693 66716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 68626 67694 gene locus_tag LOCUS_09830 68626 67694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 68787 69113 gene locus_tag LOCUS_09840 68787 69113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 69813 69115 gene locus_tag LOCUS_09850 gene prrA 69813 69115 CDS product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168189073.1 protein_id gnl|my_center|LOCUS_09850 71225 69810 gene locus_tag LOCUS_09860 71225 69810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 71292 71771 gene locus_tag LOCUS_09870 71292 71771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 71904 71830 gene locus_tag LOCUS_t00170 71904 71830 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 71981 71906 gene locus_tag LOCUS_t00180 71981 71906 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 74825 72039 gene locus_tag LOCUS_09880 74825 72039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 74997 74921 gene locus_tag LOCUS_t00190 74997 74921 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 75089 75016 gene locus_tag LOCUS_t00200 75089 75016 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 75212 75137 gene locus_tag LOCUS_t00210 75212 75137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 76075 75233 gene locus_tag LOCUS_09890 76075 75233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 76659 76072 gene locus_tag LOCUS_09900 76659 76072 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_09900 78493 76670 gene locus_tag LOCUS_09910 gene lepA 78493 76670 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_09910 78789 78511 gene locus_tag LOCUS_09920 78789 78511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 79731 78814 gene locus_tag LOCUS_09930 79731 78814 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_09930 80235 79735 gene locus_tag LOCUS_09940 80235 79735 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815159.1 protein_id gnl|my_center|LOCUS_09940 80448 80239 gene locus_tag LOCUS_09950 80448 80239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence07 387 2207 gene locus_tag LOCUS_09960 387 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2673 2822 gene locus_tag LOCUS_09970 2673 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2840 6541 gene locus_tag LOCUS_09980 2840 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6541 7443 gene locus_tag LOCUS_09990 6541 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7806 8302 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atgatatcaccaatgcattttttggggaagtaagac 8801 9748 gene locus_tag LOCUS_10000 8801 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 10136 9705 gene locus_tag LOCUS_10010 10136 9705 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 protein_id gnl|my_center|LOCUS_10010 10252 10326 gene locus_tag LOCUS_t00220 10252 10326 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10331 10407 gene locus_tag LOCUS_t00230 10331 10407 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10630 11106 gene locus_tag LOCUS_10020 10630 11106 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891185.1 protein_id gnl|my_center|LOCUS_10020 11099 11689 gene locus_tag LOCUS_10030 11099 11689 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_10030 11790 11865 gene locus_tag LOCUS_t00240 11790 11865 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11925 12764 gene locus_tag LOCUS_10040 11925 12764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_10040 13508 12780 gene locus_tag LOCUS_10050 13508 12780 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_10050 13507 14190 gene locus_tag LOCUS_10060 13507 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_10060 14995 14180 gene locus_tag LOCUS_10070 14995 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 15673 18201 gene locus_tag LOCUS_10080 15673 18201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 18365 19885 gene locus_tag LOCUS_10090 18365 19885 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_10090 20786 20232 gene locus_tag LOCUS_10100 20786 20232 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_10100 21616 20783 gene locus_tag LOCUS_10110 21616 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 21720 22928 gene locus_tag LOCUS_10120 gene rocD 21720 22928 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_10120 22974 24677 gene locus_tag LOCUS_10130 22974 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 24680 25825 gene locus_tag LOCUS_10140 24680 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 25822 27441 gene locus_tag LOCUS_10150 25822 27441 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_10150 27978 27442 gene locus_tag LOCUS_10160 27978 27442 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_10160 28326 28847 gene locus_tag LOCUS_10170 gene infC 28326 28847 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_10170 28840 29046 gene locus_tag LOCUS_10180 gene rpmI 28840 29046 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 protein_id gnl|my_center|LOCUS_10180 29065 29424 gene locus_tag LOCUS_10190 gene rplT 29065 29424 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_10190 29526 30071 gene locus_tag LOCUS_10200 29526 30071 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_10200 30068 30709 gene locus_tag LOCUS_10210 30068 30709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 31152 30706 gene locus_tag LOCUS_10220 31152 30706 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_10220 31235 31438 gene locus_tag LOCUS_10230 31235 31438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 31442 32227 gene locus_tag LOCUS_10240 31442 32227 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_10240 32570 33604 gene locus_tag LOCUS_10250 gene pheS 32570 33604 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_10250 33620 35977 gene locus_tag LOCUS_10260 gene pheT 33620 35977 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_10260 35977 36459 gene locus_tag LOCUS_10270 35977 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 37594 36476 gene locus_tag LOCUS_10280 37594 36476 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_10280 37721 38998 gene locus_tag LOCUS_10290 37721 38998 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_10290 41438 38985 gene locus_tag LOCUS_10300 gene lon 41438 38985 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_10300 41830 41441 gene locus_tag LOCUS_10310 41830 41441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 42525 41890 gene locus_tag LOCUS_10320 42525 41890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 42564 43604 gene locus_tag LOCUS_10330 42564 43604 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838331.1 protein_id gnl|my_center|LOCUS_10330 43601 44347 gene locus_tag LOCUS_10340 43601 44347 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_10340 44384 45721 gene locus_tag LOCUS_10350 44384 45721 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_10350 46682 45708 gene locus_tag LOCUS_10360 46682 45708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 46947 47123 gene locus_tag LOCUS_10370 46947 47123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 47223 48449 gene locus_tag LOCUS_10380 47223 48449 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_10380 48523 48864 gene locus_tag LOCUS_10390 48523 48864 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_10390 49879 48857 gene locus_tag LOCUS_10400 49879 48857 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_10400 51710 49896 gene locus_tag LOCUS_10410 51710 49896 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_10410 53484 51823 gene locus_tag LOCUS_10420 gene groL 53484 51823 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_10420 53803 53498 gene locus_tag LOCUS_10430 gene groES 53803 53498 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583188.1 protein_id gnl|my_center|LOCUS_10430 55509 53908 gene locus_tag LOCUS_10440 55509 53908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 57125 55506 gene locus_tag LOCUS_10450 57125 55506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 57486 57220 gene locus_tag LOCUS_10460 57486 57220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 58984 57470 gene locus_tag LOCUS_10470 58984 57470 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730516.1 protein_id gnl|my_center|LOCUS_10470 59390 58998 gene locus_tag LOCUS_10480 59390 58998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 60102 59398 gene locus_tag LOCUS_10490 60102 59398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 60500 60213 gene locus_tag LOCUS_10500 60500 60213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 60712 61212 gene locus_tag LOCUS_10510 60712 61212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 61209 62348 gene locus_tag LOCUS_10520 gene alr 61209 62348 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_10520 62385 63800 gene locus_tag LOCUS_10530 62385 63800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 64516 63797 gene locus_tag LOCUS_10540 gene hisA 64516 63797 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_10540 65132 64527 gene locus_tag LOCUS_10550 gene hisH 65132 64527 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404308.1 protein_id gnl|my_center|LOCUS_10550 65724 65137 gene locus_tag LOCUS_10560 gene hisB 65724 65137 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_10560 66901 65726 gene locus_tag LOCUS_10570 66901 65726 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228614.1 protein_id gnl|my_center|LOCUS_10570 68349 67051 gene locus_tag LOCUS_10580 68349 67051 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_10580 69852 68371 gene locus_tag LOCUS_10590 69852 68371 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_10590 70736 69852 gene locus_tag LOCUS_10600 70736 69852 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_10600 72140 70749 gene locus_tag LOCUS_10610 gene hydA 72140 70749 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_10610 73391 72141 gene locus_tag LOCUS_10620 gene preA 73391 72141 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_10620 74685 73384 gene locus_tag LOCUS_10630 74685 73384 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142081328.1 protein_id gnl|my_center|LOCUS_10630 76201 74693 gene locus_tag LOCUS_10640 76201 74693 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_10640 76304 76741 gene locus_tag LOCUS_10650 76304 76741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 77654 76713 gene locus_tag LOCUS_10660 77654 76713 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_10660 78601 77651 gene locus_tag LOCUS_10670 gene murB 78601 77651 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_10670 79977 78598 gene locus_tag LOCUS_10680 gene murC 79977 78598 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence08 537 1439 gene locus_tag LOCUS_10690 537 1439 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204297.1 protein_id gnl|my_center|LOCUS_10690 1487 1858 gene locus_tag LOCUS_10700 1487 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2383 2081 gene locus_tag LOCUS_10710 2383 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2711 2388 gene locus_tag LOCUS_10720 2711 2388 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_10720 2773 4545 gene locus_tag LOCUS_10730 2773 4545 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_10730 4636 5598 gene locus_tag LOCUS_10740 4636 5598 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928612.1 protein_id gnl|my_center|LOCUS_10740 5615 7102 gene locus_tag LOCUS_10750 gene gguA 5615 7102 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_10750 7099 8100 gene locus_tag LOCUS_10760 7099 8100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707231.1 protein_id gnl|my_center|LOCUS_10760 8829 8167 gene locus_tag LOCUS_10770 8829 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9506 8865 gene locus_tag LOCUS_10780 9506 8865 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392859.1 protein_id gnl|my_center|LOCUS_10780 9691 9503 gene locus_tag LOCUS_10790 9691 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 11314 9692 gene locus_tag LOCUS_10800 11314 9692 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392858.1 protein_id gnl|my_center|LOCUS_10800 12609 11314 gene locus_tag LOCUS_10810 12609 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 12966 12613 gene locus_tag LOCUS_10820 12966 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 13570 12935 gene locus_tag LOCUS_10830 13570 12935 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_10830 14360 13563 gene locus_tag LOCUS_10840 gene ylqF 14360 13563 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_10840 14863 14357 gene locus_tag LOCUS_10850 gene lepB 14863 14357 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_10850 15629 14871 gene locus_tag LOCUS_10860 gene lepB 15629 14871 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_10860 16303 15635 gene locus_tag LOCUS_10870 gene lepB 16303 15635 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_10870 16692 16333 gene locus_tag LOCUS_10880 gene rplS 16692 16333 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_10880 16959 19637 gene locus_tag LOCUS_10890 16959 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19785 19591 gene locus_tag LOCUS_10900 19785 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 20432 19845 gene locus_tag LOCUS_10910 20432 19845 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_10910 21511 21011 gene locus_tag LOCUS_10920 21511 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 22213 21542 gene locus_tag LOCUS_10930 22213 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23441 22764 gene locus_tag LOCUS_10940 gene trmD 23441 22764 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922154.1 protein_id gnl|my_center|LOCUS_10940 23448 23933 gene locus_tag LOCUS_10950 23448 23933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 23930 24424 gene locus_tag LOCUS_10960 23930 24424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 24940 24431 gene locus_tag LOCUS_10970 24940 24431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 24962 25225 gene locus_tag LOCUS_10980 24962 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 25727 25170 gene locus_tag LOCUS_10990 25727 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 26005 25778 gene locus_tag LOCUS_11000 26005 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 26394 26059 gene locus_tag LOCUS_11010 26394 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 26717 26403 gene locus_tag LOCUS_11020 gene rplU 26717 26403 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_11020 26862 27449 gene locus_tag LOCUS_11030 26862 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 27442 27726 gene locus_tag LOCUS_11040 27442 27726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090236.1 protein_id gnl|my_center|LOCUS_11040 27723 28550 gene locus_tag LOCUS_11050 27723 28550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_11050 28547 29281 gene locus_tag LOCUS_11060 28547 29281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646283.1 protein_id gnl|my_center|LOCUS_11060 29305 30291 gene locus_tag LOCUS_11070 29305 30291 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918767.1 protein_id gnl|my_center|LOCUS_11070 32550 30280 gene locus_tag LOCUS_11080 32550 30280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 33177 32869 gene locus_tag LOCUS_11090 33177 32869 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_11090 34609 33185 gene locus_tag LOCUS_11100 gene sufB 34609 33185 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_11100 34914 35324 gene locus_tag LOCUS_11110 gene speD 34914 35324 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 protein_id gnl|my_center|LOCUS_11110 35763 35380 gene locus_tag LOCUS_11120 35763 35380 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_11120 35787 36674 gene locus_tag LOCUS_11130 gene speE 35787 36674 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_11130 36675 37487 gene locus_tag LOCUS_11140 gene fadH 36675 37487 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 protein_id gnl|my_center|LOCUS_11140 38167 37508 gene locus_tag LOCUS_11150 38167 37508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 38264 38728 gene locus_tag LOCUS_11160 38264 38728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 38725 39828 gene locus_tag LOCUS_11170 gene gcvT 38725 39828 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479785.1 protein_id gnl|my_center|LOCUS_11170 39852 40232 gene locus_tag LOCUS_11180 gene gcvH 39852 40232 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_11180 40237 41598 gene locus_tag LOCUS_11190 gene gcvPA 40237 41598 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_11190 41579 43093 gene locus_tag LOCUS_11200 gene gcvPB 41579 43093 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_11200 43218 43700 gene locus_tag LOCUS_11210 43218 43700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 43763 44485 gene locus_tag LOCUS_11220 43763 44485 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_11220 44482 45096 gene locus_tag LOCUS_11230 gene scpB 44482 45096 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_11230 45093 45809 gene locus_tag LOCUS_11240 45093 45809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 45806 46630 gene locus_tag LOCUS_11250 45806 46630 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_11250 46627 47697 gene locus_tag LOCUS_11260 gene dinB 46627 47697 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_11260 48627 47662 gene locus_tag LOCUS_11270 48627 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 50624 48624 gene locus_tag LOCUS_11280 50624 48624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 51463 50621 gene locus_tag LOCUS_11290 51463 50621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 51583 52155 gene locus_tag LOCUS_11300 gene ubiX 51583 52155 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825691.1 protein_id gnl|my_center|LOCUS_11300 52427 53116 gene locus_tag LOCUS_11310 52427 53116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 53886 53113 gene locus_tag LOCUS_11320 53886 53113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 54767 53883 gene locus_tag LOCUS_11330 gene ispE 54767 53883 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_11330 54780 57161 gene locus_tag LOCUS_11340 54780 57161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 57158 57586 gene locus_tag LOCUS_11350 57158 57586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 57659 58549 gene locus_tag LOCUS_11360 gene pdxS 57659 58549 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_11360 58546 59127 gene locus_tag LOCUS_11370 gene pdxT 58546 59127 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_11370 59156 59449 gene locus_tag LOCUS_11380 59156 59449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 59481 60014 gene locus_tag LOCUS_11390 59481 60014 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_11390 61505 60015 gene locus_tag LOCUS_11400 61505 60015 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 protein_id gnl|my_center|LOCUS_11400 61562 62785 gene locus_tag LOCUS_11410 61562 62785 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_11410 62776 63873 gene locus_tag LOCUS_11420 gene bioF 62776 63873 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_11420 63855 64499 gene locus_tag LOCUS_11430 gene bioD 63855 64499 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908203.1 protein_id gnl|my_center|LOCUS_11430 64516 65499 gene locus_tag LOCUS_11440 gene bioB 64516 65499 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_11440 65507 66994 gene locus_tag LOCUS_11450 65507 66994 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_11450 67128 68669 gene locus_tag LOCUS_11460 67128 68669 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_11460 69360 68677 gene locus_tag LOCUS_11470 69360 68677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 69389 70000 gene locus_tag LOCUS_11480 gene tmk 69389 70000 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_11480 69997 71007 gene locus_tag LOCUS_11490 gene holB 69997 71007 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930814.1 protein_id gnl|my_center|LOCUS_11490 71696 71004 gene locus_tag LOCUS_11500 71696 71004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 72437 71700 gene locus_tag LOCUS_11510 72437 71700 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_11510 72318 72545 gene locus_tag LOCUS_11520 72318 72545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 72565 73068 gene locus_tag LOCUS_11530 72565 73068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 73606 73130 gene locus_tag LOCUS_11540 73606 73130 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_11540 73695 74789 gene locus_tag LOCUS_11550 gene ychF 73695 74789 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_11550 74959 76218 gene locus_tag LOCUS_11560 gene gdhA 74959 76218 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_11560 76728 76399 gene locus_tag LOCUS_11570 76728 76399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence09 <1 2563 gene locus_tag LOCUS_11580 <1 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390194.1:vitamin B12-dependent ribonucleotide reductase 3976 2603 gene locus_tag LOCUS_11590 3976 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4503 3976 gene locus_tag LOCUS_11600 4503 3976 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_11600 5089 5316 gene locus_tag LOCUS_11610 5089 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5268 5456 gene locus_tag LOCUS_11620 5268 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5555 6019 gene locus_tag LOCUS_11630 5555 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6082 7077 gene locus_tag LOCUS_11640 6082 7077 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530761.1 protein_id gnl|my_center|LOCUS_11640 9243 7081 gene locus_tag LOCUS_11650 9243 