>Feature sequence001 572 1462 gene locus_tag LOCUS_00010 572 1462 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980466.1 protein_id gnl|my_center|LOCUS_00010 1516 1863 gene locus_tag LOCUS_00020 1516 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1879 2847 gene locus_tag LOCUS_00030 1879 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3430 2852 gene locus_tag LOCUS_00040 3430 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3980 3432 gene locus_tag LOCUS_00050 3980 3432 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_00050 4773 4105 gene locus_tag LOCUS_00060 4773 4105 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965943.1 protein_id gnl|my_center|LOCUS_00060 5266 4808 gene locus_tag LOCUS_00070 5266 4808 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_00070 6429 5272 gene locus_tag LOCUS_00080 gene fbp 6429 5272 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868421.1 protein_id gnl|my_center|LOCUS_00080 6590 8149 gene locus_tag LOCUS_00090 6590 8149 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_00090 8299 8448 gene locus_tag LOCUS_00100 8299 8448 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870213.1 protein_id gnl|my_center|LOCUS_00100 8489 9238 gene locus_tag LOCUS_00110 gene purQ 8489 9238 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_00110 9781 9239 gene locus_tag LOCUS_00120 9781 9239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978946.1 protein_id gnl|my_center|LOCUS_00120 9919 11823 gene locus_tag LOCUS_00130 9919 11823 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_00130 11813 12739 gene locus_tag LOCUS_00140 11813 12739 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980518.1 protein_id gnl|my_center|LOCUS_00140 13425 12736 gene locus_tag LOCUS_00150 gene pyrH 13425 12736 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867869.1 protein_id gnl|my_center|LOCUS_00150 13463 14701 gene locus_tag LOCUS_00160 gene prf1 13463 14701 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_00160 14965 14693 gene locus_tag LOCUS_00170 14965 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17208 14980 gene locus_tag LOCUS_00180 17208 14980 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_00180 18160 17375 gene locus_tag LOCUS_00190 18160 17375 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_00190 18295 18621 gene locus_tag LOCUS_00200 18295 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846534.1 protein_id gnl|my_center|LOCUS_00200 19129 20034 gene locus_tag LOCUS_00210 19129 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20165 20091 gene locus_tag LOCUS_t00010 20165 20091 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20848 20387 gene locus_tag LOCUS_00220 20848 20387 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979770.1 protein_id gnl|my_center|LOCUS_00220 21081 21491 gene locus_tag LOCUS_00230 21081 21491 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_00230 21484 22146 gene locus_tag LOCUS_00240 21484 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23147 22143 gene locus_tag LOCUS_00250 23147 22143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_00250 24856 23144 gene locus_tag LOCUS_00260 24856 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26297 24858 gene locus_tag LOCUS_00270 26297 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26465 27727 gene locus_tag LOCUS_00280 26465 27727 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_00280 27724 28215 gene locus_tag LOCUS_00290 27724 28215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28220 29713 gene locus_tag LOCUS_00300 28220 29713 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883384.1 protein_id gnl|my_center|LOCUS_00300 29826 29978 gene locus_tag LOCUS_00310 29826 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29917 31557 gene locus_tag LOCUS_00320 gene thsB 29917 31557 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_00320 31798 32904 gene locus_tag LOCUS_00330 gene sucC 31798 32904 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_00330 32906 33763 gene locus_tag LOCUS_00340 gene sucD 32906 33763 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_00340 33769 34686 gene locus_tag LOCUS_00350 gene argF 33769 34686 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_00350 34729 35520 gene locus_tag LOCUS_00360 34729 35520 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_00360 35517 35648 gene locus_tag LOCUS_00370 35517 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36259 35657 gene locus_tag LOCUS_00380 36259 35657 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_00380 36573 36256 gene locus_tag LOCUS_00390 36573 36256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 36840 36625 gene locus_tag LOCUS_00400 36840 36625 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_00400 37002 36850 gene locus_tag LOCUS_00410 37002 36850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 37577 36999 gene locus_tag LOCUS_00420 37577 36999 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_00420 37768 37841 gene locus_tag LOCUS_t00020 37768 37841 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38072 38677 gene locus_tag LOCUS_00430 38072 38677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 39020 38679 gene locus_tag LOCUS_00440 39020 38679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 39127 40017 gene locus_tag LOCUS_00450 gene dapA 39127 40017 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_00450 40090 40458 gene locus_tag LOCUS_00460 gene rpl7ae 40090 40458 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_00460 40469 40678 gene locus_tag LOCUS_00470 40469 40678 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_00470 40684 40965 gene locus_tag LOCUS_00480 40684 40965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 40965 41414 gene locus_tag LOCUS_00490 gene ndk 40965 41414 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_00490 41431 43173 gene locus_tag LOCUS_00500 gene infB 41431 43173 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_00500 44197 43289 gene locus_tag LOCUS_00510 44197 43289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 44601 44206 gene locus_tag LOCUS_00520 gene speD 44601 44206 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_00520 45454 44762 gene locus_tag LOCUS_00530 45454 44762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 45706 47556 gene locus_tag LOCUS_00540 45706 47556 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_00540 47528 48172 gene locus_tag LOCUS_00550 gene lipB 47528 48172 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_00550 49742 48192 gene locus_tag LOCUS_00560 gene pruA 49742 48192 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_00560 49983 51020 gene locus_tag LOCUS_00570 49983 51020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 51758 51048 gene locus_tag LOCUS_00580 51758 51048 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 protein_id gnl|my_center|LOCUS_00580 52560 51790 gene locus_tag LOCUS_00590 gene truA 52560 51790 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_00590 52665 53627 gene locus_tag LOCUS_00600 52665 53627 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_00600 54182 53622 gene locus_tag LOCUS_00610 54182 53622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00610 55559 54438 gene locus_tag LOCUS_00620 55559 54438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00620 58242 55552 gene locus_tag LOCUS_00630 gene leuS 58242 55552 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_00630 58736 58248 gene locus_tag LOCUS_00640 58736 58248 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_00640 59284 58877 gene locus_tag LOCUS_00650 59284 58877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 61122 59299 gene locus_tag LOCUS_00660 61122 59299 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_00660 61594 61920 gene locus_tag LOCUS_00670 61594 61920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 61926 63512 gene locus_tag LOCUS_00680 gene pheT 61926 63512 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence002 734 1312 gene locus_tag LOCUS_00690 734 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1317 1835 gene locus_tag LOCUS_00700 1317 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 1840 2802 gene locus_tag LOCUS_00710 1840 2802 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_00710 2802 4124 gene locus_tag LOCUS_00720 2802 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4124 5002 gene locus_tag LOCUS_00730 4124 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 4977 6251 gene locus_tag LOCUS_00740 4977 6251 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_00740 7722 6241 gene locus_tag LOCUS_00750 7722 6241 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869988.1 protein_id gnl|my_center|LOCUS_00750 7830 8576 gene locus_tag LOCUS_00760 7830 8576 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_00760 9750 8485 gene locus_tag LOCUS_00770 gene hemA 9750 8485 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_00770 9989 11188 gene locus_tag LOCUS_00780 9989 11188 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249758.1 protein_id gnl|my_center|LOCUS_00780 11296 11685 gene locus_tag LOCUS_00790 11296 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 11743 11970 gene locus_tag LOCUS_00800 11743 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 12281 12964 gene locus_tag LOCUS_00810 12281 12964 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_00810 14195 12945 gene locus_tag LOCUS_00820 14195 12945 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_00820 14824 14195 gene locus_tag LOCUS_00830 14824 14195 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_00830 15578 14832 gene locus_tag LOCUS_00840 15578 14832 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878035.1 protein_id gnl|my_center|LOCUS_00840 16477 15575 gene locus_tag LOCUS_00850 16477 15575 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_00850 17059 16619 gene locus_tag LOCUS_00860 17059 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 17500 18309 gene locus_tag LOCUS_00870 17500 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 18951 18295 gene locus_tag LOCUS_00880 18951 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20936 18945 gene locus_tag LOCUS_00890 20936 18945 CDS product K(+)-transporting ATPase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852430.1 protein_id gnl|my_center|LOCUS_00890 22702 20933 gene locus_tag LOCUS_00900 gene kdpA 22702 20933 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_00900 24820 23273 gene locus_tag LOCUS_00910 24820 23273 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_00910 25694 24891 gene locus_tag LOCUS_00920 25694 24891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_00920 26683 25691 gene locus_tag LOCUS_00930 26683 25691 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_00930 27097 26684 gene locus_tag LOCUS_00940 27097 26684 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979839.1 protein_id gnl|my_center|LOCUS_00940 27569 27318 gene locus_tag LOCUS_00950 27569 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 27451 28047 gene locus_tag LOCUS_00960 27451 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 28767 28051 gene locus_tag LOCUS_00970 28767 28051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 28816 29829 gene locus_tag LOCUS_00980 28816 29829 CDS product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 protein_id gnl|my_center|LOCUS_00980 32576 29880 gene locus_tag LOCUS_00990 32576 29880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 32964 34349 gene locus_tag LOCUS_01000 32964 34349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 35049 34336 gene locus_tag LOCUS_01010 35049 34336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936279.1 protein_id gnl|my_center|LOCUS_01010 35870 35049 gene locus_tag LOCUS_01020 35870 35049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 protein_id gnl|my_center|LOCUS_01020 36236 35904 gene locus_tag LOCUS_01030 36236 35904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 37361 36270 gene locus_tag LOCUS_01040 37361 36270 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980376.1 protein_id gnl|my_center|LOCUS_01040 37911 37345 gene locus_tag LOCUS_01050 37911 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 38328 37975 gene locus_tag LOCUS_01060 38328 37975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 38458 39486 gene locus_tag LOCUS_01070 38458 39486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 39650 39483 gene locus_tag LOCUS_01080 39650 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 40436 39663 gene locus_tag LOCUS_01090 40436 39663 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979458.1 protein_id gnl|my_center|LOCUS_01090 40672 40956 gene locus_tag LOCUS_01100 40672 40956 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846969.1 protein_id gnl|my_center|LOCUS_01100 40953 41477 gene locus_tag LOCUS_01110 40953 41477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 42758 42468 gene locus_tag LOCUS_01120 42758 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 43049 43861 gene locus_tag LOCUS_01130 43049 43861 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979765.1 protein_id gnl|my_center|LOCUS_01130 43886 44770 gene locus_tag LOCUS_01140 43886 44770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 44774 46678 gene locus_tag LOCUS_01150 44774 46678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 46753 47451 gene locus_tag LOCUS_01160 46753 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 47588 48130 gene locus_tag LOCUS_01170 47588 48130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 48575 48138 gene locus_tag LOCUS_01180 48575 48138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 49005 49391 gene locus_tag LOCUS_01190 49005 49391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 50418 49378 gene locus_tag LOCUS_01200 50418 49378 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965219.1 protein_id gnl|my_center|LOCUS_01200 51557 50415 gene locus_tag LOCUS_01210 51557 50415 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_01210 52434 51559 gene locus_tag LOCUS_01220 52434 51559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 53530 52445 gene locus_tag LOCUS_01230 gene hppD 53530 52445 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 protein_id gnl|my_center|LOCUS_01230 53768 54217 gene locus_tag LOCUS_01240 53768 54217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence003 1377 55 gene locus_tag LOCUS_01250 gene gcvPA 1377 55 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_01250 2326 1442 gene locus_tag LOCUS_01260 2326 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2461 3189 gene locus_tag LOCUS_01270 2461 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3273 3198 gene locus_tag LOCUS_t00030 3273 3198 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3518 4363 gene locus_tag LOCUS_01280 3518 4363 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_01280 4324 4836 gene locus_tag LOCUS_01290 4324 4836 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_01290 4829 5533 gene locus_tag LOCUS_01300 gene queC 4829 5533 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_01300 6508 5540 gene locus_tag LOCUS_01310 gene mdh 6508 5540 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_01310 6985 8433 gene locus_tag LOCUS_01320 6985 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 8501 9469 gene locus_tag LOCUS_01330 gene hemB 8501 9469 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437722.1 protein_id gnl|my_center|LOCUS_01330 9502 11262 gene locus_tag LOCUS_01340 9502 11262 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_01340 11373 12293 gene locus_tag LOCUS_01350 11373 12293 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879283.1 protein_id gnl|my_center|LOCUS_01350 12294 12923 gene locus_tag LOCUS_01360 12294 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 13501 12914 gene locus_tag LOCUS_01370 gene rrmJ 13501 12914 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_01370 13872 13498 gene locus_tag LOCUS_01380 gene gcvH 13872 13498 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_01380 14209 13940 gene locus_tag LOCUS_01390 14209 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 14412 15083 gene locus_tag LOCUS_01400 14412 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15762 15112 gene locus_tag LOCUS_01410 gene snatA 15762 15112 CDS product neutral amino acid NAAT transporter SnatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250610.1 protein_id gnl|my_center|LOCUS_01410 15912 16757 gene locus_tag LOCUS_01420 15912 16757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 16732 17457 gene locus_tag LOCUS_01430 16732 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 18381 17479 gene locus_tag LOCUS_01440 18381 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 19058 18378 gene locus_tag LOCUS_01450 19058 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 20034 19213 gene locus_tag LOCUS_01460 20034 19213 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_01460 21096 20035 gene locus_tag LOCUS_01470 21096 20035 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 protein_id gnl|my_center|LOCUS_01470 21243 21791 gene locus_tag LOCUS_01480 21243 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 22417 21797 gene locus_tag LOCUS_01490 22417 21797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 22682 23704 gene locus_tag LOCUS_01500 gene asd 22682 23704 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404575.1 protein_id gnl|my_center|LOCUS_01500 23701 24597 gene locus_tag LOCUS_01510 23701 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 24698 25603 gene locus_tag LOCUS_01520 24698 25603 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_01520 25672 26796 gene locus_tag LOCUS_01530 gene aroC 25672 26796 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_01530 28467 26737 gene locus_tag LOCUS_01540 28467 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 29564 28509 gene locus_tag LOCUS_01550 29564 28509 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_01550 31296 29569 gene locus_tag LOCUS_01560 31296 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 33961 31319 gene locus_tag LOCUS_01570 gene alaS 33961 31319 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879744.1 protein_id gnl|my_center|LOCUS_01570 34805 34137 gene locus_tag LOCUS_01580 34805 34137 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_01580 35083 34805 gene locus_tag LOCUS_01590 35083 34805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 35392 35658 gene locus_tag LOCUS_01600 35392 35658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 35667 36755 gene locus_tag LOCUS_01610 35667 36755 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980376.1 protein_id gnl|my_center|LOCUS_01610 36791 38137 gene locus_tag LOCUS_01620 gene glmM 36791 38137 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_01620 39450 38230 gene locus_tag LOCUS_01630 39450 38230 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_01630 40676 39447 gene locus_tag LOCUS_01640 gene ahcY 40676 39447 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_01640 41314 40673 gene locus_tag LOCUS_01650 41314 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence004 1364 624 gene locus_tag LOCUS_01660 1364 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979153.1 protein_id gnl|my_center|LOCUS_01660 1569 2327 gene locus_tag LOCUS_01670 1569 2327 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_01670 2932 2540 gene locus_tag LOCUS_01680 2932 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3383 4372 gene locus_tag LOCUS_01690 3383 4372 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_01690 4450 4626 gene locus_tag