>Feature sequence001 665 591 gene locus_tag LOCUS_t00010 665 591 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1435 752 gene locus_tag LOCUS_00010 1435 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2274 1573 gene locus_tag LOCUS_00020 2274 1573 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084994.1 protein_id gnl|my_center|LOCUS_00020 2549 3541 gene locus_tag LOCUS_00030 gene cysD 2549 3541 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911471.1 protein_id gnl|my_center|LOCUS_00030 3543 4901 gene locus_tag LOCUS_00040 3543 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5431 4925 gene locus_tag LOCUS_00050 5431 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5650 6624 gene locus_tag LOCUS_00060 gene galT 5650 6624 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_00060 7690 6641 gene locus_tag LOCUS_00070 7690 6641 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_00070 9000 7738 gene locus_tag LOCUS_00080 9000 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10901 8997 gene locus_tag LOCUS_00090 gene treS 10901 8997 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897929.1 protein_id gnl|my_center|LOCUS_00090 11880 10888 gene locus_tag LOCUS_00100 gene meaB 11880 10888 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_00100 13259 11877 gene locus_tag LOCUS_00110 gene murA 13259 11877 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_00110 13352 14443 gene locus_tag LOCUS_00120 gene glpX 13352 14443 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_00120 14504 15913 gene locus_tag LOCUS_00130 14504 15913 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_00130 15964 17094 gene locus_tag LOCUS_00140 15964 17094 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_00140 17165 17476 gene locus_tag LOCUS_00150 17165 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17506 17937 gene locus_tag LOCUS_00160 17506 17937 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_00160 18517 18080 gene locus_tag LOCUS_00170 18517 18080 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_00170 20005 18926 gene locus_tag LOCUS_00180 20005 18926 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228266.1 protein_id gnl|my_center|LOCUS_00180 20273 21187 gene locus_tag LOCUS_00190 20273 21187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22001 21225 gene locus_tag LOCUS_00200 22001 21225 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_00200 22201 23559 gene locus_tag LOCUS_00210 gene gabT 22201 23559 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_00210 24332 24463 gene locus_tag LOCUS_00220 24332 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25926 24898 gene locus_tag LOCUS_00230 25926 24898 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206331.1 protein_id gnl|my_center|LOCUS_00230 26353 25958 gene locus_tag LOCUS_00240 26353 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27135 26395 gene locus_tag LOCUS_00250 27135 26395 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529873.1 protein_id gnl|my_center|LOCUS_00250 27964 27215 gene locus_tag LOCUS_00260 27964 27215 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_00260 28656 27994 gene locus_tag LOCUS_00270 28656 27994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29539 28667 gene locus_tag LOCUS_00280 29539 28667 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_00280 30377 29625 gene locus_tag LOCUS_00290 30377 29625 CDS product 4-pyridoxolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529871.1 protein_id gnl|my_center|LOCUS_00290 31373 30450 gene locus_tag LOCUS_00300 31373 30450 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505124.1 protein_id gnl|my_center|LOCUS_00300 33697 31370 gene locus_tag LOCUS_00310 33697 31370 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_00310 34185 33694 gene locus_tag LOCUS_00320 34185 33694 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720035.1 protein_id gnl|my_center|LOCUS_00320 34934 34182 gene locus_tag LOCUS_00330 34934 34182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35308 34931 gene locus_tag LOCUS_00340 35308 34931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36336 35305 gene locus_tag LOCUS_00350 36336 35305 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_00350 37394 36378 gene locus_tag LOCUS_00360 37394 36378 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_00360 38930 37476 gene locus_tag LOCUS_00370 38930 37476 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244111.1 protein_id gnl|my_center|LOCUS_00370 39666 39238 gene locus_tag LOCUS_00380 39666 39238 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_00380 39809 40162 gene locus_tag LOCUS_00390 39809 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41297 40311 gene locus_tag LOCUS_00400 41297 40311 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_00400 42587 41397 gene locus_tag LOCUS_00410 42587 41397 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110107.1 protein_id gnl|my_center|LOCUS_00410 43248 42598 gene locus_tag LOCUS_00420 43248 42598 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_00420 43752 45227 gene locus_tag LOCUS_00430 43752 45227 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_00430 45230 46159 gene locus_tag LOCUS_00440 45230 46159 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338663.1 protein_id gnl|my_center|LOCUS_00440 46167 47342 gene locus_tag LOCUS_00450 46167 47342 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_00450 47352 47855 gene locus_tag LOCUS_00460 47352 47855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47917 48360 gene locus_tag LOCUS_00470 47917 48360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48371 49645 gene locus_tag LOCUS_00480 48371 49645 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429682.1 protein_id gnl|my_center|LOCUS_00480 50336 49671 gene locus_tag LOCUS_00490 50336 49671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50711 51007 gene locus_tag LOCUS_00500 50711 51007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51064 51417 gene locus_tag LOCUS_00510 51064 51417 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898051.1 protein_id gnl|my_center|LOCUS_00510 54419 51525 gene locus_tag LOCUS_00520 54419 51525 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_00520 54710 57631 gene locus_tag LOCUS_00530 54710 57631 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224374.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence002 <1 507 gene locus_tag LOCUS_00540 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816113.1:NIF family HAD-type phosphatase 2162 498 gene locus_tag LOCUS_00550 gene lnt 2162 498 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168162531.1 protein_id gnl|my_center|LOCUS_00550 3349 2195 gene locus_tag LOCUS_00560 gene pcaD 3349 2195 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_00560 3405 3626 gene locus_tag LOCUS_00570 3405 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4304 3711 gene locus_tag LOCUS_00580 4304 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4600 4301 gene locus_tag LOCUS_00590 4600 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4884 5567 gene locus_tag LOCUS_00600 4884 5567 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170153456.1 protein_id gnl|my_center|LOCUS_00600 5564 7087 gene locus_tag LOCUS_00610 5564 7087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_00610 7426 7821 gene locus_tag LOCUS_00620 7426 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 9928 8039 gene locus_tag LOCUS_00630 9928 8039 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_00630 11020 10148 gene locus_tag LOCUS_00640 11020 10148 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_00640 12068 11163 gene locus_tag LOCUS_00650 12068 11163 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_00650 12708 12202 gene locus_tag LOCUS_00660 12708 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 13363 13214 gene locus_tag LOCUS_00670 13363 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 14998 13511 gene locus_tag LOCUS_00680 gene hemG 14998 13511 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_00680 15987 14995 gene locus_tag LOCUS_00690 gene hemH 15987 14995 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 protein_id gnl|my_center|LOCUS_00690 17132 16023 gene locus_tag LOCUS_00700 gene hemE 17132 16023 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_00700 17274 19652 gene locus_tag LOCUS_00710 17274 19652 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_00710 19809 20360 gene locus_tag LOCUS_00720 19809 20360 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907992.1 protein_id gnl|my_center|LOCUS_00720 20371 21357 gene locus_tag LOCUS_00730 20371 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 21383 22426 gene locus_tag LOCUS_00740 21383 22426 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_00740 22473 24044 gene locus_tag LOCUS_00750 22473 24044 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_00750 25167 24037 gene locus_tag LOCUS_00760 25167 24037 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 protein_id gnl|my_center|LOCUS_00760 25730 25293 gene locus_tag LOCUS_00770 25730 25293 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971910.1 protein_id gnl|my_center|LOCUS_00770 27547 25727 gene locus_tag LOCUS_00780 gene ctaD 27547 25727 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908511.1 protein_id gnl|my_center|LOCUS_00780 28359 27544 gene locus_tag LOCUS_00790 28359 27544 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_00790 28889 28695 gene locus_tag LOCUS_00800 28889 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 29789 29016 gene locus_tag LOCUS_00810 29789 29016 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_00810 29958 31355 gene locus_tag LOCUS_00820 29958 31355 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143220.1 protein_id gnl|my_center|LOCUS_00820 31367 33916 gene locus_tag LOCUS_00830 31367 33916 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141534.1 protein_id gnl|my_center|LOCUS_00830 34748 33936 gene locus_tag LOCUS_00840 34748 33936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 35695 34745 gene locus_tag LOCUS_00850 35695 34745 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_00850 36015 35683 gene locus_tag LOCUS_00860 36015 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 37999 36086 gene locus_tag LOCUS_00870 37999 36086 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805057.1 protein_id gnl|my_center|LOCUS_00870 39009 38005 gene locus_tag LOCUS_00880 gene hpnH 39009 38005 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_00880 40568 39009 gene locus_tag LOCUS_00890 40568 39009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 42534 40561 gene locus_tag LOCUS_00900 gene shc 42534 40561 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_00900 43564 42548 gene locus_tag LOCUS_00910 43564 42548 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_00910 44934 43561 gene locus_tag LOCUS_00920 gene hpnE 44934 43561 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_00920 45839 44952 gene locus_tag LOCUS_00930 gene hpnD 45839 44952 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_00930 46771 45836 gene locus_tag LOCUS_00940 gene hpnC 46771 45836 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_00940 47462 47956 gene locus_tag LOCUS_00950 47462 47956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 48027 49157 gene locus_tag LOCUS_00960 48027 49157 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_00960 49154 49495 gene locus_tag LOCUS_00970 49154 49495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 49492 50922 gene locus_tag LOCUS_00980 49492 50922 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_00980 50998 51519 gene locus_tag LOCUS_00990 50998 51519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 51786 51574 gene locus_tag LOCUS_01000 51786 51574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 51691 53199 gene locus_tag LOCUS_01010 51691 53199 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727618.1 protein_id gnl|my_center|LOCUS_01010 53712 53239 gene locus_tag LOCUS_01020 53712 53239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 53802 54050 gene locus_tag LOCUS_01030 53802 54050 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_01030 54058 55539 gene locus_tag LOCUS_01040 gene gltX 54058 55539 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_01040 55549 56292 gene locus_tag LOCUS_01050 55549 56292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 56303 56375 gene locus_tag LOCUS_t00020 56303 56375 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56407 56482 gene locus_tag LOCUS_t00030 56407 56482 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 56626 57921 gene locus_tag LOCUS_01060 56626 57921 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228388.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence003 2234 3034 gene locus_tag LOCUS_01070 2234 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2964 4733 gene locus_tag LOCUS_01080 2964 4733 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731469.1 protein_id gnl|my_center|LOCUS_01080 4730 5161 gene locus_tag LOCUS_01090 4730 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5272 5347 gene locus_tag LOCUS_t00040 5272 5347 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5648 6253 gene locus_tag LOCUS_01100 5648 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01100 6254 6664 gene locus_tag LOCUS_01110 6254 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6816 6586 gene locus_tag LOCUS_01120 6816 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 6830 7312 gene locus_tag LOCUS_01130 6830 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7272 7565 gene locus_tag LOCUS_01140 7272 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8027 7677 gene locus_tag LOCUS_01150 8027 7677 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_01150 8416 10323 gene locus_tag LOCUS_01160 8416 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10474 10797 gene locus_tag LOCUS_01170 10474 10797 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229671.1 protein_id gnl|my_center|LOCUS_01170 10794 11114 gene locus_tag LOCUS_01180 10794 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 11111 11575 gene locus_tag LOCUS_01190 11111 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 12465 11731 gene locus_tag LOCUS_01200 12465 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230003.1 protein_id gnl|my_center|LOCUS_01200 14161 12632 gene locus_tag LOCUS_01210 14161 12632 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230428.1 protein_id gnl|my_center|LOCUS_01210 14617 14369 gene locus_tag LOCUS_01220 14617 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 15289 15633 gene locus_tag LOCUS_01230 15289 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 16287 16664 gene locus_tag LOCUS_01240 16287 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 17058 17804 gene locus_tag LOCUS_01250 17058 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18145 17963 gene locus_tag LOCUS_01260 18145 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 18405 19187 gene locus_tag LOCUS_01270 18405 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 19761 19414 gene locus_tag LOCUS_01280 19761 19414 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_01280 19785 20345 gene locus_tag LOCUS_01290 19785 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 20726 20457 gene locus_tag LOCUS_01300 20726 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 21010 20738 gene locus_tag LOCUS_01310 21010 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 21816 21058 gene locus_tag LOCUS_01320 21816 21058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01320 22673 22143 gene locus_tag LOCUS_01330 22673 22143 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_01330 23196 22897 gene locus_tag LOCUS_01340 23196 22897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 24488 23403 gene locus_tag LOCUS_01350 24488 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 24792 24451 gene locus_tag LOCUS_01360 24792 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 25034 24837 gene locus_tag LOCUS_01370 25034 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 25280 25633 gene locus_tag LOCUS_01380 25280 25633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 26085 25603 gene locus_tag LOCUS_01390 26085 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 26806 26141 gene locus_tag LOCUS_01400 26806 26141 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223072.1 protein_id gnl|my_center|LOCUS_01400 27549 26830 gene locus_tag LOCUS_01410 27549 26830 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112978.1 protein_id gnl|my_center|LOCUS_01410 28165 27542 gene locus_tag LOCUS_01420 28165 27542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 28680 28231 gene locus_tag LOCUS_01430 28680 28231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 29177 30016 gene locus_tag LOCUS_01440 29177 30016 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_01440 30013 30525 gene locus_tag LOCUS_01450 30013 30525 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722429.1 protein_id gnl|my_center|LOCUS_01450 30533 31273 gene locus_tag LOCUS_01460 30533 31273 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091866.1 protein_id gnl|my_center|LOCUS_01460 31763 31317 gene locus_tag LOCUS_01470 31763 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 32367 32104 gene locus_tag LOCUS_01480 32367 32104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 33811 32453 gene locus_tag LOCUS_01490 33811 32453 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026898.1 protein_id gnl|my_center|LOCUS_01490 33932 34774 gene locus_tag LOCUS_01500 33932 34774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 36019 37770 gene locus_tag LOCUS_01510 36019 37770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 38749 38078 gene locus_tag LOCUS_01520 38749 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 38890 39294 gene locus_tag LOCUS_01530 38890 39294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 39291 41078 gene locus_tag LOCUS_01540 39291 41078 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031655.1 protein_id gnl|my_center|LOCUS_01540 41317 42615 gene locus_tag LOCUS_01550 41317 42615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763694.1 protein_id gnl|my_center|LOCUS_01550 42839 43891 gene locus_tag LOCUS_01560 42839 43891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 44537 44463 gene locus_tag LOCUS_t00050 44537 44463 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44788 44633 gene locus_tag LOCUS_01570 44788 44633 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_01570 45004 46467 gene locus_tag LOCUS_01580 gene tig 45004 46467 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_01580 46464 47114 gene locus_tag LOCUS_01590 gene clpP 46464 47114 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_01590 47225 48508 gene locus_tag LOCUS_01600 gene clpX 47225 48508 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_01600 48528 49868 gene locus_tag LOCUS_01610 48528 49868 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_01610 49962 50354 gene locus_tag LOCUS_01620 gene ndk 49962 50354 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_01620 50495 51526 gene locus_tag LOCUS_01630 50495 51526 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_01630 51549 52400 gene locus_tag LOCUS_01640 gene mreC 51549 52400 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815203.1 protein_id gnl|my_center|LOCUS_01640 52417 52935 gene locus_tag LOCUS_01650 52417 52935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 53052 55454 gene locus_tag LOCUS_01660 gene mrdA 53052 55454 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_01660 55467 57467 gene locus_tag LOCUS_01670 55467 57467 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence004 100 1125 gene locus_tag LOCUS_01680 100 1125 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_01680 2056 1154 gene locus_tag LOCUS_01690 2056 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2864 2061 gene locus_tag LOCUS_01700 2864 2061 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014887.1 protein_id gnl|my_center|LOCUS_01700 3889 2867 gene locus_tag LOCUS_01710 3889 2867 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 protein_id gnl|my_center|LOCUS_01710 5028 3922 gene locus_tag LOCUS_01720 gene iolX 5028 3922 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_01720 5867 5028 gene locus_tag LOCUS_01730 5867 5028 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339533.1 protein_id gnl|my_center|LOCUS_01730 7011 5869 gene locus_tag LOCUS_01740 7011 5869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 protein_id gnl|my_center|LOCUS_01740 8243 7116 gene locus_tag LOCUS_01750 8243 7116 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967117.1 protein_id gnl|my_center|LOCUS_01750 9265 8303 gene locus_tag LOCUS_01760 9265 8303 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896035.1 protein_id gnl|my_center|LOCUS_01760 10533 9439 gene locus_tag LOCUS_01770 10533 9439 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_01770 12539 10656 gene locus_tag LOCUS_01780 gene iolD 12539 10656 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_01780 13432 12536 gene locus_tag LOCUS_01790 gene iolB 13432 12536 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_01790 14358 13429 gene locus_tag LOCUS_01800 14358 13429 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764417.1 protein_id gnl|my_center|LOCUS_01800 15536 14355 gene locus_tag LOCUS_01810 15536 14355 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_01810 17502 15553 gene locus_tag LOCUS_01820 gene iolC 17502 15553 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919175.1 protein_id gnl|my_center|LOCUS_01820 18557 17775 gene locus_tag LOCUS_01830 18557 17775 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972171.1 protein_id gnl|my_center|LOCUS_01830 18946 18674 gene locus_tag LOCUS_01840 18946 18674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01840 19995 19219 gene locus_tag LOCUS_01850 gene trpA 19995 19219 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_01850 21236 19992 gene locus_tag LOCUS_01860 gene trpB 21236 19992 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_01860 22099 21233 gene locus_tag LOCUS_01870 22099 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 22957 22118 gene locus_tag LOCUS_01880 gene trpC 22957 22118 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_01880 24040 23081 gene locus_tag LOCUS_01890 24040 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 25620 24037 gene locus_tag LOCUS_01900 gene trpE 25620 24037 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826697.1 protein_id gnl|my_center|LOCUS_01900 26030 25620 gene locus_tag LOCUS_01910 26030 25620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 26338 26045 gene locus_tag LOCUS_01920 26338 26045 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_01920 26343 26504 gene locus_tag LOCUS_01930 26343 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 26501 27352 gene locus_tag LOCUS_01940 26501 27352 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_01940 28161 27394 gene locus_tag LOCUS_01950 gene hisF 28161 27394 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_01950 28904 28143 gene locus_tag LOCUS_01960 gene hisA 28904 28143 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_01960 29485 28904 gene locus_tag LOCUS_01970 gene hisH 29485 28904 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_01970 30165 29545 gene locus_tag LOCUS_01980 gene hisB 30165 29545 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_01980 31235 30162 gene locus_tag LOCUS_01990 31235 30162 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_01990 32539 31232 gene locus_tag LOCUS_02000 gene hisD 32539 31232 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_02000 32603 32920 gene locus_tag LOCUS_02010 32603 32920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 33362 32970 gene locus_tag LOCUS_02020 33362 32970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 33628 33359 gene locus_tag LOCUS_02030 33628 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 34590 33913 gene locus_tag LOCUS_02040 gene nth 34590 33913 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_02040 34608 35615 gene locus_tag LOCUS_02050 gene mshD 34608 35615 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_02050 36322 35579 gene locus_tag LOCUS_02060 36322 35579 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_02060 36427 36726 gene locus_tag LOCUS_02070 36427 36726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 38995 36878 gene locus_tag LOCUS_02080 38995 36878 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_02080 39423 39881 gene locus_tag LOCUS_02090 39423 39881 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_02090 39878 40585 gene locus_tag LOCUS_02100 gene ubiE 39878 40585 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_02100 40582 42033 gene locus_tag LOCUS_02110 40582 42033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 43513 41978 gene locus_tag LOCUS_02120 43513 41978 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_02120 44215 43523 gene locus_tag LOCUS_02130 44215 43523 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_02130 44988 44212 gene locus_tag LOCUS_02140 44988 44212 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_02140 45097 46305 gene locus_tag LOCUS_02150 45097 46305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 48660 46333 gene locus_tag LOCUS_02160 48660 46333 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_02160 48767 50104 gene locus_tag LOCUS_02170 48767 50104 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 protein_id gnl|my_center|LOCUS_02170 50792 50205 gene locus_tag LOCUS_02180 50792 50205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 51997 50798 gene locus_tag LOCUS_02190 gene rodA 51997 50798 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_02190 52833 52003 gene locus_tag LOCUS_02200 52833 52003 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_02200 53900 52884 gene locus_tag LOCUS_02210 gene mltG 53900 52884 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02210 54433 54011 gene locus_tag LOCUS_02220 gene ruvX 54433 54011 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057628.1 protein_id gnl|my_center|LOCUS_02220 54564 54430 gene locus_tag LOCUS_02230 54564 54430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 55354 54884 gene locus_tag LOCUS_02240 55354 54884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 55589 56377 gene locus_tag LOCUS_02250 55589 56377 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_02250 <57325 56447 gene locus_tag LOCUS_02260 <57325 56447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894402.1:replication-associated recombination protein A >Feature sequence005 2917 1838 gene locus_tag LOCUS_02270 2917 1838 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_02270 3155 3757 gene locus_tag LOCUS_02280 3155 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4771 3767 gene locus_tag LOCUS_02290 4771 3767 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_02290 4959 5978 gene locus_tag LOCUS_02300 4959 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5989 7155 gene locus_tag LOCUS_02310 5989 7155 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_02310 7517 7236 gene locus_tag LOCUS_02320 7517 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 7683 7940 gene locus_tag LOCUS_02330 7683 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7968 8888 gene locus_tag LOCUS_02340 gene ftcD 7968 8888 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_02340 9179 8898 gene locus_tag LOCUS_02350 9179 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 11384 9381 gene locus_tag LOCUS_02360 11384 9381 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_02360 12864 11386 gene locus_tag LOCUS_02370 12864 11386 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_02370 12986 13813 gene locus_tag LOCUS_02380 12986 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_02380 13829 15643 gene locus_tag LOCUS_02390 13829 15643 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_02390 15643 16611 gene locus_tag LOCUS_02400 15643 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 16623 17030 gene locus_tag LOCUS_02410 16623 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 17102 17323 gene locus_tag LOCUS_02420 17102 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 18386 17388 gene locus_tag LOCUS_02430 18386 17388 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_02430 19396 18425 gene locus_tag LOCUS_02440 19396 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 19553 21853 gene locus_tag LOCUS_02450 19553 21853 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_02450 22740 21862 gene locus_tag LOCUS_02460 22740 21862 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_02460 23604 22750 gene locus_tag LOCUS_02470 23604 22750 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222732.1 protein_id gnl|my_center|LOCUS_02470 25103 23601 gene locus_tag LOCUS_02480 gene purH 25103 23601 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_02480 25696 25100 gene locus_tag LOCUS_02490 gene purN 25696 25100 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919571.1 protein_id gnl|my_center|LOCUS_02490 26604 25714 gene locus_tag LOCUS_02500 gene sucD 26604 25714 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_02500 27800 26601 gene locus_tag LOCUS_02510 gene sucC 27800 26601 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_02510 28278 27862 gene locus_tag LOCUS_02520 28278 27862 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_02520 29454 28360 gene locus_tag LOCUS_02530 29454 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 29507 30118 gene locus_tag LOCUS_02540 29507 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 32476 30311 gene locus_tag LOCUS_02550 gene pcrA 32476 30311 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_02550 33690 32527 gene locus_tag LOCUS_02560 33690 32527 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_02560 34519 33839 gene locus_tag LOCUS_02570 34519 33839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 36182 34539 gene locus_tag LOCUS_02580 gene groL 36182 34539 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_02580 36563 36270 gene locus_tag LOCUS_02590 gene groES 36563 36270 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_02590 37690 36617 gene locus_tag LOCUS_02600 gene rlmN 37690 36617 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_02600 38679 37687 gene locus_tag LOCUS_02610 gene tsaD 38679 37687 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082750.1 protein_id gnl|my_center|LOCUS_02610 39179 38676 gene locus_tag LOCUS_02620 gene rimI 39179 38676 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_02620 39850 39176 gene locus_tag LOCUS_02630 gene tsaB 39850 39176 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_02630 40340 39864 gene locus_tag LOCUS_02640 gene tsaE 40340 39864 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_02640 41487 40363 gene locus_tag LOCUS_02650 41487 40363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 42493 41549 gene locus_tag LOCUS_02660 42493 41549 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_02660 43653 42490 gene locus_tag LOCUS_02670 gene alr 43653 42490 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143807.1 protein_id gnl|my_center|LOCUS_02670 45040 43646 gene locus_tag LOCUS_02680 45040 43646 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727745.1 protein_id gnl|my_center|LOCUS_02680 45411 45043 gene locus_tag LOCUS_02690 45411 45043 