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9338 9868 gene locus_tag LOCUS_11660 9338 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9849 10316 gene locus_tag LOCUS_11670 9849 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10320 11138 gene locus_tag LOCUS_11680 10320 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 11159 12442 gene locus_tag LOCUS_11690 11159 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 13038 12445 gene locus_tag LOCUS_11700 13038 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 13649 15187 gene locus_tag LOCUS_11710 13649 15187 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967331.1 protein_id gnl|my_center|LOCUS_11710 15205 15825 gene locus_tag LOCUS_11720 gene msrA 15205 15825 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_11720 16558 16118 gene locus_tag LOCUS_11730 16558 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 16736 17638 gene locus_tag LOCUS_11740 16736 17638 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 protein_id gnl|my_center|LOCUS_11740 17652 18167 gene locus_tag LOCUS_11750 17652 18167 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_11750 18480 18136 gene locus_tag LOCUS_11760 18480 18136 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 protein_id gnl|my_center|LOCUS_11760 18901 18497 gene locus_tag LOCUS_11770 18901 18497 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403434.1 protein_id gnl|my_center|LOCUS_11770 19155 18910 gene locus_tag LOCUS_11780 19155 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 19296 20105 gene locus_tag LOCUS_11790 19296 20105 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527256.1 protein_id gnl|my_center|LOCUS_11790 20760 20272 gene locus_tag LOCUS_11800 20760 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 20760 21614 gene locus_tag LOCUS_11810 20760 21614 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 protein_id gnl|my_center|LOCUS_11810 21611 22303 gene locus_tag LOCUS_11820 21611 22303 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_11820 22388 23443 gene locus_tag LOCUS_11830 22388 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 23472 23882 gene locus_tag LOCUS_11840 gene msrB 23472 23882 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_11840 24426 23848 gene locus_tag LOCUS_11850 gene rimM 24426 23848 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_11850 24928 24383 gene locus_tag LOCUS_11860 24928 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 25221 24928 gene locus_tag LOCUS_11870 gene rpsP 25221 24928 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_11870 26616 25288 gene locus_tag LOCUS_11880 gene ffh 26616 25288 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_11880 26865 26620 gene locus_tag LOCUS_11890 gene acpP 26865 26620 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_11890 27642 26896 gene locus_tag LOCUS_11900 gene fabG 27642 26896 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_11900 28589 27639 gene locus_tag LOCUS_11910 gene fabD 28589 27639 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_11910 29575 28589 gene locus_tag LOCUS_11920 29575 28589 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_11920 29785 29579 gene locus_tag LOCUS_11930 gene rpmF 29785 29579 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_11930 30242 29778 gene locus_tag LOCUS_11940 30242 29778 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_11940 30376 31008 gene locus_tag LOCUS_11950 30376 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 31032 31361 gene locus_tag LOCUS_11960 31032 31361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 31358 31600 gene locus_tag LOCUS_11970 31358 31600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 31667 31743 gene locus_tag LOCUS_t00250 31667 31743 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 32293 31862 gene locus_tag LOCUS_11980 32293 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 32751 32305 gene locus_tag LOCUS_11990 32751 32305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 33612 32878 gene locus_tag LOCUS_12000 33612 32878 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029280.1 protein_id gnl|my_center|LOCUS_12000 33538 33720 gene locus_tag LOCUS_12010 33538 33720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 33998 35539 gene locus_tag LOCUS_12020 33998 35539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 35600 35675 gene locus_tag LOCUS_t00260 35600 35675 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35687 35762 gene locus_tag LOCUS_t00270 35687 35762 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35881 36222 gene locus_tag LOCUS_12030 35881 36222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 36424 36633 gene locus_tag LOCUS_12040 36424 36633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 36693 37097 gene locus_tag LOCUS_12050 36693 37097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 37637 37098 gene locus_tag LOCUS_12060 37637 37098 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_12060 37596 38393 gene locus_tag LOCUS_12070 gene rapZ 37596 38393 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_12070 38393 39697 gene locus_tag LOCUS_12080 38393 39697 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_12080 40029 39682 gene locus_tag LOCUS_12090 40029 39682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 40106 41500 gene locus_tag LOCUS_12100 40106 41500 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 protein_id gnl|my_center|LOCUS_12100 41497 42636 gene locus_tag LOCUS_12110 41497 42636 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_12110 43206 42640 gene locus_tag LOCUS_12120 43206 42640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 44243 43203 gene locus_tag LOCUS_12130 44243 43203 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_12130 44296 48348 gene locus_tag LOCUS_12140 44296 48348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 48357 48440 gene locus_tag LOCUS_t00280 48357 48440 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48963 48502 gene locus_tag LOCUS_12150 48963 48502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 49071 50309 gene locus_tag LOCUS_12160 gene aroA 49071 50309 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141040.1 protein_id gnl|my_center|LOCUS_12160 50306 51472 gene locus_tag LOCUS_12170 50306 51472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 51810 51469 gene locus_tag LOCUS_12180 51810 51469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 52077 51823 gene locus_tag LOCUS_12190 52077 51823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 52636 52133 gene locus_tag LOCUS_12200 52636 52133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 53855 52686 gene locus_tag LOCUS_12210 53855 52686 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_12210 53911 54633 gene locus_tag LOCUS_12220 53911 54633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 55287 55197 gene locus_tag LOCUS_t00290 55287 55197 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55410 56348 gene locus_tag LOCUS_12230 55410 56348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 56953 56477 gene locus_tag LOCUS_12240 gene tadA 56953 56477 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_12240 57042 56967 gene locus_tag LOCUS_t00300 57042 56967 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57285 57049 gene locus_tag LOCUS_12250 57285 57049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 57417 57343 gene locus_tag LOCUS_t00310 57417 57343 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 57619 57544 gene locus_tag LOCUS_t00320 57619 57544 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57787 57694 gene locus_tag LOCUS_t00330 57787 57694 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58423 57857 gene locus_tag LOCUS_12260 58423 57857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 59505 58426 gene locus_tag LOCUS_12270 59505 58426 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_12270 59853 59572 gene locus_tag LOCUS_12280 59853 59572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 60833 59856 gene locus_tag LOCUS_12290 gene mltG 60833 59856 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_12290 61255 60830 gene locus_tag LOCUS_12300 gene ruvX 61255 60830 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_12300 61977 61255 gene locus_tag LOCUS_12310 gene recO 61977 61255 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895862.1 protein_id gnl|my_center|LOCUS_12310 62378 61974 gene locus_tag LOCUS_12320 62378 61974 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_12320 63654 62350 gene locus_tag LOCUS_12330 63654 62350 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_12330 64408 63701 gene locus_tag LOCUS_12340 64408 63701 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964606.1 protein_id gnl|my_center|LOCUS_12340 64853 64410 gene locus_tag LOCUS_12350 gene ybeY 64853 64410 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_12350 65770 64853 gene locus_tag LOCUS_12360 65770 64853 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_12360 66153 65782 gene locus_tag LOCUS_12370 66153 65782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 67170 66157 gene locus_tag LOCUS_12380 gene floA 67170 66157 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583132.1 protein_id gnl|my_center|LOCUS_12380 68478 67183 gene locus_tag LOCUS_12390 68478 67183 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_12390 68961 68509 gene locus_tag LOCUS_12400 68961 68509 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_12400 69131 68961 gene locus_tag LOCUS_12410 69131 68961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 69601 69248 gene locus_tag LOCUS_12420 69601 69248 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_12420 70272 70844 gene locus_tag LOCUS_12430 70272 70844 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925807.1 protein_id gnl|my_center|LOCUS_12430 70831 71040 gene locus_tag LOCUS_12440 70831 71040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 71037 71999 gene locus_tag LOCUS_12450 71037 71999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 72433 71996 gene locus_tag LOCUS_12460 72433 71996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 72523 73041 gene locus_tag LOCUS_12470 72523 73041 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_12470 73661 73038 gene locus_tag LOCUS_12480 73661 73038 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_12480 75166 73658 gene locus_tag LOCUS_12490 75166 73658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 76179 75163 gene locus_tag LOCUS_12500 76179 75163 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_12500 76904 76176 gene locus_tag LOCUS_12510 76904 76176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence10 <1 1015 gene locus_tag LOCUS_12520 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057645.1:acetyl-CoA carboxylase biotin carboxylase subunit 1027 1434 gene locus_tag LOCUS_12530 gene nusB 1027 1434 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_12530 1415 3598 gene locus_tag LOCUS_12540 1415 3598 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_12540 3598 4938 gene locus_tag LOCUS_12550 gene xseA 3598 4938 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286939.1 protein_id gnl|my_center|LOCUS_12550 4935 5165 gene locus_tag LOCUS_12560 4935 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5278 7329 gene locus_tag LOCUS_12570 5278 7329 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_12570 7326 10343 gene locus_tag LOCUS_12580 7326 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10340 14269 gene locus_tag LOCUS_12590 10340 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 14569 17130 gene locus_tag LOCUS_12600 14569 17130 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_12600 17179 19278 gene locus_tag LOCUS_12610 17179 19278 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010349194.1 protein_id gnl|my_center|LOCUS_12610 19281 20504 gene locus_tag LOCUS_12620 19281 20504 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602551.1 protein_id gnl|my_center|LOCUS_12620 20533 25632 gene locus_tag LOCUS_12630 20533 25632 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230035.1 protein_id gnl|my_center|LOCUS_12630 27379 27600 gene locus_tag LOCUS_12640 27379 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 27584 27808 gene locus_tag LOCUS_12650 27584 27808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 28735 27944 gene locus_tag LOCUS_12660 28735 27944 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245289.1 protein_id gnl|my_center|LOCUS_12660 28898 29623 gene locus_tag LOCUS_12670 28898 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29732 30214 gene locus_tag LOCUS_12680 29732 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 30221 30997 gene locus_tag LOCUS_12690 30221 30997 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_12690 30994 31845 gene locus_tag LOCUS_12700 gene nadK 30994 31845 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210719.1 protein_id gnl|my_center|LOCUS_12700 31854 33527 gene locus_tag LOCUS_12710 gene recN 31854 33527 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_12710 35030 33504 gene locus_tag LOCUS_12720 gene pyk 35030 33504 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_12720 35710 35195 gene locus_tag LOCUS_12730 35710 35195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 35691 36185 gene locus_tag LOCUS_12740 35691 36185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 36532 37041 gene locus_tag LOCUS_12750 gene rimP 36532 37041 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_12750 37034 38248 gene locus_tag LOCUS_12760 gene nusA 37034 38248 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_12760 38642 41527 gene locus_tag LOCUS_12770 38642 41527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 41737 42117 gene locus_tag LOCUS_12780 gene rbfA 41737 42117 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_12780 42114 43091 gene locus_tag LOCUS_12790 42114 43091 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_12790 43109 43981 gene locus_tag LOCUS_12800 gene truB 43109 43981 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_12800 43981 44898 gene locus_tag LOCUS_12810 43981 44898 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_12810 44916 45422 gene locus_tag LOCUS_12820 44916 45422 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932702.1 protein_id gnl|my_center|LOCUS_12820 45678 46076 gene locus_tag LOCUS_12830 45678 46076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 47135 46791 gene locus_tag LOCUS_12840 47135 46791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 49167 47239 gene locus_tag LOCUS_12850 49167 47239 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_12850 49947 49210 gene locus_tag LOCUS_12860 49947 49210 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927106.1 protein_id gnl|my_center|LOCUS_12860 49948 50226 gene locus_tag LOCUS_12870 49948 50226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 50308 51738 gene locus_tag LOCUS_12880 50308 51738 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256733.1 protein_id gnl|my_center|LOCUS_12880 51739 51987 gene locus_tag LOCUS_12890 51739 51987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 52042 52299 gene locus_tag LOCUS_12900 52042 52299 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_12900 52350 53024 gene locus_tag LOCUS_12910 52350 53024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_12910 53030 55585 gene locus_tag LOCUS_12920 53030 55585 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_12920 55582 56685 gene locus_tag LOCUS_12930 55582 56685 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_12930 56729 56974 gene locus_tag LOCUS_12940 56729 56974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 57559 56981 gene locus_tag LOCUS_12950 57559 56981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 57664 58326 gene locus_tag LOCUS_12960 57664 58326 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087633.1 protein_id gnl|my_center|LOCUS_12960 59272 58313 gene locus_tag LOCUS_12970 59272 58313 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_12970 59526 59272 gene locus_tag LOCUS_12980 59526 59272 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_12980 60515 59607 gene locus_tag LOCUS_12990 60515 59607 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_12990 62386 60596 gene locus_tag LOCUS_13000 62386 60596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 64692 62383 gene locus_tag LOCUS_13010 64692 62383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 64898 65791 gene locus_tag LOCUS_13020 64898 65791 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_13020 65754 66494 gene locus_tag LOCUS_13030 65754 66494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_13030 66511 67641 gene locus_tag LOCUS_13040 66511 67641 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909314.1 protein_id gnl|my_center|LOCUS_13040 67717 68499 gene locus_tag LOCUS_13050 gene pstB 67717 68499 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_13050 69028 70596 gene locus_tag LOCUS_13060 69028 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 70696 71754 gene locus_tag LOCUS_13070 gene tdh 70696 71754 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence11 1116 463 gene locus_tag LOCUS_13080 1116 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1514 1293 gene locus_tag LOCUS_13090 1514 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1520 1744 gene locus_tag LOCUS_13100 1520 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2509 1730 gene locus_tag LOCUS_13110 2509 1730 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_13110 2585 2971 gene locus_tag LOCUS_13120 2585 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4305 3046 gene locus_tag LOCUS_13130 4305 3046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_13130 4913 4287 gene locus_tag LOCUS_13140 4913 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4888 5937 gene locus_tag LOCUS_13150 4888 5937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_13150 5934 6653 gene locus_tag LOCUS_13160 5934 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6650 7444 gene locus_tag LOCUS_13170 6650 7444 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_13170 8156 7428 gene locus_tag LOCUS_13180 8156 7428 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_13180 8235 9029 gene locus_tag LOCUS_13190 8235 9029 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 protein_id gnl|my_center|LOCUS_13190 9026 9661 gene locus_tag LOCUS_13200 9026 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 10493 9669 gene locus_tag LOCUS_13210 10493 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 10492 11820 gene locus_tag LOCUS_13220 10492 11820 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_13220 13006 11825 gene locus_tag LOCUS_13230 gene hemL 13006 11825 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_13230 13141 14235 gene locus_tag LOCUS_13240 13141 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 15642 14242 gene locus_tag LOCUS_13250 15642 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 15620 17344 gene locus_tag LOCUS_13260 gene pabB 15620 17344 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404430.1 protein_id gnl|my_center|LOCUS_13260 17341 18399 gene locus_tag LOCUS_13270 17341 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 18412 19773 gene locus_tag LOCUS_13280 gene dacB 18412 19773 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_13280 19828 20298 gene locus_tag LOCUS_13290 19828 20298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 20295 20765 gene locus_tag LOCUS_13300 20295 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 21031 20774 gene locus_tag LOCUS_13310 21031 20774 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_13310 22332 21034 gene locus_tag LOCUS_13320 22332 21034 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_13320 22446 23915 gene locus_tag LOCUS_13330 22446 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 24660 23905 gene locus_tag LOCUS_13340 24660 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 25830 25018 gene locus_tag LOCUS_13350 25830 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 25961 26287 gene locus_tag LOCUS_13360 25961 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 26262 27446 gene locus_tag LOCUS_13370 26262 27446 CDS product IS256-like element ISDha1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459365.1 protein_id gnl|my_center|LOCUS_13370 27669 27475 gene locus_tag LOCUS_13380 27669 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 28330 28255 gene locus_tag LOCUS_t00340 28330 28255 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29350 28445 gene locus_tag LOCUS_13390 29350 28445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 29611 29354 gene locus_tag LOCUS_13400 29611 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 29637 30173 gene locus_tag LOCUS_13410 29637 30173 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_13410 30177 30650 gene locus_tag LOCUS_13420 30177 30650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 30647 31069 gene locus_tag LOCUS_13430 30647 31069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 31413 31045 gene locus_tag LOCUS_13440 31413 31045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 32787 31426 gene locus_tag LOCUS_13450 gene dnaB 32787 31426 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_13450 34754 32784 gene locus_tag LOCUS_13460 gene lonC 34754 32784 CDS product Lon family ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391681.1 protein_id gnl|my_center|LOCUS_13460 35219 34773 gene locus_tag LOCUS_13470 gene rplI 35219 34773 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_13470 35486 35238 gene locus_tag LOCUS_13480 gene rpsR 35486 35238 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_13480 35939 35505 gene locus_tag