LOCUS_01700 4450 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4607 4957 gene locus_tag LOCUS_01710 4607 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5086 5334 gene locus_tag LOCUS_01720 5086 5334 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_01720 5449 6888 gene locus_tag LOCUS_01730 gene purF 5449 6888 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869699.1 protein_id gnl|my_center|LOCUS_01730 7681 6890 gene locus_tag LOCUS_01740 7681 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8765 7665 gene locus_tag LOCUS_01750 8765 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9285 8758 gene locus_tag LOCUS_01760 9285 8758 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_01760 9992 9282 gene locus_tag LOCUS_01770 9992 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 10537 9989 gene locus_tag LOCUS_01780 10537 9989 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_01780 12164 10539 gene locus_tag LOCUS_01790 gene secY 12164 10539 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_01790 12744 12301 gene locus_tag LOCUS_01800 12744 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13222 12731 gene locus_tag LOCUS_01810 13222 12731 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250471.1 protein_id gnl|my_center|LOCUS_01810 13868 13206 gene locus_tag LOCUS_01820 gene rpsE 13868 13206 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_01820 14355 13870 gene locus_tag LOCUS_01830 14355 13870 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319359.1 protein_id gnl|my_center|LOCUS_01830 14806 14357 gene locus_tag LOCUS_01840 14806 14357 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_01840 15217 14807 gene locus_tag LOCUS_01850 15217 14807 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869973.1 protein_id gnl|my_center|LOCUS_01850 15759 15217 gene locus_tag LOCUS_01860 15759 15217 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_01860 16159 15770 gene locus_tag LOCUS_01870 16159 15770 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_01870 16330 16169 gene locus_tag LOCUS_01880 16330 16169 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_01880 16851 16330 gene locus_tag LOCUS_01890 16851 16330 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_01890 17561 16848 gene locus_tag LOCUS_01900 17561 16848 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_01900 18115 17561 gene locus_tag LOCUS_01910 18115 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 18525 18127 gene locus_tag LOCUS_01920 18525 18127 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867453.1 protein_id gnl|my_center|LOCUS_01920 18848 18522 gene locus_tag LOCUS_01930 18848 18522 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_01930 19139 18849 gene locus_tag LOCUS_01940 19139 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 19441 19139 gene locus_tag LOCUS_01950 gene yciH 19441 19139 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050002739.1 protein_id gnl|my_center|LOCUS_01950 19644 19438 gene locus_tag LOCUS_01960 19644 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 20266 19604 gene locus_tag LOCUS_01970 20266 19604 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869961.1 protein_id gnl|my_center|LOCUS_01970 20712 20263 gene locus_tag LOCUS_01980 gene rplV 20712 20263 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496502.1 protein_id gnl|my_center|LOCUS_01980 21174 20719 gene locus_tag LOCUS_01990 gene rpsS 21174 20719 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_01990 21866 21171 gene locus_tag LOCUS_02000 21866 21171 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_02000 22133 21876 gene locus_tag LOCUS_02010 22133 21876 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_02010 22885 22130 gene locus_tag LOCUS_02020 gene rpl4p 22885 22130 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_02020 23877 22888 gene locus_tag LOCUS_02030 gene rpl3p 23877 22888 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_02030 24780 24088 gene locus_tag LOCUS_02040 24780 24088 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902872.1 protein_id gnl|my_center|LOCUS_02040 24847 25107 gene locus_tag LOCUS_02050 24847 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 25740 25189 gene locus_tag LOCUS_02060 25740 25189 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589749.1 protein_id gnl|my_center|LOCUS_02060 27117 25840 gene locus_tag LOCUS_02070 27117 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 28504 27110 gene locus_tag LOCUS_02080 28504 27110 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_02080 28696 28622 gene locus_tag LOCUS_t00040 28696 28622 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29425 28757 gene locus_tag LOCUS_02090 29425 28757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 30078 29440 gene locus_tag LOCUS_02100 gene tpiA 30078 29440 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871052.1 protein_id gnl|my_center|LOCUS_02100 30216 30290 gene locus_tag LOCUS_t00050 30216 30290 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 635 1054 gene locus_tag LOCUS_02110 635 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1064 1771 gene locus_tag LOCUS_02120 1064 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2429 1953 gene locus_tag LOCUS_02130 gene pyrI 2429 1953 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877621.1 protein_id gnl|my_center|LOCUS_02130 3351 2422 gene locus_tag LOCUS_02140 gene pyrB 3351 2422 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_02140 4171 3419 gene locus_tag LOCUS_02150 4171 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5388 4168 gene locus_tag LOCUS_02160 5388 4168 CDS product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182574366.1 protein_id gnl|my_center|LOCUS_02160 5580 8306 gene locus_tag LOCUS_02170 5580 8306 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_02170 8342 8668 gene locus_tag LOCUS_02180 8342 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9410 8622 gene locus_tag LOCUS_02190 9410 8622 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394513.1 protein_id gnl|my_center|LOCUS_02190 10464 9403 gene locus_tag LOCUS_02200 10464 9403 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_02200 11449 10457 gene locus_tag LOCUS_02210 11449 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11578 12564 gene locus_tag LOCUS_02220 11578 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 13574 12561 gene locus_tag LOCUS_02230 13574 12561 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529026.1 protein_id gnl|my_center|LOCUS_02230 14946 15953 gene locus_tag LOCUS_02240 14946 15953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 18237 15961 gene locus_tag LOCUS_02250 18237 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 19263 18295 gene locus_tag LOCUS_02260 19263 18295 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_02260 21131 19542 gene locus_tag LOCUS_02270 21131 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 22159 21269 gene locus_tag LOCUS_02280 22159 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 22368 22568 gene locus_tag LOCUS_02290 22368 22568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 23189 24301 gene locus_tag LOCUS_02300 23189 24301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 24298 25137 gene locus_tag LOCUS_02310 24298 25137 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_02310 25134 26222 gene locus_tag LOCUS_02320 25134 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 26219 27211 gene locus_tag LOCUS_02330 26219 27211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 27966 27208 gene locus_tag LOCUS_02340 27966 27208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 28519 28136 gene locus_tag LOCUS_02350 28519 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence006 1619 750 gene locus_tag LOCUS_02360 1619 750 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_02360 1804 3981 gene locus_tag LOCUS_02370 gene glgB 1804 3981 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_02370 3983 5902 gene locus_tag LOCUS_02380 3983 5902 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_02380 5899 7554 gene locus_tag LOCUS_02390 5899 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7551 8879 gene locus_tag LOCUS_02400 7551 8879 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_02400 9428 8895 gene locus_tag LOCUS_02410 9428 8895 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979504.1 protein_id gnl|my_center|LOCUS_02410 9599 10063 gene locus_tag LOCUS_02420 9599 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 11133 10126 gene locus_tag LOCUS_02430 gene acdA 11133 10126 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_02430 12250 11126 gene locus_tag LOCUS_02440 12250 11126 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878637.1 protein_id gnl|my_center|LOCUS_02440 13516 12251 gene locus_tag LOCUS_02450 13516 12251 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761790.1 protein_id gnl|my_center|LOCUS_02450 13598 14347 gene locus_tag LOCUS_02460 13598 14347 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_02460 14344 15234 gene locus_tag LOCUS_02470 14344 15234 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_02470 16110 15346 gene locus_tag LOCUS_02480 16110 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 16771 16247 gene locus_tag LOCUS_02490 16771 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 16978 17886 gene locus_tag LOCUS_02500 16978 17886 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_02500 19187 17925 gene locus_tag LOCUS_02510 19187 17925 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_02510 20077 19187 gene locus_tag LOCUS_02520 20077 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 20379 21356 gene locus_tag LOCUS_02530 20379 21356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 21925 21335 gene locus_tag LOCUS_02540 21925 21335 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_02540 22009 23994 gene locus_tag LOCUS_02550 22009 23994 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_02550 23991 24902 gene locus_tag LOCUS_02560 23991 24902 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015424.1 protein_id gnl|my_center|LOCUS_02560 24913 26208 gene locus_tag LOCUS_02570 24913 26208 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_02570 26208 27140 gene locus_tag LOCUS_02580 26208 27140 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_02580 27286 27471 gene locus_tag LOCUS_02590 27286 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence007 <1 1855 gene locus_tag LOCUS_02600 <1 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020726.1:minichromosome maintenance protein MCM 1860 2165 gene locus_tag LOCUS_02610 1860 2165 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064559.1 protein_id gnl|my_center|LOCUS_02610 2185 2838 gene locus_tag LOCUS_02620 gene ubiE 2185 2838 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_02620 2947 4188 gene locus_tag LOCUS_02630 2947 4188 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979252.1 protein_id gnl|my_center|LOCUS_02630 4190 4924 gene locus_tag LOCUS_02640 gene trpA 4190 4924 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979251.1 protein_id gnl|my_center|LOCUS_02640 4914 5933 gene locus_tag LOCUS_02650 gene trpD 4914 5933 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433682.1 protein_id gnl|my_center|LOCUS_02650 6037 6504 gene locus_tag LOCUS_02660 6037 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6494 7636 gene locus_tag LOCUS_02670 6494 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7617 8177 gene locus_tag LOCUS_02680 7617 8177 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979247.1 protein_id gnl|my_center|LOCUS_02680 8179 8931 gene locus_tag LOCUS_02690 gene trpC 8179 8931 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979246.1 protein_id gnl|my_center|LOCUS_02690 8912 9682 gene locus_tag LOCUS_02700 gene aroF 8912 9682 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867571.1 protein_id gnl|my_center|LOCUS_02700 10416 9799 gene locus_tag LOCUS_02710 10416 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 10551 12236 gene locus_tag LOCUS_02720 gene pyk 10551 12236 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125075.1 protein_id gnl|my_center|LOCUS_02720 12316 13080 gene locus_tag LOCUS_02730 12316 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13077 13817 gene locus_tag LOCUS_02740 13077 13817 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_02740 13867 14235 gene locus_tag LOCUS_02750 13867 14235 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_02750 14240 14665 gene locus_tag LOCUS_02760 14240 14665 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_02760 14658 15062 gene locus_tag LOCUS_02770 14658 15062 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_02770 15068 15286 gene locus_tag LOCUS_02780 15068 15286 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_02780 15301 15375 gene locus_tag LOCUS_t00060 15301 15375 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15700 16176 gene locus_tag LOCUS_02790 15700 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 16192 16689 gene locus_tag LOCUS_02800 16192 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 16928 16734 gene locus_tag LOCUS_02810 16928 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 17239 16985 gene locus_tag LOCUS_02820 17239 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17442 18173 gene locus_tag LOCUS_02830 17442 18173 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_02830 18352 19044 gene locus_tag LOCUS_02840 18352 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 19598 19170 gene locus_tag LOCUS_02850 19598 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02850 20168 19683 gene locus_tag LOCUS_02860 20168 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02860 20386 21285 gene locus_tag LOCUS_02870 20386 21285 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980694.1 protein_id gnl|my_center|LOCUS_02870 21260 21565 gene locus_tag LOCUS_02880 21260 21565 CDS product TA0938 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980695.1 protein_id gnl|my_center|LOCUS_02880 22210 21593 gene locus_tag LOCUS_02890 22210 21593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 22887 22276 gene locus_tag LOCUS_02900 22887 22276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 23663 22884 gene locus_tag LOCUS_02910 23663 22884 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979688.1 protein_id gnl|my_center|LOCUS_02910 24893 23730 gene locus_tag LOCUS_02920 24893 23730 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_02920 25103 25453 gene locus_tag LOCUS_02930 25103 25453 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_02930 25794 25943 gene locus_tag LOCUS_02940 25794 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 26130 26258 gene locus_tag LOCUS_02950 26130 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 >Feature sequence008 <1 792 gene locus_tag LOCUS_02960 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973845.1:ABC transporter permease 793 2334 gene locus_tag LOCUS_02970 793 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2336 3787 gene locus_tag LOCUS_02980 2336 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3846 4745 gene locus_tag LOCUS_02990 3846 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6750 4780 gene locus_tag LOCUS_03000 6750 4780 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979927.1 protein_id gnl|my_center|LOCUS_03000 8093 6801 gene locus_tag LOCUS_03010 gene arsB 8093 6801 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455949.1 protein_id gnl|my_center|LOCUS_03010 8484 8086 gene locus_tag LOCUS_03020 8484 8086 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249794.1 protein_id gnl|my_center|LOCUS_03020 8818 8474 gene locus_tag LOCUS_03030 8818 8474 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_03030 9120 9037 gene locus_tag LOCUS_t00070 9120 9037 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9237 9689 gene locus_tag LOCUS_03040 9237 9689 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_03040 10170 11534 gene locus_tag LOCUS_03050 gene aspA 10170 11534 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_03050 12192 11584 gene locus_tag LOCUS_03060 12192 11584 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919791.1 protein_id gnl|my_center|LOCUS_03060 12322 13455 gene locus_tag LOCUS_03070 12322 13455 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869194.1 protein_id gnl|my_center|LOCUS_03070 13535 14752 gene locus_tag LOCUS_03080 13535 14752 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496643.1 protein_id gnl|my_center|LOCUS_03080 15743 14742 gene locus_tag LOCUS_03090 gene dph2 15743 14742 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_03090 17018 15768 gene locus_tag LOCUS_03100 gene hutI 17018 15768 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_03100 17725 17024 gene locus_tag LOCUS_03110 17725 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 18578 17718 gene locus_tag LOCUS_03120 18578 17718 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879952.1 protein_id gnl|my_center|LOCUS_03120 19356 18583 gene locus_tag LOCUS_03130 19356 18583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_03130 20070 19486 gene locus_tag LOCUS_03140 gene coaC 20070 19486 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 protein_id gnl|my_center|LOCUS_03140 20426 20950 gene locus_tag LOCUS_03150 20426 20950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 20965 21804 gene locus_tag LOCUS_03160 20965 21804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980531.1 protein_id gnl|my_center|LOCUS_03160 21794 22543 gene locus_tag LOCUS_03170 21794 22543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651061.1 protein_id gnl|my_center|LOCUS_03170 22655 25042 gene locus_tag LOCUS_03180 22655 25042 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_03180 25674 25039 gene locus_tag LOCUS_03190 gene ppaX 25674 25039 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_03190 26251 25724 gene locus_tag LOCUS_03200 26251 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence009 222 797 gene locus_tag LOCUS_03210 222 797 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_03210 1181 810 gene locus_tag LOCUS_03220 1181 810 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223515.1 protein_id gnl|my_center|LOCUS_03220 2074 1226 gene locus_tag LOCUS_03230 2074 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2173 2943 gene locus_tag LOCUS_03240 2173 2943 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_03240 4455 3253 gene locus_tag LOCUS_03250 4455 3253 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873437.1 protein_id gnl|my_center|LOCUS_03250 4713 5714 gene locus_tag LOCUS_03260 4713 5714 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_03260 5800 7032 gene locus_tag LOCUS_03270 5800 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8117 7029 gene locus_tag LOCUS_03280 8117 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8870 8193 gene locus_tag LOCUS_03290 8870 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8954 10741 gene locus_tag LOCUS_03300 8954 10741 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146849.1 protein_id gnl|my_center|LOCUS_03300 11719 10787 gene locus_tag LOCUS_03310 11719 10787 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762509.1 protein_id gnl|my_center|LOCUS_03310 11845 12282 gene locus_tag LOCUS_03320 11845 12282 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868810.1 protein_id gnl|my_center|LOCUS_03320 12394 13566 gene locus_tag LOCUS_03330 12394 13566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025067.1 protein_id gnl|my_center|LOCUS_03330 13629 14258 gene locus_tag LOCUS_03340 gene paiB 13629 14258 