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_02690 47243 45408 gene locus_tag LOCUS_02700 gene glmS 47243 45408 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_02700 48573 47254 gene locus_tag LOCUS_02710 gene glmM 48573 47254 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_02710 48970 48578 gene locus_tag LOCUS_02720 gene rpsI 48970 48578 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_02720 49422 48973 gene locus_tag LOCUS_02730 gene rplM 49422 48973 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_02730 50294 49554 gene locus_tag LOCUS_02740 50294 49554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 50791 50468 gene locus_tag LOCUS_02750 50791 50468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 51764 50826 gene locus_tag LOCUS_02760 51764 50826 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_02760 52432 51785 gene locus_tag LOCUS_02770 gene rpsD 52432 51785 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_02770 52850 52443 gene locus_tag LOCUS_02780 gene rpsK 52850 52443 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_02780 53228 52851 gene locus_tag LOCUS_02790 gene rpsM 53228 52851 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105472.1 protein_id gnl|my_center|LOCUS_02790 53719 53381 gene locus_tag LOCUS_02800 53719 53381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 54488 53748 gene locus_tag LOCUS_02810 gene map 54488 53748 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence006 349 1 gene locus_tag LOCUS_tm00010 349 1 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 984 457 gene locus_tag LOCUS_02820 gene smpB 984 457 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907868.1 protein_id gnl|my_center|LOCUS_02820 1089 1526 gene locus_tag LOCUS_02830 1089 1526 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_02830 1737 2018 gene locus_tag LOCUS_02840 1737 2018 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259328.1 protein_id gnl|my_center|LOCUS_02840 2038 3003 gene locus_tag LOCUS_02850 2038 3003 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_02850 3055 3702 gene locus_tag LOCUS_02860 3055 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3699 4472 gene locus_tag LOCUS_02870 gene rph 3699 4472 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_02870 4469 5104 gene locus_tag LOCUS_02880 4469 5104 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_02880 6458 5484 gene locus_tag LOCUS_02890 6458 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7575 6469 gene locus_tag LOCUS_02900 7575 6469 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_02900 7662 7579 gene locus_tag LOCUS_t00060 7662 7579 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7704 8315 gene locus_tag LOCUS_02910 gene clpP1 7704 8315 CDS product ATP-dependent CLP protease proteolytic subunit ClpP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111481034.1 protein_id gnl|my_center|LOCUS_02910 8318 9304 gene locus_tag LOCUS_02920 8318 9304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776099.1 protein_id gnl|my_center|LOCUS_02920 9306 10745 gene locus_tag LOCUS_02930 9306 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10742 11713 gene locus_tag LOCUS_02940 10742 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11723 13018 gene locus_tag LOCUS_02950 11723 13018 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695838.1 protein_id gnl|my_center|LOCUS_02950 13077 14102 gene locus_tag LOCUS_02960 13077 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 14099 15394 gene locus_tag LOCUS_02970 14099 15394 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_02970 15440 15679 gene locus_tag LOCUS_02980 15440 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 15813 16286 gene locus_tag LOCUS_02990 15813 16286 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_02990 16283 18682 gene locus_tag LOCUS_03000 16283 18682 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_03000 18679 19506 gene locus_tag LOCUS_03010 18679 19506 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_03010 19499 20473 gene locus_tag LOCUS_03020 19499 20473 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_03020 20476 21696 gene locus_tag LOCUS_03030 20476 21696 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_03030 21693 22847 gene locus_tag LOCUS_03040 21693 22847 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_03040 22920 23570 gene locus_tag LOCUS_03050 22920 23570 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978539.1 protein_id gnl|my_center|LOCUS_03050 23561 24325 gene locus_tag LOCUS_03060 23561 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 25486 24371 gene locus_tag LOCUS_03070 gene moaA 25486 24371 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_03070 26119 25589 gene locus_tag LOCUS_03080 26119 25589 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_03080 27268 26258 gene locus_tag LOCUS_03090 27268 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 28253 28178 gene locus_tag LOCUS_t00070 28253 28178 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 28819 28430 gene locus_tag LOCUS_03100 28819 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 28952 29027 gene locus_tag LOCUS_t00080 28952 29027 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30538 28997 gene locus_tag LOCUS_03110 30538 28997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 31693 30857 gene locus_tag LOCUS_03120 31693 30857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 32531 31683 gene locus_tag LOCUS_03130 32531 31683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 32780 33286 gene locus_tag LOCUS_03140 32780 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 33657 34508 gene locus_tag LOCUS_03150 33657 34508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34510 35010 gene locus_tag LOCUS_03160 34510 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 35013 36281 gene locus_tag LOCUS_03170 35013 36281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 36278 37276 gene locus_tag LOCUS_03180 36278 37276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 37273 39006 gene locus_tag LOCUS_03190 37273 39006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 39051 41765 gene locus_tag LOCUS_03200 39051 41765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 42140 41916 gene locus_tag LOCUS_03210 42140 41916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 42063 42794 gene locus_tag LOCUS_03220 42063 42794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 42791 43765 gene locus_tag LOCUS_03230 42791 43765 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_03230 43880 44269 gene locus_tag LOCUS_03240 43880 44269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 44849 44298 gene locus_tag LOCUS_03250 44849 44298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 47668 44846 gene locus_tag LOCUS_03260 47668 44846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 48096 47665 gene locus_tag LOCUS_03270 48096 47665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 48533 48093 gene locus_tag LOCUS_03280 48533 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 48991 48530 gene locus_tag LOCUS_03290 48991 48530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 49706 49503 gene locus_tag LOCUS_03300 49706 49503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 49973 51061 gene locus_tag LOCUS_03310 gene xerC 49973 51061 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459099.1 protein_id gnl|my_center|LOCUS_03310 51066 51383 gene locus_tag LOCUS_03320 51066 51383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 51380 53074 gene locus_tag LOCUS_03330 51380 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence007 508 152 gene locus_tag LOCUS_03340 508 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 777 1055 gene locus_tag LOCUS_03350 777 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2610 1153 gene locus_tag LOCUS_03360 2610 1153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_03360 2999 2712 gene locus_tag LOCUS_03370 2999 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3280 2996 gene locus_tag LOCUS_03380 3280 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3537 3304 gene locus_tag LOCUS_03390 3537 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4407 4075 gene locus_tag LOCUS_03400 4407 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5809 4604 gene locus_tag LOCUS_03410 5809 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 7029 5806 gene locus_tag LOCUS_03420 7029 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7910 7047 gene locus_tag LOCUS_03430 7910 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8968 7916 gene locus_tag LOCUS_03440 8968 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9240 9812 gene locus_tag LOCUS_03450 9240 9812 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_03450 9813 11573 gene locus_tag LOCUS_03460 9813 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 12781 11603 gene locus_tag LOCUS_03470 12781 11603 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_03470 12903 13418 gene locus_tag LOCUS_03480 12903 13418 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_03480 13557 15437 gene locus_tag LOCUS_03490 13557 15437 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_03490 15651 16601 gene locus_tag LOCUS_03500 15651 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 17859 16678 gene locus_tag LOCUS_03510 17859 16678 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125903.1 protein_id gnl|my_center|LOCUS_03510 18599 17856 gene locus_tag LOCUS_03520 18599 17856 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062048.1 protein_id gnl|my_center|LOCUS_03520 19741 18635 gene locus_tag LOCUS_03530 19741 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 20479 20811 gene locus_tag LOCUS_03540 20479 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 20808 21683 gene locus_tag LOCUS_03550 20808 21683 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_03550 21683 22627 gene locus_tag LOCUS_03560 21683 22627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22644 23480 gene locus_tag LOCUS_03570 22644 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 23903 23520 gene locus_tag LOCUS_03580 23903 23520 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256033.1 protein_id gnl|my_center|LOCUS_03580 24039 24110 gene locus_tag LOCUS_t00090 24039 24110 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24304 26145 gene locus_tag LOCUS_03590 gene thiC 24304 26145 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_03590 26746 26195 gene locus_tag LOCUS_03600 26746 26195 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_03600 26839 27756 gene locus_tag LOCUS_03610 26839 27756 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_03610 29861 27810 gene locus_tag LOCUS_03620 29861 27810 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_03620 30150 29902 gene locus_tag LOCUS_03630 30150 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 30703 30161 gene locus_tag LOCUS_03640 30703 30161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 31198 30794 gene locus_tag LOCUS_03650 31198 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03650 31710 31183 gene locus_tag LOCUS_03660 31710 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03660 32740 31991 gene locus_tag LOCUS_03670 32740 31991 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_03670 33141 32809 gene locus_tag LOCUS_03680 33141 32809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 33169 33975 gene locus_tag LOCUS_03690 33169 33975 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 33927 34604 gene locus_tag LOCUS_03700 33927 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 34633 35346 gene locus_tag LOCUS_03710 34633 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 35397 36626 gene locus_tag LOCUS_03720 35397 36626 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417126.1 protein_id gnl|my_center|LOCUS_03720 36623 37165 gene locus_tag LOCUS_03730 gene purE 36623 37165 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907900.1 protein_id gnl|my_center|LOCUS_03730 37170 38006 gene locus_tag LOCUS_03740 37170 38006 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_03740 39064 38114 gene locus_tag LOCUS_03750 gene mca 39064 38114 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_03750 39288 40346 gene locus_tag LOCUS_03760 39288 40346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 40343 41296 gene locus_tag LOCUS_03770 gene htpX 40343 41296 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_03770 41349 41993 gene locus_tag LOCUS_03780 41349 41993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_03780 42007 42837 gene locus_tag LOCUS_03790 42007 42837 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_03790 43072 42776 gene locus_tag LOCUS_03800 43072 42776 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_03800 <44388 43069 gene locus_tag LOCUS_03810 <44388 43069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948622.1:class II fumarate hydratase >Feature sequence008 943 164 gene locus_tag LOCUS_03820 943 164 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_03820 1204 1554 gene locus_tag LOCUS_03830 1204 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3074 1584 gene locus_tag LOCUS_03840 3074 1584 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_03840 3985 3071 gene locus_tag LOCUS_03850 3985 3071 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809790.1 protein_id gnl|my_center|LOCUS_03850 5241 4090 gene locus_tag LOCUS_03860 5241 4090 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_03860 6392 5412 gene locus_tag LOCUS_03870 6392 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6651 6418 gene locus_tag LOCUS_03880 6651 6418 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013877.1 protein_id gnl|my_center|LOCUS_03880 6860 7930 gene locus_tag LOCUS_03890 6860 7930 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_03890 9264 7981 gene locus_tag LOCUS_03900 9264 7981 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_03900 9390 10673 gene locus_tag LOCUS_03910 9390 10673 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_03910 11344 10724 gene locus_tag LOCUS_03920 11344 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12662 11481 gene locus_tag LOCUS_03930 12662 11481 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074275.1 protein_id gnl|my_center|LOCUS_03930 12891 13481 gene locus_tag LOCUS_03940 12891 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 13652 14653 gene locus_tag LOCUS_03950 gene nifS 13652 14653 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670052.1 protein_id gnl|my_center|LOCUS_03950 15201 14719 gene locus_tag LOCUS_03960 15201 14719 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_03960 16140 15214 gene locus_tag LOCUS_03970 16140 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 16595 16137 gene locus_tag LOCUS_03980 16595 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 17239 16604 gene locus_tag LOCUS_03990 17239 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 19365 17236 gene locus_tag LOCUS_04000 19365 17236 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_04000 19685 19365 gene locus_tag LOCUS_04010 19685 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 20014 19844 gene locus_tag LOCUS_04020 20014 19844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 20865 20011 gene locus_tag LOCUS_04030 20865 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 21530 20862 gene locus_tag LOCUS_04040 21530 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 22239 21520 gene locus_tag LOCUS_04050 22239 21520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_04050 23221 22289 gene locus_tag LOCUS_04060 23221 22289 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085573.1 protein_id gnl|my_center|LOCUS_04060 24204 23230 gene locus_tag LOCUS_04070 gene gmd 24204 23230 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_04070 24322 25377 gene locus_tag LOCUS_04080 24322 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 25504 26076 gene locus_tag LOCUS_04090 25504 26076 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416861.1 protein_id gnl|my_center|LOCUS_04090 26057 26719 gene locus_tag LOCUS_04100 26057 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 30266 26649 gene locus_tag LOCUS_04110 30266 26649 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_04110 31675 30494 gene locus_tag LOCUS_04120 31675 30494 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_04120 32750 31767 gene locus_tag LOCUS_04130 32750 31767 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_04130 34785 32752 gene locus_tag LOCUS_04140 34785 32752 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_04140 36419 34788 gene locus_tag LOCUS_04150 36419 34788 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_04150 36473 37078 gene locus_tag LOCUS_04160 36473 37078 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_04160 37822 37124 gene locus_tag LOCUS_04170 37822 37124 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_04170 38604 37819 gene locus_tag LOCUS_04180 38604 37819 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_04180 38925 39533 gene locus_tag LOCUS_04190 38925 39533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 39806 41695 gene locus_tag LOCUS_04200 39806 41695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence009 591 286 gene locus_tag LOCUS_04210 591 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 1762 1136 gene locus_tag LOCUS_04220 1762 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2939 2508 gene locus_tag LOCUS_04230 2939 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 3199 4101 gene locus_tag LOCUS_04240 3199 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4681 4412 gene locus_tag LOCUS_04250 4681 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5927 5289 gene locus_tag LOCUS_04260 5927 5289 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_04260 6164 8269 gene locus_tag LOCUS_04270 gene acs 6164 8269 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950924.1 protein_id gnl|my_center|LOCUS_04270 8816 8244 gene locus_tag LOCUS_04280 8816 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 9000 10064 gene locus_tag LOCUS_04290 gene pdhA 9000 10064 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_04290 10075 11121 gene locus_tag LOCUS_04300 10075 11121 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_04300 11171 11404 gene locus_tag LOCUS_04310 11171 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11433 12329 gene locus_tag LOCUS_04320 11433 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 13199 12975 gene locus_tag LOCUS_04330 13199 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 13380 15095 gene locus_tag LOCUS_04340 13380 15095 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_04340 15124 17208 gene locus_tag LOCUS_04350 15124 17208 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_04350 17205 20531 gene locus_tag LOCUS_04360 gene treS 17205 20531 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_04360 20528 22465 gene locus_tag LOCUS_04370 gene malQ 20528 22465 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542051.1 protein_id gnl|my_center|LOCUS_04370 22462 24333 gene locus_tag LOCUS_04380 gene glgB 22462 24333 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_04380 24952 24377 gene locus_tag LOCUS_04390 24952 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 25949 25032 gene locus_tag LOCUS_04400 25949 25032 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 protein_id gnl|my_center|LOCUS_04400 26755 25985 gene locus_tag LOCUS_04410 26755 25985 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 protein_id gnl|my_center|LOCUS_04410 28170 26764 gene locus_tag LOCUS_04420 28170 26764 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_04420 29113 28163 gene locus_tag LOCUS_04430 29113 28163 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_04430 29408 29157 gene locus_tag LOCUS_04440 29408 29157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 30241 29405 gene locus_tag LOCUS_04450 30241 29405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 30420 30238 gene locus_tag LOCUS_04460 30420 30238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 30573 31346 gene locus_tag LOCUS_04470 gene dapA 30573 31346 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_04470 31999 31319 gene locus_tag LOCUS_04480 31999 31319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 32146 32814 gene locus_tag LOCUS_04490 32146 32814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 protein_id gnl|my_center|LOCUS_04490 32811 34145 gene locus_tag LOCUS_04500 32811 34145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 34269 35711 gene locus_tag LOCUS_04510 34269 35711 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_04510 35820 36590 gene locus_tag LOCUS_04520 35820 36590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 36717 37226 gene locus_tag LOCUS_04530 36717 37226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 37231 37635 gene locus_tag LOCUS_04540 37231 37635 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104445.1 protein_id gnl|my_center|LOCUS_04540 37736 37933 gene locus_tag LOCUS_04550 37736 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 37952 39115 gene locus_tag LOCUS_04560 37952 39115 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_04560 39154 39600 gene locus_tag LOCUS_04570 39154 39600 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_04570 39605 40681 gene locus_tag LOCUS_04580 39605 40681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 40701 41381 gene locus_tag LOCUS_04590 40701 41381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence010 <1 1204 gene locus_tag LOCUS_04600 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932852.1:leucyl aminopeptidase 1243 1320 gene locus_tag LOCUS_t00100 1243 1320 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1599 2495 gene locus_tag LOCUS_04610 1599 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3142 2543 gene locus_tag LOCUS_04620 3142 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4515 3139 gene locus_tag LOCUS_04630 4515 3139 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_04630 5156 4512 gene locus_tag LOCUS_04640 5156 4512 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_04640 5513 6370 gene locus_tag LOCUS_04650 5513 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6542 7579 gene locus_tag LOCUS_04660 6542 7579 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_04660 7643 8719 gene locus_tag LOCUS_04670 7643 8719 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_04670 8720 10102 gene locus_tag LOCUS_04680 8720 10102 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_04680 10108 10989 gene locus_tag LOCUS_04690 10108 10989 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_04690 11039 12133 gene locus_tag LOCUS_04700 11039 12133 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_04700 12130 12942 gene locus_tag LOCUS_04710 12130 12942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083875.1 protein_id gnl|my_center|LOCUS_04710 12923 13735 gene locus_tag LOCUS_04720 12923 13735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 protein_id gnl|my_center|LOCUS_04720 14826 13732 gene locus_tag LOCUS_04730 14826 13732 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226914.1 protein_id gnl|my_center|LOCUS_04730 14975 16006 gene locus_tag LOCUS_04740 gene pdhA 14975 16006 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_04740 15973 16968 gene locus_tag LOCUS_04750 15973 16968 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606051.1 protein_id gnl|my_center|LOCUS_04750 17688 17050 gene locus_tag LOCUS_04760 17688 17050 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_04760 17783 18940 gene locus_tag LOCUS_04770 gene moeB 17783 18940 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_04770 19049 19672 gene locus_tag LOCUS_04780 19049 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19686 20459 gene locus_tag LOCUS_04790 19686 20459 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 protein_id gnl|my_center|LOCUS_04790 20456 20854 gene locus_tag LOCUS_04800 20456 20854 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_04800 20856 22427 gene locus_tag LOCUS_04810 20856 22427 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257910.1 protein_id gnl|my_center|LOCUS_04810 22424 23653 gene locus_tag LOCUS_04820 22424 23653 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 protein_id gnl|my_center|LOCUS_04820 23668 24867 gene locus_tag LOCUS_04830 23668 24867 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227809.1 protein_id gnl|my_center|LOCUS_04830 25877 24804 gene locus_tag LOCUS_04840 25877 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 25858 27450 gene locus_tag LOCUS_04850 25858 27450 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_04850 28632 27487 gene locus_tag LOCUS_04860 28632 27487 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727837.1 protein_id gnl|my_center|LOCUS_04860 30424 28640 gene locus_tag LOCUS_04870 gene accC 30424 28640 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_04870 30460 31230 gene locus_tag LOCUS_04880 30460 31230 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_04880 31243 32238 gene locus_tag LOCUS_04890 gene rfbB 31243 32238 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_04890 32160 33137 gene locus_tag LOCUS_04900 gene rfbD 32160 33137 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_04900 33134 34048 gene locus_tag LOCUS_04910 33134 34048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_04910 34366 37149 gene locus_tag LOCUS_04920 gene secA 34366 37149 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence011 665 402 gene locus_tag LOCUS_04930 665 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1021 662 gene locus_tag LOCUS_04940 1021 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 1171 2340 gene locus_tag LOCUS_04950 1171 2340 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_04950 2989 2789 gene locus_tag LOCUS_04960 2989 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 3264 2986 gene locus_tag LOCUS_04970 3264 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4927 3440 gene locus_tag LOCUS_04980 4927 3440 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_04980 5518 5012 gene locus_tag LOCUS_04990 5518 5012 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967754.1 protein_id gnl|my_center|LOCUS_04990 5868 5515 gene locus_tag LOCUS_05000 5868 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 6976 6272 gene locus_tag LOCUS_05010 6976 6272 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561207.1 protein_id gnl|my_center|LOCUS_05010 7334 7056 gene locus_tag LOCUS_05020 7334 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8350 7361 gene locus_tag LOCUS_05030 8350 7361 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_05030 9390 8347 gene locus_tag LOCUS_05040 gene pdhA 9390 8347 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_05040 10125 9403 gene locus_tag LOCUS_05050 10125 9403 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400404.1 protein_id gnl|my_center|LOCUS_05050 10224 11477 gene locus_tag LOCUS_05060 10224 11477 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223886.1 protein_id gnl|my_center|LOCUS_05060 12651 11593 gene locus_tag LOCUS_05070 12651 11593 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_05070 12644 13021 gene locus_tag LOCUS_05080 12644 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 13867 12953 gene locus_tag LOCUS_05090 13867 12953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223884.1 protein_id gnl|my_center|LOCUS_05090 14649 13864 gene locus_tag LOCUS_05100 14649 13864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537900.1 protein_id gnl|my_center|LOCUS_05100 14708 14962 gene locus_tag LOCUS_05110 14708 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15654 14914 gene locus_tag LOCUS_05120 15654 14914 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877397.1 protein_id gnl|my_center|LOCUS_05120 16486 15656 gene locus_tag LOCUS_05130 16486 15656 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_05130 17861 16503 gene locus_tag LOCUS_05140 17861 16503 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040326.1 protein_id gnl|my_center|LOCUS_05140 18765 17851 gene locus_tag LOCUS_05150 gene dpsA 18765 17851 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_05150 19850 18762 gene locus_tag LOCUS_05160 19850 18762 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_05160 21034 19847 gene locus_tag LOCUS_05170 21034 19847 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 protein_id gnl|my_center|LOCUS_05170 22017 21031 gene locus_tag LOCUS_05180 22017 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22208 22014 gene locus_tag LOCUS_05190 22208 22014 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123298.1 protein_id gnl|my_center|LOCUS_05190 22994 22224 gene locus_tag LOCUS_05200 22994 22224 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_05200 24233 23139 gene locus_tag LOCUS_05210 24233 23139 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_05210 24341 25804 gene locus_tag LOCUS_05220 24341 25804 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_05220 27278 25857 gene locus_tag LOCUS_05230 gene xylB 27278 25857 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_05230 28372 27326 gene locus_tag LOCUS_05240 28372 27326 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 protein_id gnl|my_center|LOCUS_05240 29154 28369 gene locus_tag LOCUS_05250 29154 28369 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_05250 29792 29457 gene locus_tag LOCUS_05260 29792 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 30934 30419 gene locus_tag LOCUS_05270 30934 30419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 31309 31064 gene locus_tag LOCUS_05280 31309 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 31440 31841 gene locus_tag LOCUS_05290 31440 31841 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_05290 31916 32239 gene locus_tag LOCUS_05300 31916 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 32774 32328 gene locus_tag LOCUS_05310 32774 32328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 33036 33248 gene locus_tag LOCUS_05320 33036 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 33245 33577 gene locus_tag LOCUS_05330 33245 33577 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 protein_id gnl|my_center|LOCUS_05330 34970 33810 gene locus_tag LOCUS_05340 34970 33810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence012 2105 2872 gene locus_tag LOCUS_05350 2105 2872 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_05350 4065 2914 gene locus_tag LOCUS_05360 gene menE 4065 2914 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_05360 4081 4977 gene locus_tag LOCUS_05370 gene menB 4081 4977 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693314.1 protein_id gnl|my_center|LOCUS_05370 4974 5900 gene locus_tag LOCUS_05380 4974 5900 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727336.1 protein_id gnl|my_center|LOCUS_05380 6679 5930 gene locus_tag LOCUS_05390 gene menH 6679 5930 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_05390 6685 8379 gene locus_tag LOCUS_05400 gene menD 6685 8379 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_05400 8426 9694 gene locus_tag LOCUS_05410 gene tyrS 8426 9694 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_05410 9714 10232 gene locus_tag LOCUS_05420 9714 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10333 10803 gene locus_tag LOCUS_05430 10333 10803 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_05430 11029 10817 gene locus_tag LOCUS_05440 11029 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 11162 11452 gene