LOCUS_13490 gene ssb 35939 35505 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_13490 36381 36028 gene locus_tag LOCUS_13500 gene rpsF 36381 36028 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_13500 36584 39832 gene locus_tag LOCUS_13510 36584 39832 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_13510 39886 40434 gene locus_tag LOCUS_13520 39886 40434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 40476 42710 gene locus_tag LOCUS_13530 40476 42710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 42710 44455 gene locus_tag LOCUS_13540 42710 44455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 45182 44457 gene locus_tag LOCUS_13550 45182 44457 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 protein_id gnl|my_center|LOCUS_13550 47378 45219 gene locus_tag LOCUS_13560 47378 45219 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_13560 47884 47417 gene locus_tag LOCUS_13570 47884 47417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 48398 47886 gene locus_tag LOCUS_13580 48398 47886 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_13580 48458 49237 gene locus_tag LOCUS_13590 48458 49237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 49587 49378 gene locus_tag LOCUS_13600 49587 49378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 50041 49883 gene locus_tag LOCUS_13610 50041 49883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 51044 50727 gene locus_tag LOCUS_13620 51044 50727 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 protein_id gnl|my_center|LOCUS_13620 51396 51229 gene locus_tag LOCUS_13630 51396 51229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 51475 53310 gene locus_tag LOCUS_13640 51475 53310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 53307 53687 gene locus_tag LOCUS_13650 gene aroH 53307 53687 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_13650 53684 54478 gene locus_tag LOCUS_13660 53684 54478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 54475 55332 gene locus_tag LOCUS_13670 gene pheA 54475 55332 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_13670 56194 55289 gene locus_tag LOCUS_13680 56194 55289 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_13680 58474 56252 gene locus_tag LOCUS_13690 58474 56252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 59184 58471 gene locus_tag LOCUS_13700 59184 58471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 59519 60730 gene locus_tag LOCUS_13710 59519 60730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 60787 61005 gene locus_tag LOCUS_13720 60787 61005 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529932.1 protein_id gnl|my_center|LOCUS_13720 61002 61388 gene locus_tag LOCUS_13730 61002 61388 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_13730 63547 61913 gene locus_tag LOCUS_13740 63547 61913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 64234 65052 gene locus_tag LOCUS_13750 64234 65052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 66125 65070 gene locus_tag LOCUS_13760 66125 65070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 67500 66265 gene locus_tag LOCUS_13770 67500 66265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 68618 67689 gene locus_tag LOCUS_13780 68618 67689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 71109 68950 gene locus_tag LOCUS_13790 71109 68950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence12 362 1921 gene locus_tag LOCUS_13800 362 1921 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_13800 1918 3096 gene locus_tag LOCUS_13810 gene pcaF 1918 3096 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976289.1 protein_id gnl|my_center|LOCUS_13810 3093 4586 gene locus_tag LOCUS_13820 3093 4586 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731185.1 protein_id gnl|my_center|LOCUS_13820 4688 4906 gene locus_tag LOCUS_13830 4688 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5029 7755 gene locus_tag LOCUS_13840 5029 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 8110 9072 gene locus_tag LOCUS_13850 8110 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 9062 10834 gene locus_tag LOCUS_13860 9062 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11287 10880 gene locus_tag LOCUS_13870 11287 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 12120 11329 gene locus_tag LOCUS_13880 12120 11329 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_13880 12248 13378 gene locus_tag LOCUS_13890 12248 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 13406 14260 gene locus_tag LOCUS_13900 13406 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 14273 14512 gene locus_tag LOCUS_13910 14273 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 14528 14806 gene locus_tag LOCUS_13920 14528 14806 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228240.1 protein_id gnl|my_center|LOCUS_13920 15600 14803 gene locus_tag LOCUS_13930 15600 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 15863 16825 gene locus_tag LOCUS_13940 gene cysK 15863 16825 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_13940 16822 17838 gene locus_tag LOCUS_13950 16822 17838 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_13950 17835 21311 gene locus_tag LOCUS_13960 gene metH 17835 21311 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_13960 22120 21308 gene locus_tag LOCUS_13970 22120 21308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 23481 22300 gene locus_tag LOCUS_13980 23481 22300 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_13980 23616 24839 gene locus_tag LOCUS_13990 23616 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 24846 25751 gene locus_tag LOCUS_14000 24846 25751 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_14000 25748 26782 gene locus_tag LOCUS_14010 25748 26782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_14010 26779 27543 gene locus_tag LOCUS_14020 26779 27543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075839.1 protein_id gnl|my_center|LOCUS_14020 27540 28247 gene locus_tag LOCUS_14030 27540 28247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057841.1 protein_id gnl|my_center|LOCUS_14030 28244 28732 gene locus_tag LOCUS_14040 28244 28732 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479688.1 protein_id gnl|my_center|LOCUS_14040 29859 28684 gene locus_tag LOCUS_14050 gene nagA 29859 28684 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_14050 32598 29896 gene locus_tag LOCUS_14060 32598 29896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 32832 32611 gene locus_tag LOCUS_14070 32832 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 34191 32842 gene locus_tag LOCUS_14080 34191 32842 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_14080 34227 35606 gene locus_tag LOCUS_14090 34227 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 35702 38506 gene locus_tag LOCUS_14100 35702 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 38853 38581 gene locus_tag LOCUS_14110 38853 38581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 39673 38900 gene locus_tag LOCUS_14120 39673 38900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526941.1 protein_id gnl|my_center|LOCUS_14120 40644 39670 gene locus_tag LOCUS_14130 40644 39670 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_14130 42556 40652 gene locus_tag LOCUS_14140 42556 40652 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928901.1 protein_id gnl|my_center|LOCUS_14140 42669 44102 gene locus_tag LOCUS_14150 42669 44102 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_14150 44063 44917 gene locus_tag LOCUS_14160 44063 44917 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732701.1 protein_id gnl|my_center|LOCUS_14160 44917 45975 gene locus_tag LOCUS_14170 44917 45975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 45972 46673 gene locus_tag LOCUS_14180 45972 46673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 47792 46677 gene locus_tag LOCUS_14190 47792 46677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 47791 48396 gene locus_tag LOCUS_14200 gene cobU 47791 48396 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530112.1 protein_id gnl|my_center|LOCUS_14200 48778 48320 gene locus_tag LOCUS_14210 48778 48320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 48903 49256 gene locus_tag LOCUS_14220 48903 49256 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_14220 49247 49726 gene locus_tag LOCUS_14230 49247 49726 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888144.1 protein_id gnl|my_center|LOCUS_14230 49756 50349 gene locus_tag LOCUS_14240 49756 50349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 50346 51563 gene locus_tag LOCUS_14250 gene nuoD 50346 51563 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_14250 51563 52336 gene locus_tag LOCUS_14260 51563 52336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 52323 53576 gene locus_tag LOCUS_14270 gene nuoF 52323 53576 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_14270 53579 55531 gene locus_tag LOCUS_14280 53579 55531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 55535 56542 gene locus_tag LOCUS_14290 gene nuoH 55535 56542 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114281.1 protein_id gnl|my_center|LOCUS_14290 56546 57142 gene locus_tag LOCUS_14300 56546 57142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 57139 57744 gene locus_tag LOCUS_14310 57139 57744 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_14310 57745 58065 gene locus_tag LOCUS_14320 gene nuoK 57745 58065 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329055.1 protein_id gnl|my_center|LOCUS_14320 58280 60253 gene locus_tag LOCUS_14330 gene nuoL 58280 60253 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_14330 60253 61629 gene locus_tag LOCUS_14340 60253 61629 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_14340 61626 63059 gene locus_tag LOCUS_14350 61626 63059 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_14350 63175 64371 gene locus_tag LOCUS_14360 63175 64371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 64738 64358 gene locus_tag LOCUS_14370 64738 64358 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_14370 65769 64738 gene locus_tag LOCUS_14380 65769 64738 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_14380 65847 67295 gene locus_tag LOCUS_14390 65847 67295 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence13 482 907 gene locus_tag LOCUS_14400 482 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1211 912 gene locus_tag LOCUS_14410 1211 912 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_14410 2324 1212 gene locus_tag LOCUS_14420 2324 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_14420 3197 2736 gene locus_tag LOCUS_14430 3197 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4336 3194 gene locus_tag LOCUS_14440 gene ispG 4336 3194 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_14440 5482 4343 gene locus_tag LOCUS_14450 gene rseP 5482 4343 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_14450 6633 5491 gene locus_tag LOCUS_14460 6633 5491 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_14460 7433 6630 gene locus_tag LOCUS_14470 gene cdsA 7433 6630 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_14470 8170 7430 gene locus_tag LOCUS_14480 8170 7430 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971573.1 protein_id gnl|my_center|LOCUS_14480 8379 8167 gene locus_tag LOCUS_14490 8379 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8948 8391 gene locus_tag LOCUS_14500 gene frr 8948 8391 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_14500 9700 8945 gene locus_tag LOCUS_14510 gene pyrH 9700 8945 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_14510 10343 9705 gene locus_tag LOCUS_14520 gene tsf 10343 9705 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_14520 11237 10407 gene locus_tag LOCUS_14530 gene rpsB 11237 10407 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_14530 11791 12852 gene locus_tag LOCUS_14540 gene rfbB 11791 12852 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_14540 12865 13587 gene locus_tag LOCUS_14550 12865 13587 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_14550 13584 14681 gene locus_tag LOCUS_14560 13584 14681 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_14560 14678 15208 gene locus_tag LOCUS_14570 gene rfbC 14678 15208 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_14570 16239 15205 gene locus_tag LOCUS_14580 gene rfbB 16239 15205 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_14580 16868 17833 gene locus_tag LOCUS_14590 16868 17833 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_14590 17830 18963 gene locus_tag LOCUS_14600 17830 18963 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_14600 20387 19710 gene locus_tag LOCUS_14610 20387 19710 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_14610 20886 20377 gene locus_tag LOCUS_14620 20886 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 22724 21153 gene locus_tag LOCUS_14630 22724 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23492 22725 gene locus_tag LOCUS_14640 23492 22725 CDS product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_14640 24368 23502 gene locus_tag LOCUS_14650 24368 23502 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741117.1 protein_id gnl|my_center|LOCUS_14650 24892 24365 gene locus_tag LOCUS_14660 gene rfbC 24892 24365 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613584.1 protein_id gnl|my_center|LOCUS_14660 26121 24889 gene locus_tag LOCUS_14670 26121 24889 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_14670 26918 26118 gene locus_tag LOCUS_14680 gene rfbF 26918 26118 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_14680 28720 26921 gene locus_tag LOCUS_14690 28720 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 29798 28713 gene locus_tag LOCUS_14700 29798 28713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 29930 30844 gene locus_tag LOCUS_14710 29930 30844 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_14710 30841 32295 gene locus_tag LOCUS_14720 30841 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 32687 32292 gene locus_tag LOCUS_14730 32687 32292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 33147 32674 gene locus_tag LOCUS_14740 gene fliS 33147 32674 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666704.1 protein_id gnl|my_center|LOCUS_14740 35167 33152 gene locus_tag LOCUS_14750 gene fliD 35167 33152 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080294.1 protein_id gnl|my_center|LOCUS_14750 35571 35179 gene locus_tag LOCUS_14760 35571 35179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 37617 35623 gene locus_tag LOCUS_14770 37617 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 40227 37618 gene locus_tag LOCUS_14780 40227 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 42243 40231 gene locus_tag LOCUS_14790 42243 40231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 43674 42418 gene locus_tag LOCUS_14800 43674 42418 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080946.1 protein_id gnl|my_center|LOCUS_14800 44050 43775 gene locus_tag LOCUS_14810 44050 43775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 44602 44123 gene locus_tag LOCUS_14820 44602 44123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 45923 44619 gene locus_tag LOCUS_14830 45923 44619 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657594.1 protein_id gnl|my_center|LOCUS_14830 48097 45938 gene locus_tag LOCUS_14840 48097 45938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 48573 48094 gene locus_tag LOCUS_14850 48573 48094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 48932 48570 gene locus_tag LOCUS_14860 48932 48570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 50054 48933 gene locus_tag LOCUS_14870 50054 48933 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_14870 50663 50067 gene locus_tag LOCUS_14880 50663 50067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 51376 50660 gene locus_tag LOCUS_14890 51376 50660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 52175 51381 gene locus_tag LOCUS_14900 gene flgG 52175 51381 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_14900 52991 52194 gene locus_tag LOCUS_14910 gene flgF 52991 52194 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_14910 53972 53637 gene locus_tag LOCUS_14920 53972 53637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 54434 53976 gene locus_tag LOCUS_14930 gene flgC 54434 53976 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_14930 54874 54434 gene locus_tag LOCUS_14940 gene flgB 54874 54434 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_14940 56662 54908 gene locus_tag LOCUS_14950 56662 54908 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_14950 56741 57328 gene locus_tag LOCUS_14960 56741 57328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 58719 57325 gene locus_tag LOCUS_14970 58719 57325 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_14970 59034 58720 gene locus_tag LOCUS_14980 59034 58720 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929104.1 protein_id gnl|my_center|LOCUS_14980 59145 59585 gene locus_tag LOCUS_14990 59145 59585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 60603 59590 gene locus_tag LOCUS_15000 gene moaA 60603 59590 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_15000 61247 60612 gene locus_tag LOCUS_15010 61247 60612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 62409 61255 gene locus_tag LOCUS_15020 gene queG 62409 61255 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_15020 63115 62387 gene locus_tag LOCUS_15030 63115 62387 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039795.1 protein_id gnl|my_center|LOCUS_15030 64298 63198 gene locus_tag LOCUS_15040 gene moeB 64298 63198 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_15040 65014 64295 gene locus_tag LOCUS_15050 65014 64295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 65446 65030 gene locus_tag LOCUS_15060 65446 65030 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_15060 65694 65449 gene locus_tag LOCUS_15070 65694 65449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 66503 65691 gene locus_tag LOCUS_15080 gene yidA 66503 65691 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 protein_id gnl|my_center|LOCUS_15080 66524 66997 gene locus_tag LOCUS_15090 66524 66997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence14 1714 14 gene locus_tag LOCUS_15100 1714 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1629 2099 gene locus_tag LOCUS_15110 1629 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2644 2108 gene locus_tag LOCUS_15120 2644 2108 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_15120 2799 2724 gene locus_tag LOCUS_t00350 2799 2724 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3553 2960 gene locus_tag LOCUS_15130 3553 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4884 3655 gene locus_tag LOCUS_15140 gene metK 4884 3655 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_15140 6168 4888 gene locus_tag LOCUS_15150 gene ahcY 6168 4888 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_15150 6251 6862 gene locus_tag LOCUS_15160 6251 6862 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_15160 7676 6867 gene locus_tag LOCUS_15170 7676 6867 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_15170 7972 7673 gene locus_tag LOCUS_15180 7972 7673 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_15180 8682 7969 gene locus_tag LOCUS_15190 8682 7969 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_15190 9311 8760 gene locus_tag LOCUS_15200 9311 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9451 9984 gene locus_tag LOCUS_15210 9451 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10040 11848 gene locus_tag LOCUS_15220 10040 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 11854 13287 gene locus_tag LOCUS_15230 gene mmcO 11854 13287 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_15230 13284 13799 gene locus_tag LOCUS_15240 13284 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13921 16131 gene locus_tag LOCUS_15250 13921 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 16201 17226 gene locus_tag LOCUS_15260 gene rfaD 16201 17226 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074785.1 protein_id gnl|my_center|LOCUS_15260 17240 17977 gene locus_tag LOCUS_15270 17240 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 18067 19341 gene locus_tag LOCUS_15280 18067 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 19341 20294 gene locus_tag LOCUS_15290 19341 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 20348 20929 gene locus_tag LOCUS_15300 20348 20929 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_15300 20929 21387 gene locus_tag LOCUS_15310 20929 21387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 21374 22399 gene locus_tag LOCUS_15320 21374 22399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 23409 22396 gene locus_tag LOCUS_15330 23409 22396 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_15330 24947 23433 gene locus_tag LOCUS_15340 24947 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 25942 24968 gene locus_tag LOCUS_15350 25942 24968 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_15350 26730 25942 gene locus_tag LOCUS_15360 26730 25942 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728286.1 protein_id gnl|my_center|LOCUS_15360 27988 26879 gene locus_tag LOCUS_15370 27988 26879 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525764.1 protein_id gnl|my_center|LOCUS_15370 28083 29978 gene locus_tag LOCUS_15380 28083 29978 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_15380 30531 30448 gene locus_tag LOCUS_t00360 30531 30448 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31751 30546 gene locus_tag LOCUS_15390 31751 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 32040 31756 gene locus_tag LOCUS_15400 32040 31756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 32291 