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_03340 15139 14495 gene locus_tag LOCUS_03350 15139 14495 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147211.1 protein_id gnl|my_center|LOCUS_03350 15426 16700 gene locus_tag LOCUS_03360 gene tuf 15426 16700 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_03360 16711 17025 gene locus_tag LOCUS_03370 gene rpsJ 16711 17025 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201890.1 protein_id gnl|my_center|LOCUS_03370 17054 19255 gene locus_tag LOCUS_03380 17054 19255 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_03380 19392 20315 gene locus_tag LOCUS_03390 19392 20315 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846928.1 protein_id gnl|my_center|LOCUS_03390 20761 20312 gene locus_tag LOCUS_03400 20761 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 21231 20758 gene locus_tag LOCUS_03410 21231 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 22387 21242 gene locus_tag LOCUS_03420 22387 21242 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence010 <1 559 gene locus_tag LOCUS_03430 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064652.1:serine hydroxymethyltransferase 634 1257 gene locus_tag LOCUS_03440 gene pdxT 634 1257 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081494.1 protein_id gnl|my_center|LOCUS_03440 1254 2303 gene locus_tag LOCUS_03450 gene gcvT 1254 2303 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_03450 2499 2332 gene locus_tag LOCUS_03460 2499 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 2750 5101 gene locus_tag LOCUS_03470 2750 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5101 5412 gene locus_tag LOCUS_03480 5101 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5470 5955 gene locus_tag LOCUS_03490 5470 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 6661 5972 gene locus_tag LOCUS_03500 6661 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 6958 7986 gene locus_tag LOCUS_03510 6958 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 8018 8103 gene locus_tag LOCUS_t00080 8018 8103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8655 8509 gene locus_tag LOCUS_03520 8655 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8779 11166 gene locus_tag LOCUS_03530 8779 11166 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_03530 11253 11813 gene locus_tag LOCUS_03540 11253 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 11910 12476 gene locus_tag LOCUS_03550 11910 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 12673 13485 gene locus_tag LOCUS_03560 12673 13485 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140791.1 protein_id gnl|my_center|LOCUS_03560 13486 14385 gene locus_tag LOCUS_03570 13486 14385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14386 15417 gene locus_tag LOCUS_03580 14386 15417 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584104.1 protein_id gnl|my_center|LOCUS_03580 15480 16361 gene locus_tag LOCUS_03590 15480 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 17027 16356 gene locus_tag LOCUS_03600 17027 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 17282 17076 gene locus_tag LOCUS_03610 17282 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 17413 18555 gene locus_tag LOCUS_03620 17413 18555 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846664.1 protein_id gnl|my_center|LOCUS_03620 19386 18583 gene locus_tag LOCUS_03630 gene dapB 19386 18583 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_03630 <21282 19576 gene locus_tag LOCUS_03640 <21282 19576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978720.1:acetate--CoA ligase >Feature sequence011 <1 789 gene locus_tag LOCUS_03650 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181584.1:DMT family transporter 946 2139 gene locus_tag LOCUS_03660 946 2139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799743.1 protein_id gnl|my_center|LOCUS_03660 2196 2549 gene locus_tag LOCUS_03670 2196 2549 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115283.1 protein_id gnl|my_center|LOCUS_03670 4449 2578 gene locus_tag LOCUS_03680 4449 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 6233 4464 gene locus_tag LOCUS_03690 6233 4464 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_03690 6671 6246 gene locus_tag LOCUS_03700 6671 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 7125 8153 gene locus_tag LOCUS_03710 7125 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8547 8113 gene locus_tag LOCUS_03720 8547 8113 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980194.1 protein_id gnl|my_center|LOCUS_03720 8623 9900 gene locus_tag LOCUS_03730 gene hisS 8623 9900 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_03730 10343 9909 gene locus_tag LOCUS_03740 10343 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 10517 10750 gene locus_tag LOCUS_03750 10517 10750 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_03750 10756 11085 gene locus_tag LOCUS_03760 10756 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11090 12019 gene locus_tag LOCUS_03770 gene guaA 11090 12019 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_03770 12201 12800 gene locus_tag LOCUS_03780 gene rpsB 12201 12800 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_03780 13732 12797 gene locus_tag LOCUS_03790 gene endA 13732 12797 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029509.1 protein_id gnl|my_center|LOCUS_03790 14228 13719 gene locus_tag LOCUS_03800 14228 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14471 15667 gene locus_tag LOCUS_03810 14471 15667 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_03810 15654 16601 gene locus_tag LOCUS_03820 15654 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 16648 16944 gene locus_tag LOCUS_03830 16648 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 17232 16948 gene locus_tag LOCUS_03840 17232 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 17397 17951 gene locus_tag LOCUS_03850 17397 17951 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_03850 19124 17943 gene locus_tag LOCUS_03860 gene truD 19124 17943 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 protein_id gnl|my_center|LOCUS_03860 <20083 19131 gene locus_tag LOCUS_03870 <20083 19131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763062.1:cyclic dehypoxanthinyl futalosine synthase >Feature sequence012 711 583 gene locus_tag LOCUS_03880 711 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2638 1670 gene locus_tag LOCUS_03890 2638 1670 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023043.1 protein_id gnl|my_center|LOCUS_03890 3373 2699 gene locus_tag LOCUS_03900 3373 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3363 3554 gene locus_tag LOCUS_03910 3363 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3748 4308 gene locus_tag LOCUS_03920 3748 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4289 4843 gene locus_tag LOCUS_03930 4289 4843 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_03930 4837 5196 gene locus_tag LOCUS_03940 gene pth2 4837 5196 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_03940 5717 5193 gene locus_tag LOCUS_03950 5717 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6873 5719 gene locus_tag LOCUS_03960 6873 5719 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_03960 7117 7542 gene locus_tag LOCUS_03970 7117 7542 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761799.1 protein_id gnl|my_center|LOCUS_03970 9003 7549 gene locus_tag LOCUS_03980 9003 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10442 9030 gene locus_tag LOCUS_03990 10442 9030 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_03990 10501 11832 gene locus_tag LOCUS_04000 gene glnA 10501 11832 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_04000 12001 12453 gene locus_tag LOCUS_04010 12001 12453 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_04010 12466 12807 gene locus_tag LOCUS_04020 12466 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 12975 13244 gene locus_tag LOCUS_04030 12975 13244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 13245 13898 gene locus_tag LOCUS_04040 13245 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14406 13903 gene locus_tag LOCUS_04050 gene pyrE 14406 13903 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_04050 15247 14483 gene locus_tag LOCUS_04060 15247 14483 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582793.1 protein_id gnl|my_center|LOCUS_04060 15517 16560 gene locus_tag LOCUS_04070 gene ftsZ 15517 16560 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_04070 16617 17243 gene locus_tag LOCUS_04080 gene pyrF 16617 17243 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868434.1 protein_id gnl|my_center|LOCUS_04080 17406 18293 gene locus_tag LOCUS_04090 17406 18293 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_04090 19378 18290 gene locus_tag LOCUS_04100 19378 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence013 92 958 gene locus_tag LOCUS_04110 92 958 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_04110 948 1904 gene locus_tag LOCUS_04120 948 1904 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_04120 1888 2559 gene locus_tag LOCUS_04130 gene fsa 1888 2559 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_04130 2674 3549 gene locus_tag LOCUS_04140 2674 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4561 3614 gene locus_tag LOCUS_04150 4561 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4610 5944 gene locus_tag LOCUS_04160 4610 5944 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_04160 5941 6444 gene locus_tag LOCUS_04170 5941 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 7403 6447 gene locus_tag LOCUS_04180 7403 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 7589 8188 gene locus_tag LOCUS_04190 7589 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8190 8696 gene locus_tag LOCUS_04200 8190 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 8711 10000 gene locus_tag LOCUS_04210 gene asnS 8711 10000 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_04210 10001 10987 gene locus_tag LOCUS_04220 gene hemE 10001 10987 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545646.1 protein_id gnl|my_center|LOCUS_04220 10984 11865 gene locus_tag LOCUS_04230 gene hemH 10984 11865 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 protein_id gnl|my_center|LOCUS_04230 11858 12769 gene locus_tag LOCUS_04240 11858 12769 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_04240 14081 12759 gene locus_tag LOCUS_04250 gene purD 14081 12759 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249159.1 protein_id gnl|my_center|LOCUS_04250 14574 14074 gene locus_tag LOCUS_04260 14574 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 14684 16078 gene locus_tag LOCUS_04270 14684 16078 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244111.1 protein_id gnl|my_center|LOCUS_04270 16886 16059 gene locus_tag LOCUS_04280 gene rnz 16886 16059 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_04280 17225 17800 gene locus_tag LOCUS_04290 17225 17800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence014 1868 315 gene locus_tag LOCUS_04300 1868 315 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979745.1 protein_id gnl|my_center|LOCUS_04300 3836 1869 gene locus_tag LOCUS_04310 3836 1869 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979746.1 protein_id gnl|my_center|LOCUS_04310 5069 3954 gene locus_tag LOCUS_04320 5069 3954 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846353.1 protein_id gnl|my_center|LOCUS_04320 5940 5062 gene locus_tag LOCUS_04330 gene thrB 5940 5062 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_04330 6432 6046 gene locus_tag LOCUS_04340 6432 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6551 6624 gene locus_tag LOCUS_t00090 6551 6624 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6736 7221 gene locus_tag LOCUS_04350 6736 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8050 7211 gene locus_tag LOCUS_04360 8050 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8248 8997 gene locus_tag LOCUS_04370 8248 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9045 9827 gene locus_tag LOCUS_04380 9045 9827 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868422.1 protein_id gnl|my_center|LOCUS_04380 9901 10479 gene locus_tag LOCUS_04390 9901 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 10637 11722 gene locus_tag LOCUS_04400 10637 11722 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 protein_id gnl|my_center|LOCUS_04400 11738 12601 gene locus_tag LOCUS_04410 gene folD 11738 12601 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04410 12681 13403 gene locus_tag LOCUS_04420 12681 13403 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867289.1 protein_id gnl|my_center|LOCUS_04420 13406 14695 gene locus_tag LOCUS_04430 13406 14695 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868413.1 protein_id gnl|my_center|LOCUS_04430 16275 14686 gene locus_tag LOCUS_04440 16275 14686 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 protein_id gnl|my_center|LOCUS_04440 17130 16276 gene locus_tag LOCUS_04450 17130 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 18098 17127 gene locus_tag LOCUS_04460 18098 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 <19107 18098 gene locus_tag LOCUS_04470 <19107 18098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148183415.1:type II/IV secretion system ATPase subunit >Feature sequence015 <1 526 gene locus_tag LOCUS_04480 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064951.1:NAD-dependent succinate-semialdehyde dehydrogenase 598 2175 gene locus_tag LOCUS_04490 598 2175 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_04490 3201 2368 gene locus_tag LOCUS_04500 3201 2368 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549598.1 protein_id gnl|my_center|LOCUS_04500 3659 4243 gene locus_tag LOCUS_04510 3659 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4240 4800 gene locus_tag LOCUS_04520 4240 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5376 6371 gene locus_tag LOCUS_04530 5376 6371 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980461.1 protein_id gnl|my_center|LOCUS_04530 6343 6756 gene locus_tag LOCUS_04540 6343 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6814 8268 gene locus_tag LOCUS_04550 6814 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8379 8939 gene locus_tag LOCUS_04560 8379 8939 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_04560 10266 8944 gene locus_tag LOCUS_04570 gene serS 10266 8944 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_04570 10648 10361 gene locus_tag LOCUS_04580 10648 10361 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847047.1 protein_id gnl|my_center|LOCUS_04580 11266 10736 gene locus_tag LOCUS_04590 11266 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12009 11335 gene locus_tag LOCUS_04600 12009 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12692 12060 gene locus_tag LOCUS_04610 12692 12060 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_04610 13155 12682 gene locus_tag LOCUS_04620 13155 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14482 13145 gene locus_tag LOCUS_04630 14482 13145 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496722.1 protein_id gnl|my_center|LOCUS_04630 15262 14483 gene locus_tag LOCUS_04640 gene uppS 15262 14483 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_04640 16218 15259 gene locus_tag LOCUS_04650 gene trm5b 16218 15259 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_04650 18247 16202 gene locus_tag LOCUS_04660 18247 16202 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence016 611 1207 gene locus_tag LOCUS_04670 611 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3608 1212 gene locus_tag LOCUS_04680 3608 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5031 3610 gene locus_tag LOCUS_04690 5031 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6704 5034 gene locus_tag LOCUS_04700 6704 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8380 6701 gene locus_tag LOCUS_04710 8380 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10340 8478 gene locus_tag LOCUS_04720 10340 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 10442 11290 gene locus_tag LOCUS_04730 10442 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 11305 12402 gene locus_tag LOCUS_04740 11305 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 12448 13065 gene locus_tag LOCUS_04750 12448 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 13491 13069 gene locus_tag LOCUS_04760 13491 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 14341 13484 gene locus_tag LOCUS_04770 14341 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 14554 15090 gene locus_tag LOCUS_04780 gene grpE 14554 15090 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288306.1 protein_id gnl|my_center|LOCUS_04780 15083 16921 gene locus_tag LOCUS_04790 gene dnaK 15083 16921 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357980.