locus_tag LOCUS_05450 11162 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 12216 11470 gene locus_tag LOCUS_05460 12216 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_05460 12245 12883 gene locus_tag LOCUS_05470 gene nfuA 12245 12883 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117617.1 protein_id gnl|my_center|LOCUS_05470 12891 13661 gene locus_tag LOCUS_05480 12891 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 13715 14908 gene locus_tag LOCUS_05490 gene aroC 13715 14908 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413027.1 protein_id gnl|my_center|LOCUS_05490 14911 15477 gene locus_tag LOCUS_05500 14911 15477 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_05500 15488 16582 gene locus_tag LOCUS_05510 15488 16582 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_05510 16573 17040 gene locus_tag LOCUS_05520 16573 17040 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222584.1 protein_id gnl|my_center|LOCUS_05520 17037 18122 gene locus_tag LOCUS_05530 17037 18122 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_05530 18296 18856 gene locus_tag LOCUS_05540 gene efp 18296 18856 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_05540 18874 19272 gene locus_tag LOCUS_05550 gene nusB 18874 19272 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 protein_id gnl|my_center|LOCUS_05550 19329 19886 gene locus_tag LOCUS_05560 gene pyrR 19329 19886 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_05560 19883 20797 gene locus_tag LOCUS_05570 19883 20797 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_05570 20794 22080 gene locus_tag LOCUS_05580 20794 22080 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_05580 22077 23144 gene locus_tag LOCUS_05590 gene carA 22077 23144 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_05590 23144 26425 gene locus_tag LOCUS_05600 gene carB 23144 26425 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_05600 26406 27335 gene locus_tag LOCUS_05610 26406 27335 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940572.1 protein_id gnl|my_center|LOCUS_05610 27367 28182 gene locus_tag LOCUS_05620 gene pyrF 27367 28182 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_05620 28206 28526 gene locus_tag LOCUS_05630 gene mihF 28206 28526 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_05630 28595 29077 gene locus_tag LOCUS_05640 gene gmk 28595 29077 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_05640 29067 29423 gene locus_tag LOCUS_05650 29067 29423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 29476 30693 gene locus_tag LOCUS_05660 gene coaBC 29476 30693 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_05660 30693 31883 gene locus_tag LOCUS_05670 gene metK 30693 31883 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_05670 31904 33613 gene locus_tag LOCUS_05680 31904 33613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 33625 34110 gene locus_tag LOCUS_05690 gene def 33625 34110 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_05690 34169 35005 gene locus_tag LOCUS_05700 gene fmt 34169 35005 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence013 497 664 gene locus_tag LOCUS_05710 497 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 2107 866 gene locus_tag LOCUS_05720 2107 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2671 2354 gene locus_tag LOCUS_05730 2671 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3063 2677 gene locus_tag LOCUS_05740 3063 2677 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_05740 3249 3164 gene locus_tag LOCUS_t00110 3249 3164 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3595 5583 gene locus_tag LOCUS_05750 3595 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5613 6215 gene locus_tag LOCUS_05760 gene recR 5613 6215 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_05760 6212 6775 gene locus_tag LOCUS_05770 6212 6775 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950516.1 protein_id gnl|my_center|LOCUS_05770 8432 6777 gene locus_tag LOCUS_05780 gene guaA 8432 6777 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_05780 9669 8485 gene locus_tag LOCUS_05790 9669 8485 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_05790 9976 12030 gene locus_tag LOCUS_05800 9976 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 12027 12509 gene locus_tag LOCUS_05810 gene mce 12027 12509 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_05810 12532 14076 gene locus_tag LOCUS_05820 12532 14076 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_05820 14073 14402 gene locus_tag LOCUS_05830 14073 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 14428 15411 gene locus_tag LOCUS_05840 14428 15411 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_05840 17374 15401 gene locus_tag LOCUS_05850 17374 15401 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_05850 18280 17429 gene locus_tag LOCUS_05860 18280 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18384 19073 gene locus_tag LOCUS_05870 18384 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 19620 19153 gene locus_tag LOCUS_05880 19620 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 20528 19977 gene locus_tag LOCUS_05890 20528 19977 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403256.1 protein_id gnl|my_center|LOCUS_05890 21366 20533 gene locus_tag LOCUS_05900 21366 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 21415 22626 gene locus_tag LOCUS_05910 21415 22626 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_05910 22686 23705 gene locus_tag LOCUS_05920 22686 23705 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_05920 24089 25303 gene locus_tag LOCUS_05930 24089 25303 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_05930 25419 26801 gene locus_tag LOCUS_05940 25419 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 26945 28231 gene locus_tag LOCUS_05950 26945 28231 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_05950 29020 28235 gene locus_tag LOCUS_05960 29020 28235 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_05960 28913 29179 gene locus_tag LOCUS_05970 28913 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29192 29734 gene locus_tag LOCUS_05980 29192 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 30302 29805 gene locus_tag LOCUS_05990 30302 29805 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_05990 30378 30463 gene locus_tag LOCUS_t00120 30378 30463 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 31835 30432 gene locus_tag LOCUS_06000 31835 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 32013 32327 gene locus_tag LOCUS_06010 32013 32327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence014 2122 131 gene locus_tag LOCUS_06020 2122 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3702 2119 gene locus_tag LOCUS_06030 3702 2119 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_06030 5633 3705 gene locus_tag LOCUS_06040 gene nuoL 5633 3705 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_06040 5942 5637 gene locus_tag LOCUS_06050 gene nuoK 5942 5637 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_06050 6643 5939 gene locus_tag LOCUS_06060 6643 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7503 6640 gene locus_tag LOCUS_06070 7503 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8775 7504 gene locus_tag LOCUS_06080 gene nuoH 8775 7504 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_06080 11594 8772 gene locus_tag LOCUS_06090 gene nuoG 11594 8772 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969254.1 protein_id gnl|my_center|LOCUS_06090 12891 11587 gene locus_tag LOCUS_06100 gene nuoF 12891 11587 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_06100 13562 12891 gene locus_tag LOCUS_06110 13562 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14941 13559 gene locus_tag LOCUS_06120 14941 13559 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_06120 15366 14938 gene locus_tag LOCUS_06130 15366 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 16049 15492 gene locus_tag LOCUS_06140 16049 15492 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_06140 16513 16061 gene locus_tag LOCUS_06150 16513 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 16751 18049 gene locus_tag LOCUS_06160 16751 18049 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_06160 19454 18078 gene locus_tag LOCUS_06170 gene hemL 19454 18078 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_06170 20442 19447 gene locus_tag LOCUS_06180 gene hemB 20442 19447 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_06180 21261 20455 gene locus_tag LOCUS_06190 21261 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 22246 21311 gene locus_tag LOCUS_06200 gene hemC 22246 21311 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_06200 23523 22243 gene locus_tag LOCUS_06210 23523 22243 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_06210 24429 23707 gene locus_tag LOCUS_06220 24429 23707 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_06220 25277 24480 gene locus_tag LOCUS_06230 25277 24480 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_06230 25512 25312 gene locus_tag LOCUS_06240 25512 25312 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 protein_id gnl|my_center|LOCUS_06240 26361 25591 gene locus_tag LOCUS_06250 gene proC 26361 25591 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_06250 26936 26436 gene locus_tag LOCUS_06260 26936 26436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 28235 26952 gene locus_tag LOCUS_06270 gene mshA 28235 26952 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_06270 28739 28248 gene locus_tag LOCUS_06280 28739 28248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 29131 28736 gene locus_tag LOCUS_06290 29131 28736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 29352 29771 gene locus_tag LOCUS_06300 gene sodN 29352 29771 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_06300 29822 30667 gene locus_tag LOCUS_06310 29822 30667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 31004 30738 gene locus_tag LOCUS_06320 31004 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 31126 32610 gene locus_tag LOCUS_06330 31126 32610 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_06330 33087 33461 gene locus_tag LOCUS_06340 33087 33461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 33568 33643 gene locus_tag LOCUS_t00130 33568 33643 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 315 1166 gene locus_tag LOCUS_06350 315 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 2208 1243 gene locus_tag LOCUS_06360 2208 1243 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_06360 2843 2205 gene locus_tag LOCUS_06370 gene lspA 2843 2205 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929905.1 protein_id gnl|my_center|LOCUS_06370 3622 2741 gene locus_tag LOCUS_06380 3622 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4716 3754 gene locus_tag LOCUS_06390 4716 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5063 4797 gene locus_tag LOCUS_06400 5063 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5629 5081 gene locus_tag LOCUS_06410 gene sepF 5629 5081 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224823.1 protein_id gnl|my_center|LOCUS_06410 6386 5691 gene locus_tag LOCUS_06420 6386 5691 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_06420 7495 6401 gene locus_tag LOCUS_06430 gene ftsZ 7495 6401 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_06430 8567 7758 gene locus_tag LOCUS_06440 8567 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9616 8564 gene locus_tag LOCUS_06450 gene murB 9616 8564 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_06450 11019 9613 gene locus_tag LOCUS_06460 gene murC 11019 9613 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_06460 12148 11009 gene locus_tag LOCUS_06470 gene murG 12148 11009 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_06470 13332 12145 gene locus_tag LOCUS_06480 gene spoVE 13332 12145 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_06480 14458 13421 gene locus_tag LOCUS_06490 gene mraY 14458 13421 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908018.1 protein_id gnl|my_center|LOCUS_06490 15994 14462 gene locus_tag LOCUS_06500 15994 14462 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_06500 17843 16029 gene locus_tag LOCUS_06510 gene ftsI 17843 16029 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_06510 18337 18014 gene locus_tag LOCUS_06520 18337 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 19575 18487 gene locus_tag LOCUS_06530 gene rsmH 19575 18487 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_06530 20081 19668 gene locus_tag LOCUS_06540 gene mraZ 20081 19668 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_06540 21118 20411 gene locus_tag LOCUS_06550 21118 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 21651 21088 gene locus_tag LOCUS_06560 21651 21088 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840499.1 protein_id gnl|my_center|LOCUS_06560 22795 21878 gene locus_tag LOCUS_06570 22795 21878 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_06570 23148 22759 gene locus_tag LOCUS_06580 23148 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 23305 23135 gene locus_tag LOCUS_06590 23305 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 23588 23388 gene locus_tag LOCUS_06600 23588 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 24408 23758 gene locus_tag LOCUS_06610 gene msrA 24408 23758 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_06610 24659 25990 gene locus_tag LOCUS_06620 gene egtB 24659 25990 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_06620 25993 26988 gene locus_tag LOCUS_06630 gene egtD 25993 26988 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419799.1 protein_id gnl|my_center|LOCUS_06630 28891 26957 gene locus_tag LOCUS_06640 28891 26957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 29905 29108 gene locus_tag LOCUS_06650 29905 29108 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228354.1 protein_id gnl|my_center|LOCUS_06650 30320 29919 gene locus_tag LOCUS_06660 30320 29919 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388728.1 protein_id gnl|my_center|LOCUS_06660 30679 30431 gene locus_tag LOCUS_06670 30679 30431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 32821 30743 gene locus_tag LOCUS_06680 gene lon 32821 30743 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222513.1 protein_id gnl|my_center|LOCUS_06680 33245 32862 gene locus_tag LOCUS_06690 33245 32862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence016 162 4985 gene locus_tag LOCUS_06700 gene gltB 162 4985 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 protein_id gnl|my_center|LOCUS_06700 4978 6528 gene locus_tag LOCUS_06710 4978 6528 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_06710 6623 8377 gene locus_tag LOCUS_06720 6623 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8772 8431 gene locus_tag LOCUS_06730 gene mazF6 8772 8431 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_06730 9056 8769 gene locus_tag LOCUS_06740 9056 8769 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410014.1 protein_id gnl|my_center|LOCUS_06740 9289 9062 gene locus_tag LOCUS_06750 9289 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9355 9783 gene locus_tag LOCUS_06760 9355 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9783 10088 gene locus_tag LOCUS_06770 9783 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 11428 10127 gene locus_tag LOCUS_06780 11428 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 11991 11470 gene locus_tag LOCUS_06790 11991 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 13236 12193 gene locus_tag LOCUS_06800 13236 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 14351 13338 gene locus_tag LOCUS_06810 14351 13338 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_06810 14935 14348 gene locus_tag LOCUS_06820 14935 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 17421 14932 gene locus_tag LOCUS_06830 17421 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 18512 17427 gene locus_tag LOCUS_06840 18512 17427 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_06840 19023 18529 gene locus_tag LOCUS_06850 19023 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 19262 20872 gene locus_tag LOCUS_06860 19262 20872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 20893 21591 gene locus_tag LOCUS_06870 20893 21591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_06870 21729 23582 gene locus_tag LOCUS_06880 21729 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 24438 24175 gene locus_tag LOCUS_06890 24438 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 24340 24717 gene locus_tag LOCUS_06900 24340 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 24714 25721 gene locus_tag LOCUS_06910 24714 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 25961 26623 gene locus_tag LOCUS_06920 25961 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 27137 26904 gene locus_tag LOCUS_06930 27137 26904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 27968 27312 gene locus_tag LOCUS_06940 27968 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 28352 28059 gene locus_tag LOCUS_06950 28352 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 28412 30289 gene locus_tag LOCUS_06960 28412 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 32275 30353 gene locus_tag LOCUS_06970 32275 30353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 33021 32410 gene locus_tag LOCUS_06980 33021 32410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence017 967 1042 gene locus_tag LOCUS_t00140 967 1042 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1167 1544 gene locus_tag LOCUS_06990 1167 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 1541 1843 gene locus_tag LOCUS_07000 1541 1843 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_07000 1984 2229 gene locus_tag LOCUS_07010 gene vapB4 1984 2229 CDS product type II toxin-antitoxin system antitoxin VapB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403125.1 protein_id gnl|my_center|LOCUS_07010 2226 2609 gene locus_tag LOCUS_07020 2226 2609 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_07020 3862 2798 gene locus_tag LOCUS_07030 3862 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4102 4395 gene locus_tag LOCUS_07040 4102 4395 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406322.1 protein_id gnl|my_center|LOCUS_07040 4392 4667 gene locus_tag LOCUS_07050 4392 4667 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_07050 4788 6161 gene locus_tag LOCUS_07060 4788 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6717 6214 gene locus_tag LOCUS_07070 6717 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6850 6665 gene locus_tag LOCUS_07080 6850 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07080 7133 7285 gene locus_tag LOCUS_07090 7133 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7782 8612 gene locus_tag LOCUS_07100 7782 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 9686 8844 gene locus_tag LOCUS_07110 9686 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 10276 9950 gene locus_tag LOCUS_07120 10276 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 10472 10305 gene locus_tag LOCUS_07130 10472 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10578 10799 gene locus_tag LOCUS_07140 10578 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11313 12728 gene locus_tag LOCUS_07150 11313 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 12725 15937 gene locus_tag LOCUS_07160 12725 15937 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_07160 15934 16560 gene locus_tag LOCUS_07170 15934 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 16759 17010 gene locus_tag LOCUS_07180 16759 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 17007 19325 gene locus_tag LOCUS_07190 17007 19325 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930210.1 protein_id gnl|my_center|LOCUS_07190 19466 22240 gene locus_tag LOCUS_07200 19466 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 22237 22623 gene locus_tag LOCUS_07210 22237 22623 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_07210 22625 24676 gene locus_tag LOCUS_07220 22625 24676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 24683 25714 gene locus_tag LOCUS_07230 24683 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 25729 27192 gene locus_tag LOCUS_07240 25729 27192 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_07240 28192 27467 gene locus_tag LOCUS_07250 28192 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 29109 28201 gene locus_tag LOCUS_07260 29109 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 30065 29241 gene locus_tag LOCUS_07270 30065 29241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727371.1 protein_id gnl|my_center|LOCUS_07270 30956 30186 gene locus_tag LOCUS_07280 30956 30186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227225.1 protein_id gnl|my_center|LOCUS_07280 32029 30953 gene locus_tag LOCUS_07290 32029 30953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence018 1292 294 gene locus_tag LOCUS_07300 1292 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3577 1370 gene locus_tag LOCUS_07310 3577 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5162 3606 gene locus_tag LOCUS_07320 5162 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5734 5261 gene locus_tag LOCUS_07330 5734 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5983 5759 gene locus_tag LOCUS_07340 5983 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6127 6783 gene locus_tag LOCUS_07350 6127 6783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_07350 6761 8224 gene locus_tag LOCUS_07360 6761 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 9519 8314 gene locus_tag LOCUS_07370 9519 8314 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_07370 10007 9531 gene locus_tag LOCUS_07380 10007 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 10133 12277 gene locus_tag LOCUS_07390 10133 12277 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_07390 12773 12249 gene locus_tag LOCUS_07400 12773 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 13471 12770 gene locus_tag LOCUS_07410 13471 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 13575 14456 gene locus_tag LOCUS_07420 13575 14456 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_07420 14644 14985 gene locus_tag LOCUS_07430 14644 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 14982 15977 gene locus_tag LOCUS_07440 gene rsmI 14982 15977 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_07440 15874 17610 gene locus_tag LOCUS_07450 gene metG 15874 17610 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869940.1 protein_id gnl|my_center|LOCUS_07450 17616 18569 gene locus_tag LOCUS_07460 17616 18569 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_07460 18566 19381 gene locus_tag LOCUS_07470 gene rsmA 18566 19381 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 protein_id gnl|my_center|LOCUS_07470 19378 20229 gene locus_tag LOCUS_07480 gene ispE 19378 20229 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_07480 20684 20445 gene locus_tag LOCUS_07490 20684 20445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 22172 20778 gene locus_tag LOCUS_07500 22172 20778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_07500 22840 22169 gene locus_tag LOCUS_07510 22840 22169 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_07510 23014 23087 gene locus_tag LOCUS_t00150 23014 23087 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23522 23109 gene locus_tag LOCUS_07520 23522 23109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 23485 23826 gene locus_tag LOCUS_07530 23485 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 24480 23983 gene locus_tag LOCUS_07540 24480 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 24549 25718 gene locus_tag LOCUS_07550 gene glmU 24549 25718 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_07550 25762 26709 gene locus_tag LOCUS_07560 25762 26709 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896824.1 protein_id gnl|my_center|LOCUS_07560 26923 27570 gene locus_tag LOCUS_07570 26923 27570 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_07570 27655 28227 gene locus_tag LOCUS_07580 gene pth 27655 28227 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_07580 28217 31846 gene locus_tag LOCUS_07590 gene mfd 28217 31846 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence019 282 1499 gene locus_tag LOCUS_07600 282 1499 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_07600 1594 1869 gene locus_tag LOCUS_07610 1594 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 3120 2386 gene locus_tag LOCUS_07620 3120 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3659 4645 gene locus_tag LOCUS_07630 3659 4645 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_07630 4645 5355 gene locus_tag LOCUS_07640 4645 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5390 6889 gene locus_tag LOCUS_07650 gene hyfF 5390 6889 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122519.1 protein_id gnl|my_center|LOCUS_07650 6886 8382 gene locus_tag LOCUS_07660 6886 8382 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272520.1 protein_id gnl|my_center|LOCUS_07660 8382 8720 gene locus_tag LOCUS_07670 8382 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8717 9226 gene locus_tag LOCUS_07680 8717 9226 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_07680 9223 11232 gene locus_tag LOCUS_07690 gene hyfB 9223 11232 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_07690 11318 11656 gene locus_tag LOCUS_07700 11318 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12435 11710 gene locus_tag LOCUS_07710 12435 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 14233 12674 gene locus_tag LOCUS_07720 14233 12674 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_07720 15771 14230 gene locus_tag LOCUS_07730 15771 14230 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_07730 16252 16899 gene locus_tag LOCUS_07740 16252 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 16896 17444 gene locus_tag LOCUS_07750 16896 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17580 18023 gene locus_tag LOCUS_07760 17580 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 19021 18629 gene locus_tag LOCUS_07770 19021 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 19026 19400 gene locus_tag LOCUS_07780 19026 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19641 20294 gene locus_tag LOCUS_07790 19641 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 20980 20465 gene locus_tag LOCUS_07800 20980 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 22702 21431 gene locus_tag LOCUS_07810 gene eno 22702 21431 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095220.1 protein_id gnl|my_center|LOCUS_07810 23284 22802 gene locus_tag LOCUS_07820 23284 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 24474 23281 gene locus_tag LOCUS_07830 24474 23281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_07830 25933 24752 gene locus_tag LOCUS_07840 25933 24752 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919764.1 protein_id gnl|my_center|LOCUS_07840 26595 26020 gene locus_tag LOCUS_07850 26595 26020 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731153.1 protein_id gnl|my_center|LOCUS_07850 27268 26873 gene locus_tag LOCUS_07860 27268 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 30219 27268 gene locus_tag LOCUS_07870 30219 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 32053 31514 gene locus_tag LOCUS_07880 32053 31514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence020 <1 561 gene locus_tag LOCUS_07890 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081641.1:class I SAM-dependent methyltransferase 2042 630 gene locus_tag LOCUS_07900 2042 630 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_07900 2089 3327 gene locus_tag LOCUS_07910 2089 3327 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_07910 3324 4274 gene locus_tag LOCUS_07920 3324 4274 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_07920 4551 4282 gene locus_tag LOCUS_07930 4551 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5465 4680 gene locus_tag LOCUS_07940 5465 4680 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_07940 6362 5556 gene locus_tag LOCUS_07950 6362 5556 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_07950 6574 6909 gene locus_tag LOCUS_07960 6574 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7024 7695 gene locus_tag LOCUS_07970 7024 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 8130 7834 gene locus_tag LOCUS_07980 8130 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8686 8273 gene locus_tag LOCUS_07990 8686 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9328 10608 gene locus_tag LOCUS_08000 9328 10608 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_08000 10605 11954 gene locus_tag LOCUS_08010 10605 11954 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_08010 13876 12029 gene locus_tag LOCUS_08020 13876 12029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_08020 14505 15101 gene locus_tag LOCUS_08030 14505 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 15102 15728 gene locus_tag LOCUS_08040 15102 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15828 16730 gene locus_tag LOCUS_08050 15828 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 16727 18352 gene locus_tag LOCUS_08060 gene nrfD 16727 18352 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_08060 18390 18869 gene locus_tag LOCUS_08070 18390 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 18866 19882 gene locus_tag LOCUS_08080 18866 19882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 21091 19940 gene locus_tag LOCUS_08090 21091 19940 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_08090 21746 21234 gene locus_tag LOCUS_08100 21746 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 22703 21774 gene locus_tag LOCUS_08110 22703 21774 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_08110 23860 22706 gene locus_tag LOCUS_08120 23860 22706 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_08120 26873 24156 gene locus_tag LOCUS_08130 26873 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 26944 27432 gene locus_tag LOCUS_08140 gene greA 26944 27432 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_08140 27429 28913 gene locus_tag LOCUS_08150 gene leuC 27429 28913 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_08150 28910 29533 gene locus_tag LOCUS_08160 gene leuD 28910 29533 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_08160 31364 29490 gene locus_tag LOCUS_08170 gene leuA 31364 29490 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_08170 31767 31961 gene locus_tag LOCUS_08180 31767 31961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence021 2926 1208 gene locus_tag LOCUS_08190 gene kdpA 2926 1208 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391515.1 protein_id gnl|my_center|LOCUS_08190 3324 2923 gene locus_tag LOCUS_08200 3324 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3622 6330 gene locus_tag LOCUS_08210 3622 6330 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_08210 6327 7058 gene locus_tag LOCUS_08220 6327 7058 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_08220 9595 7904 gene locus_tag LOCUS_08230 9595 7904 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_08230 9660 10970 gene locus_tag LOCUS_08240 gene lysA 9660 10970 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296430.1 protein_id gnl|my_center|LOCUS_08240 10967 12625 gene locus_tag LOCUS_08250 10967 12625 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_08250 12760 13710 gene locus_tag LOCUS_08260 12760 13710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_08260 13707 14630 gene locus_tag LOCUS_08270 13707 14630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_08270 15961 14690 gene locus_tag LOCUS_08280 15961 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 16542 18353 gene locus_tag LOCUS_08290 16542 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 18419 18598 gene locus_tag LOCUS_08300 18419 18598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 19299 19033 gene locus_tag LOCUS_08310 19299 19033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 19529 19296 gene locus_tag LOCUS_08320 19529 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 21092 19776 gene locus_tag LOCUS_08330 21092 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 21618 21139 gene locus_tag LOCUS_08340 21618 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 21974 21615 gene locus_tag LOCUS_08350 21974 21615 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229671.1 protein_id gnl|my_center|LOCUS_08350 22911 25775 gene locus_tag LOCUS_08360 gene leuS 22911 25775 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_08360 23051 22976 gene locus_tag LOCUS_t00160 23051 22976 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 26766 25759 gene locus_tag LOCUS_08370 26766 25759 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_08370 27665 26793 gene locus_tag LOCUS_08380 27665 26793 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411060.1 protein_id gnl|my_center|LOCUS_08380 27760 28503 gene locus_tag LOCUS_08390 gene trxA 27760 28503 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528773.1 protein_id gnl|my_center|LOCUS_08390 30872 28527 gene locus_tag LOCUS_08400 30872 28527 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893571.