32037 gene locus_tag LOCUS_15410 32291 32037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 33343 32363 gene locus_tag LOCUS_15420 33343 32363 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_15420 34086 33340 gene locus_tag LOCUS_15430 gene accD 34086 33340 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141604.1 protein_id gnl|my_center|LOCUS_15430 34907 34185 gene locus_tag LOCUS_15440 34907 34185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 37624 34922 gene locus_tag LOCUS_15450 37624 34922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 38333 37614 gene locus_tag LOCUS_15460 38333 37614 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_15460 40704 38341 gene locus_tag LOCUS_15470 40704 38341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 41896 40772 gene locus_tag LOCUS_15480 gene dnaJ 41896 40772 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_15480 42951 41899 gene locus_tag LOCUS_15490 gene hrcA 42951 41899 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_15490 44067 43012 gene locus_tag LOCUS_15500 44067 43012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 44132 46123 gene locus_tag LOCUS_15510 gene acs 44132 46123 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_15510 46848 46468 gene locus_tag LOCUS_15520 gene crcB 46848 46468 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 protein_id gnl|my_center|LOCUS_15520 47877 46849 gene locus_tag LOCUS_15530 47877 46849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_15530 49775 47874 gene locus_tag LOCUS_15540 49775 47874 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928558.1 protein_id gnl|my_center|LOCUS_15540 50405 49779 gene locus_tag LOCUS_15550 50405 49779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 51064 50402 gene locus_tag LOCUS_15560 51064 50402 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_15560 52056 51070 gene locus_tag LOCUS_15570 gene add 52056 51070 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_15570 52148 52224 gene locus_tag LOCUS_t00370 52148 52224 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52440 52919 gene locus_tag LOCUS_15580 52440 52919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 53191 55587 gene locus_tag LOCUS_15590 53191 55587 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_15590 55578 56861 gene locus_tag LOCUS_15600 55578 56861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 56858 59923 gene locus_tag LOCUS_15610 56858 59923 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_15610 59923 60636 gene locus_tag LOCUS_15620 59923 60636 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_15620 60961 61152 gene locus_tag LOCUS_15630 60961 61152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 61058 62755 gene locus_tag LOCUS_15640 61058 62755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 62810 63058 gene locus_tag LOCUS_15650 62810 63058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 63571 64056 gene locus_tag LOCUS_15660 63571 64056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 64858 64379 gene locus_tag LOCUS_15670 64858 64379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 65207 65374 gene locus_tag LOCUS_15680 65207 65374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 66602 65409 gene locus_tag LOCUS_15690 66602 65409 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478319.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence15 871 1077 gene locus_tag LOCUS_15700 871 1077 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 protein_id gnl|my_center|LOCUS_15700 1153 1701 gene locus_tag LOCUS_15710 1153 1701 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679904.1 protein_id gnl|my_center|LOCUS_15710 1698 1934 gene locus_tag LOCUS_15720 1698 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1931 2806 gene locus_tag LOCUS_15730 1931 2806 CDS product WcbI family polysaccharide biosynthesis putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390097.1 protein_id gnl|my_center|LOCUS_15730 5111 2886 gene locus_tag LOCUS_15740 5111 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7027 5246 gene locus_tag LOCUS_15750 7027 5246 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079698.1 protein_id gnl|my_center|LOCUS_15750 7187 8659 gene locus_tag LOCUS_15760 7187 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 9498 8614 gene locus_tag LOCUS_15770 9498 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9783 10982 gene locus_tag LOCUS_15780 9783 10982 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_15780 11073 11570 gene locus_tag LOCUS_15790 11073 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 11580 12167 gene locus_tag LOCUS_15800 11580 12167 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091136546.1 protein_id gnl|my_center|LOCUS_15800 15642 12175 gene locus_tag LOCUS_15810 15642 12175 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225968.1 protein_id gnl|my_center|LOCUS_15810 19182 15679 gene locus_tag LOCUS_15820 19182 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 19771 19319 gene locus_tag LOCUS_15830 19771 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 20753 19857 gene locus_tag LOCUS_15840 gene oxyR 20753 19857 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368909.1 protein_id gnl|my_center|LOCUS_15840 20984 23050 gene locus_tag LOCUS_15850 gene katG 20984 23050 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_15850 24997 23045 gene locus_tag LOCUS_15860 24997 23045 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_15860 25076 25435 gene locus_tag LOCUS_15870 25076 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 25442 26041 gene locus_tag LOCUS_15880 25442 26041 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 protein_id gnl|my_center|LOCUS_15880 26038 26565 gene locus_tag LOCUS_15890 26038 26565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 26528 28387 gene locus_tag LOCUS_15900 26528 28387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 28388 29131 gene locus_tag LOCUS_15910 gene murI 28388 29131 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141495.1 protein_id gnl|my_center|LOCUS_15910 31753 29120 gene locus_tag LOCUS_15920 31753 29120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 32388 31753 gene locus_tag LOCUS_15930 32388 31753 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259093.1 protein_id gnl|my_center|LOCUS_15930 32492 34393 gene locus_tag LOCUS_15940 gene dxs 32492 34393 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_15940 34371 34820 gene locus_tag LOCUS_15950 34371 34820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 34827 35816 gene locus_tag LOCUS_15960 34827 35816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_15960 35823 36863 gene locus_tag LOCUS_15970 35823 36863 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_15970 37368 36928 gene locus_tag LOCUS_15980 37368 36928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 37583 39715 gene locus_tag LOCUS_15990 gene topA 37583 39715 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_15990 39717 41048 gene locus_tag LOCUS_16000 gene trmFO 39717 41048 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_16000 41060 41590 gene locus_tag LOCUS_16010 gene hslV 41060 41590 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881090.1 protein_id gnl|my_center|LOCUS_16010 41587 43035 gene locus_tag LOCUS_16020 gene hslU 41587 43035 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_16020 43056 43673 gene locus_tag LOCUS_16030 43056 43673 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879683.1 protein_id gnl|my_center|LOCUS_16030 43674 45041 gene locus_tag LOCUS_16040 43674 45041 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_16040 45648 45061 gene locus_tag LOCUS_16050 45648 45061 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_16050 48551 45645 gene locus_tag LOCUS_16060 48551 45645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_16060 48607 49134 gene locus_tag LOCUS_16070 gene def 48607 49134 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_16070 49112 49975 gene locus_tag LOCUS_16080 gene fmt 49112 49975 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_16080 49972 51306 gene locus_tag LOCUS_16090 gene rsmB 49972 51306 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_16090 51303 52013 gene locus_tag LOCUS_16100 51303 52013 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_16100 52010 52435 gene locus_tag LOCUS_16110 52010 52435 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257857.1 protein_id gnl|my_center|LOCUS_16110 52440 53711 gene locus_tag LOCUS_16120 52440 53711 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392427.1 protein_id gnl|my_center|LOCUS_16120 53678 54442 gene locus_tag LOCUS_16130 53678 54442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 54420 56030 gene locus_tag LOCUS_16140 54420 56030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 56027 56491 gene locus_tag LOCUS_16150 56027 56491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 56528 57169 gene locus_tag LOCUS_16160 56528 57169 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_16160 57166 58419 gene locus_tag LOCUS_16170 57166 58419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence16 1753 773 gene locus_tag LOCUS_16180 1753 773 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_16180 2205 1750 gene locus_tag LOCUS_16190 gene dut 2205 1750 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_16190 2536 2213 gene locus_tag LOCUS_16200 2536 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2558 2701 gene locus_tag LOCUS_16210 2558 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2939 2790 gene locus_tag LOCUS_16220 2939 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3075 3938 gene locus_tag LOCUS_16230 3075 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3957 4418 gene locus_tag LOCUS_16240 gene rlmH 3957 4418 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796170.1 protein_id gnl|my_center|LOCUS_16240 4399 6102 gene locus_tag LOCUS_16250 gene argS 4399 6102 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_16250 7174 6044 gene locus_tag LOCUS_16260 7174 6044 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460323.1 protein_id gnl|my_center|LOCUS_16260 7638 7171 gene locus_tag LOCUS_16270 7638 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 8708 7635 gene locus_tag LOCUS_16280 gene hisC 8708 7635 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_16280 9271 8705 gene locus_tag LOCUS_16290 gene pyrE 9271 8705 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_16290 9984 9268 gene locus_tag LOCUS_16300 gene pyrF 9984 9268 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_16300 10942 9989 gene locus_tag LOCUS_16310 10942 9989 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_16310 11776 10946 gene locus_tag LOCUS_16320 11776 10946 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_16320 11895 12035 gene locus_tag LOCUS_16330 11895 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12706 12122 gene locus_tag LOCUS_16340 12706 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 13097 13690 gene locus_tag LOCUS_16350 gene rpoE 13097 13690 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_16350 13687 14052 gene locus_tag LOCUS_16360 13687 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 14063 14740 gene locus_tag LOCUS_16370 14063 14740 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_16370 14822 16189 gene locus_tag LOCUS_16380 14822 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 16281 17288 gene locus_tag LOCUS_16390 16281 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 17702 17280 gene locus_tag LOCUS_16400 17702 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 18489 17695 gene locus_tag LOCUS_16410 18489 17695 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925142.1 protein_id gnl|my_center|LOCUS_16410 18947 18486 gene locus_tag LOCUS_16420 18947 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 19042 20127 gene locus_tag LOCUS_16430 19042 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 21700 20129 gene locus_tag LOCUS_16440 21700 20129 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_16440 22227 21697 gene locus_tag LOCUS_16450 22227 21697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 22295 23881 gene locus_tag LOCUS_16460 22295 23881 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_16460 23878 25407 gene locus_tag LOCUS_16470 23878 25407 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_16470 25404 26975 gene locus_tag LOCUS_16480 25404 26975 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_16480 27947 26988 gene locus_tag LOCUS_16490 27947 26988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_16490 29252 28026 gene locus_tag LOCUS_16500 29252 28026 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_16500 30731 29268 gene locus_tag LOCUS_16510 30731 29268 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_16510 30876 32459 gene locus_tag LOCUS_16520 30876 32459 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_16520 32743 32534 gene locus_tag LOCUS_16530 32743 32534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 32721 33542 gene locus_tag LOCUS_16540 32721 33542 CDS product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029662.1 protein_id gnl|my_center|LOCUS_16540 34158 33715 gene locus_tag LOCUS_16550 34158 33715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 34730 34224 gene locus_tag LOCUS_16560 34730 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 38578 34742 gene locus_tag LOCUS_16570 38578 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 38671 40269 gene locus_tag LOCUS_16580 38671 40269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 40341 41210 gene locus_tag LOCUS_16590 gene yedA 40341 41210 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_16590 41609 41178 gene locus_tag LOCUS_16600 41609 41178 CDS product formate hydrogenlyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460860.1 protein_id gnl|my_center|LOCUS_16600 42919 41609 gene locus_tag LOCUS_16610 42919 41609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 44292 42919 gene locus_tag LOCUS_16620 44292 42919 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_16620 44894 44289 gene locus_tag LOCUS_16630 44894 44289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 45724 44888 gene locus_tag LOCUS_16640 45724 44888 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_16640 47559 45721 gene locus_tag LOCUS_16650 gene hyfB 47559 45721 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_16650 47821 47546 gene locus_tag LOCUS_16660 47821 47546 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888251.1 protein_id gnl|my_center|LOCUS_16660 48983 48216 gene locus_tag LOCUS_16670 48983 48216 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_16670 49927 48980 gene locus_tag LOCUS_16680 49927 48980 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660448.1 protein_id gnl|my_center|LOCUS_16680 49992 50669 gene locus_tag LOCUS_16690 49992 50669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 50683 53577 gene locus_tag LOCUS_16700 50683 53577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 53596 54000 gene locus_tag LOCUS_16710 53596 54000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 54091 54687 gene locus_tag LOCUS_16720 54091 54687 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence17 823 1143 gene locus_tag LOCUS_16730 823 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1150 4188 gene locus_tag LOCUS_16740 1150 4188 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_16740 4185 5396 gene locus_tag LOCUS_16750 4185 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5381 6520 gene locus_tag LOCUS_16760 5381 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7113 6517 gene locus_tag LOCUS_16770 7113 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8388 7264 gene locus_tag LOCUS_16780 8388 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 10643 8472 gene locus_tag LOCUS_16790 10643 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 10635 16229 gene locus_tag LOCUS_16800 10635 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 17612 16476 gene locus_tag LOCUS_16810 17612 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 17965 17609 gene locus_tag LOCUS_16820 17965 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 18495 18031 gene locus_tag LOCUS_16830 18495 18031 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244191.1 protein_id gnl|my_center|LOCUS_16830 18593 18730 gene locus_tag LOCUS_16840 18593 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 18730 19197 gene locus_tag LOCUS_16850 18730 19197 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403092.1 protein_id gnl|my_center|LOCUS_16850 19194 20804 gene locus_tag LOCUS_16860 19194 20804 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258288.1 protein_id gnl|my_center|LOCUS_16860 20798 21499 gene locus_tag LOCUS_16870 20798 21499 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_16870 21496 22362 gene locus_tag LOCUS_16880 21496 22362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 22862 22359 gene locus_tag LOCUS_16890 22862 22359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 23322 22846 gene locus_tag LOCUS_16900 23322 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 24105 23368 gene locus_tag LOCUS_16910 24105 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 24175 24744 gene locus_tag LOCUS_16920 24175 24744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 24818 25207 gene locus_tag LOCUS_16930 24818 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 25256 27073 gene locus_tag LOCUS_16940 25256 27073 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_16940 27073 29187 gene locus_tag LOCUS_16950 27073 29187 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480226.1 protein_id gnl|my_center|LOCUS_16950 29180 30364 gene locus_tag LOCUS_16960 29180 30364 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_16960 33181 30503 gene locus_tag LOCUS_16970 33181 30503 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_16970 34014 33178 gene locus_tag LOCUS_16980 gene ftcD 34014 33178 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_16980 35334 34018 gene locus_tag LOCUS_16990 gene radA 35334 34018 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_16990 35456 35965 gene locus_tag LOCUS_17000 35456 35965 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 protein_id gnl|my_center|LOCUS_17000 35962 36342 gene locus_tag LOCUS_17010 35962 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 40595 36339 gene locus_tag LOCUS_17020 40595 36339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 40720 42189 gene locus_tag LOCUS_17030 gene crtI 40720 42189 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_17030 42186 43019 gene locus_tag LOCUS_17040 42186 43019 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258542.1 protein_id gnl|my_center|LOCUS_17040 43423 42992 gene locus_tag LOCUS_17050 43423 42992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 43457 44890 gene locus_tag LOCUS_17060 gene crtI 43457 44890 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225924.1 protein_id gnl|my_center|LOCUS_17060 44887 45570 gene locus_tag LOCUS_17070 44887 45570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 45567 46658 gene locus_tag LOCUS_17080 45567 46658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 46613 47344 gene locus_tag LOCUS_17090 gene cmk 46613 47344 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_17090 47345 47968 gene locus_tag LOCUS_17100 47345 47968 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_17100 47955 48797 gene locus_tag LOCUS_17110 gene ispH 47955 48797 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_17110 48814 49767 gene locus_tag LOCUS_17120 48814 49767 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence18 886 2427 gene locus_tag LOCUS_17130 886 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2681 2505 gene locus_tag LOCUS_17140 2681 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3085 3927 gene locus_tag LOCUS_17150 3085 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3927 5174 gene locus_tag LOCUS_17160 3927 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5174 7051 gene locus_tag LOCUS_17170 5174 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 7183 8934 gene locus_tag LOCUS_17180 7183 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 8961 10388 gene locus_tag LOCUS_17190 8961 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 10385 12478 gene locus_tag LOCUS_17200 10385 12478 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205671.1 protein_id gnl|my_center|LOCUS_17200 12946 14145 gene locus_tag LOCUS_17210 12946 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 16988 14142 gene locus_tag LOCUS_17220 16988 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 17766 17191 gene locus_tag LOCUS_17230 17766 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 18194 17763 gene locus_tag LOCUS_17240 18194 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 19648 18191 gene locus_tag LOCUS_17250 19648 18191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 19752 20456 gene locus_tag LOCUS_17260 19752 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 20456 21139 gene locus_tag LOCUS_17270 20456 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 23095 21818 gene locus_tag LOCUS_17280 23095 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 23982 23092 gene locus_tag LOCUS_17290 23982 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 24995 27325 gene locus_tag LOCUS_17300 24995 27325 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967567.1 protein_id gnl|my_center|LOCUS_17300 27341 29656 gene locus_tag LOCUS_17310 27341 29656 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_17310 29659 30528 gene locus_tag LOCUS_17320 29659 30528 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_17320 