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence017 2029 200 gene locus_tag LOCUS_04800 2029 200 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_04800 2449 3048 gene locus_tag LOCUS_04810 2449 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4200 3016 gene locus_tag LOCUS_04820 4200 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4663 4202 gene locus_tag LOCUS_04830 4663 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5483 4758 gene locus_tag LOCUS_04840 5483 4758 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_04840 8137 5516 gene locus_tag LOCUS_04850 8137 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8292 9068 gene locus_tag LOCUS_04860 8292 9068 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979642.1 protein_id gnl|my_center|LOCUS_04860 9169 10341 gene locus_tag LOCUS_04870 9169 10341 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_04870 10342 11325 gene locus_tag LOCUS_04880 10342 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 11331 11846 gene locus_tag LOCUS_04890 11331 11846 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_04890 13063 11861 gene locus_tag LOCUS_04900 13063 11861 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082184.1 protein_id gnl|my_center|LOCUS_04900 13308 14693 gene locus_tag LOCUS_04910 gene proS 13308 14693 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_04910 14623 15351 gene locus_tag LOCUS_04920 14623 15351 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147184.1 protein_id gnl|my_center|LOCUS_04920 15338 16030 gene locus_tag LOCUS_04930 gene radB 15338 16030 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903214.1 protein_id gnl|my_center|LOCUS_04930 16086 17105 gene locus_tag LOCUS_04940 gene fen 16086 17105 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_04940 <17622 17094 gene locus_tag LOCUS_04950 <17622 17094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846716.1:tyrosine--tRNA ligase >Feature sequence018 1646 1038 gene locus_tag LOCUS_04960 1646 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2250 1648 gene locus_tag LOCUS_04970 2250 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2475 3317 gene locus_tag LOCUS_04980 2475 3317 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_04980 4809 4090 gene locus_tag LOCUS_04990 gene rsmA 4809 4090 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249850.1 protein_id gnl|my_center|LOCUS_04990 5354 4806 gene locus_tag LOCUS_05000 5354 4806 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_05000 5667 5359 gene locus_tag LOCUS_05010 5667 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 5966 5670 gene locus_tag LOCUS_05020 5966 5670 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_05020 7128 5971 gene locus_tag LOCUS_05030 7128 5971 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867968.1 protein_id gnl|my_center|LOCUS_05030 7522 7262 gene locus_tag LOCUS_05040 gene rpl37A 7522 7262 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877571.1 protein_id gnl|my_center|LOCUS_05040 8309 7524 gene locus_tag LOCUS_05050 gene rrp42 8309 7524 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_05050 9062 8310 gene locus_tag LOCUS_05060 gene rrp41 9062 8310 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_05060 9720 9046 gene locus_tag LOCUS_05070 gene rrp4 9720 9046 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_05070 10574 9885 gene locus_tag LOCUS_05080 10574 9885 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_05080 10692 10997 gene locus_tag LOCUS_05090 10692 10997 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_05090 11010 12371 gene locus_tag LOCUS_05100 11010 12371 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_05100 13303 12368 gene locus_tag LOCUS_05110 13303 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13351 14037 gene locus_tag LOCUS_05120 gene nth 13351 14037 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083173.1 protein_id gnl|my_center|LOCUS_05120 14806 14039 gene locus_tag LOCUS_05130 14806 14039 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651002.1 protein_id gnl|my_center|LOCUS_05130 15271 14915 gene locus_tag LOCUS_05140 15271 14915 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_05140 15993 15382 gene locus_tag LOCUS_05150 15993 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 16784 16443 gene locus_tag LOCUS_05160 16784 16443 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_05160 17054 16794 gene locus_tag LOCUS_05170 17054 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 17544 17131 gene locus_tag LOCUS_05180 17544 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence019 308 811 gene locus_tag LOCUS_05190 308 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1851 862 gene locus_tag LOCUS_05200 1851 862 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979583.1 protein_id gnl|my_center|LOCUS_05200 2096 3454 gene locus_tag LOCUS_05210 2096 3454 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867854.1 protein_id gnl|my_center|LOCUS_05210 3970 3446 gene locus_tag LOCUS_05220 3970 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 4153 6030 gene locus_tag LOCUS_05230 4153 6030 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_05230 6947 6027 gene locus_tag LOCUS_05240 6947 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7472 7852 gene locus_tag LOCUS_05250 7472 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8271 7903 gene locus_tag LOCUS_05260 8271 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 8435 10048 gene locus_tag LOCUS_05270 gene pyrG 8435 10048 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_05270 10055 13321 gene locus_tag LOCUS_05280 10055 13321 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_05280 13318 14097 gene locus_tag LOCUS_05290 13318 14097 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_05290 14239 14577 gene locus_tag LOCUS_05300 14239 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 14612 15274 gene locus_tag LOCUS_05310 14612 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15267 16478 gene locus_tag LOCUS_05320 15267 16478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429682.1 protein_id gnl|my_center|LOCUS_05320 16595 17212 gene locus_tag LOCUS_05330 16595 17212 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence020 490 1632 gene locus_tag LOCUS_05340 490 1632 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_05340 2754 1960 gene locus_tag LOCUS_05350 2754 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3701 2916 gene locus_tag LOCUS_05360 3701 2916 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_05360 3897 4163 gene locus_tag LOCUS_05370 3897 4163 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763131.1 protein_id gnl|my_center|LOCUS_05370 4728 4222 gene locus_tag LOCUS_05380 4728 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4969 6591 gene locus_tag LOCUS_05390 4969 6591 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957568.1 protein_id gnl|my_center|LOCUS_05390 7885 6746 gene locus_tag LOCUS_05400 7885 6746 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_05400 8155 8808 gene locus_tag LOCUS_05410 8155 8808 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_05410 8967 10166 gene locus_tag LOCUS_05420 gene thrC 8967 10166 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_05420 11195 10263 gene locus_tag LOCUS_05430 11195 10263 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_05430 11301 12683 gene locus_tag LOCUS_05440 11301 12683 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_05440 13652 12693 gene locus_tag LOCUS_05450 13652 12693 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846974.1 protein_id gnl|my_center|LOCUS_05450 15309 13996 gene locus_tag LOCUS_05460 15309 13996 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979127.1 protein_id gnl|my_center|LOCUS_05460 16514 15315 gene locus_tag LOCUS_05470 16514 15315 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_05470 17213 16596 gene locus_tag LOCUS_05480 17213 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05480 >Feature sequence021 478 1905 gene locus_tag LOCUS_05490 gene cobQ 478 1905 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496916.1 protein_id gnl|my_center|LOCUS_05490 1895 2884 gene locus_tag LOCUS_05500 gene cbiB 1895 2884 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_05500 2889 3866 gene locus_tag LOCUS_05510 2889 3866 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387325.1 protein_id gnl|my_center|LOCUS_05510 3960 4139 gene locus_tag LOCUS_05520 3960 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4359 5492 gene locus_tag LOCUS_05530 4359 5492 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867468.1 protein_id gnl|my_center|LOCUS_05530 5936 5481 gene locus_tag LOCUS_05540 gene rimI 5936 5481 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240337.1 protein_id gnl|my_center|LOCUS_05540 5998 6693 gene locus_tag LOCUS_05550 gene ribB 5998 6693 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_05550 6686 7117 gene locus_tag LOCUS_05560 6686 7117 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868432.1 protein_id gnl|my_center|LOCUS_05560 7114 7608 gene locus_tag LOCUS_05570 gene ribC 7114 7608 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_05570 7620 8024 gene locus_tag LOCUS_05580 gene ribH 7620 8024 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_05580 8914 8021 gene locus_tag LOCUS_05590 gene mptA 8914 8021 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_05590 9283 8924 gene locus_tag LOCUS_05600 9283 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9583 9658 gene locus_tag LOCUS_t00100 9583 9658 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9840 10871 gene locus_tag LOCUS_05610 9840 10871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846815.1 protein_id gnl|my_center|LOCUS_05610 10868 11821 gene locus_tag LOCUS_05620 10868 11821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980628.1 protein_id gnl|my_center|LOCUS_05620 11831 12799 gene locus_tag LOCUS_05630 11831 12799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846816.1 protein_id gnl|my_center|LOCUS_05630 12792 13745 gene locus_tag LOCUS_05640 12792 13745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980630.1 protein_id gnl|my_center|LOCUS_05640 13726 14124 gene locus_tag LOCUS_05650 13726 14124 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980631.1 protein_id gnl|my_center|LOCUS_05650 14275 16317 gene locus_tag LOCUS_05660 14275 16317 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980626.1 protein_id gnl|my_center|LOCUS_05660 16965 16468 gene locus_tag LOCUS_05670 16965 16468 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868358.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence022 1930 1232 gene locus_tag LOCUS_05680 1930 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2626 1994 gene locus_tag LOCUS_05690 gene rnhB 2626 1994 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869628.1 protein_id gnl|my_center|LOCUS_05690 2701 3768 gene locus_tag LOCUS_05700 gene idsA 2701 3768 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_05700 3873 4082 gene locus_tag LOCUS_05710 3873 4082 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_05710 5061 4240 gene locus_tag LOCUS_05720 5061 4240 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_05720 8266 5204 gene locus_tag LOCUS_05730 8266 5204 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979182.1 protein_id gnl|my_center|LOCUS_05730 8417 11104 gene locus_tag LOCUS_05740 gene acnA 8417 11104 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_05740 11545 11180 gene locus_tag LOCUS_05750 11545 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978593.1 protein_id gnl|my_center|LOCUS_05750 11757 12941 gene locus_tag LOCUS_05760 11757 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 13968 12952 gene locus_tag LOCUS_05770 gene purM 13968 12952 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_05770 14229 14660 gene locus_tag LOCUS_05780 14229 14660 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979189.1 protein_id gnl|my_center|LOCUS_05780 14686 14761 gene locus_tag LOCUS_t00110 14686 14761 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14771 14965 gene locus_tag LOCUS_05790 14771 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16267 14933 gene locus_tag LOCUS_05800 gene cca 16267 14933 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870623.1 protein_id gnl|my_center|LOCUS_05800 16694 16269 gene locus_tag LOCUS_05810 16694 16269 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_05810 16742 16814 gene locus_tag LOCUS_t00120 16742 16814 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 465 737 gene locus_tag LOCUS_05820 465 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1047 757 gene locus_tag LOCUS_05830 1047 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2081 1044 gene locus_tag LOCUS_05840 2081 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2347 3726 gene locus_tag LOCUS_05850 gene dnaG 2347 3726 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_05850 3730 5208 gene locus_tag LOCUS_05860 3730 5208 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_05860 5306 5710 gene locus_tag LOCUS_05870 5306 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05870 5911 6249 gene locus_tag LOCUS_05880 5911 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6385 7068 gene locus_tag LOCUS_05890 6385 7068 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_05890 7114 7479 gene locus_tag LOCUS_05900 7114 7479 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_05900 7554 7853 gene locus_tag LOCUS_05910 7554 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7853 8689 gene locus_tag LOCUS_05920 7853 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9292 8672 gene locus_tag LOCUS_05930 9292 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9663 9394 gene locus_tag LOCUS_05940 9663 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 10013 9663 gene locus_tag LOCUS_05950 10013 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11452 10013 gene locus_tag LOCUS_05960 gene fpoN 11452 10013 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_05960 12941 11454 gene locus_tag LOCUS_05970 gene fpoM 12941 11454 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_05970 14834 12942 gene locus_tag LOCUS_05980 gene fpoL 14834 12942 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_05980 15135 14836 gene locus_tag LOCUS_05990 gene fpoK 15135 14836 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_05990 15354 15136 gene locus_tag LOCUS_06000 15354 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 15595 15347 gene locus_tag LOCUS_06010 15595 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 16032 15592 gene locus_tag LOCUS_06020 16032 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 <16641 16029 gene locus_tag LOCUS_06030 <16641 16029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813219.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence024 853 1275 gene locus_tag LOCUS_06040 853 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1985 1362 gene locus_tag LOCUS_06050 1985 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2036 2428 gene locus_tag LOCUS_06060 2036 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3350 2460 gene locus_tag LOCUS_06070 gene purC 3350 2460 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878767.1 protein_id gnl|my_center|LOCUS_06070 3683 3384 gene locus_tag LOCUS_06080 3683 3384 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229084.1 protein_id gnl|my_center|LOCUS_06080 3809 4264 gene locus_tag LOCUS_06090 3809 4264 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_06090 5429 4254 gene locus_tag LOCUS_06100 5429 4254 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_06100 5988 5422 gene locus_tag LOCUS_06110 5988 5422 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_06110 7318 5948 gene locus_tag LOCUS_06120 gene cysS 7318 5948 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_06120 7438 7983 gene locus_tag LOCUS_06130 7438 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979834.1 protein_id gnl|my_center|LOCUS_06130 7989 9110 gene locus_tag LOCUS_06140 7989 9110 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_06140 9115 10146 gene locus_tag LOCUS_06150 9115 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 10756 10148 gene locus_tag LOCUS_06160 10756 10148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980178.1 protein_id gnl|my_center|LOCUS_06160 10923 12230 gene locus_tag LOCUS_06170 10923 12230 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877902.1 protein_id gnl|my_center|LOCUS_06170 12855 12199 gene locus_tag LOCUS_06180 12855 12199 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583945.1 protein_id gnl|my_center|LOCUS_06180 13769 12909 gene locus_tag LOCUS_06190 13769 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 15518 14097 gene locus_tag LOCUS_06200 15518 14097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence025 211 951 gene locus_tag LOCUS_06210 211 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 941 1672 gene locus_tag LOCUS_06220 941 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1920 2669 gene locus_tag LOCUS_06230 gene speE 1920 2669 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869811.1 protein_id gnl|my_center|LOCUS_06230 3036 2659 gene locus_tag LOCUS_06240 3036 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3620 3069 gene locus_tag LOCUS_06250 3620 3069 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_06250 5197 3617 gene locus_tag LOCUS_06260 5197 3617 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_06260 6450 5233 gene locus_tag LOCUS_06270 6450 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 7447 6542 gene locus_tag LOCUS_06280 7447 6542 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980488.1 protein_id gnl|my_center|LOCUS_06280 8195 7524 gene locus_tag LOCUS_06290 8195 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8250 9488 gene locus_tag LOCUS_06300 gene leuC 8250 9488 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081330.1 protein_id gnl|my_center|LOCUS_06300 9490 9960 gene locus_tag LOCUS_06310 gene hacB 9490 9960 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870784.1 protein_id gnl|my_center|LOCUS_06310 11153 10035 gene locus_tag LOCUS_06320 11153 10035 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_06320 12154 11141 gene locus_tag LOCUS_06330 12154 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 13643 12276 gene locus_tag LOCUS_06340 13643 12276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979184.1 protein_id gnl|my_center|LOCUS_06340 13948 14337 gene locus_tag LOCUS_06350 13948 14337 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_06350 14334 15560 gene locus_tag LOCUS_06360 14334 15560 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence026 53 1774 gene locus_tag LOCUS_06370 gene ctaD 53 1774 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815474.1 protein_id gnl|my_center|LOCUS_06370 1776 2441 gene locus_tag LOCUS_06380 1776 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2442 3323 gene locus_tag LOCUS_06390 gene cyoE 2442 3323 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168719.1 protein_id gnl|my_center|LOCUS_06390 3330 3965 gene locus_tag LOCUS_06400 3330 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5812 3992 gene locus_tag LOCUS_06410 5812 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6290 5820 gene locus_tag LOCUS_06420 6290 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6465 7586 gene locus_tag LOCUS_06430 6465 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7778 7587 gene locus_tag LOCUS_06440 7778 7587 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877990.1 protein_id gnl|my_center|LOCUS_06440 7928 9394 gene locus_tag LOCUS_06450 gene aldA 7928 9394 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588856.1 protein_id gnl|my_center|LOCUS_06450 10386 9400 gene locus_tag LOCUS_06460 10386 9400 CDS product encapsulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978997.1 protein_id gnl|my_center|LOCUS_06460 10486 12402 gene locus_tag LOCUS_06470 gene malA 10486 12402 CDS product alpha-glucosidase MalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980614.1 protein_id gnl|my_center|LOCUS_06470 12590 12399 gene locus_tag LOCUS_06480 12590 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 12741 13235 gene locus_tag LOCUS_06490 12741 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 14064 13243 gene locus_tag LOCUS_06500 14064 13243 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846458.1 protein_id gnl|my_center|LOCUS_06500 14254 14045 gene locus_tag LOCUS_06510 14254 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 14558 14244 gene locus_tag LOCUS_06520 14558 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 14900 14610 gene locus_tag LOCUS_06530 14900 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 15421 14990 gene locus_tag LOCUS_06540 15421 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence027 2162 1245 gene locus_tag LOCUS_06550 2162 1245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979801.1 protein_id gnl|my_center|LOCUS_06550 2329 2159 gene locus_tag LOCUS_06560 2329 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2741 3616 gene locus_tag LOCUS_06570 2741 3616 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763057.1 protein_id gnl|my_center|LOCUS_06570 3738 5210 gene locus_tag LOCUS_06580 3738 5210 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978087.1 protein_id gnl|my_center|LOCUS_06580 5479 7881 gene locus_tag LOCUS_06590 5479 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7878 10067 gene locus_tag LOCUS_06600 7878 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 10064 11104 gene locus_tag LOCUS_06610 10064 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 11120 12574 gene locus_tag LOCUS_06620 11120 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12571 14262 gene locus_tag LOCUS_06630 gene cas1 12571 14262 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_06630 14268 14558 gene locus_tag LOCUS_06640 gene cas2 14268 14558 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_06640 14919 15175 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatttccatgaatgaaaattcatggctccattgaagc >Feature sequence028 775 362 gene locus_tag LOCUS_06650 775 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1390 779 gene locus_tag LOCUS_06660 1390 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1674 1393 gene locus_tag LOCUS_06670 1674 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2578 2766 gene locus_tag LOCUS_06680 2578 