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence022 1593 379 gene locus_tag LOCUS_08410 1593 379 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_08410 2021 1815 gene locus_tag LOCUS_08420 2021 1815 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_08420 3526 2204 gene locus_tag LOCUS_08430 gene cysS 3526 2204 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_08430 3619 6369 gene locus_tag LOCUS_08440 gene valS 3619 6369 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_08440 6594 6947 gene locus_tag LOCUS_08450 6594 6947 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971571.1 protein_id gnl|my_center|LOCUS_08450 6944 7348 gene locus_tag LOCUS_08460 6944 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7356 8195 gene locus_tag LOCUS_08470 7356 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8263 9963 gene locus_tag LOCUS_08480 gene pgi 8263 9963 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_08480 10044 11081 gene locus_tag LOCUS_08490 gene gnd 10044 11081 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_08490 11088 11759 gene locus_tag LOCUS_08500 gene pgl 11088 11759 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_08500 12430 11765 gene locus_tag LOCUS_08510 gene rpiA 12430 11765 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920162.1 protein_id gnl|my_center|LOCUS_08510 14613 12493 gene locus_tag LOCUS_08520 gene glgX 14613 12493 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_08520 16412 14640 gene locus_tag LOCUS_08530 gene glgP 16412 14640 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_08530 16693 18225 gene locus_tag LOCUS_08540 16693 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 19162 18272 gene locus_tag LOCUS_08550 19162 18272 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_08550 19440 19889 gene locus_tag LOCUS_08560 19440 19889 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_08560 21221 19935 gene locus_tag LOCUS_08570 21221 19935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 22816 21284 gene locus_tag LOCUS_08580 22816 21284 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947090.1 protein_id gnl|my_center|LOCUS_08580 23655 23008 gene locus_tag LOCUS_08590 23655 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 23758 24330 gene locus_tag LOCUS_08600 23758 24330 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_08600 25089 24439 gene locus_tag LOCUS_08610 25089 24439 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_08610 25409 25086 gene locus_tag LOCUS_08620 25409 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 25566 25703 gene locus_tag LOCUS_08630 25566 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 25818 26846 gene locus_tag LOCUS_08640 25818 26846 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_08640 26849 27721 gene locus_tag LOCUS_08650 26849 27721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_08650 27718 28176 gene locus_tag LOCUS_08660 27718 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 28202 28774 gene locus_tag LOCUS_08670 28202 28774 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_08670 28839 29693 gene locus_tag LOCUS_08680 28839 29693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 30191 29814 gene locus_tag LOCUS_08690 30191 29814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence023 2391 43 gene locus_tag LOCUS_08700 2391 43 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_08700 3276 2467 gene locus_tag LOCUS_08710 3276 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3545 3294 gene locus_tag LOCUS_08720 3545 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5514 3706 gene locus_tag LOCUS_08730 5514 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5827 5585 gene locus_tag LOCUS_08740 5827 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5808 7235 gene locus_tag LOCUS_08750 5808 7235 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_08750 8650 7241 gene locus_tag LOCUS_08760 8650 7241 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026898.1 protein_id gnl|my_center|LOCUS_08760 8887 10002 gene locus_tag LOCUS_08770 8887 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 10830 10051 gene locus_tag LOCUS_08780 gene tam 10830 10051 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705336.1 protein_id gnl|my_center|LOCUS_08780 11870 10827 gene locus_tag LOCUS_08790 gene add 11870 10827 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_08790 12078 13760 gene locus_tag LOCUS_08800 12078 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 15241 14222 gene locus_tag LOCUS_08810 15241 14222 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_08810 16143 15238 gene locus_tag LOCUS_08820 16143 15238 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_08820 17072 16140 gene locus_tag LOCUS_08830 17072 16140 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_08830 18265 17069 gene locus_tag LOCUS_08840 18265 17069 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_08840 19326 18262 gene locus_tag LOCUS_08850 19326 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 19972 19481 gene locus_tag LOCUS_08860 19972 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20025 21056 gene locus_tag LOCUS_08870 20025 21056 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_08870 22598 21123 gene locus_tag LOCUS_08880 gene ahcY 22598 21123 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_08880 23318 22968 gene locus_tag LOCUS_08890 23318 22968 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_08890 25498 26274 gene locus_tag LOCUS_08900 25498 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 26174 26524 gene locus_tag LOCUS_08910 26174 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 26943 26419 gene locus_tag LOCUS_08920 26943 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 26962 27036 gene locus_tag LOCUS_t00170 26962 27036 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27525 27046 gene locus_tag LOCUS_08930 27525 27046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 27608 27982 gene locus_tag LOCUS_08940 27608 27982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 28006 28824 gene locus_tag LOCUS_08950 28006 28824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence024 1294 110 gene locus_tag LOCUS_08960 1294 110 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 protein_id gnl|my_center|LOCUS_08960 2151 1291 gene locus_tag LOCUS_08970 gene argB 2151 1291 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_08970 3326 2148 gene locus_tag LOCUS_08980 gene argJ 3326 2148 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_08980 4321 3323 gene locus_tag LOCUS_08990 gene argC 4321 3323 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_08990 6177 4420 gene locus_tag LOCUS_09000 6177 4420 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_09000 8730 6268 gene locus_tag LOCUS_09010 gene pheT 8730 6268 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_09010 9793 8741 gene locus_tag LOCUS_09020 gene pheS 9793 8741 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_09020 10575 9790 gene locus_tag LOCUS_09030 10575 9790 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_09030 10961 10599 gene locus_tag LOCUS_09040 gene rplT 10961 10599 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 protein_id gnl|my_center|LOCUS_09040 11169 10975 gene locus_tag LOCUS_09050 gene rpmI 11169 10975 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 protein_id gnl|my_center|LOCUS_09050 11741 11187 gene locus_tag LOCUS_09060 gene infC 11741 11187 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_09060 11978 12457 gene locus_tag LOCUS_09070 11978 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 13314 12454 gene locus_tag LOCUS_09080 13314 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13399 13755 gene locus_tag LOCUS_09090 13399 13755 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086804.1 protein_id gnl|my_center|LOCUS_09090 16064 13893 gene locus_tag LOCUS_09100 gene pucD 16064 13893 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_09100 16761 16198 gene locus_tag LOCUS_09110 16761 16198 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_09110 17623 16748 gene locus_tag LOCUS_09120 17623 16748 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_09120 18642 17632 gene locus_tag LOCUS_09130 18642 17632 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522340.1 protein_id gnl|my_center|LOCUS_09130 18800 20359 gene locus_tag LOCUS_09140 18800 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 20837 20493 gene locus_tag LOCUS_09150 20837 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 21458 21961 gene locus_tag LOCUS_09160 21458 21961 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142676.1 protein_id gnl|my_center|LOCUS_09160 21961 22980 gene locus_tag LOCUS_09170 21961 22980 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071365.1 protein_id gnl|my_center|LOCUS_09170 22986 24104 gene locus_tag LOCUS_09180 22986 24104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 24120 24740 gene locus_tag LOCUS_09190 24120 24740 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_09190 24853 24704 gene locus_tag LOCUS_09200 24853 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 25038 26072 gene locus_tag LOCUS_09210 25038 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 26780 26151 gene locus_tag LOCUS_09220 26780 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence025 <1 681 gene locus_tag LOCUS_09230 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728538.1:hydrogenase expression/formation protein HypE 702 1823 gene locus_tag LOCUS_09240 gene hypD 702 1823 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_09240 1842 2183 gene locus_tag LOCUS_09250 1842 2183 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 protein_id gnl|my_center|LOCUS_09250 2185 3024 gene locus_tag LOCUS_09260 gene hypB 2185 3024 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_09260 3406 4215 gene locus_tag LOCUS_09270 3406 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4106 5362 gene locus_tag LOCUS_09280 4106 5362 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955127.1 protein_id gnl|my_center|LOCUS_09280 5359 7821 gene locus_tag LOCUS_09290 5359 7821 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955129.1 protein_id gnl|my_center|LOCUS_09290 7956 8999 gene locus_tag LOCUS_09300 7956 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 9158 10339 gene locus_tag LOCUS_09310 9158 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10401 12479 gene locus_tag LOCUS_09320 gene fusA 10401 12479 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_09320 13084 12536 gene locus_tag LOCUS_09330 13084 12536 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_09330 15075 13087 gene locus_tag LOCUS_09340 gene thrS 15075 13087 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_09340 16290 15154 gene locus_tag LOCUS_09350 gene mshC 16290 15154 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_09350 16945 16292 gene locus_tag LOCUS_09360 gene npdG 16945 16292 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_09360 17124 17906 gene locus_tag LOCUS_09370 gene fabI 17124 17906 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_09370 18039 19997 gene locus_tag LOCUS_09380 18039 19997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_09380 20008 20382 gene locus_tag LOCUS_09390 20008 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 20392 20910 gene locus_tag LOCUS_09400 20392 20910 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059290.1 protein_id gnl|my_center|LOCUS_09400 20928 22151 gene locus_tag LOCUS_09410 20928 22151 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113287.1 protein_id gnl|my_center|LOCUS_09410 22168 22566 gene locus_tag LOCUS_09420 22168 22566 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891587.1 protein_id gnl|my_center|LOCUS_09420 23478 22603 gene locus_tag LOCUS_09430 23478 22603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 24209 23403 gene locus_tag LOCUS_09440 24209 23403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_09440 25128 24277 gene locus_tag LOCUS_09450 25128 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 25519 25220 gene locus_tag LOCUS_09460 25519 25220 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_09460 25906 25643 gene locus_tag LOCUS_09470 25906 25643 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_09470 26283 25906 gene locus_tag LOCUS_09480 26283 25906 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_09480 <27115 26562 gene locus_tag LOCUS_09490 <27115 26562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545439.1:rod shape-determining protein >Feature sequence026 3247 4272 gene locus_tag LOCUS_09500 3247 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4706 4299 gene locus_tag LOCUS_09510 4706 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4981 4706 gene locus_tag LOCUS_09520 4981 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 10321 5027 gene locus_tag LOCUS_09530 10321 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 11367 10318 gene locus_tag LOCUS_09540 11367 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 13453 11570 gene locus_tag LOCUS_09550 13453 11570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_09550 13914 13450 gene locus_tag LOCUS_09560 13914 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 14087 14317 gene locus_tag LOCUS_09570 14087 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 14314 15111 gene locus_tag LOCUS_09580 14314 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09580 15251 15409 gene locus_tag LOCUS_09590 15251 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 16902 15376 gene locus_tag LOCUS_09600 16902 15376 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_09600 17051 17470 gene locus_tag LOCUS_09610 17051 17470 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 protein_id gnl|my_center|LOCUS_09610 18847 17519 gene locus_tag LOCUS_09620 18847 17519 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 protein_id gnl|my_center|LOCUS_09620 20330 18969 gene locus_tag LOCUS_09630 gene lysA 20330 18969 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_09630 20504 20758 gene locus_tag LOCUS_09640 20504 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 21155 20913 gene locus_tag LOCUS_09650 21155 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 21568 21230 gene locus_tag LOCUS_09660 21568 21230 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_09660 21804 21565 gene locus_tag LOCUS_09670 21804 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 21879 22529 gene locus_tag LOCUS_09680 21879 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 22477 23232 gene locus_tag LOCUS_09690 22477 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 23340 23621 gene locus_tag LOCUS_09700 23340 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 24052 23726 gene locus_tag LOCUS_09710 24052 23726 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_09710 24351 24049 gene locus_tag LOCUS_09720 24351 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 24653 24429 gene locus_tag LOCUS_09730 24653 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 25548 25817 gene locus_tag LOCUS_09740 25548 25817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 25817 26320 gene locus_tag LOCUS_09750 25817 26320 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969542.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence027 <1 2108 gene locus_tag LOCUS_09760 <1 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812442.1:ABC transporter ATP-binding protein 2724 2140 gene locus_tag LOCUS_09770 2724 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2748 2936 gene locus_tag LOCUS_09780 2748 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2933 4750 gene locus_tag LOCUS_09790 2933 4750 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_09790 4780 6579 gene locus_tag LOCUS_09800 4780 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7422 6607 gene locus_tag LOCUS_09810 7422 6607 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_09810 8090 7503 gene locus_tag LOCUS_09820 gene pyrE 8090 7503 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_09820 9148 8087 gene locus_tag LOCUS_09830 gene purM 9148 8087 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 protein_id gnl|my_center|LOCUS_09830 10718 9159 gene locus_tag LOCUS_09840 gene purF 10718 9159 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085623.1 protein_id gnl|my_center|LOCUS_09840 10888 11736 gene locus_tag LOCUS_09850 10888 11736 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_09850 14176 11846 gene locus_tag LOCUS_09860 gene purL 14176 11846 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404114.1 protein_id gnl|my_center|LOCUS_09860 14853 14173 gene locus_tag LOCUS_09870 gene purQ 14853 14173 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666774.1 protein_id gnl|my_center|LOCUS_09870 15104 14850 gene locus_tag LOCUS_09880 gene purS 15104 14850 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871117.1 protein_id gnl|my_center|LOCUS_09880 16024 15119 gene locus_tag LOCUS_09890 16024 15119 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230768.1 protein_id gnl|my_center|LOCUS_09890 17337 16021 gene locus_tag LOCUS_09900 gene purB 17337 16021 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_09900 18716 17334 gene locus_tag LOCUS_09910 gene purD 18716 17334 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256525.1 protein_id gnl|my_center|LOCUS_09910 19996 18713 gene locus_tag LOCUS_09920 19996 18713 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_09920 22591 20102 gene locus_tag LOCUS_09930 gene clpB 22591 20102 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_09930 23141 22683 gene locus_tag LOCUS_09940 23141 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 24274 23144 gene locus_tag LOCUS_09950 gene dnaJ 24274 23144 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_09950 24970 24278 gene locus_tag LOCUS_09960 24970 24278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 26817 24967 gene locus_tag LOCUS_09970 gene dnaK 26817 24967 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence028 1568 402 gene locus_tag LOCUS_09980 1568 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1772 2125 gene locus_tag LOCUS_09990 1772 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2219 2677 gene locus_tag LOCUS_10000 2219 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4185 2665 gene locus_tag LOCUS_10010 4185 2665 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_10010 4423 4578 gene locus_tag LOCUS_10020 4423 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4980 4904 gene locus_tag LOCUS_t00180 4980 4904 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6272 5013 gene locus_tag LOCUS_10030 6272 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6736 6284 gene locus_tag LOCUS_10040 6736 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7984 6746 gene locus_tag LOCUS_10050 7984 6746 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_10050 8982 7981 gene locus_tag LOCUS_10060 8982 7981 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419738.1 protein_id gnl|my_center|LOCUS_10060 9112 9375 gene locus_tag LOCUS_10070 9112 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10452 9427 gene locus_tag LOCUS_10080 10452 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 11117 10482 gene locus_tag LOCUS_10090 11117 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 12258 11128 gene locus_tag LOCUS_10100 12258 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 12517 13515 gene locus_tag LOCUS_10110 12517 13515 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_10110 13508 14416 gene locus_tag LOCUS_10120 13508 14416 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_10120 15576 14374 gene locus_tag LOCUS_10130 15576 14374 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406273.1 protein_id gnl|my_center|LOCUS_10130 15703 16089 gene locus_tag LOCUS_10140 15703 16089 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_10140 16142 17830 gene locus_tag LOCUS_10150 16142 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 17917 18234 gene locus_tag LOCUS_10160 17917 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 18935 18216 gene locus_tag LOCUS_10170 18935 18216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10170 20323 18989 gene locus_tag LOCUS_10180 gene glnA 20323 18989 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_10180 21365 20349 gene locus_tag LOCUS_10190 21365 20349 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_10190 21620 23479 gene locus_tag LOCUS_10200 21620 23479 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_10200 23472 24155 gene locus_tag LOCUS_10210 23472 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 24327 25265 gene locus_tag LOCUS_10220 24327 25265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 <26443 25528 gene locus_tag LOCUS_10230 <26443 25528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270110.1:HAD-IB family hydrolase >Feature sequence029 919 2169 gene locus_tag LOCUS_10240 gene ccrA 919 2169 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_10240 2166 3059 gene locus_tag LOCUS_10250 2166 3059 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_10250 4522 3113 gene locus_tag LOCUS_10260 4522 3113 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_10260 6763 4571 gene locus_tag LOCUS_10270 6763 4571 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748465.1 protein_id gnl|my_center|LOCUS_10270 6653 6913 gene locus_tag LOCUS_10280 6653 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6914 7630 gene locus_tag LOCUS_10290 6914 7630 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892083.1 protein_id gnl|my_center|LOCUS_10290 9643 7670 gene locus_tag LOCUS_10300 9643 7670 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_10300 10231 9656 gene locus_tag LOCUS_10310 10231 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10527 11693 gene locus_tag LOCUS_10320 10527 11693 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895548.1 protein_id gnl|my_center|LOCUS_10320 11696 13774 gene locus_tag LOCUS_10330 11696 13774 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748465.1 protein_id gnl|my_center|LOCUS_10330 13774 15459 gene locus_tag LOCUS_10340 13774 15459 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_10340 15459 15647 gene locus_tag LOCUS_10350 15459 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 15644 17254 gene locus_tag LOCUS_10360 15644 17254 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727774.1 protein_id gnl|my_center|LOCUS_10360 17733 17407 gene locus_tag LOCUS_10370 17733 17407 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403376.1 protein_id gnl|my_center|LOCUS_10370 18053 17730 gene locus_tag LOCUS_10380 18053 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 19841 18591 gene locus_tag LOCUS_10390 19841 18591 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_10390 20465 20935 gene locus_tag LOCUS_10400 20465 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 21573 20965 gene locus_tag LOCUS_10410 gene phoU 21573 20965 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804558.1 protein_id gnl|my_center|LOCUS_10410 24644 21603 gene locus_tag LOCUS_10420 24644 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 25094 24687 gene locus_tag LOCUS_10430 25094 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence030 1566 349 gene locus_tag LOCUS_10440 1566 349 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486609.1 protein_id gnl|my_center|LOCUS_10440 1845 2780 gene locus_tag LOCUS_10450 1845 2780 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057210.1 protein_id gnl|my_center|LOCUS_10450 3006 3380 gene locus_tag LOCUS_10460 3006 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3377 3673 gene locus_tag LOCUS_10470 3377 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3794 3997 gene locus_tag LOCUS_10480 3794 3997 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_10480 5585 4212 gene locus_tag LOCUS_10490 5585 4212 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_10490 7068 5770 gene locus_tag LOCUS_10500 7068 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 8018 7065 gene locus_tag LOCUS_10510 8018 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 8820 8032 gene locus_tag LOCUS_10520 8820 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 10310 8817 gene locus_tag LOCUS_10530 10310 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 10941 10507 gene locus_tag LOCUS_10540 10941 10507 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_10540 11168 10899 gene locus_tag LOCUS_10550 11168 10899 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402915.1 protein_id gnl|my_center|LOCUS_10550 11589 11212 gene locus_tag LOCUS_10560 11589 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11908 13704 gene locus_tag LOCUS_10570 11908 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 13805 14758 gene locus_tag LOCUS_10580 13805 14758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_10580 14755 15693 gene locus_tag LOCUS_10590 14755 15693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_10590 15812 16657 gene locus_tag LOCUS_10600 15812 16657 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_10600 16669 17190 gene locus_tag LOCUS_10610 16669 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10610 17266 18363 gene locus_tag LOCUS_10620 17266 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10620 18449 20104 gene locus_tag LOCUS_10630 18449 20104 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226313.1 protein_id gnl|my_center|LOCUS_10630 20417 21667 gene locus_tag LOCUS_10640 20417 21667 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_10640 22825 21743 gene locus_tag LOCUS_10650 22825 21743 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_10650 24228 24716 gene locus_tag LOCUS_10660 24228 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence031 220 3840 gene locus_tag LOCUS_10670 220 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3904 5685 gene locus_tag LOCUS_10680 3904 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5780 6760 gene locus_tag LOCUS_10690 5780 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8304 6874 gene locus_tag LOCUS_10700 8304 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9922 8246 gene locus_tag LOCUS_10710 9922 8246 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_10710 10355 10969 gene locus_tag LOCUS_10720 10355 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11256 11732 gene locus_tag LOCUS_10730 11256 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12717 11698 gene locus_tag LOCUS_10740 12717 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 13069 12722 gene locus_tag LOCUS_10750 13069 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13938 13648 gene locus_tag LOCUS_10760 13938 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 14362 15648 gene locus_tag LOCUS_10770 14362 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 16138 15695 gene locus_tag LOCUS_10780 16138 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 18140 17205 gene locus_tag LOCUS_10790 gene xerD 18140 17205 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389683.1 protein_id gnl|my_center|LOCUS_10790 18769 18137 gene locus_tag LOCUS_10800 18769 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 20425 18773 gene locus_tag LOCUS_10810 20425 18773 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_10810 22192 20537 gene locus_tag LOCUS_10820 gene recN 22192 20537 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_10820 23165 22248 gene locus_tag LOCUS_10830 23165 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 24019 23177 gene locus_tag LOCUS_10840 24019 23177 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence032 1919 345 gene locus_tag LOCUS_10850 1919 345 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_10850 3053 1965 gene locus_tag LOCUS_10860 3053 1965 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205073.1 protein_id gnl|my_center|LOCUS_10860 3926 3234 gene locus_tag LOCUS_10870 3926 3234 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_10870 6427 3926 gene locus_tag LOCUS_10880 6427 3926 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 6953 6429 gene locus_tag LOCUS_10890 gene cutC 6953 6429 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_10890 7855 6953 gene locus_tag LOCUS_10900 7855 6953 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_10900 9056 8052 gene locus_tag LOCUS_10910 9056 8052 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_10910 9835 9053 gene locus_tag LOCUS_10920 9835 9053 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_10920 11541 9964 gene locus_tag LOCUS_10930 11541 9964 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 protein_id gnl|my_center|LOCUS_10930 12699 11557 gene locus_tag LOCUS_10940 12699 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 13715 12792 gene locus_tag LOCUS_10950 13715 12792 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_10950 14884 13712 gene locus_tag LOCUS_10960 14884 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 15791 14895 gene locus_tag LOCUS_10970 15791 14895 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728150.1 protein_id gnl|my_center|LOCUS_10970 17059 15788 gene locus_tag LOCUS_10980 17059 15788 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_10980 18126 17056 gene locus_tag LOCUS_10990 18126 17056 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234306381.1 protein_id gnl|my_center|LOCUS_10990 18238 19869 gene locus_tag LOCUS_11000 18238 19869 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_11000 21052 19904 gene locus_tag LOCUS_11010 21052 19904 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533159.1 protein_id gnl|my_center|LOCUS_11010 21933 21049 gene locus_tag LOCUS_11020 21933 21049 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528427.1 protein_id gnl|my_center|LOCUS_11020 22727 21930 gene locus_tag LOCUS_11030 22727 21930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870166.1 protein_id gnl|my_center|LOCUS_11030 