30525 31691 gene locus_tag LOCUS_17330 30525 31691 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_17330 31697 32602 gene locus_tag LOCUS_17340 31697 32602 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064309.1 protein_id gnl|my_center|LOCUS_17340 32700 32626 gene locus_tag LOCUS_t00380 32700 32626 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32813 33745 gene locus_tag LOCUS_17350 32813 33745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 33815 34471 gene locus_tag LOCUS_17360 33815 34471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 34567 37548 gene locus_tag LOCUS_17370 34567 37548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_17370 38130 37846 gene locus_tag LOCUS_17380 38130 37846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 38132 42016 gene locus_tag LOCUS_17390 gene rpoB 38132 42016 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833083.1 protein_id gnl|my_center|LOCUS_17390 42130 44295 gene locus_tag LOCUS_17400 42130 44295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 44340 45233 gene locus_tag LOCUS_17410 44340 45233 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 protein_id gnl|my_center|LOCUS_17410 45230 46024 gene locus_tag LOCUS_17420 45230 46024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 46396 46025 gene locus_tag LOCUS_17430 46396 46025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 46862 46398 gene locus_tag LOCUS_17440 46862 46398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 <47988 46942 gene locus_tag LOCUS_17450 <47988 46942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230264.1:S53 family serine peptidase >Feature sequence19 386 1132 gene locus_tag LOCUS_17460 386 1132 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085032.1 protein_id gnl|my_center|LOCUS_17460 1162 2454 gene locus_tag LOCUS_17470 1162 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2476 3480 gene locus_tag LOCUS_17480 2476 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4572 3451 gene locus_tag LOCUS_17490 4572 3451 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_17490 5237 4569 gene locus_tag LOCUS_17500 gene phoU 5237 4569 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_17500 5355 6212 gene locus_tag LOCUS_17510 5355 6212 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_17510 6205 6996 gene locus_tag LOCUS_17520 6205 6996 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_17520 7026 7868 gene locus_tag LOCUS_17530 7026 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 7855 9006 gene locus_tag LOCUS_17540 gene thiO 7855 9006 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_17540 9000 9980 gene locus_tag LOCUS_17550 gene bioB 9000 9980 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861135.1 protein_id gnl|my_center|LOCUS_17550 9981 11132 gene locus_tag LOCUS_17560 9981 11132 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369839.1 protein_id gnl|my_center|LOCUS_17560 11120 11533 gene locus_tag LOCUS_17570 11120 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 12059 11622 gene locus_tag LOCUS_17580 12059 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 13188 14282 gene locus_tag LOCUS_17590 13188 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14979 14668 gene locus_tag LOCUS_17600 14979 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 16637 16215 gene locus_tag LOCUS_17610 16637 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 16968 17294 gene locus_tag LOCUS_17620 16968 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 18874 18626 gene locus_tag LOCUS_17630 18874 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 19692 19417 gene locus_tag LOCUS_17640 19692 19417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 20597 19992 gene locus_tag LOCUS_17650 20597 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 21280 20942 gene locus_tag LOCUS_17660 21280 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 21734 21297 gene locus_tag LOCUS_17670 21734 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 22417 21701 gene locus_tag LOCUS_17680 22417 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 24177 23056 gene locus_tag LOCUS_17690 24177 23056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 24468 24217 gene locus_tag LOCUS_17700 24468 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812460.1 protein_id gnl|my_center|LOCUS_17700 24732 24568 gene locus_tag LOCUS_17710 24732 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 26368 25949 gene locus_tag LOCUS_17720 26368 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 27048 26719 gene locus_tag LOCUS_17730 27048 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 29251 28340 gene locus_tag LOCUS_17740 29251 28340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 30018 29383 gene locus_tag LOCUS_17750 30018 29383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 30740 30333 gene locus_tag LOCUS_17760 30740 30333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 31722 31561 gene locus_tag LOCUS_17770 31722 31561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 32083 31799 gene locus_tag LOCUS_17780 32083 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 32622 32200 gene locus_tag LOCUS_17790 32622 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 33237 32623 gene locus_tag LOCUS_17800 33237 32623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 34869 33370 gene locus_tag LOCUS_17810 gene mqo 34869 33370 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083116.1 protein_id gnl|my_center|LOCUS_17810 35727 34954 gene locus_tag LOCUS_17820 35727 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 36243 35761 gene locus_tag LOCUS_17830 gene resA 36243 35761 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_17830 37507 36290 gene locus_tag LOCUS_17840 37507 36290 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_17840 37854 37627 gene locus_tag LOCUS_17850 37854 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 37735 38526 gene locus_tag LOCUS_17860 37735 38526 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 protein_id gnl|my_center|LOCUS_17860 39428 38865 gene locus_tag LOCUS_17870 39428 38865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258265.1 protein_id gnl|my_center|LOCUS_17870 39924 39442 gene locus_tag LOCUS_17880 gene coaD 39924 39442 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_17880 40470 39928 gene locus_tag LOCUS_17890 gene rsmD 40470 39928 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_17890 41213 40485 gene locus_tag LOCUS_17900 41213 40485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 43899 41233 gene locus_tag LOCUS_17910 43899 41233 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_17910 46081 44030 gene locus_tag LOCUS_17920 gene recG 46081 44030 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_17920 <47486 46467 gene locus_tag LOCUS_17930 <47486 46467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001009435.1:methyl-accepting chemotaxis protein >Feature sequence20 3006 1012 gene locus_tag LOCUS_17940 3006 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5012 3003 gene locus_tag LOCUS_17950 5012 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5087 5842 gene locus_tag LOCUS_17960 5087 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 5856 8114 gene locus_tag LOCUS_17970 5856 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 8439 8116 gene locus_tag LOCUS_17980 8439 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8570 9064 gene locus_tag LOCUS_17990 8570 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9061 10125 gene locus_tag LOCUS_18000 9061 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 10805 10131 gene locus_tag LOCUS_18010 10805 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 12826 10988 gene locus_tag LOCUS_18020 12826 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 12829 14067 gene locus_tag LOCUS_18030 12829 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 16039 14039 gene locus_tag LOCUS_18040 16039 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 16190 16912 gene locus_tag LOCUS_18050 16190 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 16909 17679 gene locus_tag LOCUS_18060 16909 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 19699 17648 gene locus_tag LOCUS_18070 19699 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 19811 22027 gene locus_tag LOCUS_18080 19811 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 22785 22024 gene locus_tag LOCUS_18090 22785 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 23656 22769 gene locus_tag LOCUS_18100 23656 22769 CDS product WcbI family polysaccharide biosynthesis putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390097.1 protein_id gnl|my_center|LOCUS_18100 24480 23653 gene locus_tag LOCUS_18110 24480 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 24743 24477 gene locus_tag LOCUS_18120 24743 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 25954 24740 gene locus_tag LOCUS_18130 25954 24740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 27430 26387 gene locus_tag LOCUS_18140 27430 26387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 27565 29505 gene locus_tag LOCUS_18150 27565 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 30520 32139 gene locus_tag LOCUS_18160 30520 32139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 32136 33026 gene locus_tag LOCUS_18170 32136 33026 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479830.1 protein_id gnl|my_center|LOCUS_18170 33026 34099 gene locus_tag LOCUS_18180 33026 34099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 34473 35114 gene locus_tag LOCUS_18190 34473 35114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 35125 36705 gene locus_tag LOCUS_18200 35125 36705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 36879 37601 gene locus_tag LOCUS_18210 36879 37601 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_18210 37649 38530 gene locus_tag LOCUS_18220 37649 38530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 38527 40497 gene locus_tag LOCUS_18230 38527 40497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 40626 41384 gene locus_tag LOCUS_18240 40626 41384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 41481 42011 gene locus_tag LOCUS_18250 41481 42011 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_18250 42008 42742 gene locus_tag LOCUS_18260 42008 42742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 42739 43578 gene locus_tag LOCUS_18270 42739 43578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 43770 43588 gene locus_tag LOCUS_18280 43770 43588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence21 25 918 gene locus_tag LOCUS_18290 25 918 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403152.1 protein_id gnl|my_center|LOCUS_18290 915 1811 gene locus_tag LOCUS_18300 gene murQ 915 1811 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_18300 1814 3385 gene locus_tag LOCUS_18310 1814 3385 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_18310 3447 4061 gene locus_tag LOCUS_18320 3447 4061 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_18320 4058 4429 gene locus_tag LOCUS_18330 4058 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4426 5190 gene locus_tag LOCUS_18340 4426 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5588 5193 gene locus_tag LOCUS_18350 gene mce 5588 5193 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_18350 7116 5590 gene locus_tag LOCUS_18360 7116 5590 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_18360 7626 8030 gene locus_tag LOCUS_18370 7626 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 10206 8437 gene locus_tag LOCUS_18380 gene accC 10206 8437 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_18380 11095 10307 gene locus_tag LOCUS_18390 11095 10307 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938095.1 protein_id gnl|my_center|LOCUS_18390 11785 11141 gene locus_tag LOCUS_18400 11785 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 13432 11807 gene locus_tag LOCUS_18410 13432 11807 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_18410 13558 14883 gene locus_tag LOCUS_18420 13558 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 16409 14880 gene locus_tag LOCUS_18430 16409 14880 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_18430 16474 16986 gene locus_tag LOCUS_18440 16474 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 16973 17842 gene locus_tag LOCUS_18450 16973 17842 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086558.1 protein_id gnl|my_center|LOCUS_18450 18134 17823 gene locus_tag LOCUS_18460 18134 17823 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_18460 18211 18636 gene locus_tag LOCUS_18470 18211 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 18719 21214 gene locus_tag LOCUS_18480 gene clpC 18719 21214 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_18480 21216 22403 gene locus_tag LOCUS_18490 21216 22403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 22452 22685 gene locus_tag LOCUS_18500 22452 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 22682 23680 gene locus_tag LOCUS_18510 22682 23680 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_18510 23998 24552 gene locus_tag LOCUS_18520 23998 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 24552 26048 gene locus_tag LOCUS_18530 gene hutH 24552 26048 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_18530 26186 27385 gene locus_tag LOCUS_18540 26186 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 27385 28449 gene locus_tag LOCUS_18550 27385 28449 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_18550 28598 30166 gene locus_tag LOCUS_18560 gene hutU 28598 30166 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243634.1 protein_id gnl|my_center|LOCUS_18560 30154 31413 gene locus_tag LOCUS_18570 gene hutI 30154 31413 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869661.1 protein_id gnl|my_center|LOCUS_18570 31410 32699 gene locus_tag LOCUS_18580 31410 32699 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_18580 32728 33147 gene locus_tag LOCUS_18590 32728 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 33923 33150 gene locus_tag LOCUS_18600 33923 33150 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228726.1 protein_id gnl|my_center|LOCUS_18600 34056 34331 gene locus_tag LOCUS_18610 34056 34331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 34331 34981 gene locus_tag LOCUS_18620 34331 34981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 34978 35613 gene locus_tag LOCUS_18630 34978 35613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 35620 36783 gene locus_tag LOCUS_18640 35620 36783 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_18640 36793 38331 gene locus_tag LOCUS_18650 36793 38331 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_18650 38341 40149 gene locus_tag LOCUS_18660 38341 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 40956 40207 gene locus_tag LOCUS_18670 gene pgl 40956 40207 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_18670 41831 40953 gene locus_tag LOCUS_18680 41831 40953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 43375 41831 gene locus_tag LOCUS_18690 gene zwf 43375 41831 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_18690 <44001 43372 gene locus_tag LOCUS_18700 <44001 43372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256404.1:decarboxylating 6-phosphogluconate dehydrogenase >Feature sequence22 <1 1426 gene locus_tag LOCUS_18710 <1 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582600.1:TldD/PmbA family protein 1419 2750 gene locus_tag LOCUS_18720 1419 2750 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_18720 3504 2728 gene locus_tag LOCUS_18730 gene proC 3504 2728 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_18730 4519 3644 gene locus_tag LOCUS_18740 4519 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5050 4523 gene locus_tag LOCUS_18750 5050 4523 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_18750 5332 5060 gene locus_tag LOCUS_18760 5332 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5375 6232 gene locus_tag LOCUS_18770 gene folD 5375 6232 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_18770 6946 6245 gene locus_tag LOCUS_18780 6946 6245 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_18780 7048 7677 gene locus_tag LOCUS_18790 7048 7677 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460932.1 protein_id gnl|my_center|LOCUS_18790 7682 8161 gene locus_tag LOCUS_18800 7682 8161 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730990.1 protein_id gnl|my_center|LOCUS_18800 8541 8188 gene locus_tag LOCUS_18810 8541 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 8428 8796 gene locus_tag LOCUS_18820 8428 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18820 9288 8800 gene locus_tag LOCUS_18830 9288 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 9926 9285 gene locus_tag LOCUS_18840 9926 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 10049 10819 gene locus_tag LOCUS_18850 gene sufC 10049 10819 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_18850 10812 11927 gene locus_tag LOCUS_18860 gene sufD 10812 11927 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259319.1 protein_id gnl|my_center|LOCUS_18860 11924 13168 gene locus_tag LOCUS_18870 11924 13168 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_18870 13175 13570 gene locus_tag LOCUS_18880 13175 13570 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_18880 13567 13902 gene locus_tag LOCUS_18890 13567 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 13899 15521 gene locus_tag LOCUS_18900 13899 15521 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_18900 15788 15528 gene locus_tag LOCUS_18910 15788 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 15814 16329 gene locus_tag LOCUS_18920 15814 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 16577 16293 gene locus_tag LOCUS_18930 16577 16293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 16637 16942 gene locus_tag LOCUS_18940 16637 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 16939 17640 gene locus_tag LOCUS_18950 16939 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 17633 18331 gene locus_tag LOCUS_18960 17633 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 18318 19058 gene locus_tag LOCUS_18970 18318 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 19073 19783 gene locus_tag LOCUS_18980 gene pcp 19073 19783 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482616.1 protein_id gnl|my_center|LOCUS_18980 19882 21501 gene locus_tag LOCUS_18990 19882 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 21517 23526 gene locus_tag LOCUS_19000 21517 23526 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142806.1 protein_id gnl|my_center|LOCUS_19000 23531 25132 gene locus_tag LOCUS_19010 23531 25132 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967661.1 protein_id gnl|my_center|LOCUS_19010 25134 26774 gene locus_tag LOCUS_19020 25134 26774 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_19020 26747 27316 gene locus_tag LOCUS_19030 26747 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 28171 27338 gene locus_tag LOCUS_19040 28171 27338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_19040 28269 28114 gene locus_tag LOCUS_19050 28269 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19050 28569 28438 gene locus_tag LOCUS_19060 28569 28438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 30524 28590 gene locus_tag LOCUS_19070 30524 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 30523 31053 gene locus_tag LOCUS_19080 30523 31053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 31370 31047 gene locus_tag LOCUS_19090 31370 31047 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_19090 32156 31374 gene locus_tag LOCUS_19100 32156 31374 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_19100 32413 32213 gene locus_tag LOCUS_19110 gene thiS 32413 32213 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230301.1 protein_id gnl|my_center|LOCUS_19110 33502 32432 gene locus_tag LOCUS_19120 gene thiO 33502 32432 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_19120 35173 33512 gene locus_tag LOCUS_19130 35173 33512 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 protein_id gnl|my_center|LOCUS_19130 35927 35193 gene locus_tag LOCUS_19140 35927 35193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 35926 36543 gene locus_tag LOCUS_19150 35926 36543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 36536 37891 gene locus_tag LOCUS_19160 36536 37891 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_19160 37945 38289 gene locus_tag LOCUS_19170 37945 38289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 39575 38409 gene locus_tag LOCUS_19180 39575 38409 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence23 1134 34 gene locus_tag LOCUS_19190 gene murG 1134 34 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_19190 2318 1137 gene locus_tag LOCUS_19200 gene spoVE 2318 1137 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_19200 3732 2311 gene locus_tag LOCUS_19210 gene murD 3732 2311 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_19210 4748 3729 gene locus_tag LOCUS_19220 gene mraY 4748 3729 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_19220 5452 4745 gene locus_tag LOCUS_19230 5452 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 6825 5449 gene locus_tag LOCUS_19240 6825 5449 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_19240 8228 6822 gene locus_tag LOCUS_19250 8228 6822 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_19250 9978 8221 gene locus_tag LOCUS_19260 9978 8221 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_19260 10431 9985 gene locus_tag LOCUS_19270 10431 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 11308 10433 gene locus_tag LOCUS_19280 gene rsmH 11308 10433 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228422.1 