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2855 3034 gene locus_tag LOCUS_06690 gene lysW 2855 3034 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101022.1 protein_id gnl|my_center|LOCUS_06690 3117 4169 gene locus_tag LOCUS_06700 gene argC 3117 4169 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_06700 4173 4976 gene locus_tag LOCUS_06710 4173 4976 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_06710 4973 6187 gene locus_tag LOCUS_06720 4973 6187 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_06720 6184 7032 gene locus_tag LOCUS_06730 gene lysX 6184 7032 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 protein_id gnl|my_center|LOCUS_06730 7029 8111 gene locus_tag LOCUS_06740 7029 8111 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_06740 9185 8589 gene locus_tag LOCUS_06750 9185 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9301 10518 gene locus_tag LOCUS_06760 9301 10518 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_06760 10523 11866 gene locus_tag LOCUS_06770 gene argH 10523 11866 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101154.1 protein_id gnl|my_center|LOCUS_06770 12111 13361 gene locus_tag LOCUS_06780 gene egtB 12111 13361 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_06780 13358 14311 gene locus_tag LOCUS_06790 gene egtD 13358 14311 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence029 1176 2375 gene locus_tag LOCUS_06800 1176 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2583 2927 gene locus_tag LOCUS_06810 2583 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3134 3063 gene locus_tag LOCUS_t00130 3134 3063 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4258 3212 gene locus_tag LOCUS_06820 4258 3212 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946349.1 protein_id gnl|my_center|LOCUS_06820 5426 4380 gene locus_tag LOCUS_06830 5426 4380 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_06830 5560 6216 gene locus_tag LOCUS_06840 5560 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6265 6750 gene locus_tag LOCUS_06850 6265 6750 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 protein_id gnl|my_center|LOCUS_06850 6749 6821 gene locus_tag LOCUS_t00140 6749 6821 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7728 6829 gene locus_tag LOCUS_06860 7728 6829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846625.1 protein_id gnl|my_center|LOCUS_06860 8397 7831 gene locus_tag LOCUS_06870 8397 7831 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_06870 8828 8403 gene locus_tag LOCUS_06880 8828 8403 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_06880 10008 8896 gene locus_tag LOCUS_06890 gene priS 10008 8896 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_06890 10077 13241 gene locus_tag LOCUS_06900 10077 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13388 13301 gene locus_tag LOCUS_t00150 13388 13301 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 1548 3380 gene locus_tag LOCUS_06910 1548 3380 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383105.1 protein_id gnl|my_center|LOCUS_06910 3396 4415 gene locus_tag LOCUS_06920 3396 4415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_06920 4408 5370 gene locus_tag LOCUS_06930 4408 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5367 6164 gene locus_tag LOCUS_06940 5367 6164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762316.1 protein_id gnl|my_center|LOCUS_06940 6165 7142 gene locus_tag LOCUS_06950 6165 7142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978692.1 protein_id gnl|my_center|LOCUS_06950 7214 8230 gene locus_tag LOCUS_06960 7214 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8285 9739 gene locus_tag LOCUS_06970 gene bgaS 8285 9739 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_06970 10036 9743 gene locus_tag LOCUS_06980 10036 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 10651 10121 gene locus_tag LOCUS_06990 10651 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11038 10718 gene locus_tag LOCUS_07000 11038 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11595 11068 gene locus_tag LOCUS_07010 11595 11068 CDS product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877981.1 protein_id gnl|my_center|LOCUS_07010 11821 13890 gene locus_tag LOCUS_07020 11821 13890 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence031 63 134 gene locus_tag LOCUS_t00160 63 134 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 184 1479 gene locus_tag LOCUS_07030 184 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1517 2158 gene locus_tag LOCUS_07040 1517 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3627 2695 gene locus_tag LOCUS_07050 3627 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3781 3951 gene locus_tag LOCUS_07060 3781 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3948 4124 gene locus_tag LOCUS_07070 3948 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4126 5088 gene locus_tag LOCUS_07080 4126 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 5075 6919 gene locus_tag LOCUS_07090 5075 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6916 7095 gene locus_tag LOCUS_07100 6916 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 7178 7408 gene locus_tag LOCUS_07110 7178 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7413 7808 gene locus_tag LOCUS_07120 7413 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 7979 8293 gene locus_tag LOCUS_07130 7979 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8421 8669 gene locus_tag LOCUS_07140 8421 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 8666 9115 gene locus_tag LOCUS_07150 8666 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9102 9326 gene locus_tag LOCUS_07160 9102 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 9307 9549 gene locus_tag LOCUS_07170 9307 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 10151 10417 gene locus_tag LOCUS_07180 10151 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 10418 10681 gene locus_tag LOCUS_07190 10418 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10689 11333 gene locus_tag LOCUS_07200 10689 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 12061 11660 gene locus_tag LOCUS_07210 12061 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 12187 12498 gene locus_tag LOCUS_07220 12187 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 12722 13129 gene locus_tag LOCUS_07230 12722 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13813 14031 gene locus_tag LOCUS_07240 13813 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence032 <1 666 gene locus_tag LOCUS_07250 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064935.1:translation initiation factor IF-2 subunit alpha 663 836 gene locus_tag LOCUS_07260 663 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 823 1581 gene locus_tag LOCUS_07270 823 1581 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_07270 1710 3554 gene locus_tag LOCUS_07280 1710 3554 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_07280 3541 4623 gene locus_tag LOCUS_07290 3541 4623 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_07290 4676 5503 gene locus_tag LOCUS_07300 4676 5503 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763580.1 protein_id gnl|my_center|LOCUS_07300 6213 5482 gene locus_tag LOCUS_07310 gene otsB 6213 5482 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227964.1 protein_id gnl|my_center|LOCUS_07310 7521 6214 gene locus_tag LOCUS_07320 7521 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 7698 7811 gene locus_tag LOCUS_r00010 7698 7811 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7916 8125 gene locus_tag LOCUS_07330 7916 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8125 9660 gene locus_tag LOCUS_07340 8125 9660 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 protein_id gnl|my_center|LOCUS_07340 10726 9692 gene locus_tag LOCUS_07350 gene mtnA 10726 9692 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_07350 12800 10791 gene locus_tag LOCUS_07360 12800 10791 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_07360 13126 13199 gene locus_tag LOCUS_t00170 13126 13199 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13215 13478 gene locus_tag LOCUS_07370 13215 13478 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867737.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence033 408 1466 gene locus_tag LOCUS_07380 gene fni 408 1466 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_07380 1450 1998 gene locus_tag LOCUS_07390 1450 1998 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870034.1 protein_id gnl|my_center|LOCUS_07390 2058 3011 gene locus_tag LOCUS_07400 2058 3011 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868717.1 protein_id gnl|my_center|LOCUS_07400 3176 3805 gene locus_tag LOCUS_07410 3176 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4075 5106 gene locus_tag LOCUS_07420 4075 5106 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285864.1 protein_id gnl|my_center|LOCUS_07420 5084 5722 gene locus_tag LOCUS_07430 5084 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7654 5726 gene locus_tag LOCUS_07440 7654 5726 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_07440 7983 7657 gene locus_tag LOCUS_07450 7983 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 8757 8092 gene locus_tag LOCUS_07460 8757 8092 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 protein_id gnl|my_center|LOCUS_07460 10138 8762 gene locus_tag LOCUS_07470 10138 8762 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_07470 11892 10138 gene locus_tag LOCUS_07480 11892 10138 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_07480 12226 11897 gene locus_tag LOCUS_07490 12226 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 13281 12223 gene locus_tag LOCUS_07500 13281 12223 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_07500 13850 13281 gene locus_tag LOCUS_07510 13850 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 14157 13858 gene locus_tag LOCUS_07520 14157 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence034 32 559 gene locus_tag LOCUS_07530 32 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 704 2386 gene locus_tag LOCUS_07540 704 2386 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_07540 2387 3487 gene locus_tag LOCUS_07550 2387 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5492 3492 gene locus_tag LOCUS_07560 5492 3492 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_07560 5709 5482 gene locus_tag LOCUS_07570 5709 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6143 5652 gene locus_tag LOCUS_07580 6143 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6244 7299 gene locus_tag LOCUS_07590 gene aroB 6244 7299 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980356.1 protein_id gnl|my_center|LOCUS_07590 7301 8128 gene locus_tag LOCUS_07600 7301 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8104 8943 gene locus_tag LOCUS_07610 8104 8943 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867575.1 protein_id gnl|my_center|LOCUS_07610 8936 10192 gene locus_tag LOCUS_07620 gene aroA 8936 10192 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496517.1 protein_id gnl|my_center|LOCUS_07620 10223 11875 gene locus_tag LOCUS_07630 gene argS 10223 11875 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878394.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence035 <1 1845 gene locus_tag LOCUS_07640 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879380.1:DNA-directed RNA polymerase subunit B 1842 4544 gene locus_tag LOCUS_07650 1842 4544 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_07650 4544 6130 gene locus_tag LOCUS_07660 4544 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6133 6576 gene locus_tag LOCUS_07670 6133 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6674 7003 gene locus_tag LOCUS_07680 gene eif1A 6674 7003 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_07680 7012 7770 gene locus_tag LOCUS_07690 7012 7770 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_07690 7763 8341 gene locus_tag LOCUS_07700 7763 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 8455 8529 gene locus_tag LOCUS_t00180 8455 8529 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9201 8527 gene locus_tag LOCUS_07710 9201 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10033 9188 gene locus_tag LOCUS_07720 gene hemC 10033 9188 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_07720 11288 9987 gene locus_tag LOCUS_07730 gene hemL 11288 9987 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_07730 11370 12353 gene locus_tag LOCUS_07740 11370 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 12481 12822 gene locus_tag LOCUS_07750 12481 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12800 13117 gene locus_tag LOCUS_07760 12800 13117 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496905.1 protein_id gnl|my_center|LOCUS_07760 13208 13510 gene locus_tag LOCUS_07770 13208 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence036 1863 265 gene locus_tag LOCUS_07780 1863 265 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_07780 3171 1951 gene locus_tag LOCUS_07790 3171 1951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_07790 4712 3264 gene locus_tag LOCUS_07800 4712 3264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_07800 6013 5798 gene locus_tag LOCUS_07810 6013 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 7269 6787 gene locus_tag LOCUS_07820 7269 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 8276 8202 gene locus_tag LOCUS_t00190 8276 8202 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8433 9314 gene locus_tag LOCUS_07830 8433 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9458 10204 gene locus_tag LOCUS_07840 9458 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 10204 11094 gene locus_tag LOCUS_07850 10204 11094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180622.1 protein_id gnl|my_center|LOCUS_07850 11513 11121 gene locus_tag LOCUS_07860 11513 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 <12867 11550 gene locus_tag LOCUS_07870 <12867 11550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762019.1:acyl CoA:acetate/3-ketoacid CoA transferase >Feature sequence037 <1 1745 gene locus_tag LOCUS_07880 <1 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein 2878 1742 gene locus_tag LOCUS_07890 2878 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3470 2871 gene locus_tag LOCUS_07900 3470 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4128 3472 gene locus_tag LOCUS_07910 4128 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5339 4137 gene locus_tag LOCUS_07920 5339 4137 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250090.1 protein_id gnl|my_center|LOCUS_07920 5938 5336 gene locus_tag LOCUS_07930 5938 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6416 6036 gene locus_tag LOCUS_07940 6416 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6885 6496 gene locus_tag LOCUS_07950 6885 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7007 7933 gene locus_tag LOCUS_07960 7007 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8921 7944 gene locus_tag LOCUS_07970 gene meaB 8921 7944 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_07970 9339 8893 gene locus_tag LOCUS_07980 9339 8893 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_07980 11026 9308 gene locus_tag LOCUS_07990 11026 9308 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_07990 11557 11126 gene locus_tag LOCUS_08000 11557 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 <12360 11835 gene locus_tag LOCUS_08010 <12360 11835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257382.1:glycosyltransferase family 4 protein >Feature sequence038 824 423 gene locus_tag LOCUS_08020 824 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2772 814 gene locus_tag LOCUS_08030 gene lonB 2772 814 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_08030 3536 2901 gene locus_tag LOCUS_08040 3536 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3788 4954 gene locus_tag LOCUS_08050 3788 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4964 6088 gene locus_tag LOCUS_08060 4964 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6078 7046 gene locus_tag LOCUS_08070 6078 7046 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868750.1 protein_id gnl|my_center|LOCUS_08070 7046 8347 gene locus_tag LOCUS_08080 7046 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8347 8943 gene locus_tag LOCUS_08090 8347 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9303 9118 gene locus_tag LOCUS_08100 9303 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence039 4 76 gene locus_tag LOCUS_t00200 4 76 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1435 245 gene locus_tag LOCUS_08110 1435 245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 protein_id gnl|my_center|LOCUS_08110 1525 1842 gene locus_tag LOCUS_08120 1525 1842 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259894.1 protein_id gnl|my_center|LOCUS_08120 2425 2204 gene locus_tag LOCUS_08130 2425 2204 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_08130 2636 2418 gene locus_tag LOCUS_08140 2636 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3187 4599 gene locus_tag LOCUS_08150 3187 4599 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429707.1 protein_id gnl|my_center|LOCUS_08150 4689 5465 gene locus_tag LOCUS_08160 4689 5465 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_08160 6508 5657 gene locus_tag LOCUS_08170 6508 5657 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_08170 7460 6597 gene locus_tag LOCUS_08180 7460 6597 CDS product bifunctional 2-dehydro-3-deoxy-phosphogluconate/2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846807.1 protein_id gnl|my_center|LOCUS_08180 8187 7453 gene locus_tag LOCUS_08190 8187 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 9269 8184 gene locus_tag LOCUS_08200 9269 8184 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980451.1 protein_id gnl|my_center|LOCUS_08200 9474 10913 gene locus_tag LOCUS_08210 9474 10913 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429773.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence040 445 1293 gene locus_tag LOCUS_08220 445 1293 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_08220 1290 2051 gene locus_tag LOCUS_08230 1290 2051 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_08230 3050 2040 gene locus_tag LOCUS_08240 gene cysM 3050 2040 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358955.1 protein_id gnl|my_center|LOCUS_08240 3138 4217 gene locus_tag LOCUS_08250 3138 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4533 4207 gene locus_tag LOCUS_08260 4533 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5512 4538 gene locus_tag LOCUS_08270 5512 4538 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763430.1 protein_id gnl|my_center|LOCUS_08270 5923 5513 gene locus_tag LOCUS_08280 gene trxA 5923 5513 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_08280 6025 6408 gene locus_tag LOCUS_08290 6025 6408 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012964688.1 protein_id gnl|my_center|LOCUS_08290 7368 6412 gene locus_tag LOCUS_08300 7368 6412 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 protein_id gnl|my_center|LOCUS_08300 7470 8282 gene locus_tag LOCUS_08310 7470 8282 CDS product DUF929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846855.1 protein_id gnl|my_center|LOCUS_08310 8575 9354 gene locus_tag LOCUS_08320 8575 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11207 9459 gene locus_tag LOCUS_08330 11207 9459 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980495.