23527 22724 gene locus_tag LOCUS_11040 23527 22724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533156.1 protein_id gnl|my_center|LOCUS_11040 <24680 23531 gene locus_tag LOCUS_11050 <24680 23531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970052.1:ABC transporter substrate-binding protein >Feature sequence033 392 3319 gene locus_tag LOCUS_11060 gene topA 392 3319 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_11060 3316 3966 gene locus_tag LOCUS_11070 3316 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3963 5147 gene locus_tag LOCUS_11080 3963 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5306 5379 gene locus_tag LOCUS_t00190 5306 5379 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5383 6783 gene locus_tag LOCUS_11090 5383 6783 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_11090 8170 6749 gene locus_tag LOCUS_11100 gene murD 8170 6749 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_11100 9609 8167 gene locus_tag LOCUS_11110 gene murL 9609 8167 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_11110 10472 9645 gene locus_tag LOCUS_11120 gene pgeF 10472 9645 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_11120 10608 11183 gene locus_tag LOCUS_11130 gene sigR 10608 11183 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_11130 11242 11550 gene locus_tag LOCUS_11140 11242 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 11547 12728 gene locus_tag LOCUS_11150 11547 12728 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_11150 12725 14344 gene locus_tag LOCUS_11160 12725 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 14373 14924 gene locus_tag LOCUS_11170 gene folE 14373 14924 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_11170 14997 15941 gene locus_tag LOCUS_11180 gene folP 14997 15941 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_11180 15938 16459 gene locus_tag LOCUS_11190 15938 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 16456 16824 gene locus_tag LOCUS_11200 gene folB 16456 16824 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113138.1 protein_id gnl|my_center|LOCUS_11200 16808 17299 gene locus_tag LOCUS_11210 gene folK 16808 17299 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613722.1 protein_id gnl|my_center|LOCUS_11210 17424 19184 gene locus_tag LOCUS_11220 17424 19184 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_11220 19188 20048 gene locus_tag LOCUS_11230 19188 20048 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_11230 20045 21526 gene locus_tag LOCUS_11240 gene lysS 20045 21526 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_11240 22678 21650 gene locus_tag LOCUS_11250 22678 21650 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence034 879 181 gene locus_tag LOCUS_11260 879 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1062 1457 gene locus_tag LOCUS_11270 1062 1457 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_11270 1592 3820 gene locus_tag LOCUS_11280 1592 3820 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775729.1 protein_id gnl|my_center|LOCUS_11280 5124 3850 gene locus_tag LOCUS_11290 5124 3850 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_11290 5243 6172 gene locus_tag LOCUS_11300 5243 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6208 6492 gene locus_tag LOCUS_11310 6208 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6505 6780 gene locus_tag LOCUS_11320 6505 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6839 8464 gene locus_tag LOCUS_11330 6839 8464 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_11330 10118 8394 gene locus_tag LOCUS_11340 10118 8394 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229303.1 protein_id gnl|my_center|LOCUS_11340 12896 10377 gene locus_tag LOCUS_11350 gene gyrA 12896 10377 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_11350 14833 12911 gene locus_tag LOCUS_11360 gene gyrB 14833 12911 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_11360 15467 15066 gene locus_tag LOCUS_11370 15467 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 16567 15464 gene locus_tag LOCUS_11380 gene recF 16567 15464 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_11380 17631 16594 gene locus_tag LOCUS_11390 gene dnaN 17631 16594 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_11390 19423 17963 gene locus_tag LOCUS_11400 gene dnaA 19423 17963 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950320.1 protein_id gnl|my_center|LOCUS_11400 19840 20220 gene locus_tag LOCUS_11410 19840 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 20217 20558 gene locus_tag LOCUS_11420 20217 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 20555 21766 gene locus_tag LOCUS_11430 20555 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 21769 22857 gene locus_tag LOCUS_11440 21769 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 23046 23591 gene locus_tag LOCUS_11450 23046 23591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 24210 23683 gene locus_tag LOCUS_11460 24210 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence035 203 2317 gene locus_tag LOCUS_11470 203 2317 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821440.1 protein_id gnl|my_center|LOCUS_11470 2658 3701 gene locus_tag LOCUS_11480 2658 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4748 3798 gene locus_tag LOCUS_11490 4748 3798 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_11490 5692 4763 gene locus_tag LOCUS_11500 gene era 5692 4763 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_11500 7019 5700 gene locus_tag LOCUS_11510 7019 5700 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_11510 7525 7016 gene locus_tag LOCUS_11520 gene ybeY 7525 7016 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_11520 8570 7515 gene locus_tag LOCUS_11530 8570 7515 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_11530 8878 8555 gene locus_tag LOCUS_11540 8878 8555 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_11540 9147 8908 gene locus_tag LOCUS_11550 9147 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 9958 9185 gene locus_tag LOCUS_11560 9958 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 11159 10014 gene locus_tag LOCUS_11570 gene dnaJ 11159 10014 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074629.1 protein_id gnl|my_center|LOCUS_11570 12231 11146 gene locus_tag LOCUS_11580 gene hrcA 12231 11146 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_11580 14183 12366 gene locus_tag LOCUS_11590 gene lepA 14183 12366 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729920.1 protein_id gnl|my_center|LOCUS_11590 14404 14667 gene locus_tag LOCUS_11600 gene rpsT 14404 14667 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_11600 15759 14704 gene locus_tag LOCUS_11610 15759 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 16706 15756 gene locus_tag LOCUS_11620 gene folP 16706 15756 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776664.1 protein_id gnl|my_center|LOCUS_11620 18305 17163 gene locus_tag LOCUS_11630 18305 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 19764 18319 gene locus_tag LOCUS_11640 19764 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 19948 21465 gene locus_tag LOCUS_11650 19948 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 21462 24266 gene locus_tag LOCUS_11660 21462 24266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence036 <1 781 gene locus_tag LOCUS_11670 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051156418.1:quinolinate synthase NadA 971 2176 gene locus_tag LOCUS_11680 971 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5333 2430 gene locus_tag LOCUS_11690 gene uvrA 5333 2430 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_11690 5596 6234 gene locus_tag LOCUS_11700 gene satP 5596 6234 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_11700 8176 6296 gene locus_tag LOCUS_11710 8176 6296 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_11710 8652 8386 gene locus_tag LOCUS_11720 8652 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 8539 8775 gene locus_tag LOCUS_11730 8539 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 9904 8753 gene locus_tag LOCUS_11740 gene thrC 9904 8753 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_11740 11580 9901 gene locus_tag LOCUS_11750 11580 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13856 11784 gene locus_tag LOCUS_11760 gene uvrB 13856 11784 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11760 14626 13934 gene locus_tag LOCUS_11770 14626 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 15554 14673 gene locus_tag LOCUS_11780 15554 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 15784 20526 gene locus_tag LOCUS_11790 15784 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 21791 20472 gene locus_tag LOCUS_11800 21791 20472 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_11800 22670 21969 gene locus_tag LOCUS_11810 22670 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 22720 22848 gene locus_tag LOCUS_11820 22720 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 23038 23985 gene locus_tag LOCUS_11830 23038 23985 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080538.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence037 1276 290 gene locus_tag LOCUS_11840 1276 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2481 1354 gene locus_tag LOCUS_11850 2481 1354 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_11850 2822 3793 gene locus_tag LOCUS_11860 2822 3793 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_11860 5365 3776 gene locus_tag LOCUS_11870 5365 3776 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_11870 6003 5362 gene locus_tag LOCUS_11880 6003 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6054 6476 gene locus_tag LOCUS_11890 6054 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6549 7061 gene locus_tag LOCUS_11900 6549 7061 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_11900 7231 7995 gene locus_tag LOCUS_11910 gene mutY 7231 7995 CDS product A/G-specific adenine glycosylase MutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731026.1 protein_id gnl|my_center|LOCUS_11910 8081 8629 gene locus_tag LOCUS_11920 gene rfbC 8081 8629 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140473.1 protein_id gnl|my_center|LOCUS_11920 9333 8734 gene locus_tag LOCUS_11930 9333 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9494 10225 gene locus_tag LOCUS_11940 9494 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 12460 10286 gene locus_tag LOCUS_11950 12460 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 13302 12466 gene locus_tag LOCUS_11960 13302 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 16061 13377 gene locus_tag LOCUS_11970 16061 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 16739 16236 gene locus_tag LOCUS_11980 16739 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 18390 16762 gene locus_tag LOCUS_11990 18390 16762 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_11990 18718 20118 gene locus_tag LOCUS_12000 gene sufB 18718 20118 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_12000 20237 20578 gene locus_tag LOCUS_12010 20237 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 21524 20649 gene locus_tag LOCUS_12020 21524 20649 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_12020 21578 22915 gene locus_tag LOCUS_12030 gene sufD 21578 22915 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_12030 22908 23225 gene locus_tag LOCUS_12040 22908 23225 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence038 1094 1582 gene locus_tag LOCUS_12050 1094 1582 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899658.1 protein_id gnl|my_center|LOCUS_12050 1657 1866 gene locus_tag LOCUS_12060 1657 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1899 2342 gene locus_tag LOCUS_12070 1899 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2478 5468 gene locus_tag LOCUS_12080 2478 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3918 4012 gene locus_tag LOCUS_t00200 3918 4012 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5491 6390 gene locus_tag LOCUS_12090 5491 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6453 7628 gene locus_tag LOCUS_12100 6453 7628 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143157.1 protein_id gnl|my_center|LOCUS_12100 8870 7674 gene locus_tag LOCUS_12110 8870 7674 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_12110 9060 9542 gene locus_tag LOCUS_12120 9060 9542 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_12120 10064 9663 gene locus_tag LOCUS_12130 10064 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 11231 10488 gene locus_tag LOCUS_12140 11231 10488 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088322.1 protein_id gnl|my_center|LOCUS_12140 11321 12028 gene locus_tag LOCUS_12150 11321 12028 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909164.1 protein_id gnl|my_center|LOCUS_12150 13339 13632 gene locus_tag LOCUS_12160 13339 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13759 14664 gene locus_tag LOCUS_12170 13759 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 15277 14726 gene locus_tag LOCUS_12180 15277 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 15451 15699 gene locus_tag LOCUS_12190 15451 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 16371 15787 gene locus_tag LOCUS_12200 16371 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 16537 17280 gene locus_tag LOCUS_12210 16537 17280 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 protein_id gnl|my_center|LOCUS_12210 17291 19648 gene locus_tag LOCUS_12220 17291 19648 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_12220 19770 20294 gene locus_tag LOCUS_12230 19770 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 21394 20264 gene locus_tag LOCUS_12240 21394 20264 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_12240 21863 21450 gene locus_tag LOCUS_12250 21863 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 22375 22097 gene locus_tag LOCUS_12260 22375 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 22425 22979 gene locus_tag LOCUS_12270 22425 22979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence039 994 1416 gene locus_tag LOCUS_12280 994 1416 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_12280 1442 3088 gene locus_tag LOCUS_12290 1442 3088 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_12290 3108 6677 gene locus_tag LOCUS_12300 gene nifJ 3108 6677 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_12300 6679 7689 gene locus_tag LOCUS_12310 6679 7689 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_12310 7754 10168 gene locus_tag LOCUS_12320 gene ppsA 7754 10168 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_12320 10931 10524 gene locus_tag LOCUS_12330 10931 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11546 11106 gene locus_tag LOCUS_12340 11546 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 11872 11543 gene locus_tag LOCUS_12350 11872 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 12202 12032 gene locus_tag LOCUS_12360 12202 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12727 12879 gene locus_tag LOCUS_12370 12727 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 12968 17308 gene locus_tag LOCUS_12380 12968 17308 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909023.1 protein_id gnl|my_center|LOCUS_12380 18802 17549 gene locus_tag LOCUS_12390 18802 17549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_12390 19653 18928 gene locus_tag LOCUS_12400 19653 18928 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057268.1 protein_id gnl|my_center|LOCUS_12400 20309 19650 gene locus_tag LOCUS_12410 20309 19650 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_12410 23170 20309 gene locus_tag LOCUS_12420 23170 20309 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence040 327 1091 gene locus_tag LOCUS_12430 327 1091 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_12430 1250 2128 gene locus_tag LOCUS_12440 1250 2128 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_12440 2131 2616 gene locus_tag LOCUS_12450 2131 2616 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_12450 2613 5006 gene locus_tag LOCUS_12460 2613 5006 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_12460 5003 5896 gene locus_tag LOCUS_12470 5003 5896 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_12470 5898 6794 gene locus_tag LOCUS_12480 5898 6794 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462180.1 protein_id gnl|my_center|LOCUS_12480 6835 8037 gene locus_tag LOCUS_12490 6835 8037 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950389.1 protein_id gnl|my_center|LOCUS_12490 8991 8044 gene locus_tag LOCUS_12500 8991 8044 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339158.1 protein_id gnl|my_center|LOCUS_12500 9221 9517 gene locus_tag LOCUS_12510 9221 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 9514 10401 gene locus_tag LOCUS_12520 9514 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 10405 11724 gene locus_tag LOCUS_12530 10405 11724 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 protein_id gnl|my_center|LOCUS_12530 11721 12308 gene locus_tag LOCUS_12540 11721 12308 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_12540 12316 12705 gene locus_tag LOCUS_12550 12316 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 12696 13589 gene locus_tag LOCUS_12560 12696 13589 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112326.1 protein_id gnl|my_center|LOCUS_12560 13601 14167 gene locus_tag LOCUS_12570 13601 14167 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530298.1 protein_id gnl|my_center|LOCUS_12570 14164 15363 gene locus_tag LOCUS_12580 14164 15363 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_12580 15436 16452 gene locus_tag LOCUS_12590 15436 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 16496 17473 gene locus_tag LOCUS_12600 16496 17473 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_12600 17470 18519 gene locus_tag LOCUS_12610 17470 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 18799 19866 gene locus_tag LOCUS_12620 18799 19866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 protein_id gnl|my_center|LOCUS_12620 19900 21468 gene locus_tag LOCUS_12630 19900 21468 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388002.1 protein_id gnl|my_center|LOCUS_12630 21465 22592 gene locus_tag LOCUS_12640 21465 22592 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence041 1920 955 gene locus_tag LOCUS_12650 1920 955 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_12650 2740 1973 gene locus_tag LOCUS_12660 2740 1973 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_12660 2824 5520 gene locus_tag LOCUS_12670 2824 5520 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 protein_id gnl|my_center|LOCUS_12670 6642 5602 gene locus_tag LOCUS_12680 6642 5602 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_12680 6734 7384 gene locus_tag LOCUS_12690 6734 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7427 8965 gene locus_tag LOCUS_12700 7427 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 10423 8957 gene locus_tag LOCUS_12710 10423 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 12476 10500 gene locus_tag LOCUS_12720 12476 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 12982 12515 gene locus_tag LOCUS_12730 12982 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 14153 13008 gene locus_tag LOCUS_12740 14153 13008 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591937.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 15620 14394 gene locus_tag LOCUS_12750 15620 14394 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_12750 16752 15622 gene locus_tag LOCUS_12760 16752 15622 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_12760 19130 16749 gene locus_tag LOCUS_12770 19130 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 17125 17043 gene locus_tag LOCUS_t00210 17125 17043 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19301 20047 gene locus_tag LOCUS_12780 19301 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 21246 20101 gene locus_tag LOCUS_12790 21246 20101 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_12790 21546 21262 gene locus_tag LOCUS_12800 21546 21262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 22977 21721 gene locus_tag LOCUS_12810 22977 21721 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence042 1776 193 gene locus_tag LOCUS_12820 1776 193 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_12820 2186 1866 gene locus_tag LOCUS_12830 2186 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3078 2275 gene locus_tag LOCUS_12840 3078 2275 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114532.1 protein_id gnl|my_center|LOCUS_12840 3525 3142 gene locus_tag LOCUS_12850 3525 3142 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_12850 3896 3603 gene locus_tag LOCUS_12860 3896 3603 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_12860 4298 3945 gene locus_tag LOCUS_12870 gene rplS 4298 3945 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_12870 5100 4285 gene locus_tag LOCUS_12880 gene trmD 5100 4285 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140891.1 protein_id gnl|my_center|LOCUS_12880 5609 5106 gene locus_tag LOCUS_12890 gene rimM 5609 5106 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 protein_id gnl|my_center|LOCUS_12890 6246 5590 gene locus_tag LOCUS_12900 6246 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 6704 6243 gene locus_tag LOCUS_12910 6704 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8394 6805 gene locus_tag LOCUS_12920 gene ffh 8394 6805 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_12920 9593 8454 gene locus_tag LOCUS_12930 gene ftsY 9593 8454 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223799.1 protein_id gnl|my_center|LOCUS_12930 13458 9943 gene locus_tag LOCUS_12940 13458 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14458 13556 gene locus_tag LOCUS_12950 gene mutM 14458 13556 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_12950 15146 14451 gene locus_tag LOCUS_12960 gene rnc 15146 14451 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_12960 15453 15157 gene locus_tag LOCUS_12970 gene acpP 15453 15157 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 protein_id gnl|my_center|LOCUS_12970 16567 15488 gene locus_tag LOCUS_12980 gene plsX 16567 15488 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_12980 16748 16569 gene locus_tag LOCUS_12990 gene rpmF 16748 16569 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_12990 17407 16871 gene locus_tag LOCUS_13000 17407 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 18083 17505 gene locus_tag LOCUS_13010 18083 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 18604 18083 gene locus_tag LOCUS_13020 gene coaD 18604 18083 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_13020 19155 18601 gene locus_tag LOCUS_13030 gene rsmD 19155 18601 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234708061.1 protein_id gnl|my_center|LOCUS_13030 19227 20507 gene locus_tag LOCUS_13040 19227 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 <21803 20522 gene locus_tag LOCUS_13050 <21803 20522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141278.1:ATP-dependent DNA helicase RecG >Feature sequence043 1370 453 gene locus_tag LOCUS_13060 1370 453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_13060 3042 1423 gene locus_tag LOCUS_13070 3042 1423 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_13070 4034 3192 gene locus_tag LOCUS_13080 4034 3192 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222017.1 protein_id gnl|my_center|LOCUS_13080 4119 5351 gene locus_tag LOCUS_13090 4119 5351 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 protein_id gnl|my_center|LOCUS_13090 5353 6384 gene locus_tag LOCUS_13100 5353 6384 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_13100 6381 7847 gene locus_tag LOCUS_13110 6381 7847 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284833.1 protein_id gnl|my_center|LOCUS_13110 7844 8659 gene locus_tag LOCUS_13120 7844 8659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_13120 8764 9573 gene locus_tag LOCUS_13130 8764 9573 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974366.1 protein_id gnl|my_center|LOCUS_13130 9638 10384 gene locus_tag LOCUS_13140 9638 10384 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_13140 10758 11549 gene locus_tag LOCUS_13150 10758 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 13107 11827 gene locus_tag LOCUS_13160 13107 11827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_13160 14443 13226 gene locus_tag LOCUS_13170 gene ilvA 14443 13226 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_13170 14554 15039 gene locus_tag LOCUS_13180 14554 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 14943 15227 gene locus_tag LOCUS_13190 14943 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 15564 16487 gene locus_tag LOCUS_13200 15564 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 16563 16994 gene locus_tag LOCUS_13210 16563 16994 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_13210 16991 18592 gene locus_tag LOCUS_13220 16991 18592 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_13220 19041 18661 gene locus_tag LOCUS_13230 19041 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 19173 20357 gene locus_tag LOCUS_13240 19173 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 20757 21527 gene locus_tag LOCUS_13250 20757 21527 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence044 1303 128 gene locus_tag LOCUS_13260 1303 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13260 1468 1677 gene locus_tag LOCUS_13270 gene rpmB 1468 1677 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_13270 1778 2980 gene locus_tag LOCUS_13280 1778 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3905 3003 gene locus_tag LOCUS_13290 3905 3003 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_13290 4129 5937 gene locus_tag LOCUS_13300 4129 5937 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_13300 6026 7711 gene locus_tag LOCUS_13310 6026 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 8860 7748 gene locus_tag LOCUS_13320 8860 7748 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931215.1 protein_id gnl|my_center|LOCUS_13320 8864 9010 gene locus_tag LOCUS_13330 8864 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9026 9922 gene locus_tag LOCUS_13340 9026 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 11052 9877 gene locus_tag LOCUS_13350 gene trpD 11052 9877 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_13350 12238 11033 gene locus_tag LOCUS_13360 12238 11033 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064857.1 protein_id gnl|my_center|LOCUS_13360 12526 12290 gene locus_tag LOCUS_13370 12526 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 13321 12695 gene locus_tag LOCUS_13380 13321 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 13746 13327 gene locus_tag LOCUS_13390 13746 13327 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_13390 14309 13884 gene locus_tag LOCUS_13400 14309 13884 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_13400 14555 16111 gene locus_tag LOCUS_13410 14555 16111 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_13410 16108 17613 gene locus_tag LOCUS_13420 gene glpK 16108 17613 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_13420 17623 18741 gene locus_tag LOCUS_13430 17623 18741 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_13430 18777 19685 gene locus_tag LOCUS_13440 18777 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence045 455 180 gene locus_tag LOCUS_13450 455 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2297 525 gene locus_tag LOCUS_13460 2297 525 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_13460 4080 2539 gene locus_tag LOCUS_13470 gene glpK 4080 2539 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705539.1 protein_id gnl|my_center|LOCUS_13470 4213 5127 gene locus_tag LOCUS_13480 4213 5127 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_13480 5120 6244 gene locus_tag LOCUS_13490 5120 6244 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_13490 6241 7404 gene locus_tag LOCUS_13500 6241 7404 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_13500 7401 8537 gene locus_tag LOCUS_13510 7401 8537 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_13510 8549 9466 gene locus_tag LOCUS_13520 8549 9466 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_13520 9801 9442 gene locus_tag LOCUS_13530 9801 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 9960 13217 gene locus_tag LOCUS_13540 9960 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 13214 14719 gene locus_tag LOCUS_13550 13214 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 16975 14753 gene locus_tag LOCUS_13560 gene ftsH 16975 14753 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_13560 17123 18208 gene locus_tag LOCUS_13570 17123 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 18387 20789 gene locus_tag LOCUS_13580 18387 20789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence046 380 475 gene locus_tag LOCUS_t00220 380 475 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 962 1375 gene locus_tag LOCUS_13590 gene rplK 962 1375 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_13590 1401 2126 gene locus_tag LOCUS_13600 gene rplA 1401 2126 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_13600 2317 3000 gene locus_tag LOCUS_13610 2317 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3070 3468 gene locus_tag LOCUS_13620 gene rplL 3070 3468 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112006.1 protein_id gnl|my_center|LOCUS_13620 4085 3816 gene locus_tag LOCUS_13630 4085 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4033 7590 gene locus_tag LOCUS_13640 gene rpoB 4033 7590 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_13640 7590 11696 gene locus_tag LOCUS_13650 7590 11696 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_13650 11838 12209 gene locus_tag LOCUS_13660 gene rpsL 11838 12209 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_13660 12211 12681 gene locus_tag LOCUS_13670 gene rpsG 12211 12681 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908590.1 protein_id gnl|my_center|LOCUS_13670 12715 14814 gene locus_tag LOCUS_13680 gene fusA 12715 14814 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_13680 14987 14754 gene locus_tag LOCUS_13690 14987 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 14935 16122 gene locus_tag LOCUS_13700 gene tuf 14935 16122 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055596.1 protein_id gnl|my_center|LOCUS_13700 16166 16492 gene locus_tag LOCUS_13710 gene rpsJ 16166 16492 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_13710 16748 17410 gene locus_tag LOCUS_13720 gene rplC 16748 17410 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_13720 17407 18189 gene locus_tag LOCUS_13730 gene rplD 17407 18189 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_13730 18189 18479 gene locus_tag LOCUS_13740 18189 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 18486 19322 gene locus_tag LOCUS_13750 gene rplB 18486 19322 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_13750 19335 19613 gene locus_tag LOCUS_13760 gene rpsS 19335 19613 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence047 35 2173 gene locus_tag LOCUS_13770 35 2173 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530454.1 protein_id gnl|my_center|LOCUS_13770 4314 2203 gene locus_tag LOCUS_13780 gene pknB 4314 2203 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_13780 5907 4417 gene locus_tag LOCUS_13790 gene mmsA 5907 4417 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_13790 7277 5940 gene locus_tag LOCUS_13800 7277 5940 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_13800 7465 9123 gene locus_tag LOCUS_13810 7465 9123 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270376.1 protein_id gnl|my_center|LOCUS_13810 11451 9148 gene locus_tag LOCUS_13820 gene ligA 11451 9148 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813875.1 protein_id gnl|my_center|LOCUS_13820 12566 11448 gene locus_tag LOCUS_13830 gene mnmA 12566 11448 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415909.1 protein_id gnl|my_center|LOCUS_13830 13774 12587 gene locus_tag LOCUS_13840 gene nifS 13774 12587 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_13840 15205 13808 gene locus_tag LOCUS_13850 15205 13808 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912534.1 protein_id gnl|my_center|LOCUS_13850 18696 15484 gene locus_tag LOCUS_13860 gene ileS 18696 15484 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence048 284 1744 gene locus_tag LOCUS_13870 284 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2169 1798 gene locus_tag LOCUS_13880 2169 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3474 2254 gene locus_tag LOCUS_13890 3474 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3673 3766 gene locus_tag LOCUS_t00230 3673 3766 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4260 4757 gene locus_tag LOCUS_13900 gene mug 4260 4757 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_13900 4843 5208 gene locus_tag LOCUS_13910 4843 5208 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_13910 5246 6160 gene locus_tag LOCUS_13920 5246 6160 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213071.1 protein_id gnl|my_center|LOCUS_13920 6218 6637 gene locus_tag LOCUS_13930 6218 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 6725 7999 gene locus_tag LOCUS_13940 6725 7999 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_13940 8201 9895 gene locus_tag LOCUS_13950 8201 9895 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_13950 10037 11476 gene locus_tag LOCUS_13960 10037 11476 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_13960 11470 12240 gene locus_tag LOCUS_13970 11470 12240 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_13970 12237 13442 gene locus_tag LOCUS_13980 12237 13442 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_13980 14147 13464 gene locus_tag LOCUS_13990 14147 13464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_13990 14740 14144 gene locus_tag LOCUS_14000 14740 14144 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_14000 17384 14772 gene locus_tag LOCUS_14010 17384 14772 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_14010 17383 18558 gene locus_tag LOCUS_14020 17383 18558 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390685.