protein_id gnl|my_center|LOCUS_19280 11764 11321 gene locus_tag LOCUS_19290 gene mraZ 11764 11321 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_19290 12153 12815 gene locus_tag LOCUS_19300 12153 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 13294 12899 gene locus_tag LOCUS_19310 13294 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 13677 13291 gene locus_tag LOCUS_19320 13677 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 13898 14368 gene locus_tag LOCUS_19330 13898 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 14379 15533 gene locus_tag LOCUS_19340 14379 15533 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930937.1 protein_id gnl|my_center|LOCUS_19340 15539 18205 gene locus_tag LOCUS_19350 15539 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 19009 18212 gene locus_tag LOCUS_19360 19009 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 18999 20504 gene locus_tag LOCUS_19370 gene lnt 18999 20504 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071408.1 protein_id gnl|my_center|LOCUS_19370 20497 21078 gene locus_tag LOCUS_19380 20497 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 21099 21614 gene locus_tag LOCUS_19390 21099 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 21822 21601 gene locus_tag LOCUS_19400 21822 21601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 21897 23261 gene locus_tag LOCUS_19410 21897 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 23261 24052 gene locus_tag LOCUS_19420 23261 24052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 24578 23970 gene locus_tag LOCUS_19430 gene coaE 24578 23970 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_19430 25859 24681 gene locus_tag LOCUS_19440 25859 24681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 26715 25879 gene locus_tag LOCUS_19450 gene mutM 26715 25879 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_19450 27158 26718 gene locus_tag LOCUS_19460 27158 26718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 29783 27159 gene locus_tag LOCUS_19470 gene polA 29783 27159 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729359.1 protein_id gnl|my_center|LOCUS_19470 32140 29780 gene locus_tag LOCUS_19480 32140 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 32139 32390 gene locus_tag LOCUS_19490 32139 32390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 32418 32912 gene locus_tag LOCUS_19500 32418 32912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 32921 33151 gene locus_tag LOCUS_19510 32921 33151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 33148 33990 gene locus_tag LOCUS_19520 33148 33990 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064258.1 protein_id gnl|my_center|LOCUS_19520 33992 34369 gene locus_tag LOCUS_19530 33992 34369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 34821 34366 gene locus_tag LOCUS_19540 34821 34366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 35233 36342 gene locus_tag LOCUS_19550 35233 36342 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_19550 36339 36656 gene locus_tag LOCUS_19560 36339 36656 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063774.1 protein_id gnl|my_center|LOCUS_19560 36653 38047 gene locus_tag LOCUS_19570 36653 38047 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_19570 38499 39056 gene locus_tag LOCUS_19580 38499 39056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence24 186 1559 gene locus_tag LOCUS_19590 186 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1538 1804 gene locus_tag LOCUS_19600 1538 1804 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895291.1 protein_id gnl|my_center|LOCUS_19600 1848 2726 gene locus_tag LOCUS_19610 1848 2726 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_19610 4779 2668 gene locus_tag LOCUS_19620 4779 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5210 4776 gene locus_tag LOCUS_19630 5210 4776 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_19630 7153 5207 gene locus_tag LOCUS_19640 7153 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 7260 7718 gene locus_tag LOCUS_19650 7260 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7718 8275 gene locus_tag LOCUS_19660 7718 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 9010 8246 gene locus_tag LOCUS_19670 9010 8246 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_19670 9927 9007 gene locus_tag LOCUS_19680 9927 9007 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_19680 9975 11228 gene locus_tag LOCUS_19690 gene egtB 9975 11228 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_19690 11893 11231 gene locus_tag LOCUS_19700 11893 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19700 12421 11918 gene locus_tag LOCUS_19710 12421 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19710 12476 13429 gene locus_tag LOCUS_19720 gene selD 12476 13429 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_19720 13490 13717 gene locus_tag LOCUS_19730 13490 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 13785 14555 gene locus_tag LOCUS_19740 13785 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 14568 14795 gene locus_tag LOCUS_19750 14568 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 15490 15329 gene locus_tag LOCUS_19760 15490 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 16026 16253 gene locus_tag LOCUS_19770 16026 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19770 16914 17096 gene locus_tag LOCUS_19780 16914 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 17550 17113 gene locus_tag LOCUS_19790 17550 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19790 18249 18070 gene locus_tag LOCUS_19800 18249 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 18713 18396 gene locus_tag LOCUS_19810 18713 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 19534 21072 gene locus_tag LOCUS_19820 19534 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 22274 23068 gene locus_tag LOCUS_19830 22274 23068 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011326545.1 protein_id gnl|my_center|LOCUS_19830 24034 23237 gene locus_tag LOCUS_19840 24034 23237 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125007056.1 protein_id gnl|my_center|LOCUS_19840 24436 24260 gene locus_tag LOCUS_19850 24436 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 25424 24651 gene locus_tag LOCUS_19860 25424 24651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19860 25855 25559 gene locus_tag LOCUS_19870 25855 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19870 25854 26378 gene locus_tag LOCUS_19880 25854 26378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 26984 26502 gene locus_tag LOCUS_19890 26984 26502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 29655 27478 gene locus_tag LOCUS_19900 29655 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 30034 29657 gene locus_tag LOCUS_19910 30034 29657 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618277.1 protein_id gnl|my_center|LOCUS_19910 31947 30097 gene locus_tag LOCUS_19920 gene uvrC 31947 30097 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_19920 32574 31954 gene locus_tag LOCUS_19930 32574 31954 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_19930 32918 32571 gene locus_tag LOCUS_19940 32918 32571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 33107 33031 gene locus_tag LOCUS_t00390 33107 33031 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33191 33889 gene locus_tag LOCUS_19950 33191 33889 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_19950 33891 34580 gene locus_tag LOCUS_19960 33891 34580 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_19960 35836 34622 gene locus_tag LOCUS_19970 35836 34622 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_19970 36649 35843 gene locus_tag LOCUS_19980 gene dapF 36649 35843 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140817.1 protein_id gnl|my_center|LOCUS_19980 37561 36662 gene locus_tag LOCUS_19990 gene miaA 37561 36662 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_19990 38733 37561 gene locus_tag LOCUS_20000 38733 37561 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207959.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence25 1693 1226 gene locus_tag LOCUS_20010 1693 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1700 3475 gene locus_tag LOCUS_20020 1700 3475 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_20020 3942 3472 gene locus_tag LOCUS_20030 gene folK 3942 3472 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 protein_id gnl|my_center|LOCUS_20030 4319 3942 gene locus_tag LOCUS_20040 gene folB 4319 3942 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391948.1 protein_id gnl|my_center|LOCUS_20040 5104 4286 gene locus_tag LOCUS_20050 gene folP 5104 4286 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438639.1 protein_id gnl|my_center|LOCUS_20050 6372 5098 gene locus_tag LOCUS_20060 6372 5098 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_20060 6857 6369 gene locus_tag LOCUS_20070 6857 6369 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_20070 7285 6854 gene locus_tag LOCUS_20080 gene moaC 7285 6854 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764132.1 protein_id gnl|my_center|LOCUS_20080 7352 8539 gene locus_tag LOCUS_20090 7352 8539 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393972.1 protein_id gnl|my_center|LOCUS_20090 8536 9450 gene locus_tag LOCUS_20100 8536 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 9646 9455 gene locus_tag LOCUS_20110 9646 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 10490 9648 gene locus_tag LOCUS_20120 10490 9648 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_20120 10589 10987 gene locus_tag LOCUS_20130 10589 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 11198 10992 gene locus_tag LOCUS_20140 11198 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 12404 11682 gene locus_tag LOCUS_20150 12404 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 12832 12407 gene locus_tag LOCUS_20160 12832 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 13262 12852 gene locus_tag LOCUS_20170 13262 12852 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705855.1 protein_id gnl|my_center|LOCUS_20170 13991 13281 gene locus_tag LOCUS_20180 13991 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 15436 14063 gene locus_tag LOCUS_20190 15436 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 16314 15454 gene locus_tag LOCUS_20200 gene aroF 16314 15454 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_20200 17084 16341 gene locus_tag LOCUS_20210 17084 16341 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_20210 18554 17091 gene locus_tag LOCUS_20220 gene rho 18554 17091 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_20220 19081 18677 gene locus_tag LOCUS_20230 19081 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 20274 19132 gene locus_tag LOCUS_20240 20274 19132 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_20240 20523 21557 gene locus_tag LOCUS_20250 20523 21557 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768275.1 protein_id gnl|my_center|LOCUS_20250 21554 22384 gene locus_tag LOCUS_20260 gene rsmA 21554 22384 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837565.1 protein_id gnl|my_center|LOCUS_20260 22317 23093 gene locus_tag LOCUS_20270 22317 23093 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288860.1 protein_id gnl|my_center|LOCUS_20270 23103 24125 gene locus_tag LOCUS_20280 23103 24125 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_20280 25212 24112 gene locus_tag LOCUS_20290 25212 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 26255 25209 gene locus_tag LOCUS_20300 26255 25209 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141525.1 protein_id gnl|my_center|LOCUS_20300 27520 26279 gene locus_tag LOCUS_20310 27520 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 28767 27517 gene locus_tag LOCUS_20320 28767 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 30683 28764 gene locus_tag LOCUS_20330 gene ftsH 30683 28764 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 protein_id gnl|my_center|LOCUS_20330 31279 30707 gene locus_tag LOCUS_20340 gene hpt 31279 30707 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_20340 32156 31269 gene locus_tag LOCUS_20350 32156 31269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 32653 32153 gene locus_tag LOCUS_20360 gene smpB 32653 32153 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_20360 33037 32666 gene locus_tag LOCUS_20370 33037 32666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 33840 33115 gene locus_tag LOCUS_20380 33840 33115 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_20380 34931 33837 gene locus_tag LOCUS_20390 34931 33837 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384956.1 protein_id gnl|my_center|LOCUS_20390 36161 34941 gene locus_tag LOCUS_20400 36161 34941 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence26 1002 595 gene locus_tag LOCUS_20410 1002 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3363 1435 gene locus_tag LOCUS_20420 3363 1435 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970453.1 protein_id gnl|my_center|LOCUS_20420 8858 3372 gene locus_tag LOCUS_20430 8858 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 9192 8851 gene locus_tag LOCUS_20440 9192 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 11777 9933 gene locus_tag LOCUS_20450 11777 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 12856 11774 gene locus_tag LOCUS_20460 12856 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 13813 13463 gene locus_tag LOCUS_20470 13813 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 15371 14769 gene locus_tag LOCUS_20480 15371 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20480 16419 16826 gene locus_tag LOCUS_20490 16419 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 16959 17531 gene locus_tag LOCUS_20500 16959 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 17701 17627 gene locus_tag LOCUS_t00400 17701 17627 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17947 17876 gene locus_tag LOCUS_t00410 17947 17876 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19156 17957 gene locus_tag LOCUS_20510 19156 17957 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_20510 20464 19163 gene locus_tag LOCUS_20520 gene eno 20464 19163 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_20520 20925 20470 gene locus_tag LOCUS_20530 gene ndk 20925 20470 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_20530 21110 21784 gene locus_tag LOCUS_20540 21110 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 22017 21802 gene locus_tag LOCUS_20550 22017 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 23363 22032 gene locus_tag LOCUS_20560 23363 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 25039 23360 gene locus_tag LOCUS_20570 25039 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 25693 25157 gene locus_tag LOCUS_20580 25693 25157 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_20580 25754 26116 gene locus_tag LOCUS_20590 25754 26116 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_20590 26113 27651 gene locus_tag LOCUS_20600 26113 27651 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_20600 28295 27648 gene locus_tag LOCUS_20610 28295 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 30317 28323 gene locus_tag LOCUS_20620 gene ligA 30317 28323 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_20620 33286 30314 gene locus_tag LOCUS_20630 gene uvrA 33286 30314 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_20630 34024 33290 gene locus_tag LOCUS_20640 34024 33290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 34737 34021 gene locus_tag LOCUS_20650 34737 34021 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_20650 34799 35959 gene locus_tag LOCUS_20660 34799 35959 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence27 865 2403 gene locus_tag LOCUS_20670 865 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2420 2821 gene locus_tag LOCUS_20680 2420 2821 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 protein_id gnl|my_center|LOCUS_20680 2797 4407 gene locus_tag LOCUS_20690 2797 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5195 4404 gene locus_tag LOCUS_20700 gene trpA 5195 4404 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142606.1 protein_id gnl|my_center|LOCUS_20700 6364 5192 gene locus_tag LOCUS_20710 gene trpB 6364 5192 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_20710 6983 6354 gene locus_tag LOCUS_20720 6983 6354 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528978.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20720 7774 6980 gene locus_tag LOCUS_20730 gene trpC 7774 6980 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423144.1 protein_id gnl|my_center|LOCUS_20730 8807 7767 gene locus_tag LOCUS_20740 gene trpD 8807 7767 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975564.1 protein_id gnl|my_center|LOCUS_20740 9213 8857 gene locus_tag LOCUS_20750 gene rplQ 9213 8857 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_20750 10157 9231 gene locus_tag LOCUS_20760 10157 9231 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_20760 10966 10256 gene locus_tag LOCUS_20770 gene rpsD 10966 10256 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_20770 11381 10986 gene locus_tag LOCUS_20780 gene rpsK 11381 10986 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_20780 11622 14231 gene locus_tag LOCUS_20790 11622 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 15628 14330 gene locus_tag LOCUS_20800 15628 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 15768 16997 gene locus_tag LOCUS_20810 15768 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 17049 17348 gene locus_tag LOCUS_20820 17049 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 18749 17469 gene locus_tag LOCUS_20830 18749 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 20056 18866 gene locus_tag LOCUS_20840 20056 18866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_20840 20816 20037 gene locus_tag LOCUS_20850 20816 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 21202 20819 gene locus_tag LOCUS_20860 gene rpsM 21202 20819 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_20860 21654 21361 gene locus_tag LOCUS_20870 21654 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 22474 21671 gene locus_tag LOCUS_20880 gene map 22474 21671 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_20880 23129 22479 gene locus_tag LOCUS_20890 23129 22479 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_20890 24423 23131 gene locus_tag LOCUS_20900 gene secY 24423 23131 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_20900 24990 24427 gene locus_tag LOCUS_20910 gene rplO 24990 24427 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766080.1 protein_id gnl|my_center|LOCUS_20910 25549 25028 gene locus_tag LOCUS_20920 gene rpsE 25549 25028 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_20920 25915 25550 gene locus_tag LOCUS_20930 gene rplR 25915 25550 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_20930 26466 25915 gene locus_tag LOCUS_20940 gene rplF 26466 25915 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_20940 26882 26481 gene locus_tag LOCUS_20950 gene rpsH 26882 26481 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_20950 27670 27092 gene locus_tag LOCUS_20960 gene rplE 27670 27092 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_20960 28036 27674 gene locus_tag LOCUS_20970 gene rplX 28036 27674 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_20970 28418 28041 gene locus_tag LOCUS_20980 gene rplN 28418 28041 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936658.1 protein_id gnl|my_center|LOCUS_20980 28689 28420 gene locus_tag LOCUS_20990 gene rpsQ 28689 28420 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_20990 28900 28676 gene locus_tag LOCUS_21000 gene rpmC 28900 28676 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_21000 29316 28897 gene locus_tag LOCUS_21010 gene rplP 29316 28897 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_21010 30175 29318 gene locus_tag LOCUS_21020 30175 29318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 30652 30179 gene locus_tag LOCUS_21030 30652 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 30927 30652 gene locus_tag LOCUS_21040 gene rpsS 30927 30652 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140906.1 protein_id gnl|my_center|LOCUS_21040 31755 30931 gene locus_tag LOCUS_21050 gene rplB 31755 30931 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869925.1 protein_id gnl|my_center|LOCUS_21050 32075 31767 gene locus_tag LOCUS_21060 gene rplW 32075 31767 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_21060 32734 32075 gene locus_tag LOCUS_21070 gene rplD 32734 32075 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_21070 33379 32738 gene locus_tag LOCUS_21080 gene rplC 33379 32738 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_21080 33811 33623 gene locus_tag LOCUS_21090 33811 33623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence28 <1 560 gene locus_tag LOCUS_21100 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391697.1:polysaccharide biosynthesis protein 856 1761 gene locus_tag LOCUS_21110 856 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_21110 1941 1666 gene locus_tag LOCUS_21120 1941 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1908 2471 gene locus_tag LOCUS_21130 gene greA 1908 2471 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_21130 2484 3983 gene locus_tag LOCUS_21140 gene lysS 2484 3983 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_21140 4083 4514 gene locus_tag LOCUS_21150 4083 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4569 5402 gene locus_tag LOCUS_21160 gene truA 4569 5402 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815924.1 protein_id gnl|my_center|LOCUS_21160 6869 5361 gene locus_tag LOCUS_21170 6869 