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence041 137 53 gene locus_tag LOCUS_t00210 137 53 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 541 122 gene locus_tag LOCUS_08340 541 122 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_08340 1283 579 gene locus_tag LOCUS_08350 gene psmA 1283 579 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_08350 1639 2913 gene locus_tag LOCUS_08360 1639 2913 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_08360 2913 3758 gene locus_tag LOCUS_08370 2913 3758 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250562.1 protein_id gnl|my_center|LOCUS_08370 3798 4463 gene locus_tag LOCUS_08380 3798 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6291 4477 gene locus_tag LOCUS_08390 6291 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6840 7052 gene locus_tag LOCUS_08400 6840 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 6977 7858 gene locus_tag LOCUS_08410 6977 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 8285 7827 gene locus_tag LOCUS_08420 8285 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 9892 8330 gene locus_tag LOCUS_08430 9892 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 10500 10006 gene locus_tag LOCUS_08440 10500 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10657 11313 gene locus_tag LOCUS_08450 gene rpe 10657 11313 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence042 56 373 gene locus_tag LOCUS_08460 56 373 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_08460 464 928 gene locus_tag LOCUS_08470 464 928 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_08470 935 1537 gene locus_tag LOCUS_08480 935 1537 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_08480 1530 1913 gene locus_tag LOCUS_08490 1530 1913 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_08490 1913 2785 gene locus_tag LOCUS_08500 1913 2785 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_08500 2814 3590 gene locus_tag LOCUS_08510 2814 3590 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_08510 3587 4408 gene locus_tag LOCUS_08520 3587 4408 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251074.1 protein_id gnl|my_center|LOCUS_08520 4395 4775 gene locus_tag LOCUS_08530 4395 4775 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_08530 6010 4838 gene locus_tag LOCUS_08540 6010 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6968 6075 gene locus_tag LOCUS_08550 gene prpB 6968 6075 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_08550 8280 6955 gene locus_tag LOCUS_08560 8280 6955 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_08560 9826 8555 gene locus_tag LOCUS_08570 9826 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence043 2125 653 gene locus_tag LOCUS_08580 2125 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3001 2156 gene locus_tag LOCUS_08590 3001 2156 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_08590 3208 3897 gene locus_tag LOCUS_08600 gene sfsA 3208 3897 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979065.1 protein_id gnl|my_center|LOCUS_08600 4164 5609 gene locus_tag LOCUS_08610 4164 5609 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_08610 8620 5624 gene locus_tag LOCUS_08620 gene carB 8620 5624 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 protein_id gnl|my_center|LOCUS_08620 9650 8604 gene locus_tag LOCUS_08630 gene carA 9650 8604 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965933.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence044 <1 888 gene locus_tag LOCUS_08640 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056897.1:aldo/keto reductase 1532 1017 gene locus_tag LOCUS_08650 1532 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1762 3225 gene locus_tag LOCUS_08660 1762 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3321 3686 gene locus_tag LOCUS_08670 3321 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4426 5736 gene locus_tag LOCUS_08680 4426 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5921 6868 gene locus_tag LOCUS_08690 5921 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6978 7532 gene locus_tag LOCUS_08700 gene rfbC 6978 7532 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_08700 7553 8479 gene locus_tag LOCUS_08710 gene rfbB 7553 8479 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence045 311 226 gene locus_tag LOCUS_t00220 311 226 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 480 319 gene locus_tag LOCUS_08720 480 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 607 1863 gene locus_tag LOCUS_08730 607 1863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_08730 1983 3254 gene locus_tag LOCUS_08740 1983 3254 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_08740 3256 4002 gene locus_tag LOCUS_08750 3256 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4501 3986 gene locus_tag LOCUS_08760 4501 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4610 5026 gene locus_tag LOCUS_08770 4610 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5156 5560 gene locus_tag LOCUS_08780 5156 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 7281 5626 gene locus_tag LOCUS_08790 7281 5626 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_08790 8221 7256 gene locus_tag LOCUS_08800 8221 7256 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_08800 8429 8226 gene locus_tag LOCUS_08810 8429 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 9212 8478 gene locus_tag LOCUS_08820 gene cobS 9212 8478 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence046 84 158 gene locus_tag LOCUS_t00230 84 158 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 328 687 gene locus_tag LOCUS_08830 328 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 702 1313 gene locus_tag LOCUS_08840 702 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2137 1688 gene locus_tag LOCUS_08850 2137 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3291 2134 gene locus_tag LOCUS_08860 3291 2134 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_08860 4379 3558 gene locus_tag LOCUS_08870 4379 3558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267572.1 protein_id gnl|my_center|LOCUS_08870 6330 4510 gene locus_tag LOCUS_08880 6330 4510 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979899.1 protein_id gnl|my_center|LOCUS_08880 6544 7011 gene locus_tag LOCUS_08890 6544 7011 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980406.1 protein_id gnl|my_center|LOCUS_08890 8630 7008 gene locus_tag LOCUS_08900 8630 7008 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846899.1 protein_id gnl|my_center|LOCUS_08900 9379 8627 gene locus_tag LOCUS_08910 9379 8627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978575.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence047 <1 1437 gene locus_tag LOCUS_08920 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877454.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1434 2066 gene locus_tag LOCUS_08930 gene iorB 1434 2066 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_08930 2137 2547 gene locus_tag LOCUS_08940 2137 2547 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582722.1 protein_id gnl|my_center|LOCUS_08940 2538 2906 gene locus_tag LOCUS_08950 2538 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4288 3068 gene locus_tag LOCUS_08960 4288 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5000 6292 gene locus_tag LOCUS_08970 5000 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6359 6886 gene locus_tag LOCUS_08980 6359 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6958 7173 gene locus_tag LOCUS_08990 6958 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 7242 8441 gene locus_tag LOCUS_09000 7242 8441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence048 291 73 gene locus_tag LOCUS_09010 291 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 410 2695 gene locus_tag LOCUS_09020 410 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2755 3747 gene locus_tag LOCUS_09030 2755 3747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_09030 3771 6035 gene locus_tag LOCUS_09040 3771 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6037 8544 gene locus_tag LOCUS_09050 6037 8544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_09050 8548 8934 gene locus_tag LOCUS_09060 8548 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence049 537 337 gene locus_tag LOCUS_09070 537 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 639 2618 gene locus_tag LOCUS_09080 639 2618 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979587.1 protein_id gnl|my_center|LOCUS_09080 2648 3301 gene locus_tag LOCUS_09090 2648 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5556 3790 gene locus_tag LOCUS_09100 5556 3790 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868264.1 protein_id gnl|my_center|LOCUS_09100 6039 5632 gene locus_tag LOCUS_09110 6039 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 6146 6538 gene locus_tag LOCUS_09120 6146 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_09120 6660 7115 gene locus_tag LOCUS_09130 6660 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7560 7123 gene locus_tag LOCUS_09140 7560 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8150 7671 gene locus_tag LOCUS_09150 8150 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 8254 9243 gene locus_tag LOCUS_09160 8254 9243 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846753.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence050 <1 822 gene locus_tag LOCUS_09170 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876722.1:UbiA family prenyltransferase 819 1553 gene locus_tag LOCUS_09180 819 1553 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_09180 1699 1944 gene locus_tag LOCUS_09190 gene purS 1699 1944 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548369.1 protein_id gnl|my_center|LOCUS_09190 1947 4259 gene locus_tag LOCUS_09200 gene purL 1947 4259 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_09200 4265 4519 gene locus_tag LOCUS_09210 4265 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5198 4509 gene locus_tag LOCUS_09220 5198 4509 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_09220 5479 5189 gene locus_tag LOCUS_09230 5479 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 6155 5538 gene locus_tag LOCUS_09240 6155 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence051 1151 174 gene locus_tag LOCUS_09250 1151 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1485 1556 gene locus_tag LOCUS_t00240 1485 1556 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2278 1679 gene locus_tag LOCUS_09260 2278 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2444 3007 gene locus_tag LOCUS_09270 2444 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2976 3707 gene locus_tag LOCUS_09280 2976 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4145 3918 gene locus_tag LOCUS_09290 4145 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4263 4757 gene locus_tag LOCUS_09300 4263 4757 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_09300 5260 5090 gene locus_tag LOCUS_09310 5260 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6751 5459 gene locus_tag LOCUS_09320 6751 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7042 7308 gene locus_tag LOCUS_09330 7042 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7309 7572 gene locus_tag LOCUS_09340 7309 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 7580 8224 gene locus_tag LOCUS_09350 7580 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 8947 8549 gene locus_tag LOCUS_09360 8947 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence052 2278 1178 gene locus_tag LOCUS_09370 2278 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3464 2283 gene locus_tag LOCUS_09380 gene glyA 3464 2283 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_09380 4811 3588 gene locus_tag LOCUS_09390 4811 3588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979148.1 protein_id gnl|my_center|LOCUS_09390 5132 7510 gene locus_tag LOCUS_09400 5132 7510 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_09400 7512 8672 gene locus_tag LOCUS_09410 7512 8672 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence053 2821 1004 gene locus_tag LOCUS_09420 2821 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4835 2823 gene locus_tag LOCUS_09430 4835 2823 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065174.1 protein_id gnl|my_center|LOCUS_09430 5985 4840 gene locus_tag LOCUS_09440 gene ugpC 5985 4840 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252937.1 protein_id gnl|my_center|LOCUS_09440 6911 5991 gene locus_tag LOCUS_09450 6911 5991 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 protein_id gnl|my_center|LOCUS_09450 7822 6911 gene locus_tag LOCUS_09460 7822 6911 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_09460 <8777 7875 gene locus_tag LOCUS_09470 <8777 7875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967720.1:extracellular solute-binding protein >Feature sequence054 534 713 gene locus_tag LOCUS_09480 534 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 872 1825 gene locus_tag LOCUS_09490 872 1825 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_09490 3159 3075 gene locus_tag LOCUS_t00250 3159 3075 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3251 3535 gene locus_tag LOCUS_09500 3251 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3516 3938 gene locus_tag LOCUS_09510 3516 3938 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_09510 4019 4294 gene locus_tag LOCUS_09520 gene albA 4019 4294 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_09520 4383 5363 gene locus_tag LOCUS_09530 gene ispB 4383 5363 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_09530 5365 6528 gene locus_tag LOCUS_09540 5365 6528 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_09540 6529 6729 gene locus_tag LOCUS_09550 6529 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6772 8319 gene locus_tag LOCUS_09560 6772 8319 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence055 3152 1524 gene locus_tag LOCUS_09570 gene thsB 3152 1524 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_09570 3230 3787 gene locus_tag LOCUS_09580 3230 3787 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978555.1 protein_id gnl|my_center|LOCUS_09580 4811 3816 gene locus_tag LOCUS_09590 4811 3816 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_09590 4889 6232 gene locus_tag LOCUS_09600 4889 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6487 6203 gene locus_tag LOCUS_09610 6487 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6668 7264 gene locus_tag LOCUS_09620 6668 7264 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_09620 7331 7414 gene locus_tag LOCUS_t00260 7331 7414 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7462 8034 gene locus_tag LOCUS_09630 7462 8034 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence056 1092 304 gene locus_tag LOCUS_09640 1092 304 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880910.1 protein_id gnl|my_center|LOCUS_09640 2234 1089 gene locus_tag LOCUS_09650 gene acdA 2234 1089 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_09650 2551 3201 gene locus_tag LOCUS_09660 2551 3201 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867371.1 protein_id gnl|my_center|LOCUS_09660 4121 3192 gene locus_tag LOCUS_09670 gene arcC 4121 3192 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_09670 4249 4635 gene locus_tag LOCUS_09680 4249 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4702 5517 gene locus_tag LOCUS_09690 4702 5517 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_09690 6067 5546 gene locus_tag LOCUS_09700 6067 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8203 6449 gene locus_tag LOCUS_09710 8203 6449 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence057 1 183 gene locus_tag LOCUS_09720 1 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1136 177 gene locus_tag LOCUS_09730 1136 177 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_09730 1247 1384 gene locus_tag LOCUS_09740 1247 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2632 1349 gene locus_tag LOCUS_09750 gene aspS 2632 1349 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_09750 2784 2629 gene locus_tag LOCUS_09760 2784 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3090 4355 gene locus_tag LOCUS_09770 3090 4355 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867774.1 protein_id gnl|my_center|LOCUS_09770 4456 5334 gene locus_tag LOCUS_09780 4456 5334 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_09780 5708 5343 gene locus_tag LOCUS_09790 5708 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5794 6027 gene locus_tag LOCUS_09800 5794 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 6027 7457 gene locus_tag LOCUS_09810 gene merA 6027 7457 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09810 7515 8306 gene locus_tag LOCUS_09820 7515 8306 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722560.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence058 1165 686 gene locus_tag LOCUS_09830 1165 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1410 1162 gene locus_tag LOCUS_09840 1410 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1894 1454 gene locus_tag LOCUS_09850 1894 1454 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_09850 2594 1980 gene locus_tag LOCUS_09860 2594 1980 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902614.1 protein_id gnl|my_center|LOCUS_09860 6235 2594 gene locus_tag LOCUS_09870 6235 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6928 6449 gene locus_tag LOCUS_09880 6928 6449 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582465.1 protein_id gnl|my_center|LOCUS_09880 7034 7474 gene locus_tag LOCUS_09890 7034 7474 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence059 583 80 gene locus_tag LOCUS_09900 583 80 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_09900 1187 651 gene locus_tag LOCUS_09910 gene msrA 1187 651 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_09910 1668 1180 gene locus_tag LOCUS_09920 1668 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2013 3413 gene locus_tag LOCUS_09930 2013 3413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978004.1 protein_id gnl|my_center|LOCUS_09930 3410 4228 gene locus_tag LOCUS_09940 3410 4228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_09940 4358 5638 gene locus_tag LOCUS_09950 4358 5638 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_09950 5619 6608 gene locus_tag LOCUS_09960 5619 6608 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691510.1 protein_id gnl|my_center|LOCUS_09960 6634 7218 gene locus_tag LOCUS_09970 6634 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 8018 7266 gene locus_tag LOCUS_09980 gene fabG 8018 7266 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979123.