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence049 448 236 gene locus_tag LOCUS_14030 448 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 765 690 gene locus_tag LOCUS_t00240 765 690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1830 829 gene locus_tag LOCUS_14040 1830 829 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409345.1 protein_id gnl|my_center|LOCUS_14040 2685 1942 gene locus_tag LOCUS_14050 2685 1942 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_14050 2785 3969 gene locus_tag LOCUS_14060 2785 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5031 4000 gene locus_tag LOCUS_14070 gene speB 5031 4000 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_14070 5744 5028 gene locus_tag LOCUS_14080 5744 5028 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_14080 7239 5824 gene locus_tag LOCUS_14090 7239 5824 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_14090 7393 7465 gene locus_tag LOCUS_t00250 7393 7465 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7681 8160 gene locus_tag LOCUS_14100 7681 8160 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_14100 9332 8232 gene locus_tag LOCUS_14110 9332 8232 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_14110 10715 9384 gene locus_tag LOCUS_14120 10715 9384 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193455.1 protein_id gnl|my_center|LOCUS_14120 11631 11137 gene locus_tag LOCUS_14130 11631 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 12251 11649 gene locus_tag LOCUS_14140 12251 11649 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_14140 12632 12387 gene locus_tag LOCUS_14150 12632 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 14133 12817 gene locus_tag LOCUS_14160 gene dinB 14133 12817 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_14160 14920 14207 gene locus_tag LOCUS_14170 14920 14207 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_14170 15411 14941 gene locus_tag LOCUS_14180 gene nrdR 15411 14941 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224266.1 protein_id gnl|my_center|LOCUS_14180 16098 15529 gene locus_tag LOCUS_14190 16098 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 16317 16958 gene locus_tag LOCUS_14200 gene lexA 16317 16958 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_14200 18159 17002 gene locus_tag LOCUS_14210 gene dapE 18159 17002 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406235.1 protein_id gnl|my_center|LOCUS_14210 18980 18156 gene locus_tag LOCUS_14220 18980 18156 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence050 268 1143 gene locus_tag LOCUS_14230 268 1143 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_14230 1143 1643 gene locus_tag LOCUS_14240 1143 1643 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929961.1 protein_id gnl|my_center|LOCUS_14240 1816 4149 gene locus_tag LOCUS_14250 1816 4149 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_14250 4239 4847 gene locus_tag LOCUS_14260 4239 4847 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969630.1 protein_id gnl|my_center|LOCUS_14260 4972 5979 gene locus_tag LOCUS_14270 gene mer 4972 5979 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_14270 5976 6776 gene locus_tag LOCUS_14280 gene kduD 5976 6776 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_14280 6813 8474 gene locus_tag LOCUS_14290 6813 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8496 9653 gene locus_tag LOCUS_14300 8496 9653 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_14300 9685 10476 gene locus_tag LOCUS_14310 gene garL 9685 10476 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064097.1 protein_id gnl|my_center|LOCUS_14310 10796 12208 gene locus_tag LOCUS_14320 10796 12208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_14320 12384 12731 gene locus_tag LOCUS_14330 12384 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 12847 15150 gene locus_tag LOCUS_14340 12847 15150 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_14340 17474 15255 gene locus_tag LOCUS_14350 17474 15255 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 protein_id gnl|my_center|LOCUS_14350 17562 18278 gene locus_tag LOCUS_14360 17562 18278 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731344.1 protein_id gnl|my_center|LOCUS_14360 19086 18349 gene locus_tag LOCUS_14370 19086 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence051 1596 1057 gene locus_tag LOCUS_14380 1596 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2808 1681 gene locus_tag LOCUS_14390 2808 1681 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_14390 3668 2805 gene locus_tag LOCUS_14400 3668 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4307 3693 gene locus_tag LOCUS_14410 4307 3693 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777029.1 protein_id gnl|my_center|LOCUS_14410 6132 4267 gene locus_tag LOCUS_14420 6132 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6238 6723 gene locus_tag LOCUS_14430 6238 6723 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812075.1 protein_id gnl|my_center|LOCUS_14430 7190 8446 gene locus_tag LOCUS_14440 7190 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8443 9900 gene locus_tag LOCUS_14450 gene sufB 8443 9900 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_14450 9900 10706 gene locus_tag LOCUS_14460 gene sufC 9900 10706 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_14460 10703 12118 gene locus_tag LOCUS_14470 gene sufD 10703 12118 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_14470 12129 12680 gene locus_tag LOCUS_14480 gene sufT 12129 12680 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_14480 12783 13016 gene locus_tag LOCUS_14490 12783 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 13144 14313 gene locus_tag LOCUS_14500 13144 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 14667 15128 gene locus_tag LOCUS_14510 14667 15128 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_14510 15125 18040 gene locus_tag LOCUS_14520 gene acnA 15125 18040 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence052 <1 1572 gene locus_tag LOCUS_14530 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223633.1:ferredoxin reductase family protein 1619 2170 gene locus_tag LOCUS_14540 1619 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2172 3026 gene locus_tag LOCUS_14550 2172 3026 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_14550 3202 4032 gene locus_tag LOCUS_14560 3202 4032 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_14560 5022 4090 gene locus_tag LOCUS_14570 5022 4090 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_14570 5065 5934 gene locus_tag LOCUS_14580 5065 5934 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_14580 6462 5962 gene locus_tag LOCUS_14590 6462 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 6534 7532 gene locus_tag LOCUS_14600 6534 7532 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_14600 7549 8022 gene locus_tag LOCUS_14610 7549 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 9802 8087 gene locus_tag LOCUS_14620 9802 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 10197 12107 gene locus_tag LOCUS_14630 10197 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13052 12621 gene locus_tag LOCUS_14640 13052 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 14494 13214 gene locus_tag LOCUS_14650 14494 13214 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_14650 15411 14491 gene locus_tag LOCUS_14660 15411 14491 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942741.1 protein_id gnl|my_center|LOCUS_14660 17357 15417 gene locus_tag LOCUS_14670 gene cooS 17357 15417 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_14670 18060 17425 gene locus_tag LOCUS_14680 18060 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence053 419 171 gene locus_tag LOCUS_14690 419 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 309 1052 gene locus_tag LOCUS_14700 309 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1070 2005 gene locus_tag LOCUS_14710 1070 2005 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_14710 2273 3547 gene locus_tag LOCUS_14720 2273 3547 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_14720 3537 7046 gene locus_tag LOCUS_14730 3537 7046 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_14730 7642 7064 gene locus_tag LOCUS_14740 7642 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 10656 7834 gene locus_tag LOCUS_14750 10656 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 11035 10658 gene locus_tag LOCUS_14760 11035 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 11574 11074 gene locus_tag LOCUS_14770 11574 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 11915 11586 gene locus_tag LOCUS_14780 11915 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 12650 12447 gene locus_tag LOCUS_14790 12650 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 13601 12696 gene locus_tag LOCUS_14800 13601 12696 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_14800 14467 13598 gene locus_tag LOCUS_14810 14467 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 15852 14464 gene locus_tag LOCUS_14820 15852 14464 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_14820 16727 15849 gene locus_tag LOCUS_14830 16727 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 17431 16730 gene locus_tag LOCUS_14840 17431 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 18325 17447 gene locus_tag LOCUS_14850 18325 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence054 320 514 gene locus_tag LOCUS_14860 320 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 868 524 gene locus_tag LOCUS_14870 868 524 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_14870 1043 2650 gene locus_tag LOCUS_14880 1043 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2647 3924 gene locus_tag LOCUS_14890 2647 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14890 4003 5211 gene locus_tag LOCUS_14900 4003 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14900 5198 5530 gene locus_tag LOCUS_14910 5198 5530 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404784.1 protein_id gnl|my_center|LOCUS_14910 5654 6739 gene locus_tag LOCUS_14920 5654 6739 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_14920 7048 6836 gene locus_tag LOCUS_14930 7048 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6998 7537 gene locus_tag LOCUS_14940 6998 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 9198 7495 gene locus_tag LOCUS_14950 gene ilvD 9198 7495 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908989.1 protein_id gnl|my_center|LOCUS_14950 9397 10614 gene locus_tag LOCUS_14960 9397 10614 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_14960 11098 12552 gene locus_tag LOCUS_14970 11098 12552 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_14970 12839 12630 gene locus_tag LOCUS_14980 12839 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 13035 12871 gene locus_tag LOCUS_14990 13035 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 13580 13242 gene locus_tag LOCUS_15000 13580 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 13936 13577 gene locus_tag LOCUS_15010 13936 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 14071 14439 gene locus_tag LOCUS_15020 14071 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 15816 14842 gene locus_tag LOCUS_15030 15816 14842 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113238.1 protein_id gnl|my_center|LOCUS_15030 16737 16264 gene locus_tag LOCUS_15040 16737 16264 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_15040 17059 17469 gene locus_tag LOCUS_15050 17059 17469 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_15050 17466 18086 gene locus_tag LOCUS_15060 17466 18086 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence055 <1 2070 gene locus_tag LOCUS_15070 <1 2070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727975.1:preprotein translocase subunit SecA 2057 3184 gene locus_tag LOCUS_15080 gene prfB 2057 3184 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_15080 3333 4193 gene locus_tag LOCUS_15090 gene ftsE 3333 4193 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_15090 4193 5077 gene locus_tag LOCUS_15100 gene ftsX 4193 5077 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_15100 5216 5620 gene locus_tag LOCUS_15110 5216 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5617 5952 gene locus_tag LOCUS_15120 5617 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6308 5904 gene locus_tag LOCUS_15130 gene msrB 6308 5904 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 protein_id gnl|my_center|LOCUS_15130 6427 7059 gene locus_tag LOCUS_15140 6427 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7056 7310 gene locus_tag LOCUS_15150 7056 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7307 8047 gene locus_tag LOCUS_15160 7307 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8044 9198 gene locus_tag LOCUS_15170 gene hemW 8044 9198 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_15170 9195 10574 gene locus_tag LOCUS_15180 9195 10574 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_15180 10696 13614 gene locus_tag LOCUS_15190 gene ppdK 10696 13614 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_15190 13736 15658 gene locus_tag LOCUS_15200 gene dnaG 13736 15658 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_15200 15655 16746 gene locus_tag LOCUS_15210 15655 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 16832 16905 gene locus_tag LOCUS_t00260 16832 16905 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <18306 16918 gene locus_tag LOCUS_15220 <18306 16918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391410.1:NAD-glutamate dehydrogenase >Feature sequence056 237 163 gene locus_tag LOCUS_t00270 237 163 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 441 1220 gene locus_tag LOCUS_15230 441 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1851 1258 gene locus_tag LOCUS_15240 1851 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1928 4282 gene locus_tag LOCUS_15250 1928 4282 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_15250 4279 5658 gene locus_tag LOCUS_15260 4279 5658 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_15260 5655 7244 gene locus_tag LOCUS_15270 5655 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7241 8125 gene locus_tag LOCUS_15280 7241 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8144 8902 gene locus_tag LOCUS_15290 8144 8902 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_15290 9651 8881 gene locus_tag LOCUS_15300 9651 8881 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083649.1 protein_id gnl|my_center|LOCUS_15300 11027 9648 gene locus_tag LOCUS_15310 11027 9648 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_15310 11420 12361 gene locus_tag LOCUS_15320 gene cynR 11420 12361 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114874.1 protein_id gnl|my_center|LOCUS_15320 12373 13869 gene locus_tag LOCUS_15330 12373 13869 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_15330 13866 15248 gene locus_tag LOCUS_15340 13866 15248 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_15340 15342 16787 gene locus_tag LOCUS_15350 15342 16787 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_15350 16794 17660 gene locus_tag LOCUS_15360 gene nadC 16794 17660 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence057 890 315 gene locus_tag LOCUS_15370 890 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1886 1017 gene locus_tag LOCUS_15380 1886 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4894 1883 gene locus_tag LOCUS_15390 4894 1883 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_15390 6444 4930 gene locus_tag LOCUS_15400 gene nrfD 6444 4930 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_15400 6616 7470 gene locus_tag LOCUS_15410 6616 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 7544 8173 gene locus_tag LOCUS_15420 7544 8173 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_15420 9752 8394 gene locus_tag LOCUS_15430 gene rtcB 9752 8394 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413616.1 protein_id gnl|my_center|LOCUS_15430 10228 9854 gene locus_tag LOCUS_15440 10228 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10610 11896 gene locus_tag LOCUS_15450 10610 11896 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_15450 12933 11935 gene locus_tag LOCUS_15460 12933 11935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_15460 13867 12926 gene locus_tag LOCUS_15470 13867 12926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_15470 15516 13918 gene locus_tag LOCUS_15480 15516 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 16495 15947 gene locus_tag LOCUS_15490 16495 15947 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530470.1 protein_id gnl|my_center|LOCUS_15490 17688 16684 gene locus_tag LOCUS_15500 17688 16684 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_15500 17980 17813 gene locus_tag LOCUS_15510 17980 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence058 <1 2028 gene locus_tag LOCUS_15520 <1 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003410648.1:cobaltochelatase subunit CobN 2025 3995 gene locus_tag LOCUS_15530 2025 3995 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 protein_id gnl|my_center|LOCUS_15530 3995 4513 gene locus_tag LOCUS_15540 3995 4513 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085328.1 protein_id gnl|my_center|LOCUS_15540 4513 5229 gene locus_tag LOCUS_15550 4513 5229 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038172.1 protein_id gnl|my_center|LOCUS_15550 5271 6206 gene locus_tag LOCUS_15560 5271 6206 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_15560 6272 7180 gene locus_tag LOCUS_15570 gene cobD 6272 7180 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_15570 7177 7938 gene locus_tag LOCUS_15580 7177 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 9670 8225 gene locus_tag LOCUS_15590 9670 8225 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 protein_id gnl|my_center|LOCUS_15590 9742 10527 gene locus_tag LOCUS_15600 9742 10527 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014630030.1 protein_id gnl|my_center|LOCUS_15600 10524 11189 gene locus_tag LOCUS_15610 10524 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 11313 12176 gene locus_tag LOCUS_15620 11313 12176 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_15620 12173 14047 gene locus_tag LOCUS_15630 12173 14047 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_15630 14061 14642 gene locus_tag LOCUS_15640 14061 14642 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_15640 14639 15505 gene locus_tag LOCUS_15650 14639 15505 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_15650 16522 15494 gene locus_tag LOCUS_15660 16522 15494 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443441.1 protein_id gnl|my_center|LOCUS_15660 17271 16519 gene locus_tag LOCUS_15670 gene etfB 17271 16519 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398765.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence059 1499 438 gene locus_tag LOCUS_15680 1499 438 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_15680 1498 2184 gene locus_tag LOCUS_15690 1498 2184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_15690 2174 3685 gene locus_tag LOCUS_15700 2174 3685 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_15700 3769 4401 gene locus_tag LOCUS_15710 3769 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4796 4437 gene locus_tag LOCUS_15720 gene rsfS 4796 4437 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 protein_id gnl|my_center|LOCUS_15720 5020 4793 gene locus_tag LOCUS_15730 5020 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5544 5023 gene locus_tag LOCUS_15740 gene nadD 5544 5023 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655767.1 protein_id gnl|my_center|LOCUS_15740 5753 7120 gene locus_tag LOCUS_15750 5753 7120 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028829.1 protein_id gnl|my_center|LOCUS_15750 7241 8920 gene locus_tag LOCUS_15760 7241 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10410 8974 gene locus_tag LOCUS_15770 10410 8974 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_15770 11293 10403 gene locus_tag LOCUS_15780 11293 10403 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_15780 12537 11290 gene locus_tag LOCUS_15790 12537 11290 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_15790 13725 12592 gene locus_tag LOCUS_15800 gene proB 13725 12592 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060218.1 protein_id gnl|my_center|LOCUS_15800 15125 13722 gene locus_tag LOCUS_15810 gene obgE 15125 13722 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_15810 16162 15344 gene locus_tag LOCUS_15820 16162 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence060 3171 1489 gene locus_tag LOCUS_15830 3171 1489 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_15830 4085 3177 gene locus_tag LOCUS_15840 gene dapA 4085 3177 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_15840 5070 4252 gene locus_tag LOCUS_15850 gene dapB 5070 4252 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_15850 8014 5072 gene locus_tag LOCUS_15860 8014 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9441 8224 gene locus_tag LOCUS_15870 9441 8224 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071997834.1 protein_id gnl|my_center|LOCUS_15870 11909 9507 gene locus_tag LOCUS_15880 11909 9507 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_15880 12322 12065 gene locus_tag LOCUS_15890 gene rpsO 12322 12065 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_15890 13429 12443 gene locus_tag LOCUS_15900 13429 12443 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_15900 14345 13455 gene locus_tag LOCUS_15910 gene truB 14345 13455 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_15910 14803 14342 gene locus_tag LOCUS_15920 14803 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 16709 14811 gene locus_tag LOCUS_15930 gene infB 16709 14811 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence061 715 2829 gene locus_tag LOCUS_15940 715 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 3396 3034 gene locus_tag LOCUS_15950 3396 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3278 3682 gene locus_tag LOCUS_15960 3278 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3807 10307 gene locus_tag LOCUS_15970 3807 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10304 11845 gene locus_tag LOCUS_15980 10304 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 11949 12617 gene locus_tag LOCUS_15990 11949 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 12826 14946 gene locus_tag LOCUS_16000 12826 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 15037 15474 gene locus_tag LOCUS_16010 15037 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 16188 15640 gene locus_tag LOCUS_16020 16188 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 16574 16185 gene locus_tag LOCUS_16030 16574 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence062 939 1871 gene locus_tag LOCUS_16040 939 1871 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_16040 2063 3091 gene locus_tag LOCUS_16050 2063 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 5417 3399 gene locus_tag LOCUS_16060 5417 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6218 5433 gene locus_tag LOCUS_16070 6218 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7456 6254 gene locus_tag LOCUS_16080 7456 6254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390949.1 protein_id gnl|my_center|LOCUS_16080 9206 7449 gene locus_tag LOCUS_16090 9206 7449 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 protein_id gnl|my_center|LOCUS_16090 10425 9334 gene locus_tag LOCUS_16100 10425 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 11873 10785 gene locus_tag LOCUS_16110 11873 10785 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965728.1 protein_id gnl|my_center|LOCUS_16110 12014 12298 gene locus_tag LOCUS_16120 12014 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 12669 14309 gene locus_tag LOCUS_16130 12669 14309 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_16130 14913 14632 gene locus_tag LOCUS_16140 14913 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 15170 14913 gene locus_tag LOCUS_16150 15170 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence063 1201 56 gene locus_tag LOCUS_16160 1201 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1393 2259 gene locus_tag LOCUS_16170 1393 2259 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_16170 2262 3659 gene locus_tag LOCUS_16180 2262 3659 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_16180 5287 3692 gene locus_tag LOCUS_16190 5287 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5396 5878 gene locus_tag LOCUS_16200 gene ribC 5396 5878 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_16200 7143 5932 gene locus_tag LOCUS_16210 7143 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 7266 8906 gene locus_tag LOCUS_16220 7266 8906 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_16220 8903 10570 gene locus_tag LOCUS_16230 8903 10570 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_16230 10614 10859 gene locus_tag LOCUS_16240 10614 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 11056 11916 gene locus_tag LOCUS_16250 gene fdhD 11056 11916 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_16250 11913 12467 gene locus_tag LOCUS_16260 gene moaC 11913 12467 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296355.1 protein_id gnl|my_center|LOCUS_16260 13495 12527 gene locus_tag LOCUS_16270 13495 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 14556 13471 gene locus_tag LOCUS_16280 14556 13471 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_16280 14686 14964 gene locus_tag LOCUS_16290 14686 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16290 14965 15891 gene locus_tag LOCUS_16300 14965 15891 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16300 16498 15941 gene locus_tag LOCUS_16310 16498 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence064 1 1251 gene locus_tag LOCUS_16320 1 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1248 3818 gene locus_tag LOCUS_16330 1248 3818 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_16330 3811 4815 gene locus_tag LOCUS_16340 3811 4815 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_16340 4822 7356 gene locus_tag LOCUS_16350 4822 7356 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_16350 7617 8144 gene locus_tag LOCUS_16360 7617 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 8818 8177 gene locus_tag LOCUS_16370 8818 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 12768 8953 gene locus_tag LOCUS_16380 gene dnaE 12768 8953 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_16380 13043 14701 gene locus_tag LOCUS_16390 13043 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 14777 15685 gene locus_tag LOCUS_16400 gene speB 14777 15685 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence065 776 2728 gene locus_tag LOCUS_16410 776 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2725 4506 gene locus_tag LOCUS_16420 gene cydC 2725 4506 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_16420 4546 5346 gene locus_tag LOCUS_16430 4546 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6256 5411 gene locus_tag LOCUS_16440 6256 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6642 6253 gene locus_tag LOCUS_16450 6642 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7828 7118 gene locus_tag LOCUS_16460 7828 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8993 7893 gene locus_tag LOCUS_16470 8993 7893 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_16470 9152 9988 gene locus_tag LOCUS_16480 9152 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 9985 10491 gene locus_tag LOCUS_16490 9985 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 11996 10548 gene locus_tag LOCUS_16500 11996 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 12196 14154 gene locus_tag LOCUS_16510 12196 14154 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814302.1 protein_id gnl|my_center|LOCUS_16510 14171 14854 gene locus_tag LOCUS_16520 gene ureA 14171 14854 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence066 582 866 gene locus_tag LOCUS_16530 582 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2572 1844 gene locus_tag LOCUS_16540 gene hxpB 2572 1844 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 protein_id gnl|my_center|LOCUS_16540 2672 3619 gene locus_tag LOCUS_16550 2672 3619 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191243275.1 protein_id gnl|my_center|LOCUS_16550 3679 4131 gene locus_tag LOCUS_16560 3679 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4228 4737 gene locus_tag LOCUS_16570 4228 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4759 5403 gene locus_tag LOCUS_16580 4759 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5595 5864 gene locus_tag LOCUS_16590 5595 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5839 6147 gene locus_tag LOCUS_16600 5839 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6255 7070 gene locus_tag LOCUS_16610 6255 7070 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_16610 8891 7200 gene locus_tag LOCUS_16620 8891 7200 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_16620 11635 8885 gene locus_tag LOCUS_16630 11635 8885 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_16630 12190 11837 gene locus_tag LOCUS_16640 12190 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12135 14669 gene locus_tag LOCUS_16650 12135 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 <15736 14706 gene locus_tag LOCUS_16660 <15736 14706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793191.1:class I SAM-dependent methyltransferase >Feature sequence067 479 1405 gene locus_tag LOCUS_16670 479 1405 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_16670 2913 1564 gene locus_tag LOCUS_16680 2913 1564 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_16680 4133 2904 gene locus_tag LOCUS_16690 4133 2904 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_16690 5198 4329 gene locus_tag LOCUS_16700 5198 4329 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_16700 5542 6744 gene locus_tag LOCUS_16710 5542 6744 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_16710 6860 7771 gene locus_tag LOCUS_16720 6860 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7939 8832 gene locus_tag LOCUS_16730 7939 8832 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726715.1 protein_id gnl|my_center|LOCUS_16730 8829 9635 gene locus_tag LOCUS_16740 8829 9635 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_16740 9787 10980 gene locus_tag LOCUS_16750 9787 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 12331 11045 gene locus_tag LOCUS_16760 12331 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 12699 13358 gene locus_tag LOCUS_16770 12699 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 13476 14357 gene locus_tag LOCUS_16780 13476 14357 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_16780 14719 14420 gene locus_tag LOCUS_16790 14719 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence068 <1 1311 gene locus_tag LOCUS_16800 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933544.1:aldehyde dehydrogenase family protein 2675 1359 gene locus_tag LOCUS_16810 2675 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4623 2860 gene locus_tag LOCUS_16820 gene argS 4623 2860 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228472.1 protein_id gnl|my_center|LOCUS_16820 4760 7453 gene locus_tag LOCUS_16830 gene acnA 4760 7453 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_16830 8228 7470 gene locus_tag LOCUS_16840 8228 7470 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_16840 9415 8195 gene locus_tag LOCUS_16850 9415 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 9585 10049 gene locus_tag LOCUS_16860 gene bcp 9585 10049 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_16860 10097 11215 gene locus_tag LOCUS_16870 10097 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 11901 11203 gene locus_tag LOCUS_16880 11901 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 11907 12536 gene locus_tag LOCUS_16890 11907 12536 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_16890 12533 13021 gene locus_tag LOCUS_16900 12533 13021 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_16900 13018 13719 gene locus_tag LOCUS_16910 13018 13719 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_16910 <14707 13763 gene locus_tag LOCUS_16920 <14707 13763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899889.