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6905 7330 gene locus_tag LOCUS_21180 gene rplM 6905 7330 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_21180 7339 7728 gene locus_tag LOCUS_21190 gene rpsI 7339 7728 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_21190 7866 8795 gene locus_tag LOCUS_21200 7866 8795 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_21200 8843 9055 gene locus_tag LOCUS_21210 8843 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 9052 9381 gene locus_tag LOCUS_21220 9052 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9378 9650 gene locus_tag LOCUS_21230 9378 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9710 11098 gene locus_tag LOCUS_21240 9710 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 11091 11564 gene locus_tag LOCUS_21250 11091 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 11561 12793 gene locus_tag LOCUS_21260 11561 12793 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405326.1 protein_id gnl|my_center|LOCUS_21260 12797 13393 gene locus_tag LOCUS_21270 12797 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 13445 14011 gene locus_tag LOCUS_21280 13445 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 14001 14720 gene locus_tag LOCUS_21290 14001 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 14717 15502 gene locus_tag LOCUS_21300 14717 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 15507 15797 gene locus_tag LOCUS_21310 15507 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 15862 16518 gene locus_tag LOCUS_21320 gene fliP 15862 16518 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061723562.1 protein_id gnl|my_center|LOCUS_21320 17484 16543 gene locus_tag LOCUS_21330 17484 16543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_21330 18151 17495 gene locus_tag LOCUS_21340 18151 17495 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_21340 18548 19447 gene locus_tag LOCUS_21350 gene metF 18548 19447 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_21350 19494 19760 gene locus_tag LOCUS_21360 gene fliQ 19494 19760 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965448.1 protein_id gnl|my_center|LOCUS_21360 19757 20464 gene locus_tag LOCUS_21370 19757 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 20421 21467 gene locus_tag LOCUS_21380 gene flhB 20421 21467 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918961.1 protein_id gnl|my_center|LOCUS_21380 21467 23473 gene locus_tag LOCUS_21390 gene flhA 21467 23473 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_21390 23596 24945 gene locus_tag LOCUS_21400 gene secD 23596 24945 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_21400 24949 26253 gene locus_tag LOCUS_21410 24949 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 26228 28195 gene locus_tag LOCUS_21420 26228 28195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 28314 31952 gene locus_tag LOCUS_21430 28314 31952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence29 582 1295 gene locus_tag LOCUS_21440 582 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1367 2167 gene locus_tag LOCUS_21450 1367 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2203 2889 gene locus_tag LOCUS_21460 2203 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2889 3611 gene locus_tag LOCUS_21470 2889 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3622 7680 gene locus_tag LOCUS_21480 3622 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 8114 7677 gene locus_tag LOCUS_21490 8114 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 9753 8146 gene locus_tag LOCUS_21500 9753 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 11182 9743 gene locus_tag LOCUS_21510 gene pelF 11182 9743 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_21510 12399 11179 gene locus_tag LOCUS_21520 12399 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 13156 12401 gene locus_tag LOCUS_21530 13156 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 14811 13153 gene locus_tag LOCUS_21540 14811 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 14914 15354 gene locus_tag LOCUS_21550 14914 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 16669 15332 gene locus_tag LOCUS_21560 16669 15332 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_21560 17847 16693 gene locus_tag LOCUS_21570 17847 16693 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 protein_id gnl|my_center|LOCUS_21570 18616 17840 gene locus_tag LOCUS_21580 18616 17840 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_21580 18996 18613 gene locus_tag LOCUS_21590 18996 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 19321 18998 gene locus_tag LOCUS_21600 19321 18998 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_21600 19320 19994 gene locus_tag LOCUS_21610 19320 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 19994 20662 gene locus_tag LOCUS_21620 19994 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 21278 20667 gene locus_tag LOCUS_21630 21278 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 21837 21352 gene locus_tag LOCUS_21640 21837 21352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 21963 22049 gene locus_tag LOCUS_t00420 21963 22049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22681 22061 gene locus_tag LOCUS_21650 22681 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 23917 22700 gene locus_tag LOCUS_21660 23917 22700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_21660 24615 23914 gene locus_tag LOCUS_21670 24615 23914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_21670 26089 24617 gene locus_tag LOCUS_21680 26089 24617 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088058.1 protein_id gnl|my_center|LOCUS_21680 26310 26750 gene locus_tag LOCUS_21690 26310 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 27451 26747 gene locus_tag LOCUS_21700 27451 26747 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_21700 27562 27720 gene locus_tag LOCUS_21710 27562 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 27733 28266 gene locus_tag LOCUS_21720 27733 28266 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889621.1 protein_id gnl|my_center|LOCUS_21720 28697 28263 gene locus_tag LOCUS_21730 28697 28263 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797556.1 protein_id gnl|my_center|LOCUS_21730 29128 28802 gene locus_tag LOCUS_21740 29128 28802 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938889.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence30 858 1064 gene locus_tag LOCUS_21750 858 1064 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070876731.1 protein_id gnl|my_center|LOCUS_21750 1068 2222 gene locus_tag LOCUS_21760 1068 2222 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_21760 3499 2219 gene locus_tag LOCUS_21770 gene fahA 3499 2219 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186438.1 protein_id gnl|my_center|LOCUS_21770 4365 3496 gene locus_tag LOCUS_21780 4365 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_21780 4371 5549 gene locus_tag LOCUS_21790 gene hppD 4371 5549 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_21790 5576 6436 gene locus_tag LOCUS_21800 gene deoC 5576 6436 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_21800 6437 7885 gene locus_tag LOCUS_21810 6437 7885 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_21810 7882 10764 gene locus_tag LOCUS_21820 7882 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10768 11979 gene locus_tag LOCUS_21830 10768 11979 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 protein_id gnl|my_center|LOCUS_21830 11964 13574 gene locus_tag LOCUS_21840 11964 13574 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_21840 13687 15141 gene locus_tag LOCUS_21850 13687 15141 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_21850 15148 18105 gene locus_tag LOCUS_21860 15148 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_21860 18092 19048 gene locus_tag LOCUS_21870 18092 19048 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_21870 19789 19034 gene locus_tag LOCUS_21880 19789 19034 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889498.1 protein_id gnl|my_center|LOCUS_21880 20838 19789 gene locus_tag LOCUS_21890 gene cobT 20838 19789 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_21890 21421 20810 gene locus_tag LOCUS_21900 21421 20810 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257085.1 protein_id gnl|my_center|LOCUS_21900 21448 22326 gene locus_tag LOCUS_21910 21448 22326 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_21910 22328 22924 gene locus_tag LOCUS_21920 22328 22924 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_21920 22970 23734 gene locus_tag LOCUS_21930 22970 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 23763 23851 gene locus_tag LOCUS_t00430 23763 23851 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23975 24742 gene locus_tag LOCUS_21940 23975 24742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 25475 24747 gene locus_tag LOCUS_21950 gene aroE 25475 24747 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168154.1 protein_id gnl|my_center|LOCUS_21950 26005 25472 gene locus_tag LOCUS_21960 26005 25472 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence31 2322 271 gene locus_tag LOCUS_21970 gene uvrB 2322 271 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_21970 2415 3428 gene locus_tag LOCUS_21980 2415 3428 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258060.1 protein_id gnl|my_center|LOCUS_21980 3453 4100 gene locus_tag LOCUS_21990 3453 4100 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_21990 4191 4688 gene locus_tag LOCUS_22000 gene pth 4191 4688 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_22000 4883 5401 gene locus_tag LOCUS_22010 4883 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5403 6251 gene locus_tag LOCUS_22020 5403 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 7422 6268 gene locus_tag LOCUS_22030 7422 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 8505 7459 gene locus_tag LOCUS_22040 8505 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 8531 9862 gene locus_tag LOCUS_22050 8531 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_22050 9849 11276 gene locus_tag LOCUS_22060 9849 11276 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_22060 12596 11259 gene locus_tag LOCUS_22070 gene glmU 12596 11259 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_22070 14092 12593 gene locus_tag LOCUS_22080 gene gltX 14092 12593 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_22080 14499 14089 gene locus_tag LOCUS_22090 14499 14089 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_22090 16334 14622 gene locus_tag LOCUS_22100 16334 14622 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_22100 17373 16387 gene locus_tag LOCUS_22110 gene meaB 17373 16387 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_22110 17340 18374 gene locus_tag LOCUS_22120 17340 18374 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_22120 18365 19732 gene locus_tag LOCUS_22130 18365 19732 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_22130 19781 23023 gene locus_tag LOCUS_22140 19781 23023 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_22140 23272 24573 gene locus_tag LOCUS_22150 gene aceA 23272 24573 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 protein_id gnl|my_center|LOCUS_22150 24570 26072 gene locus_tag LOCUS_22160 gene aceB 24570 26072 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483026.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence32 1829 3040 gene locus_tag LOCUS_22170 gene ftsA 1829 3040 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_22170 3041 4165 gene locus_tag LOCUS_22180 gene ftsZ 3041 4165 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_22180 4178 4981 gene locus_tag LOCUS_22190 4178 4981 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056998.1 protein_id gnl|my_center|LOCUS_22190 5251 6234 gene locus_tag LOCUS_22200 5251 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6203 7258 gene locus_tag LOCUS_22210 6203 7258 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_22210 7255 8469 gene locus_tag LOCUS_22220 7255 8469 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_22220 8466 9167 gene locus_tag LOCUS_22230 8466 9167 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_22230 9185 9652 gene locus_tag LOCUS_22240 9185 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 10242 10766 gene locus_tag LOCUS_22250 10242 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 10913 11371 gene locus_tag LOCUS_22260 10913 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 11358 12323 gene locus_tag LOCUS_22270 11358 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 12323 12901 gene locus_tag LOCUS_22280 12323 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 13446 13940 gene locus_tag LOCUS_22290 13446 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 13937 15334 gene locus_tag LOCUS_22300 13937 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 16199 15309 gene locus_tag LOCUS_22310 16199 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 16281 18896 gene locus_tag LOCUS_22320 16281 18896 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_22320 18893 19435 gene locus_tag LOCUS_22330 gene pyrR 18893 19435 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_22330 19419 20324 gene locus_tag LOCUS_22340 19419 20324 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_22340 20328 21602 gene locus_tag LOCUS_22350 20328 21602 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880489.1 protein_id gnl|my_center|LOCUS_22350 23666 21540 gene locus_tag LOCUS_22360 23666 21540 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_22360 24312 23677 gene locus_tag LOCUS_22370 24312 23677 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence33 <1 630 gene locus_tag LOCUS_22380 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496518.1:homocitrate synthase family protein 3740 1218 gene locus_tag LOCUS_22390 3740 1218 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_22390 4583 3750 gene locus_tag LOCUS_22400 4583 3750 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_22400 5008 4580 gene locus_tag LOCUS_22410 5008 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5042 5587 gene locus_tag LOCUS_22420 5042 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 5658 7085 gene locus_tag LOCUS_22430 gene fumC 5658 7085 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958006.1 protein_id gnl|my_center|LOCUS_22430 7151 8623 gene locus_tag LOCUS_22440 7151 8623 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198630.1 protein_id gnl|my_center|LOCUS_22440 9339 8620 gene locus_tag LOCUS_22450 9339 8620 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455762.1 protein_id gnl|my_center|LOCUS_22450 11288 9393 gene locus_tag LOCUS_22460 11288 9393 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_22460 11864 11304 gene locus_tag LOCUS_22470 gene efp 11864 11304 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_22470 12044 14587 gene locus_tag LOCUS_22480 12044 14587 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_22480 15548 14949 gene locus_tag LOCUS_22490 gene plsY 15548 14949 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087861.1 protein_id gnl|my_center|LOCUS_22490 16936 15545 gene locus_tag LOCUS_22500 gene der 16936 15545 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_22500 17003 18400 gene locus_tag LOCUS_22510 gene miaB 17003 18400 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811605.1 protein_id gnl|my_center|LOCUS_22510 18397 20880 gene locus_tag LOCUS_22520 gene mutS 18397 20880 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774369.1 protein_id gnl|my_center|LOCUS_22520 20873 22567 gene locus_tag LOCUS_22530 gene mutL 20873 22567 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence34 <1 977 gene locus_tag LOCUS_22540 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990711.1:HAMP domain-containing methyl-accepting chemotaxis protein 1030 1323 gene locus_tag LOCUS_22550 1030 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2068 1337 gene locus_tag LOCUS_22560 2068 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2874 2065 gene locus_tag LOCUS_22570 2874 2065 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_22570 4157 2871 gene locus_tag LOCUS_22580 gene hisD 4157 2871 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 protein_id gnl|my_center|LOCUS_22580 4783 4151 gene locus_tag LOCUS_22590 gene hisG 4783 4151 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393532.1 protein_id gnl|my_center|LOCUS_22590 5970 4783 gene locus_tag LOCUS_22600 gene hisZ 5970 4783 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_22600 9284 5967 gene locus_tag LOCUS_22610 9284 5967 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_22610 9174 9434 gene locus_tag LOCUS_22620 9174 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 9493 10644 gene locus_tag LOCUS_22630 9493 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 10783 12468 gene locus_tag LOCUS_22640 10783 12468 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_22640 12468 13427 gene locus_tag LOCUS_22650 12468 13427 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_22650 13427 14317 gene locus_tag LOCUS_22660 13427 14317 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_22660 15800 14400 gene locus_tag LOCUS_22670 15800 14400 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804509.1 protein_id gnl|my_center|LOCUS_22670 15914 16690 gene locus_tag LOCUS_22680 gene surE 15914 16690 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_22680 16897 18624 gene locus_tag LOCUS_22690 16897 18624 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079800.1 protein_id gnl|my_center|LOCUS_22690 19123 18611 gene locus_tag LOCUS_22700 19123 18611 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_22700 20261 19128 gene locus_tag LOCUS_22710 20261 19128 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_22710 20571 21962 gene locus_tag LOCUS_22720 gene pckA 20571 21962 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_22720 22004 22405 gene locus_tag LOCUS_22730 22004 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence35 475 2775 gene locus_tag LOCUS_22740 475 2775 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_22740 2899 5484 gene locus_tag LOCUS_22750 2899 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5500 6345 gene locus_tag LOCUS_22760 5500 6345 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_22760 6692 6354 gene locus_tag LOCUS_22770 6692 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939692.1 protein_id gnl|my_center|LOCUS_22770 6750 8237 gene locus_tag LOCUS_22780 6750 8237 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_22780 8234 9094 gene locus_tag LOCUS_22790 gene ubiA 8234 9094 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_22790 9091 10242 gene locus_tag LOCUS_22800 9091 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 10397 10239 gene locus_tag LOCUS_22810 10397 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 11529 10402 gene locus_tag LOCUS_22820 11529 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 12407 11532 gene locus_tag LOCUS_22830 12407 11532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_22830 12802 12404 gene locus_tag LOCUS_22840 12802 12404 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_22840 15968 13203 gene locus_tag LOCUS_22850 15968 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 16097 17395 gene locus_tag LOCUS_22860 16097 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 17341 18621 gene locus_tag LOCUS_22870 17341 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 20456 18978 gene locus_tag LOCUS_22880 20456 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence36 1557 73 gene locus_tag LOCUS_22890 gene cysS 1557 73 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693844.1 protein_id gnl|my_center|LOCUS_22890 2221 1535 gene locus_tag LOCUS_22900 gene cysE 2221 1535 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_22900 2799 2233 gene locus_tag LOCUS_22910 2799 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3278 2796 gene locus_tag LOCUS_22920 gene ispF 3278 2796 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_22920 3973 3275 gene locus_tag LOCUS_22930 gene ispD 3973 3275 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_22930 5045 3975 gene locus_tag LOCUS_22940 5045 3975 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966462.1 protein_id gnl|my_center|LOCUS_22940 6178 5045 gene locus_tag LOCUS_22950 gene hemW 6178 5045 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_22950 7023 6175 gene locus_tag LOCUS_22960 7023 6175 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_22960 7868 7020 gene locus_tag LOCUS_22970 7868 7020 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081771.1 protein_id gnl|my_center|LOCUS_22970 8727 7876 gene locus_tag LOCUS_22980 8727 7876 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_22980 9738 8728 gene locus_tag LOCUS_22990 gene plsX 9738 8728 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_22990 11320 9731 gene locus_tag LOCUS_23000 11320 9731 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227781.1 protein_id gnl|my_center|LOCUS_23000 11481 11672 gene locus_tag LOCUS_23010 gene rpmB 11481 11672 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_23010 12150 11728 gene locus_tag LOCUS_23020 12150 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 13106 12147 gene locus_tag LOCUS_23030 gene pdxY 13106 12147 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528990.1 protein_id gnl|my_center|LOCUS_23030 14091 13093 gene locus_tag LOCUS_23040 gene thiL 14091 13093 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 protein_id gnl|my_center|LOCUS_23040 14741 14088 gene locus_tag LOCUS_23050 gene rpe 14741 14088 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_23050 15778 14738 gene locus_tag LOCUS_23060 15778 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 16528 15782 gene locus_tag LOCUS_23070 16528 15782 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393206.1 protein_id gnl|my_center|LOCUS_23070 <18699 16581 gene locus_tag LOCUS_23080 <18699 16581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730541.1:phospholipid carrier-dependent glycosyltransferase >Feature sequence37 1550 513 gene locus_tag LOCUS_23090 1550 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887741.1 protein_id gnl|my_center|LOCUS_23090 1639 2088 gene locus_tag LOCUS_23100 1639 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3687 2077 gene locus_tag LOCUS_23110 3687 2077 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966695.1 protein_id gnl|my_center|LOCUS_23110 4847 3684 gene locus_tag LOCUS_23120 4847 3684 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_23120 5641 4850 gene locus_tag LOCUS_23130 5641 4850 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_23130 6963 6223 gene locus_tag LOCUS_23140 6963 6223 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_23140 9233 6960 gene locus_tag LOCUS_23150 9233 6960 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_23150 10054 9233 gene locus_tag LOCUS_23160 10054 9233 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946385.1 protein_id gnl|my_center|LOCUS_23160 10350 10015 gene locus_tag LOCUS_23170 10350 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 11867 10347 gene locus_tag LOCUS_23180 11867 10347 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_23180 11893 12078 gene locus_tag LOCUS_23190 11893 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 12075 13511 gene locus_tag LOCUS_23200 12075 13511 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125918.1 protein_id gnl|my_center|LOCUS_23200 13508 14056 gene locus_tag LOCUS_23210 13508 14056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_23210 14413 14090 gene locus_tag LOCUS_23220 14413 14090 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_23220 15048 14617 gene locus_tag LOCUS_23230 15048 14617 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403937.