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence060 976 8 gene locus_tag LOCUS_09990 976 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1388 2488 gene locus_tag LOCUS_10000 1388 2488 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679900.1 protein_id gnl|my_center|LOCUS_10000 3500 2538 gene locus_tag LOCUS_10010 3500 2538 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_10010 7009 3740 gene locus_tag LOCUS_10020 7009 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence061 <1 1187 gene locus_tag LOCUS_10030 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 1246 1743 gene locus_tag LOCUS_10040 1246 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1826 2434 gene locus_tag LOCUS_10050 1826 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3629 3081 gene locus_tag LOCUS_10060 gene msrA 3629 3081 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_10060 3996 3622 gene locus_tag LOCUS_10070 3996 3622 CDS product methionine-R-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853613.1 protein_id gnl|my_center|LOCUS_10070 4567 4307 gene locus_tag LOCUS_10080 4567 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4633 5337 gene locus_tag LOCUS_10090 4633 5337 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902872.1 protein_id gnl|my_center|LOCUS_10090 5840 5367 gene locus_tag LOCUS_10100 5840 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6059 7174 gene locus_tag LOCUS_10110 6059 7174 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence062 1427 258 gene locus_tag LOCUS_10120 gene agl3 1427 258 CDS product UDP-sulfoquinovose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846779.1 protein_id gnl|my_center|LOCUS_10120 1552 2154 gene locus_tag LOCUS_10130 1552 2154 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880317.1 protein_id gnl|my_center|LOCUS_10130 3399 2170 gene locus_tag LOCUS_10140 3399 2170 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869538.1 protein_id gnl|my_center|LOCUS_10140 4166 3402 gene locus_tag LOCUS_10150 4166 3402 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_10150 4307 5449 gene locus_tag LOCUS_10160 4307 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5449 6264 gene locus_tag LOCUS_10170 5449 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7684 6266 gene locus_tag LOCUS_10180 gene gcvPB 7684 6266 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence063 359 33 gene locus_tag LOCUS_10190 359 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1041 361 gene locus_tag LOCUS_10200 1041 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1844 1038 gene locus_tag LOCUS_10210 1844 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979078.1 protein_id gnl|my_center|LOCUS_10210 2638 1841 gene locus_tag LOCUS_10220 2638 1841 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979077.1 protein_id gnl|my_center|LOCUS_10220 4753 2732 gene locus_tag LOCUS_10230 4753 2732 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_10230 4898 5905 gene locus_tag LOCUS_10240 4898 5905 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582760.1 protein_id gnl|my_center|LOCUS_10240 6173 6018 gene locus_tag LOCUS_10250 6173 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6172 7605 gene locus_tag LOCUS_10260 6172 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence064 2295 2714 gene locus_tag LOCUS_10270 2295 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2714 3469 gene locus_tag LOCUS_10280 2714 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3717 4670 gene locus_tag LOCUS_10290 3717 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4670 5701 gene locus_tag LOCUS_10300 4670 5701 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_10300 5704 7095 gene locus_tag LOCUS_10310 5704 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7615 7085 gene locus_tag LOCUS_10320 7615 7085 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978265.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence065 1763 906 gene locus_tag LOCUS_10330 1763 906 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947999.1 protein_id gnl|my_center|LOCUS_10330 2081 3031 gene locus_tag LOCUS_10340 gene coaA 2081 3031 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165813.1 protein_id gnl|my_center|LOCUS_10340 4270 3065 gene locus_tag LOCUS_10350 4270 3065 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_10350 4384 5310 gene locus_tag LOCUS_10360 4384 5310 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258066.1 protein_id gnl|my_center|LOCUS_10360 7113 5329 gene locus_tag LOCUS_10370 7113 5329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867421.1 protein_id gnl|my_center|LOCUS_10370 <7613 7097 gene locus_tag LOCUS_10380 <7613 7097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582658.1:ABC transporter ATP-binding protein >Feature sequence066 1759 944 gene locus_tag LOCUS_10390 1759 944 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_10390 1846 2262 gene locus_tag LOCUS_10400 1846 2262 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651021.1 protein_id gnl|my_center|LOCUS_10400 2341 3900 gene locus_tag LOCUS_10410 2341 3900 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_10410 4117 5976 gene locus_tag LOCUS_10420 4117 5976 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089503.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence067 171 1487 gene locus_tag LOCUS_10430 171 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2775 1588 gene locus_tag LOCUS_10440 2775 1588 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_10440 2956 2789 gene locus_tag LOCUS_10450 2956 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3579 4940 gene locus_tag LOCUS_10460 3579 4940 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249095.1 protein_id gnl|my_center|LOCUS_10460 5206 5607 gene locus_tag LOCUS_10470 5206 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5669 5890 gene locus_tag LOCUS_10480 5669 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 5958 6527 gene locus_tag LOCUS_10490 5958 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6521 6943 gene locus_tag LOCUS_10500 6521 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence068 3530 2436 gene locus_tag LOCUS_10510 3530 2436 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_10510 5087 3564 gene locus_tag LOCUS_10520 5087 3564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583972.1 protein_id gnl|my_center|LOCUS_10520 6075 5068 gene locus_tag LOCUS_10530 6075 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 7241 6126 gene locus_tag LOCUS_10540 7241 6126 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382128.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence069 561 944 gene locus_tag LOCUS_10550 561 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1077 4694 gene locus_tag LOCUS_10560 1077 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4691 5341 gene locus_tag LOCUS_10570 4691 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5396 5953 gene locus_tag LOCUS_10580 5396 5953 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_10580 5970 6404 gene locus_tag LOCUS_10590 5970 6404 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence070 1394 420 gene locus_tag LOCUS_10600 1394 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2740 1391 gene locus_tag LOCUS_10610 2740 1391 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381849.1 protein_id gnl|my_center|LOCUS_10610 3106 3504 gene locus_tag LOCUS_10620 3106 3504 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978000.1 protein_id gnl|my_center|LOCUS_10620 3511 4677 gene locus_tag LOCUS_10630 gene coaBC 3511 4677 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876840.1 protein_id gnl|my_center|LOCUS_10630 4664 5422 gene locus_tag LOCUS_10640 4664 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6100 5393 gene locus_tag LOCUS_10650 6100 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence071 752 2020 gene locus_tag LOCUS_10660 gene purB 752 2020 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_10660 2017 2592 gene locus_tag LOCUS_10670 2017 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2661 3719 gene locus_tag LOCUS_10680 2661 3719 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_10680 4411 3740 gene locus_tag LOCUS_10690 4411 3740 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980120.1 protein_id gnl|my_center|LOCUS_10690 4431 4904 gene locus_tag LOCUS_10700 4431 4904 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_10700 <7086 5222 gene locus_tag LOCUS_10710 <7086 5222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846671.1:MMPL family transporter >Feature sequence072 1911 1174 gene locus_tag LOCUS_10720 1911 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2003 3283 gene locus_tag LOCUS_10730 2003 3283 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_10730 3369 4595 gene locus_tag LOCUS_10740 3369 4595 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_10740 5299 4610 gene locus_tag LOCUS_10750 5299 4610 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249096.1 protein_id gnl|my_center|LOCUS_10750 5427 5987 gene locus_tag LOCUS_10760 5427 5987 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_10760 6061 7071 gene locus_tag LOCUS_10770 gene pdxS 6061 7071 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence073 1319 120 gene locus_tag LOCUS_10780 1319 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2587 1316 gene locus_tag LOCUS_10790 2587 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3291 2668 gene locus_tag LOCUS_10800 3291 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4238 3288 gene locus_tag LOCUS_10810 4238 3288 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_10810 4551 4318 gene locus_tag LOCUS_10820 4551 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4676 5737 gene locus_tag LOCUS_10830 4676 5737 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_10830 5734 6708 gene locus_tag LOCUS_10840 5734 6708 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249841.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence074 1298 87 gene locus_tag LOCUS_10850 gene sufB 1298 87 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921889.1 protein_id gnl|my_center|LOCUS_10850 2747 1305 gene locus_tag LOCUS_10860 gene sufB 2747 1305 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356769.1 protein_id gnl|my_center|LOCUS_10860 3490 2753 gene locus_tag LOCUS_10870 gene sufC 3490 2753 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_10870 3576 4247 gene locus_tag LOCUS_10880 3576 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5182 4235 gene locus_tag LOCUS_10890 5182 4235 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_10890 5782 5288 gene locus_tag LOCUS_10900 5782 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence075 <1 1221 gene locus_tag LOCUS_10910 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020936.1:dihydroorotase 1791 2846 gene locus_tag LOCUS_10920 1791 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10920 2856 3275 gene locus_tag LOCUS_10930 2856 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10930 3713 4993 gene locus_tag LOCUS_10940 3713 4993 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_10940 5219 5147 gene locus_tag LOCUS_t00270 5219 5147 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5547 6632 gene locus_tag LOCUS_10950 5547 6632 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020301.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence076 522 1481 gene locus_tag LOCUS_10960 522 1481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240578.1 protein_id gnl|my_center|LOCUS_10960 2513 1524 gene locus_tag LOCUS_10970 2513 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2654 2727 gene locus_tag LOCUS_t00280 2654 2727 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4323 3079 gene locus_tag LOCUS_10980 4323 3079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053896.1 protein_id gnl|my_center|LOCUS_10980 4453 6153 gene locus_tag LOCUS_10990 4453 6153 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_10990 6308 6223 gene locus_tag LOCUS_t00290 6308 6223 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 201 2150 gene locus_tag LOCUS_11000 gene gyrB 201 2150 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583896.1 protein_id gnl|my_center|LOCUS_11000 2161 4548 gene locus_tag LOCUS_11010 gene gyrA 2161 4548 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_11010 4548 5471 gene locus_tag LOCUS_11020 4548 5471 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_11020 6209 5592 gene locus_tag LOCUS_11030 6209 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence078 759 259 gene locus_tag LOCUS_11040 759 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1914 913 gene locus_tag LOCUS_11050 1914 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1913 2152 gene locus_tag LOCUS_11060 1913 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3070 2321 gene locus_tag LOCUS_11070 3070 2321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979631.1 protein_id gnl|my_center|LOCUS_11070 4415 3144 gene locus_tag LOCUS_11080 4415 3144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088030.1 protein_id gnl|my_center|LOCUS_11080 4530 5468 gene locus_tag LOCUS_11090 4530 5468 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence079 2371 2691 gene locus_tag LOCUS_11100 2371 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11100 3169 2972 gene locus_tag LOCUS_11110 3169 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4526 3462 gene locus_tag LOCUS_11120 4526 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5283 4561 gene locus_tag LOCUS_11130 5283 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence080 <1 799 gene locus_tag LOCUS_11140 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964979.1:ATP-dependent DNA helicase 839 1480 gene locus_tag LOCUS_11150 839 1480 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146461.1 protein_id gnl|my_center|LOCUS_11150 1458 1988 gene locus_tag LOCUS_11160 gene rimI 1458 1988 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240337.1 protein_id gnl|my_center|LOCUS_11160 2918 1980 gene locus_tag LOCUS_11170 2918 1980 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_11170 4196 3015 gene locus_tag LOCUS_11180 4196 3015 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_11180 4965 4237 gene locus_tag LOCUS_11190 gene alaXM 4965 4237 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_11190 5059 5628 gene locus_tag LOCUS_11200 5059 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence081 488 1222 gene locus_tag LOCUS_11210 488 1222 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979915.1 protein_id gnl|my_center|LOCUS_11210 1447 2769 gene locus_tag LOCUS_11220 1447 2769 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_11220 3003 3788 gene locus_tag LOCUS_11230 3003 3788 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_11230 4944 3835 gene locus_tag LOCUS_11240 4944 3835 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403232.1 protein_id gnl|my_center|LOCUS_11240 5714 4950 gene locus_tag LOCUS_11250 5714 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence082 489 2852 gene locus_tag LOCUS_11260 489 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3298 2867 gene locus_tag LOCUS_11270 3298 2867 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_11270 3413 4663 gene locus_tag LOCUS_11280 3413 4663 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_11280 4664 5080 gene locus_tag LOCUS_11290 gene pfdA 4664 5080 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879555.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence083 654 325 gene locus_tag LOCUS_11300 654 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877792.1 protein_id gnl|my_center|LOCUS_11300 969 754 gene locus_tag LOCUS_11310 969 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1020 2435 gene locus_tag LOCUS_11320 1020 2435 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081553.1 protein_id gnl|my_center|LOCUS_11320 2443 3450 gene locus_tag LOCUS_11330 2443 3450 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870204.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence084 145 504 gene locus_tag LOCUS_11340 145 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 761 1192 gene locus_tag LOCUS_11350 761 1192 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080665811.1 protein_id gnl|my_center|LOCUS_11350 1323 3497 gene locus_tag LOCUS_11360 gene katG 1323 3497 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_11360 5299 3659 gene locus_tag LOCUS_11370 5299 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence085 283 1230 gene locus_tag LOCUS_11380 283 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1285 1815 gene locus_tag LOCUS_11390 1285 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3358 1829 gene locus_tag LOCUS_11400 gene hutH 3358 1829 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032916282.1 protein_id gnl|my_center|LOCUS_11400 3484 3675 gene locus_tag LOCUS_11410 3484 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4231 3791 gene locus_tag LOCUS_11420 4231 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 <5263 4322 gene locus_tag LOCUS_11430 <5263 4322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967072.1:LD-carboxypeptidase >Feature sequence086 <1 1165 gene locus_tag LOCUS_11440 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061171.1:ribosome rescue protein RqcH 2102 1158 gene locus_tag LOCUS_11450 2102 1158 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_11450 3628 2372 gene locus_tag LOCUS_11460 3628 2372 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010923212.1 protein_id gnl|my_center|LOCUS_11460 4644 3628 gene locus_tag LOCUS_11470 4644 3628 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_11470 <5260 4648 gene locus_tag LOCUS_11480 <5260 4648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267707.1:isovaleryl-CoA dehydrogenase >Feature sequence087 118 777 gene locus_tag LOCUS_11490 118 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 767 2644 gene locus_tag LOCUS_11500 767 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3024 3386 gene locus_tag LOCUS_11510 3024 3386 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_11510 3389 3931 gene locus_tag LOCUS_11520 3389 3931 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_11520 4093 4992 gene locus_tag LOCUS_11530 4093 4992 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence088 848 1396 gene locus_tag LOCUS_11540 848 1396 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_11540 4365 1477 gene locus_tag LOCUS_11550 4365 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4558 4905 gene locus_tag LOCUS_11560 4558 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence089 986 738 gene locus_tag LOCUS_11570 986 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1641 1123 gene locus_tag LOCUS_11580 1641 1123 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_11580 2650 1655 gene locus_tag LOCUS_11590 gene radA 2650 1655 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_11590 3663 2650 gene locus_tag LOCUS_11600 3663 2650 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_11600 4423 3674 gene locus_tag LOCUS_11610 4423 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence090 <1 535 gene locus_tag LOCUS_11620 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762723.1:tRNA 4-thiouridine(8) synthase ThiI 1028 507 gene locus_tag LOCUS_11630 1028 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1218 1290 gene locus_tag LOCUS_t00300 1218 1290 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2074 2742 gene locus_tag LOCUS_11640 2074 2742 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250650.1 protein_id gnl|my_center|LOCUS_11640 2742 2948 gene locus_tag LOCUS_11650 2742 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2929 3426 gene locus_tag LOCUS_11660 2929 3426 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_11660 3427 3726 gene locus_tag LOCUS_11670 3427 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3726 3887 gene locus_tag LOCUS_11680 3726 3887 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_11680 4186 3884 gene locus_tag LOCUS_11690 4186 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence091 16 1173 gene locus_tag LOCUS_11700 16 1173 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_11700 1329 1823 gene locus_tag LOCUS_11710 1329 1823 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_11710 2198 3484 gene locus_tag LOCUS_11720 2198 3484 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278478.1 protein_id gnl|my_center|LOCUS_11720 3486 3761 gene locus_tag LOCUS_11730 3486 3761 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811676.1 protein_id gnl|my_center|LOCUS_11730 3767 4567 gene locus_tag LOCUS_11740 gene etfB 3767 4567 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence092 101 1051 gene locus_tag LOCUS_11750 101 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1976 1104 gene locus_tag LOCUS_11760 1976 1104 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015265.1 protein_id gnl|my_center|LOCUS_11760 2082 3527 gene locus_tag LOCUS_11770 2082 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3849 3508 gene locus_tag LOCUS_11780 3849 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4578 4168 gene locus_tag LOCUS_11790 4578 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence093 <1 2590 gene locus_tag LOCUS_11800 <1 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880376.1:chromosome segregation protein SMC 2591 3364 gene locus_tag LOCUS_11810 2591 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3333 3602 gene locus_tag LOCUS_11820 3333 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3604 4122 gene locus_tag LOCUS_11830 gene cas4 3604 4122 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence094 291 34 gene locus_tag LOCUS_11840 291 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 953 693 gene locus_tag LOCUS_11850 953 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1640 2932 gene locus_tag LOCUS_11860 1640 2932 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250773.1 protein_id gnl|my_center|LOCUS_11860 3013 3222 gene locus_tag LOCUS_11870 3013 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3222 3293 gene locus_tag LOCUS_t00310 3222 3293 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3343 3624 gene locus_tag LOCUS_11880 3343 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3723 4094 gene locus_tag LOCUS_11890 3723 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence095 452 610 gene locus_tag LOCUS_11900 452 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 658 1674 gene locus_tag LOCUS_11910 658 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2173 1676 gene locus_tag LOCUS_11920 2173 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2460 2170 gene locus_tag LOCUS_11930 2460 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence096 924 1913 gene locus_tag LOCUS_11940 924 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2039 3889 gene locus_tag LOCUS_11950 gene iorA 2039 3889 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_11950 3886 4446 gene locus_tag LOCUS_11960 3886 4446 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence097 1463 231 gene locus_tag LOCUS_11970 1463 231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021185.1 protein_id gnl|my_center|LOCUS_11970 1514 2146 gene locus_tag LOCUS_11980 1514 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3119 2367 gene locus_tag LOCUS_11990 3119 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3567 4343 gene locus_tag LOCUS_12000 3567 4343 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651040.