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence069 <1 896 gene locus_tag LOCUS_16930 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968197.1:potassium-transporting ATPase subunit KdpB 946 1527 gene locus_tag LOCUS_16940 gene kdpC 946 1527 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_16940 1775 2428 gene locus_tag LOCUS_16950 1775 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2749 4626 gene locus_tag LOCUS_16960 2749 4626 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_16960 5586 4666 gene locus_tag LOCUS_16970 5586 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6062 5736 gene locus_tag LOCUS_16980 6062 5736 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_16980 6557 6892 gene locus_tag LOCUS_16990 6557 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10129 6962 gene locus_tag LOCUS_17000 10129 6962 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_17000 11387 10158 gene locus_tag LOCUS_17010 11387 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 12073 11384 gene locus_tag LOCUS_17020 12073 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229209.1 protein_id gnl|my_center|LOCUS_17020 12142 14040 gene locus_tag LOCUS_17030 12142 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence070 293 2269 gene locus_tag LOCUS_17040 293 2269 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_17040 3330 2317 gene locus_tag LOCUS_17050 3330 2317 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142395.1 protein_id gnl|my_center|LOCUS_17050 3494 4873 gene locus_tag LOCUS_17060 3494 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4905 5597 gene locus_tag LOCUS_17070 4905 5597 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223717.1 protein_id gnl|my_center|LOCUS_17070 5670 6167 gene locus_tag LOCUS_17080 5670 6167 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_17080 6225 6743 gene locus_tag LOCUS_17090 6225 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7028 6834 gene locus_tag LOCUS_17100 7028 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 7681 7025 gene locus_tag LOCUS_17110 7681 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 8332 8123 gene locus_tag LOCUS_17120 8332 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17120 9846 8377 gene locus_tag LOCUS_17130 9846 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 9935 11125 gene locus_tag LOCUS_17140 9935 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 11125 12396 gene locus_tag LOCUS_17150 11125 12396 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_17150 14285 12411 gene locus_tag LOCUS_17160 14285 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17160 >Feature sequence071 444 1541 gene locus_tag LOCUS_17170 444 1541 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_17170 3043 1571 gene locus_tag LOCUS_17180 3043 1571 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_17180 3146 5311 gene locus_tag LOCUS_17190 3146 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5555 5220 gene locus_tag LOCUS_17200 5555 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5506 7485 gene locus_tag LOCUS_17210 5506 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7560 8435 gene locus_tag LOCUS_17220 7560 8435 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_17220 8432 8833 gene locus_tag LOCUS_17230 8432 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8841 9800 gene locus_tag LOCUS_17240 gene trxB 8841 9800 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_17240 9952 10278 gene locus_tag LOCUS_17250 gene trxA 9952 10278 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_17250 10299 11297 gene locus_tag LOCUS_17260 10299 11297 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_17260 12409 11453 gene locus_tag LOCUS_17270 12409 11453 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_17270 13793 12384 gene locus_tag LOCUS_17280 13793 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence072 1338 643 gene locus_tag LOCUS_17290 1338 643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_17290 1519 1905 gene locus_tag LOCUS_17300 1519 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2024 2254 gene locus_tag LOCUS_17310 2024 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3035 2229 gene locus_tag LOCUS_17320 3035 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3142 3498 gene locus_tag LOCUS_17330 3142 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3485 3895 gene locus_tag LOCUS_17340 3485 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4049 4408 gene locus_tag LOCUS_17350 4049 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4415 6730 gene locus_tag LOCUS_17360 4415 6730 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_17360 6780 6986 gene locus_tag LOCUS_17370 6780 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7536 6991 gene locus_tag LOCUS_17380 7536 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 8372 7644 gene locus_tag LOCUS_17390 8372 7644 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 protein_id gnl|my_center|LOCUS_17390 8940 8413 gene locus_tag LOCUS_17400 8940 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 9575 8937 gene locus_tag LOCUS_17410 9575 8937 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_17410 10290 10799 gene locus_tag LOCUS_17420 10290 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 10969 11325 gene locus_tag LOCUS_17430 10969 11325 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_17430 13342 12140 gene locus_tag LOCUS_17440 13342 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence073 1698 745 gene locus_tag LOCUS_17450 1698 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2048 1716 gene locus_tag LOCUS_17460 2048 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2375 3004 gene locus_tag LOCUS_17470 2375 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3040 3993 gene locus_tag LOCUS_17480 3040 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4007 5851 gene locus_tag LOCUS_17490 gene typA 4007 5851 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_17490 5896 5981 gene locus_tag LOCUS_t00280 5896 5981 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6061 6492 gene locus_tag LOCUS_17500 gene tadA 6061 6492 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_17500 6571 6657 gene locus_tag LOCUS_t00290 6571 6657 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7095 7295 gene locus_tag LOCUS_17510 7095 7295 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_17510 7369 7626 gene locus_tag LOCUS_17520 7369 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 8674 7631 gene locus_tag LOCUS_17530 8674 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 9720 8671 gene locus_tag LOCUS_17540 9720 8671 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_17540 11753 9717 gene locus_tag LOCUS_17550 11753 9717 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_17550 12992 11805 gene locus_tag LOCUS_17560 gene marP 12992 11805 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_17560 13095 13826 gene locus_tag LOCUS_17570 13095 13826 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence074 <1 1352 gene locus_tag LOCUS_17580 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977186.1:Pup--protein ligase 1436 2215 gene locus_tag LOCUS_17590 1436 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2245 2709 gene locus_tag LOCUS_17600 2245 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2713 3477 gene locus_tag LOCUS_17610 gene tatC 2713 3477 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_17610 3474 5723 gene locus_tag LOCUS_17620 3474 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5768 7447 gene locus_tag LOCUS_17630 5768 7447 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_17630 7796 8290 gene locus_tag LOCUS_17640 7796 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 8277 9053 gene locus_tag LOCUS_17650 8277 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 9068 9544 gene locus_tag LOCUS_17660 9068 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 10907 9504 gene locus_tag LOCUS_17670 10907 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 11497 10982 gene locus_tag LOCUS_17680 11497 10982 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_17680 11994 13799 gene locus_tag LOCUS_17690 11994 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence075 <1 2100 gene locus_tag LOCUS_17700 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026932.1:nitrate reductase subunit alpha 2192 3829 gene locus_tag LOCUS_17710 gene narH 2192 3829 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030994.1 protein_id gnl|my_center|LOCUS_17710 3826 4467 gene locus_tag LOCUS_17720 3826 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4464 5216 gene locus_tag LOCUS_17730 gene narI 4464 5216 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_17730 5334 6443 gene locus_tag LOCUS_17740 5334 6443 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_17740 6499 6960 gene locus_tag LOCUS_17750 6499 6960 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027346.1 protein_id gnl|my_center|LOCUS_17750 7065 8303 gene locus_tag LOCUS_17760 7065 8303 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_17760 9545 8526 gene locus_tag LOCUS_17770 9545 8526 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_17770 10282 9596 gene locus_tag LOCUS_17780 10282 9596 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_17780 11951 10872 gene locus_tag LOCUS_17790 gene tal 11951 10872 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_17790 12169 11945 gene locus_tag LOCUS_17800 12169 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 12635 13519 gene locus_tag LOCUS_17810 12635 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence076 <1 582 gene locus_tag LOCUS_17820 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225317.1:o-succinylbenzoate synthase 1160 771 gene locus_tag LOCUS_17830 1160 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1411 1157 gene locus_tag LOCUS_17840 1411 1157 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_17840 1786 2076 gene locus_tag LOCUS_17850 1786 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2493 3677 gene locus_tag LOCUS_17860 2493 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3689 4312 gene locus_tag LOCUS_17870 3689 4312 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408045.1 protein_id gnl|my_center|LOCUS_17870 4309 7350 gene locus_tag LOCUS_17880 4309 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7468 9030 gene locus_tag LOCUS_17890 7468 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 9076 10476 gene locus_tag LOCUS_17900 9076 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 11873 10473 gene locus_tag LOCUS_17910 11873 10473 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_17910 13394 11949 gene locus_tag LOCUS_17920 13394 11949 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence077 577 191 gene locus_tag LOCUS_17930 577 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 732 574 gene locus_tag LOCUS_17940 732 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1963 908 gene locus_tag LOCUS_17950 1963 908 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_17950 2622 1960 gene locus_tag LOCUS_17960 2622 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3427 2645 gene locus_tag LOCUS_17970 3427 2645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_17970 4512 3562 gene locus_tag LOCUS_17980 4512 3562 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_17980 6499 4664 gene locus_tag LOCUS_17990 6499 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 7964 6588 gene locus_tag LOCUS_18000 7964 6588 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946795.1 protein_id gnl|my_center|LOCUS_18000 9187 7961 gene locus_tag LOCUS_18010 9187 7961 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_18010 10453 9275 gene locus_tag LOCUS_18020 10453 9275 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_18020 12017 10524 gene locus_tag LOCUS_18030 12017 10524 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020644771.1 protein_id gnl|my_center|LOCUS_18030 12706 12014 gene locus_tag LOCUS_18040 12706 12014 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_18040 13441 13163 gene locus_tag LOCUS_18050 13441 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence078 577 332 gene locus_tag LOCUS_18060 577 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1583 579 gene locus_tag LOCUS_18070 gene argF 1583 579 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_18070 2423 1617 gene locus_tag LOCUS_18080 2423 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2776 3648 gene locus_tag LOCUS_18090 2776 3648 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_18090 5113 3749 gene locus_tag LOCUS_18100 5113 3749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_18100 6166 5177 gene locus_tag LOCUS_18110 6166 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6331 7731 gene locus_tag LOCUS_18120 6331 7731 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_18120 7771 8895 gene locus_tag LOCUS_18130 gene cydB 7771 8895 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_18130 8898 10793 gene locus_tag LOCUS_18140 gene cydD 8898 10793 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461540.1 protein_id gnl|my_center|LOCUS_18140 10790 12568 gene locus_tag LOCUS_18150 10790 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18150 12744 13076 gene locus_tag LOCUS_18160 12744 13076 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173685.1 protein_id gnl|my_center|LOCUS_18160 13073 13381 gene locus_tag LOCUS_18170 13073 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence079 1759 206 gene locus_tag LOCUS_18180 1759 206 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 protein_id gnl|my_center|LOCUS_18180 2608 1835 gene locus_tag LOCUS_18190 2608 1835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314013.1 protein_id gnl|my_center|LOCUS_18190 3755 2682 gene locus_tag LOCUS_18200 3755 2682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707231.1 protein_id gnl|my_center|LOCUS_18200 5586 3940 gene locus_tag LOCUS_18210 5586 3940 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400583.1 protein_id gnl|my_center|LOCUS_18210 6738 5668 gene locus_tag LOCUS_18220 6738 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 7941 6970 gene locus_tag LOCUS_18230 7941 6970 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_18230 8963 7929 gene locus_tag LOCUS_18240 8963 7929 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257219.1 protein_id gnl|my_center|LOCUS_18240 9890 8994 gene locus_tag LOCUS_18250 9890 8994 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_18250 11584 9887 gene locus_tag LOCUS_18260 11584 9887 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_18260 11985 13022 gene locus_tag LOCUS_18270 11985 13022 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070840.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence080 2280 565 gene locus_tag LOCUS_18280 2280 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18280 2468 2722 gene locus_tag LOCUS_18290 2468 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3623 2733 gene locus_tag LOCUS_18300 3623 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 5149 3614 gene locus_tag LOCUS_18310 5149 3614 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_18310 5275 6522 gene locus_tag LOCUS_18320 5275 6522 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674723.1 protein_id gnl|my_center|LOCUS_18320 6785 6486 gene locus_tag LOCUS_18330 6785 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 6775 7506 gene locus_tag LOCUS_18340 6775 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 7548 8591 gene locus_tag LOCUS_18350 7548 8591 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_18350 9681 8503 gene locus_tag LOCUS_18360 9681 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 12836 9678 gene locus_tag LOCUS_18370 12836 9678 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911743.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence081 398 730 gene locus_tag LOCUS_18380 398 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 723 1184 gene locus_tag LOCUS_18390 723 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1130 3475 gene locus_tag LOCUS_18400 1130 3475 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_18400 4961 4242 gene locus_tag LOCUS_18410 4961 4242 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_18410 5248 4961 gene locus_tag LOCUS_18420 5248 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5326 5538 gene locus_tag LOCUS_18430 5326 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6505 6023 gene locus_tag LOCUS_18440 6505 6023 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_18440 6798 7235 gene locus_tag LOCUS_18450 6798 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 8058 7660 gene locus_tag LOCUS_18460 8058 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 9326 8055 gene locus_tag LOCUS_18470 9326 8055 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496803.1 protein_id gnl|my_center|LOCUS_18470 11170 9323 gene locus_tag LOCUS_18480 11170 9323 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141556.1 protein_id gnl|my_center|LOCUS_18480 11847 11167 gene locus_tag LOCUS_18490 11847 11167 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228433.1 protein_id gnl|my_center|LOCUS_18490 12275 12499 gene locus_tag LOCUS_18500 12275 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18500 12441 12818 gene locus_tag LOCUS_18510 12441 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence082 <1 1101 gene locus_tag LOCUS_18520 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030900.1:dihydropyrimidinase 1098 2102 gene locus_tag LOCUS_18530 1098 2102 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_18530 3767 2127 gene locus_tag LOCUS_18540 3767 2127 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_18540 4853 3840 gene locus_tag LOCUS_18550 gene speB 4853 3840 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727391.1 protein_id gnl|my_center|LOCUS_18550 5814 4861 gene locus_tag LOCUS_18560 5814 4861 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_18560 7123 5798 gene locus_tag LOCUS_18570 7123 5798 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228747.1 protein_id gnl|my_center|LOCUS_18570 8609 7146 gene locus_tag LOCUS_18580 8609 7146 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223436.1 protein_id gnl|my_center|LOCUS_18580 8857 10389 gene locus_tag LOCUS_18590 8857 10389 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742168.1 protein_id gnl|my_center|LOCUS_18590 11012 10620 gene locus_tag LOCUS_18600 11012 10620 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031457.1 protein_id gnl|my_center|LOCUS_18600 11133 11720 gene locus_tag LOCUS_18610 11133 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 11713 12192 gene locus_tag LOCUS_18620 11713 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 12192 12647 gene locus_tag LOCUS_18630 12192 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence083 405 782 gene locus_tag LOCUS_18640 405 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 782 2164 gene locus_tag LOCUS_18650 782 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2368 2180 gene locus_tag LOCUS_18660 2368 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2556 2368 gene locus_tag LOCUS_18670 2556 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2981 4390 gene locus_tag LOCUS_18680 2981 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5328 5969 gene locus_tag LOCUS_18690 5328 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 9138 6175 gene locus_tag LOCUS_18700 9138 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 9352 9558 gene locus_tag LOCUS_18710 9352 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 11555 9486 gene locus_tag LOCUS_18720 11555 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 11993 11790 gene locus_tag LOCUS_18730 11993 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 12444 12838 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagcccggccgtgatggccgggaagac >Feature sequence084 3118 2621 gene locus_tag LOCUS_18740 3118 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4803 3115 gene locus_tag LOCUS_18750 4803 3115 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_18750 6848 4800 gene locus_tag LOCUS_18760 6848 4800 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_18760 8535 6841 gene locus_tag LOCUS_18770 8535 6841 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_18770 9428 8547 gene locus_tag LOCUS_18780 9428 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11273 9699 gene locus_tag LOCUS_18790 11273 9699 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_18790 12485 11358 gene locus_tag LOCUS_18800 12485 11358 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence085 726 1034 gene locus_tag LOCUS_18810 gene gatC 726 1034 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_18810 1031 2476 gene locus_tag LOCUS_18820 gene gatA 1031 2476 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_18820 2473 4083 gene locus_tag LOCUS_18830 gene gatB 2473 4083 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_18830 4135 5838 gene locus_tag LOCUS_18840 gene ilvD 4135 5838 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 protein_id gnl|my_center|LOCUS_18840 5876 6703 gene locus_tag LOCUS_18850 5876 6703 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_18850 6909 8591 gene locus_tag LOCUS_18860 6909 8591 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_18860 8588 9952 gene locus_tag LOCUS_18870 8588 9952 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_18870 9949 11370 gene locus_tag LOCUS_18880 9949 11370 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_18880 11395 12177 gene locus_tag LOCUS_18890 11395 12177 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_18890 12276 12422 gene locus_tag LOCUS_18900 12276 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence086 <1 906 gene locus_tag LOCUS_18910 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha 903 1925 gene locus_tag LOCUS_18920 903 1925 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_18920 3139 1922 gene locus_tag LOCUS_18930 3139 1922 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_18930 3175 3876 gene locus_tag LOCUS_18940 3175 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3873 6359 gene locus_tag LOCUS_18950 3873 6359 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_18950 6465 6845 gene locus_tag LOCUS_18960 gene gcvH 6465 6845 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_18960 6910 7395 gene locus_tag LOCUS_18970 6910 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 7412 8521 gene locus_tag LOCUS_18980 7412 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 8567 9067 gene locus_tag LOCUS_18990 8567 9067 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_18990 10088 9084 gene locus_tag LOCUS_19000 10088 9084 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807763.1 protein_id gnl|my_center|LOCUS_19000 10276 11583 gene locus_tag LOCUS_19010 10276 11583 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224729.1 protein_id gnl|my_center|LOCUS_19010 12206 11559 gene locus_tag LOCUS_19020 12206 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 <12762 12254 gene locus_tag LOCUS_19030 <12762 12254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061871.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase >Feature sequence087 <1 808 gene locus_tag LOCUS_19040 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258558.1:DUF1156 domain-containing protein 805 1179 gene locus_tag LOCUS_19050 805 1179 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_19050 1163 1582 gene locus_tag LOCUS_19060 1163 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1569 4910 gene locus_tag LOCUS_19070 1569 4910 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_19070 5302 6621 gene locus_tag LOCUS_19080 5302 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 8987 6618 gene locus_tag LOCUS_19090 8987 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 9382 8987 gene locus_tag LOCUS_19100 9382 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 10472 9555 gene locus_tag LOCUS_19110 10472 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 11325 10462 gene locus_tag LOCUS_19120 11325 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 11577 12110 gene locus_tag LOCUS_19130 11577 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence088 13 1092 gene locus_tag LOCUS_19140 13 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1089 1808 gene locus_tag LOCUS_19150 1089 1808 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_19150 3886 1835 gene locus_tag LOCUS_19160 gene pknB 3886 1835 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112820.1 protein_id gnl|my_center|LOCUS_19160 5717 4002 gene locus_tag LOCUS_19170 5717 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6235 5714 gene locus_tag LOCUS_19180 6235 5714 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776669.1 protein_id gnl|my_center|LOCUS_19180 6888 6232 gene locus_tag LOCUS_19190 6888 6232 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_19190 7285 7369 gene locus_tag LOCUS_t00300 7285 7369 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7521 8012 gene locus_tag LOCUS_19200 7521 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 8009 9544 gene locus_tag LOCUS_19210 8009 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 9666 9965 gene locus_tag LOCUS_19220 9666 9965 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_19220 11004 10150 gene locus_tag LOCUS_19230 11004 10150 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_19230 10939 11421 gene locus_tag LOCUS_19240 10939 11421 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729205.1 protein_id gnl|my_center|LOCUS_19240 11496 11816 gene locus_tag LOCUS_19250 11496 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 11819 12097 gene locus_tag LOCUS_19260 11819 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence089 693 2249 gene locus_tag LOCUS_19270 693 2249 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 protein_id gnl|my_center|LOCUS_19270 3233 2304 gene locus_tag LOCUS_19280 3233 2304 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_19280 3740 6196 gene locus_tag LOCUS_19290 3740 6196 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 protein_id gnl|my_center|LOCUS_19290 6294 7661 gene locus_tag LOCUS_19300 6294 7661 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_19300 7739 8971 gene locus_tag LOCUS_19310 7739 8971 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_19310 8999 10375 gene locus_tag LOCUS_19320 8999 10375 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052448.1 protein_id gnl|my_center|LOCUS_19320 10520 10786 gene locus_tag LOCUS_19330 10520 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 10881 11459 gene locus_tag LOCUS_19340 10881 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 11462 12259 gene locus_tag LOCUS_19350 gene atpB 11462 12259 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908157.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence090 384 1124 gene locus_tag LOCUS_19360 384 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1271 2209 gene locus_tag LOCUS_19370 1271 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2202 3203 gene locus_tag LOCUS_19380 2202 3203 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896811.1 protein_id gnl|my_center|LOCUS_19380 5567 3225 gene locus_tag LOCUS_19390 5567 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5809 7140 gene locus_tag LOCUS_19400 5809 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7137 9767 gene locus_tag LOCUS_19410 7137 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 9764 11593 gene locus_tag LOCUS_19420 9764 11593 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194786.1 protein_id gnl|my_center|LOCUS_19420 12125 11526 gene locus_tag LOCUS_19430 12125 11526 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389758.