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence38 307 1482 gene locus_tag LOCUS_23240 307 1482 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_23240 2691 1498 gene locus_tag LOCUS_23250 2691 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23250 2976 2692 gene locus_tag LOCUS_23260 2976 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23260 4205 3687 gene locus_tag LOCUS_23270 4205 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4683 4315 gene locus_tag LOCUS_23280 4683 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 6627 5347 gene locus_tag LOCUS_23290 6627 5347 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_23290 6562 6897 gene locus_tag LOCUS_23300 6562 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 6948 7322 gene locus_tag LOCUS_23310 6948 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7426 7953 gene locus_tag LOCUS_23320 7426 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 9398 7929 gene locus_tag LOCUS_23330 9398 7929 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_23330 9504 9800 gene locus_tag LOCUS_23340 9504 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 9921 11096 gene locus_tag LOCUS_23350 9921 11096 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_23350 14180 11175 gene locus_tag LOCUS_23360 14180 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_23360 14371 14610 gene locus_tag LOCUS_23370 14371 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 14622 15233 gene locus_tag LOCUS_23380 14622 15233 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_23380 15745 15912 gene locus_tag LOCUS_23390 15745 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 15992 16609 gene locus_tag LOCUS_23400 15992 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 <17281 16625 gene locus_tag LOCUS_23410 <17281 16625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038157.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence39 2251 185 gene locus_tag LOCUS_23420 2251 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3479 2241 gene locus_tag LOCUS_23430 3479 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 4770 3481 gene locus_tag LOCUS_23440 4770 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4872 5531 gene locus_tag LOCUS_23450 4872 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 6933 5608 gene locus_tag LOCUS_23460 6933 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 7206 8462 gene locus_tag LOCUS_23470 7206 8462 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870127.1 protein_id gnl|my_center|LOCUS_23470 8464 9792 gene locus_tag LOCUS_23480 8464 9792 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_23480 9850 11004 gene locus_tag LOCUS_23490 9850 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 11005 12642 gene locus_tag LOCUS_23500 11005 12642 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_23500 13228 12656 gene locus_tag LOCUS_23510 13228 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 14057 13233 gene locus_tag LOCUS_23520 14057 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 14142 15509 gene locus_tag LOCUS_23530 14142 15509 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence40 <1 513 gene locus_tag LOCUS_23540 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085848.1:M20/M25/M40 family metallo-hydrolase 510 2603 gene locus_tag LOCUS_23550 510 2603 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_23550 4136 2607 gene locus_tag LOCUS_23560 4136 2607 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_23560 4681 4253 gene locus_tag LOCUS_23570 4681 4253 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_23570 4663 6051 gene locus_tag LOCUS_23580 4663 6051 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_23580 6061 6363 gene locus_tag LOCUS_23590 6061 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6360 7286 gene locus_tag LOCUS_23600 6360 7286 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007451.1 protein_id gnl|my_center|LOCUS_23600 7283 7960 gene locus_tag LOCUS_23610 7283 7960 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_23610 8032 9129 gene locus_tag LOCUS_23620 8032 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 9146 10828 gene locus_tag LOCUS_23630 gene ctaD 9146 10828 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_23630 10841 11461 gene locus_tag LOCUS_23640 10841 11461 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_23640 11471 11680 gene locus_tag LOCUS_23650 11471 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 11682 11873 gene locus_tag LOCUS_23660 11682 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 12876 12304 gene locus_tag LOCUS_23670 12876 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 14542 12911 gene locus_tag LOCUS_23680 14542 12911 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_23680 <15675 14566 gene locus_tag LOCUS_23690 <15675 14566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259349.1:MFS transporter >Feature sequence41 <1 1503 gene locus_tag LOCUS_23700 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965496.1:gamma-glutamyltransferase 1545 2429 gene locus_tag LOCUS_23710 1545 2429 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_23710 2422 3432 gene locus_tag LOCUS_23720 2422 3432 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_23720 3440 3817 gene locus_tag LOCUS_23730 3440 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 5285 3927 gene locus_tag LOCUS_23740 5285 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5910 6386 gene locus_tag LOCUS_23750 5910 6386 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_23750 6555 6860 gene locus_tag LOCUS_23760 6555 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 7111 6863 gene locus_tag LOCUS_23770 7111 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 7551 7360 gene locus_tag LOCUS_23780 7551 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 8311 9045 gene locus_tag LOCUS_23790 8311 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 11390 10884 gene locus_tag LOCUS_23800 11390 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 11872 11603 gene locus_tag LOCUS_23810 gene rpsO 11872 11603 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632621.1 protein_id gnl|my_center|LOCUS_23810 12729 11989 gene locus_tag LOCUS_23820 gene phbB 12729 11989 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_23820 12980 13360 gene locus_tag LOCUS_23830 12980 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 13381 15201 gene locus_tag LOCUS_23840 gene recQ 13381 15201 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence42 407 910 gene locus_tag LOCUS_23850 407 910 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393736.1 protein_id gnl|my_center|LOCUS_23850 1551 907 gene locus_tag LOCUS_23860 1551 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2092 1568 gene locus_tag LOCUS_23870 2092 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2315 2464 gene locus_tag LOCUS_23880 2315 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2448 3656 gene locus_tag LOCUS_23890 2448 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3660 5732 gene locus_tag LOCUS_23900 3660 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6145 7584 gene locus_tag LOCUS_23910 6145 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 7589 9694 gene locus_tag LOCUS_23920 7589 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 9829 10101 gene locus_tag LOCUS_23930 9829 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 10188 11273 gene locus_tag LOCUS_23940 gene prfA 10188 11273 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_23940 11242 12150 gene locus_tag LOCUS_23950 gene prmC 11242 12150 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_23950 12174 13829 gene locus_tag LOCUS_23960 12174 13829 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence43 1609 62 gene locus_tag LOCUS_23970 1609 62 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932603.1 protein_id gnl|my_center|LOCUS_23970 1687 2211 gene locus_tag LOCUS_23980 1687 2211 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_23980 6462 2221 gene locus_tag LOCUS_23990 6462 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 8380 6488 gene locus_tag LOCUS_24000 8380 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 9078 8461 gene locus_tag LOCUS_24010 9078 8461 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_24010 9155 10615 gene locus_tag LOCUS_24020 gene proS 9155 10615 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_24020 10629 11117 gene locus_tag LOCUS_24030 10629 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 11117 12367 gene locus_tag LOCUS_24040 11117 12367 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_24040 12371 13249 gene locus_tag LOCUS_24050 12371 13249 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461588.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence44 71 439 gene locus_tag LOCUS_24060 71 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1632 676 gene locus_tag LOCUS_24070 1632 676 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 protein_id gnl|my_center|LOCUS_24070 2066 2434 gene locus_tag LOCUS_24080 2066 2434 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920799.1 protein_id gnl|my_center|LOCUS_24080 3654 2470 gene locus_tag LOCUS_24090 3654 2470 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112513.1 protein_id gnl|my_center|LOCUS_24090 4637 3651 gene locus_tag LOCUS_24100 4637 3651 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_24100 5073 4648 gene locus_tag LOCUS_24110 5073 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 5879 5082 gene locus_tag LOCUS_24120 5879 5082 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_24120 6127 5885 gene locus_tag LOCUS_24130 6127 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 6608 6300 gene locus_tag LOCUS_24140 gene rpsJ 6608 6300 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_24140 7864 6659 gene locus_tag LOCUS_24150 gene tuf 7864 6659 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_24150 9997 7898 gene locus_tag LOCUS_24160 gene fusA 9997 7898 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_24160 10477 10007 gene locus_tag LOCUS_24170 gene rpsG 10477 10007 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_24170 10924 10484 gene locus_tag LOCUS_24180 gene rpsL 10924 10484 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459097.1 protein_id gnl|my_center|LOCUS_24180 11668 11018 gene locus_tag LOCUS_24190 11668 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 13158 11746 gene locus_tag LOCUS_24200 13158 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence45 1568 198 gene locus_tag LOCUS_24210 gene leuC 1568 198 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_24210 1527 2831 gene locus_tag LOCUS_24220 1527 2831 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 protein_id gnl|my_center|LOCUS_24220 2828 3304 gene locus_tag LOCUS_24230 2828 3304 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_24230 3301 4401 gene locus_tag LOCUS_24240 3301 4401 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_24240 4398 5615 gene locus_tag LOCUS_24250 4398 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5612 6847 gene locus_tag LOCUS_24260 gene gabT 5612 6847 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_24260 6863 7924 gene locus_tag LOCUS_24270 6863 7924 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_24270 9435 7882 gene locus_tag LOCUS_24280 9435 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 11734 9443 gene locus_tag LOCUS_24290 11734 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 11809 12021 gene locus_tag LOCUS_24300 11809 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence46 2456 1284 gene locus_tag LOCUS_24310 2456 1284 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_24310 3810 2464 gene locus_tag LOCUS_24320 3810 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 5286 3961 gene locus_tag LOCUS_24330 5286 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 6858 5290 gene locus_tag LOCUS_24340 gene pruA 6858 5290 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_24340 8247 7000 gene locus_tag LOCUS_24350 8247 7000 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_24350 8852 8247 gene locus_tag LOCUS_24360 8852 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 9704 8853 gene locus_tag LOCUS_24370 9704 8853 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173912.1 protein_id gnl|my_center|LOCUS_24370 10572 9670 gene locus_tag LOCUS_24380 10572 9670 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228998.1 protein_id gnl|my_center|LOCUS_24380 11974 10559 gene locus_tag LOCUS_24390 gene lpdA 11974 10559 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883470.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence47 2929 4257 gene locus_tag LOCUS_24400 2929 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 4536 5822 gene locus_tag LOCUS_24410 4536 5822 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_24410 7637 5829 gene locus_tag LOCUS_24420 7637 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 7670 8506 gene locus_tag LOCUS_24430 7670 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 8499 9794 gene locus_tag LOCUS_24440 gene glnA 8499 9794 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_24440 <11264 9801 gene locus_tag LOCUS_24450 <11264 9801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921872.1:ATP-binding protein >Feature sequence48 865 41 gene locus_tag LOCUS_24460 865 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1695 859 gene locus_tag LOCUS_24470 1695 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1776 2939 gene locus_tag LOCUS_24480 1776 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2963 3385 gene locus_tag LOCUS_24490 2963 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3397 4011 gene locus_tag LOCUS_24500 3397 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4383 4015 gene locus_tag LOCUS_24510 4383 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 5105 4410 gene locus_tag LOCUS_24520 5105 4410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_24520 5241 6176 gene locus_tag LOCUS_24530 5241 6176 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972240.1 protein_id gnl|my_center|LOCUS_24530 6188 6373 gene locus_tag LOCUS_24540 6188 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 6370 7830 gene locus_tag LOCUS_24550 6370 7830 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_24550 7827 8222 gene locus_tag LOCUS_24560 7827 8222 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372681.1 protein_id gnl|my_center|LOCUS_24560 <9379 8219 gene locus_tag LOCUS_24570 <9379 8219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072278426.1:glycosyltransferase family 39 protein >Feature sequence49 2891 258 gene locus_tag LOCUS_24580 2891 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3262 2888 gene locus_tag LOCUS_24590 3262 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7140 3343 gene locus_tag LOCUS_24600 gene rpoC 7140 3343 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773568.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence50 1293 925 gene locus_tag LOCUS_24610 1293 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2879 1293 gene locus_tag LOCUS_24620 2879 1293 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_24620 3367 2879 gene locus_tag LOCUS_24630 3367 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4407 3364 gene locus_tag LOCUS_24640 4407 3364 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065537.1 protein_id gnl|my_center|LOCUS_24640 4879 4460 gene locus_tag LOCUS_24650 4879 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 4990 5754 gene locus_tag LOCUS_24660 4990 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 5815 6705 gene locus_tag LOCUS_24670 5815 6705 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_24670 6705 7580 gene locus_tag LOCUS_24680 6705 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence51 1512 43 gene locus_tag LOCUS_24690 1512 43 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202677.1 protein_id gnl|my_center|LOCUS_24690 2450 1509 gene locus_tag LOCUS_24700 2450 1509 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_24700 2979 2443 gene locus_tag LOCUS_24710 2979 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3174 3371 gene locus_tag LOCUS_24720 3174 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4533 3376 gene locus_tag LOCUS_24730 4533 3376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 protein_id gnl|my_center|LOCUS_24730 4604 5383 gene locus_tag LOCUS_24740 4604 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5475 6011 gene locus_tag LOCUS_24750 5475 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 6732 6025 gene locus_tag LOCUS_24760 6732 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 6973 7308 gene locus_tag LOCUS_24770 6973 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence52 782 1120 gene locus_tag LOCUS_24780 782 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1130 2110 gene locus_tag LOCUS_24790 gene ugpC 1130 2110 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_24790 2107 3582 gene locus_tag LOCUS_24800 2107 3582 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030127.1 protein_id gnl|my_center|LOCUS_24800 3579 4598 gene locus_tag LOCUS_24810 3579 4598 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_24810 4598 5746 gene locus_tag LOCUS_24820 4598 5746 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_24820 5746 6408 gene locus_tag LOCUS_24830 5746 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence53 2006 1581 gene locus_tag LOCUS_24840 2006 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3238 2591 gene locus_tag LOCUS_24850 gene hisIE 3238 2591 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_24850 3993 3220 gene locus_tag LOCUS_24860 gene hisF 3993 3220 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_24860 4943 3984 gene locus_tag LOCUS_24870 4943 3984 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_24870 5058 5864 gene locus_tag LOCUS_24880 gene bglS 5058 5864 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244531.1 protein_id gnl|my_center|LOCUS_24880 5943 5869 gene locus_tag LOCUS_t00440 5943 5869 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6028 5955 gene locus_tag LOCUS_t00450 6028 5955 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence54 577 113 gene locus_tag LOCUS_24890 577 113 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_24890 703 1164 gene locus_tag LOCUS_24900 703 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1264 2799 gene locus_tag LOCUS_24910 1264 2799 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_24910 3466 2828 gene locus_tag LOCUS_24920 3466 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4469 3825 gene locus_tag LOCUS_24930 4469 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5321 4482 gene locus_tag LOCUS_24940 5321 4482 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173736.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence55 29 1003 gene locus_tag LOCUS_24950 29 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1054 1743 gene locus_tag LOCUS_24960 gene mprA 1054 1743 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_24960 1740 3071 gene locus_tag LOCUS_24970 1740 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence56 2178 2699 gene locus_tag LOCUS_24980 2178 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3065 3556 gene locus_tag LOCUS_24990 3065 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence57 <1 755 gene locus_tag LOCUS_25000 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394225.1:VOC family protein 1096 1284 gene locus_tag LOCUS_25010 1096 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2714 1281 gene locus_tag LOCUS_25020 2714 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020