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence098 1558 515 gene locus_tag LOCUS_12010 1558 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1886 1605 gene locus_tag LOCUS_12020 1886 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846757.1 protein_id gnl|my_center|LOCUS_12020 2068 3084 gene locus_tag LOCUS_12030 2068 3084 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_12030 3408 3324 gene locus_tag LOCUS_t00320 3408 3324 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 <1 1224 gene locus_tag LOCUS_12040 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978029.1:MFS transporter 1356 1733 gene locus_tag LOCUS_12050 1356 1733 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_12050 1730 1981 gene locus_tag LOCUS_12060 1730 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2969 1983 gene locus_tag LOCUS_12070 2969 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 <4581 3115 gene locus_tag LOCUS_12080 <4581 3115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003227847.1:gamma-glutamyltransferase >Feature sequence100 1001 327 gene locus_tag LOCUS_12090 1001 327 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_12090 1908 1057 gene locus_tag LOCUS_12100 1908 1057 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_12100 2072 2455 gene locus_tag LOCUS_12110 2072 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2455 3180 gene locus_tag LOCUS_12120 2455 3180 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980436.1 protein_id gnl|my_center|LOCUS_12120 3690 3217 gene locus_tag LOCUS_12130 3690 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence101 1655 714 gene locus_tag LOCUS_12140 1655 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2015 2938 gene locus_tag LOCUS_12150 2015 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3305 4084 gene locus_tag LOCUS_12160 3305 4084 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence102 1614 340 gene locus_tag LOCUS_12170 1614 340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_12170 1851 2153 gene locus_tag LOCUS_12180 1851 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2637 2467 gene locus_tag LOCUS_12190 2637 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2944 3369 gene locus_tag LOCUS_12200 2944 3369 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249672.1 protein_id gnl|my_center|LOCUS_12200 3800 4336 gene locus_tag LOCUS_12210 3800 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence103 1117 359 gene locus_tag LOCUS_12220 1117 359 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846195.1 protein_id gnl|my_center|LOCUS_12220 2231 1923 gene locus_tag LOCUS_12230 2231 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3152 2751 gene locus_tag LOCUS_12240 3152 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3364 3149 gene locus_tag LOCUS_12250 3364 3149 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878978.1 protein_id gnl|my_center|LOCUS_12250 3705 3893 gene locus_tag LOCUS_12260 3705 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4510 4438 gene locus_tag LOCUS_t00330 4510 4438 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104 2253 1078 gene locus_tag LOCUS_12270 2253 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2374 3327 gene locus_tag LOCUS_12280 2374 3327 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_12280 <4516 3374 gene locus_tag LOCUS_12290 <4516 3374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523157.1:FAD-binding oxidoreductase >Feature sequence105 485 156 gene locus_tag LOCUS_12300 485 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1595 615 gene locus_tag LOCUS_12310 1595 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1853 1608 gene locus_tag LOCUS_12320 1853 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2060 1890 gene locus_tag LOCUS_12330 2060 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2815 2066 gene locus_tag LOCUS_12340 2815 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3568 2816 gene locus_tag LOCUS_12350 3568 2816 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_12350 <4506 3565 gene locus_tag LOCUS_12360 <4506 3565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061070.1:fumarate reductase subunit A >Feature sequence106 97 924 gene locus_tag LOCUS_12370 97 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 924 1859 gene locus_tag LOCUS_12380 924 1859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_12380 3897 1930 gene locus_tag LOCUS_12390 3897 1930 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 protein_id gnl|my_center|LOCUS_12390 4237 3902 gene locus_tag LOCUS_12400 4237 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence107 1540 2793 gene locus_tag LOCUS_12410 1540 2793 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053786.1 protein_id gnl|my_center|LOCUS_12410 3455 3216 gene locus_tag LOCUS_12420 3455 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3925 4161 gene locus_tag LOCUS_12430 3925 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence108 550 479 gene locus_tag LOCUS_t00340 550 479 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 638 2224 gene locus_tag LOCUS_12440 638 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2283 2750 gene locus_tag LOCUS_12450 2283 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 2725 3378 gene locus_tag LOCUS_12460 2725 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 3462 3638 gene locus_tag LOCUS_12470 3462 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 4136 4300 gene locus_tag LOCUS_12480 4136 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence109 437 365 gene locus_tag LOCUS_t00350 437 365 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1560 400 gene locus_tag LOCUS_12490 1560 400 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_12490 2420 1569 gene locus_tag LOCUS_12500 gene nfo 2420 1569 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109358.1 protein_id gnl|my_center|LOCUS_12500 3149 2424 gene locus_tag LOCUS_12510 3149 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence110 1139 1726 gene locus_tag LOCUS_12520 1139 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1723 2307 gene locus_tag LOCUS_12530 1723 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2706 2984 gene locus_tag LOCUS_12540 2706 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2981 3430 gene locus_tag LOCUS_12550 2981 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3811 3578 gene locus_tag LOCUS_12560 3811 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence111 2261 1482 gene locus_tag LOCUS_12570 2261 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3376 2258 gene locus_tag LOCUS_12580 3376 2258 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence112 <1 639 gene locus_tag LOCUS_12590 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902031.1:SprT family zinc-dependent metalloprotease 709 1596 gene locus_tag LOCUS_12600 709 1596 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_12600 2375 1632 gene locus_tag LOCUS_12610 2375 1632 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_12610 3036 2365 gene locus_tag LOCUS_12620 3036 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3227 4111 gene locus_tag LOCUS_12630 3227 4111 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846818.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence113 <1 515 gene locus_tag LOCUS_12640 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979823.1:APC family permease 799 1725 gene locus_tag LOCUS_12650 799 1725 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_12650 1715 2542 gene locus_tag LOCUS_12660 1715 2542 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770593.1 protein_id gnl|my_center|LOCUS_12660 2539 3561 gene locus_tag LOCUS_12670 2539 3561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence114 994 1173 gene locus_tag LOCUS_12680 994 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1219 1350 gene locus_tag LOCUS_12690 1219 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence115 99 953 gene locus_tag LOCUS_12700 99 953 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251185.1 protein_id gnl|my_center|LOCUS_12700 955 1701 gene locus_tag LOCUS_12710 955 1701 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_12710 3345 1690 gene locus_tag LOCUS_12720 3345 1690 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978028.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence116 2198 1941 gene locus_tag LOCUS_12730 2198 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2553 3209 gene locus_tag LOCUS_12740 2553 3209 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence117 847 2658 gene locus_tag LOCUS_12750 847 2658 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_12750 3041 2682 gene locus_tag LOCUS_12760 3041 2682 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_12760 3373 3116 gene locus_tag LOCUS_12770 3373 3116 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence118 1799 294 gene locus_tag LOCUS_12780 1799 294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979012.1 protein_id gnl|my_center|LOCUS_12780 2236 1802 gene locus_tag LOCUS_12790 2236 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2407 3072 gene locus_tag LOCUS_12800 2407 3072 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537542.1 protein_id gnl|my_center|LOCUS_12800 3619 3353 gene locus_tag LOCUS_12810 3619 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence119 35 108 gene locus_tag LOCUS_t00360 35 108 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1962 1255 gene locus_tag LOCUS_12820 1962 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2392 3096 gene locus_tag LOCUS_12830 2392 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence120 <1 661 gene locus_tag LOCUS_12840 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460426.1:heavy metal translocating P-type ATPase 1010 1579 gene locus_tag LOCUS_12850 1010 1579 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 protein_id gnl|my_center|LOCUS_12850 1820 2911 gene locus_tag LOCUS_12860 1820 2911 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence121 171 1442 gene locus_tag LOCUS_12870 gene gdhA 171 1442 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_12870 2598 1627 gene locus_tag LOCUS_12880 gene adhP 2598 1627 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_12880 2693 2764 gene locus_tag LOCUS_t00370 2693 2764 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 1285 239 gene locus_tag LOCUS_12890 1285 239 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 1852 1583 gene locus_tag LOCUS_12900 1852 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12900 2167 2643 gene locus_tag LOCUS_12910 2167 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2682 3443 gene locus_tag LOCUS_12920 2682 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence123 465 806 gene locus_tag LOCUS_12930 465 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 799 1059 gene locus_tag LOCUS_12940 799 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1140 2246 gene locus_tag LOCUS_12950 1140 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2243 2614 gene locus_tag LOCUS_12960 2243 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2872 3189 gene locus_tag LOCUS_12970 2872 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence124 576 262 gene locus_tag LOCUS_12980 576 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1088 1237 gene locus_tag LOCUS_12990 1088 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1230 2498 gene locus_tag LOCUS_13000 1230 2498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250773.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence125 <1 639 gene locus_tag LOCUS_13010 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496485.1:carbohydrate kinase family protein 620 1144 gene locus_tag LOCUS_13020 620 1144 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120696.1 protein_id gnl|my_center|LOCUS_13020 1163 2386 gene locus_tag LOCUS_13030 gene eno 1163 2386 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_13030 2376 3188 gene locus_tag LOCUS_13040 2376 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence126 1838 1509 gene locus_tag LOCUS_13050 1838 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2385 1927 gene locus_tag LOCUS_13060 2385 1927 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132361.1 protein_id gnl|my_center|LOCUS_13060 <3379 2378 gene locus_tag LOCUS_13070 <3379 2378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979769.1:MFS transporter >Feature sequence127 3235 2033 gene locus_tag LOCUS_13080 3235 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence128 439 639 gene locus_tag LOCUS_13090 439 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 646 888 gene locus_tag LOCUS_13100 646 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2868 1240 gene locus_tag LOCUS_13110 2868 1240 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_13110 2987 3061 gene locus_tag LOCUS_t00380 2987 3061 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 1825 80 gene locus_tag LOCUS_13120 1825 80 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979823.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence130 2377 617 gene locus_tag LOCUS_13130 2377 617 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence131 1175 243 gene locus_tag LOCUS_13140 1175 243 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_13140 1400 1185 gene locus_tag LOCUS_13150 1400 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1608 2174 gene locus_tag LOCUS_13160 1608 2174 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978556.1 protein_id gnl|my_center|LOCUS_13160 2179 2436 gene locus_tag LOCUS_13170 2179 2436 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870430.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence132 979 269 gene locus_tag LOCUS_13180 979 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2234 1836 gene locus_tag LOCUS_13190 2234 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2547 2404 gene locus_tag LOCUS_13200 2547 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence133 602 949 gene locus_tag LOCUS_13210 602 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846147.1 protein_id gnl|my_center|LOCUS_13210 951 1766 gene locus_tag LOCUS_13220 951 1766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 protein_id gnl|my_center|LOCUS_13220 1952 2434 gene locus_tag LOCUS_13230 1952 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <3000 2431 gene locus_tag LOCUS_13240 <3000 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978165.1:ATP-dependent DNA ligase >Feature sequence134 810 34 gene locus_tag LOCUS_13250 810 34 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979642.1 protein_id gnl|my_center|LOCUS_13250 1015 1335 gene locus_tag LOCUS_13260 1015 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1919 1389 gene locus_tag LOCUS_13270 1919 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2324 1932 gene locus_tag LOCUS_13280 2324 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence135 694 374 gene locus_tag LOCUS_13290 694 374 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061915.1 protein_id gnl|my_center|LOCUS_13290 910 1794 gene locus_tag LOCUS_13300 910 1794 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958069.1 protein_id gnl|my_center|LOCUS_13300 1849 2484 gene locus_tag LOCUS_13310 1849 2484 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence136 <2770 233 gene locus_tag LOCUS_13320 <2770 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584105.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence137 <2656 1765 gene locus_tag LOCUS_13330 <2656 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878993.1:DUF763 domain-containing protein >Feature sequence138 1551 346 gene locus_tag LOCUS_13340 1551 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence139 2364 442 gene locus_tag LOCUS_13350 2364 442 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence140 >Feature sequence141 <1 1145 gene locus_tag LOCUS_13360 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018306920.1:proton-conducting transporter membrane subunit 1661 1221 gene locus_tag LOCUS_13370 1661 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2027 1905 gene locus_tag LOCUS_13380 2027 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2386 2117 gene locus_tag LOCUS_13390 2386 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence142 1386 499 gene locus_tag LOCUS_13400 1386 499 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979238.1 protein_id gnl|my_center|LOCUS_13400 <2141 1527 gene locus_tag LOCUS_13410 <2141 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081856.1:DUF1015 domain-containing protein >Feature sequence143 326 1243 gene locus_tag LOCUS_13420 326 1243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_13420 1240 2019 gene locus_tag LOCUS_13430 1240 2019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence144 >Feature sequence145 173 1267 gene locus_tag LOCUS_13440 173 1267 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125103.1 protein_id gnl|my_center|LOCUS_13440