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence091 457 384 gene locus_tag LOCUS_t00310 457 384 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 472 1239 gene locus_tag LOCUS_19440 472 1239 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_19440 1330 2661 gene locus_tag LOCUS_19450 1330 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2679 4646 gene locus_tag LOCUS_19460 2679 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4643 5404 gene locus_tag LOCUS_19470 4643 5404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_19470 5401 6147 gene locus_tag LOCUS_19480 5401 6147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_19480 6886 6152 gene locus_tag LOCUS_19490 6886 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 7804 6896 gene locus_tag LOCUS_19500 7804 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 8384 7890 gene locus_tag LOCUS_19510 8384 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 8576 9826 gene locus_tag LOCUS_19520 8576 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19520 9830 10192 gene locus_tag LOCUS_19530 9830 10192 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_19530 10829 10200 gene locus_tag LOCUS_19540 10829 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 11592 10879 gene locus_tag LOCUS_19550 11592 10879 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942542.1 protein_id gnl|my_center|LOCUS_19550 12200 11640 gene locus_tag LOCUS_19560 12200 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence092 1839 289 gene locus_tag LOCUS_19570 1839 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2600 1839 gene locus_tag LOCUS_19580 2600 1839 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_19580 4497 2677 gene locus_tag LOCUS_19590 4497 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5442 7193 gene locus_tag LOCUS_19600 5442 7193 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_19600 7198 8682 gene locus_tag LOCUS_19610 7198 8682 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_19610 8679 10223 gene locus_tag LOCUS_19620 8679 10223 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_19620 11060 10278 gene locus_tag LOCUS_19630 11060 10278 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_19630 11495 11076 gene locus_tag LOCUS_19640 gene fabZ 11495 11076 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence093 1887 364 gene locus_tag LOCUS_19650 1887 364 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_19650 2564 1896 gene locus_tag LOCUS_19660 2564 1896 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_19660 3532 2564 gene locus_tag LOCUS_19670 3532 2564 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_19670 4182 3730 gene locus_tag LOCUS_19680 4182 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5972 4326 gene locus_tag LOCUS_19690 gene gcvPB 5972 4326 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_19690 7354 5969 gene locus_tag LOCUS_19700 gene gcvPA 7354 5969 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_19700 8436 7354 gene locus_tag LOCUS_19710 gene gcvT 8436 7354 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_19710 8955 8497 gene locus_tag LOCUS_19720 8955 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 9592 9029 gene locus_tag LOCUS_19730 9592 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 9749 10585 gene locus_tag LOCUS_19740 9749 10585 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_19740 11368 10625 gene locus_tag LOCUS_19750 11368 10625 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078072.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence094 563 835 gene locus_tag LOCUS_19760 563 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2865 1153 gene locus_tag LOCUS_19770 2865 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3608 4282 gene locus_tag LOCUS_19780 3608 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4279 4806 gene locus_tag LOCUS_19790 4279 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 5177 4803 gene locus_tag LOCUS_19800 5177 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 5988 5380 gene locus_tag LOCUS_19810 5988 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 8491 5981 gene locus_tag LOCUS_19820 8491 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 9534 8488 gene locus_tag LOCUS_19830 9534 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 10436 9771 gene locus_tag LOCUS_19840 10436 9771 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_19840 11644 10433 gene locus_tag LOCUS_19850 gene istA 11644 10433 CDS product IS21-like element ISMbo1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414864.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence095 1651 1136 gene locus_tag LOCUS_19860 1651 1136 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_19860 1749 2393 gene locus_tag LOCUS_19870 1749 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2402 3040 gene locus_tag LOCUS_19880 2402 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3034 4125 gene locus_tag LOCUS_19890 3034 4125 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_19890 4122 4538 gene locus_tag LOCUS_19900 4122 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4994 4545 gene locus_tag LOCUS_19910 4994 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6364 5222 gene locus_tag LOCUS_19920 6364 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6533 6937 gene locus_tag LOCUS_19930 6533 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7587 6913 gene locus_tag LOCUS_19940 7587 6913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_19940 9580 7712 gene locus_tag LOCUS_19950 9580 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 9863 10804 gene locus_tag LOCUS_19960 gene rpoD 9863 10804 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259420.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence096 503 1087 gene locus_tag LOCUS_19970 503 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1731 1231 gene locus_tag LOCUS_19980 1731 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2936 1728 gene locus_tag LOCUS_19990 2936 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4786 2933 gene locus_tag LOCUS_20000 4786 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5032 5580 gene locus_tag LOCUS_20010 5032 5580 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 protein_id gnl|my_center|LOCUS_20010 5846 6238 gene locus_tag LOCUS_20020 5846 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_20020 6326 8002 gene locus_tag LOCUS_20030 6326 8002 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 protein_id gnl|my_center|LOCUS_20030 8214 9170 gene locus_tag LOCUS_20040 8214 9170 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 protein_id gnl|my_center|LOCUS_20040 11139 9235 gene locus_tag LOCUS_20050 11139 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence097 746 297 gene locus_tag LOCUS_20060 746 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1270 743 gene locus_tag LOCUS_20070 1270 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2414 1254 gene locus_tag LOCUS_20080 2414 1254 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_20080 5779 2417 gene locus_tag LOCUS_20090 5779 2417 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_20090 9834 5776 gene locus_tag LOCUS_20100 9834 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 10211 9945 gene locus_tag LOCUS_20110 10211 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence098 468 4160 gene locus_tag LOCUS_20120 gene recC 468 4160 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113008.1 protein_id gnl|my_center|LOCUS_20120 4157 7885 gene locus_tag LOCUS_20130 4157 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 7909 9894 gene locus_tag LOCUS_20140 gene recD 7909 9894 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113007.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence099 816 52 gene locus_tag LOCUS_20150 816 52 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897510.1 protein_id gnl|my_center|LOCUS_20150 1883 984 gene locus_tag LOCUS_20160 1883 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2463 1876 gene locus_tag LOCUS_20170 2463 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2780 3520 gene locus_tag LOCUS_20180 2780 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3820 4041 gene locus_tag LOCUS_20190 3820 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4444 4142 gene locus_tag LOCUS_20200 4444 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4422 4775 gene locus_tag LOCUS_20210 4422 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8793 5143 gene locus_tag LOCUS_20220 8793 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8960 9187 gene locus_tag LOCUS_20230 8960 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 9187 10566 gene locus_tag LOCUS_20240 9187 10566 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence100 22 606 gene locus_tag LOCUS_20250 22 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1970 636 gene locus_tag LOCUS_20260 gene selA 1970 636 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_20260 2998 1967 gene locus_tag LOCUS_20270 gene selD 2998 1967 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_20270 4926 2995 gene locus_tag LOCUS_20280 gene selB 4926 2995 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804590.1 protein_id gnl|my_center|LOCUS_20280 5627 4926 gene locus_tag LOCUS_20290 5627 4926 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205383.1 protein_id gnl|my_center|LOCUS_20290 5809 6543 gene locus_tag LOCUS_20300 5809 6543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_20300 6683 7522 gene locus_tag LOCUS_20310 6683 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 7561 8916 gene locus_tag LOCUS_20320 7561 8916 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_20320 10597 8981 gene locus_tag LOCUS_20330 10597 8981 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence101 2100 394 gene locus_tag LOCUS_20340 2100 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3143 2103 gene locus_tag LOCUS_20350 3143 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20350 3248 3454 gene locus_tag LOCUS_20360 3248 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5073 3667 gene locus_tag LOCUS_20370 gene lpdA 5073 3667 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_20370 6132 5131 gene locus_tag LOCUS_20380 6132 5131 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_20380 6918 6157 gene locus_tag LOCUS_20390 6918 6157 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_20390 7558 7103 gene locus_tag LOCUS_20400 gene rnhA 7558 7103 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228761.1 protein_id gnl|my_center|LOCUS_20400 7564 10368 gene locus_tag LOCUS_20410 gene aceE 7564 10368 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence102 332 706 gene locus_tag LOCUS_20420 332 706 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_20420 818 1027 gene locus_tag LOCUS_20430 818 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1450 1118 gene locus_tag LOCUS_20440 1450 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20440 2062 2541 gene locus_tag LOCUS_20450 2062 2541 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_20450 2538 4556 gene locus_tag LOCUS_20460 2538 4556 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_20460 4553 5554 gene locus_tag LOCUS_20470 4553 5554 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_20470 5554 6210 gene locus_tag LOCUS_20480 5554 6210 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_20480 6210 7676 gene locus_tag LOCUS_20490 6210 7676 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_20490 7673 9178 gene locus_tag LOCUS_20500 7673 9178 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_20500 9896 9456 gene locus_tag LOCUS_20510 9896 9456 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229740.1 protein_id gnl|my_center|LOCUS_20510 10189 9893 gene locus_tag LOCUS_20520 10189 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 10358 10534 gene locus_tag LOCUS_20530 10358 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence103 610 900 gene locus_tag LOCUS_20540 610 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2333 1035 gene locus_tag LOCUS_20550 gene nusA 2333 1035 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_20550 2782 2258 gene locus_tag LOCUS_20560 gene rimP 2782 2258 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_20560 4491 3028 gene locus_tag LOCUS_20570 gene proS 4491 3028 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_20570 5862 4591 gene locus_tag LOCUS_20580 gene ispG 5862 4591 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_20580 7328 5943 gene locus_tag LOCUS_20590 7328 5943 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_20590 8617 7325 gene locus_tag LOCUS_20600 8617 7325 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 protein_id gnl|my_center|LOCUS_20600 10424 8742 gene locus_tag LOCUS_20610 10424 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence104 496 900 gene locus_tag LOCUS_20620 496 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2016 886 gene locus_tag LOCUS_20630 2016 886 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_20630 3381 2098 gene locus_tag LOCUS_20640 gene hflX 3381 2098 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_20640 4349 3378 gene locus_tag LOCUS_20650 4349 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5341 4427 gene locus_tag LOCUS_20660 gene miaA 5341 4427 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390091.1 protein_id gnl|my_center|LOCUS_20660 6747 5359 gene locus_tag LOCUS_20670 gene miaB 6747 5359 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296630.1 protein_id gnl|my_center|LOCUS_20670 7781 6744 gene locus_tag LOCUS_20680 7781 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 8964 7789 gene locus_tag LOCUS_20690 8964 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 <10635 9084 gene locus_tag LOCUS_20700 <10635 9084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973274.1:DNA translocase FtsK >Feature sequence105 2283 1126 gene locus_tag LOCUS_20710 2283 1126 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_20710 3607 2360 gene locus_tag LOCUS_20720 3607 2360 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_20720 4800 3661 gene locus_tag LOCUS_20730 gene hisC 4800 3661 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_20730 5956 4835 gene locus_tag LOCUS_20740 5956 4835 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_20740 6957 5953 gene locus_tag LOCUS_20750 6957 5953 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_20750 8027 6954 gene locus_tag LOCUS_20760 gene pdhA 8027 6954 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_20760 9260 8259 gene locus_tag LOCUS_20770 gene mer 9260 8259 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_20770 10324 9257 gene locus_tag LOCUS_20780 10324 9257 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence106 967 167 gene locus_tag LOCUS_20790 967 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1020 1289 gene locus_tag LOCUS_20800 1020 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1328 2215 gene locus_tag LOCUS_20810 1328 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2373 3359 gene locus_tag LOCUS_20820 gene gap 2373 3359 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_20820 3356 4561 gene locus_tag LOCUS_20830 3356 4561 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_20830 4566 5387 gene locus_tag LOCUS_20840 gene tpiA 4566 5387 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 protein_id gnl|my_center|LOCUS_20840 5503 5733 gene locus_tag LOCUS_20850 gene secG 5503 5733 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 protein_id gnl|my_center|LOCUS_20850 5730 7688 gene locus_tag LOCUS_20860 5730 7688 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229764.1 protein_id gnl|my_center|LOCUS_20860 7754 7840 gene locus_tag LOCUS_t00320 7754 7840 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8145 7819 gene locus_tag LOCUS_20870 8145 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence107 33 357 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagcccggccgtgatggccgggaagacc 815 531 gene locus_tag LOCUS_20880 gene cas2 815 531 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_20880 2501 819 gene locus_tag LOCUS_20890 gene cas1 2501 819 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_20890 3415 2498 gene locus_tag LOCUS_20900 3415 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 6534 3412 gene locus_tag LOCUS_20910 6534 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 7976 6534 gene locus_tag LOCUS_20920 7976 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 9123 7978 gene locus_tag LOCUS_20930 9123 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 9856 9620 gene locus_tag LOCUS_20940 9856 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence108 <1 1167 gene locus_tag LOCUS_20950 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001762563.1:RNA-guided endonuclease TnpB family protein 1982 1080 gene locus_tag LOCUS_20960 1982 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2995 2339 gene locus_tag LOCUS_20970 2995 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3939 3193 gene locus_tag LOCUS_20980 3939 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4004 4495 gene locus_tag LOCUS_20990 4004 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4518 4967 gene locus_tag LOCUS_21000 4518 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4964 5311 gene locus_tag LOCUS_21010 4964 5311 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_21010 5308 6753 gene locus_tag LOCUS_21020 5308 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7033 7941 gene locus_tag LOCUS_21030 7033 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 8182 8784 gene locus_tag LOCUS_21040 8182 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21040 >Feature sequence109 224 865 gene locus_tag LOCUS_21050 224 865 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530617.1 protein_id gnl|my_center|LOCUS_21050 1890 895 gene locus_tag LOCUS_21060 1890 895 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_21060 2157 2597 gene locus_tag LOCUS_21070 2157 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2630 3124 gene locus_tag LOCUS_21080 2630 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978009.1 protein_id gnl|my_center|LOCUS_21080 3628 3170 gene locus_tag LOCUS_21090 3628 3170 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_21090 4024 4803 gene locus_tag LOCUS_21100 gene regX 4024 4803 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_21100 6338 4890 gene locus_tag LOCUS_21110 gene dnaB 6338 4890 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_21110 7109 6660 gene locus_tag LOCUS_21120 gene rplI 7109 6660 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_21120 7615 7106 gene locus_tag LOCUS_21130 7615 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8097 7615 gene locus_tag LOCUS_21140 8097 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 8585 8148 gene locus_tag LOCUS_21150 8585 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 9242 8826 gene locus_tag LOCUS_21160 9242 8826 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence110 494 102 gene locus_tag LOCUS_21170 494 102 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_21170 772 497 gene locus_tag LOCUS_21180 772 497 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417918.1 protein_id gnl|my_center|LOCUS_21180 914 1189 gene locus_tag LOCUS_21190 914 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1189 1620 gene locus_tag LOCUS_21200 1189 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1708 1633 gene locus_tag LOCUS_t00330 1708 1633 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1842 1767 gene locus_tag LOCUS_t00340 1842 1767 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2072 1998 gene locus_tag LOCUS_t00350 2072 1998 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3165 2125 gene locus_tag LOCUS_21210 3165 2125 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_21210 3298 3915 gene locus_tag LOCUS_21220 3298 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4671 3925 gene locus_tag LOCUS_21230 4671 3925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_21230 5717 4668 gene locus_tag LOCUS_21240 5717 4668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_21240 5744 7048 gene locus_tag LOCUS_21250 gene serS 5744 7048 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081577.1 protein_id gnl|my_center|LOCUS_21250 7826 7071 gene locus_tag LOCUS_21260 gene regX 7826 7071 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 protein_id gnl|my_center|LOCUS_21260 <9649 7903 gene locus_tag LOCUS_21270 <9649 7903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876913.1:two-component system sensor histidine kinase SenX3 >Feature sequence111 2268 1213 gene locus_tag LOCUS_21280 2268 1213 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_21280 3072 2278 gene locus_tag LOCUS_21290 3072 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3834 4892 gene locus_tag LOCUS_21300 3834 4892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_21300 4889 5641 gene locus_tag LOCUS_21310 4889 5641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_21310 7269 5653 gene locus_tag LOCUS_21320 7269 5653 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_21320 7445 8104 gene locus_tag LOCUS_21330 7445 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 8274 8166 gene locus_tag LOCUS_r00010 8274 8166 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 9385 8783 gene locus_tag LOCUS_21340 9385 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence112 2839 1262 gene locus_tag LOCUS_21350 gene serA 2839 1262 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_21350 4071 2857 gene locus_tag LOCUS_21360 4071 2857 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_21360 4090 5235 gene locus_tag LOCUS_21370 gene serC 4090 5235 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_21370 6341 5316 gene locus_tag LOCUS_21380 gene ilvC 6341 5316 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_21380 7220 6654 gene locus_tag LOCUS_21390 gene ilvN 7220 6654 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_21390 9016 7217 gene locus_tag LOCUS_21400 9016 7217 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence113 1932 151 gene locus_tag LOCUS_21410 1932 151 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_21410 2585 1932 gene locus_tag LOCUS_21420 2585 1932 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_21420 4333 2585 gene locus_tag LOCUS_21430 4333 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6380 5913 gene locus_tag LOCUS_21440 6380 5913 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974727.1 protein_id gnl|my_center|LOCUS_21440 6594 6424 gene locus_tag LOCUS_21450 6594 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 7170 6649 gene locus_tag LOCUS_21460 7170 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 7666 7184 gene locus_tag LOCUS_21470 7666 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 <9405 7804 gene locus_tag LOCUS_21480 <9405 7804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974722.1:phage tail sheath subtilisin-like domain-containing protein >Feature sequence114 492 1199 gene locus_tag LOCUS_21490 492 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229827.1 protein_id gnl|my_center|LOCUS_21490 2754 1216 gene locus_tag LOCUS_21500 2754 1216 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_21500 2845 3708 gene locus_tag LOCUS_21510 2845 3708 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528511.1 protein_id gnl|my_center|LOCUS_21510 3705 4253 gene locus_tag LOCUS_21520 3705 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4231 5178 gene locus_tag LOCUS_21530 4231 5178 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_21530 5175 6488 gene locus_tag LOCUS_21540 5175 6488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_21540 8094 6523 gene locus_tag LOCUS_21550 8094 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 8096 8335 gene locus_tag LOCUS_21560 8096 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 8564 8848 gene locus_tag LOCUS_21570 8564 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence115 1576 368 gene locus_tag LOCUS_21580 1576 368 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_21580 3613 2030 gene locus_tag LOCUS_21590 3613 2030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_21590 4317 3610 gene locus_tag LOCUS_21600 4317 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 4916 4314 gene locus_tag LOCUS_21610 4916 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5342 7057 gene locus_tag LOCUS_21620 gene mptB 5342 7057 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_21620 7579 7097 gene locus_tag LOCUS_21630 7579 7097 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095190.1 protein_id gnl|my_center|LOCUS_21630 7661 7735 gene locus_tag LOCUS_t00360 7661 7735 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7738 7812 gene locus_tag LOCUS_t00370 7738 7812 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7864 8028 gene locus_tag LOCUS_21640 gene rpmG 7864 8028 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_21640 8130 8203 gene locus_tag LOCUS_t00380 8130 8203 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8263 8583 gene locus_tag LOCUS_21650 8263 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence116 638 417 gene locus_tag LOCUS_21660 638 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21660 784 972 gene locus_tag LOCUS_21670 784 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1885 1169 gene locus_tag LOCUS_21680 1885 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2377 1952 gene locus_tag LOCUS_21690 2377 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3729 2614 gene locus_tag LOCUS_21700 3729 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4096 4752 gene locus_tag LOCUS_21710 4096 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4745 5485 gene locus_tag LOCUS_21720 4745 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 7272 5878 gene locus_tag LOCUS_21730 7272 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 8265 7579 gene locus_tag LOCUS_21740 8265 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 8601 8266 gene locus_tag LOCUS_21750 8601 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence117 662 862 gene locus_tag LOCUS_21760 662 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1441 959 gene locus_tag LOCUS_21770 1441 959 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_21770 1522 2700 gene locus_tag LOCUS_21780 1522 2700 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_21780 3318 2785 gene locus_tag LOCUS_21790 3318 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4775 3318 gene locus_tag LOCUS_21800 gene atpD 4775 3318 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_21800 5783 4782 gene locus_tag LOCUS_21810 5783 4782 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144299.1 protein_id gnl|my_center|LOCUS_21810 7310 5787 gene locus_tag LOCUS_21820 gene atpA 7310 5787 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_21820 8350 7313 gene locus_tag LOCUS_21830 8350 7313 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_21830 8895 8347 gene locus_tag LOCUS_21840 8895 8347 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898818.1 protein_id gnl|my_center|LOCUS_21840 9177 8914 gene locus_tag LOCUS_21850 9177 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence118 1289 216 gene locus_tag LOCUS_21860 gene hypE 1289 216 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_21860 2400 1282 gene locus_tag LOCUS_21870 gene hypD 2400 1282 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_21870 2687 2397 gene locus_tag LOCUS_21880 2687 2397 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_21880 3546 2689 gene locus_tag LOCUS_21890 3546 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 4067 3543 gene locus_tag LOCUS_21900 gene hydD 4067 3543 CDS product hydrogenase biosynthesis protein HydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078602.1 protein_id gnl|my_center|LOCUS_21900 4920 4108 gene locus_tag LOCUS_21910 gene cybH 4920 4108 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 protein_id gnl|my_center|LOCUS_21910 6661 4937 gene locus_tag LOCUS_21920 6661 4937 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_21920 8060 6732 gene locus_tag LOCUS_21930 gene hyaA 8060 6732 CDS product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 protein_id gnl|my_center|LOCUS_21930 8401 8057 gene locus_tag LOCUS_21940 8401 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 8879 8535 gene locus_tag LOCUS_21950 8879 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence119 755 375 gene locus_tag LOCUS_21960 755 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1609 755 gene locus_tag LOCUS_21970 1609 755 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_21970 2427 1594 gene locus_tag LOCUS_21980 2427 1594 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_21980 3766 2522 gene locus_tag LOCUS_21990 3766 2522 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_21990 3964 5595 gene locus_tag LOCUS_22000 3964 5595 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence120 239 676 gene locus_tag LOCUS_22010 gene rplP 239 676 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_22010 673 948 gene locus_tag LOCUS_22020 673 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 948 1238 gene locus_tag LOCUS_22030 gene rpsQ 948 1238 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_22030 1235 1603 gene locus_tag LOCUS_22040 gene rplN 1235 1603 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_22040 1603 1911 gene locus_tag LOCUS_22050 gene rplX 1603 1911 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_22050 1908 2633 gene locus_tag LOCUS_22060 gene rplE 1908 2633 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_22060 2639 2824 gene locus_tag LOCUS_22070 2639 2824 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_22070 2834 3238 gene locus_tag LOCUS_22080 gene rpsH 2834 3238 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_22080 3291 3830 gene locus_tag LOCUS_22090 gene rplF 3291 3830 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_22090 3830 4204 gene locus_tag LOCUS_22100 gene rplR 3830 4204 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_22100 4204 4752 gene locus_tag LOCUS_22110 gene rpsE 4204 4752 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403680.1 protein_id gnl|my_center|LOCUS_22110 4755 4940 gene locus_tag LOCUS_22120 gene rpmD 4755 4940 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_22120 4937 5425 gene locus_tag LOCUS_22130 gene rplO 4937 5425 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_22130 5431 6717 gene locus_tag LOCUS_22140 gene secY 5431 6717 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_22140 6725 7384 gene locus_tag LOCUS_22150 6725 7384 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_22150 7392 8132 gene locus_tag LOCUS_22160 gene map 7392 8132 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_22160 8160 8498 gene locus_tag LOCUS_22170 8160 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 8844 8575 gene locus_tag LOCUS_22180 8844 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence121 1318 239 gene locus_tag LOCUS_22190 1318 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1570 4023 gene locus_tag LOCUS_22200 1570 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4702 4013 gene locus_tag LOCUS_22210 4702 4013 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640373.1 protein_id gnl|my_center|LOCUS_22210 4985 5620 gene locus_tag LOCUS_22220 4985 5620 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_22220 6175 5639 gene locus_tag LOCUS_22230 gene orn 6175 5639 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271546.1 protein_id gnl|my_center|LOCUS_22230 6254 6706 gene locus_tag LOCUS_22240 gene dut 6254 6706 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_22240 6789 8345 gene locus_tag LOCUS_22250 6789 8345 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878617.1 protein_id gnl|my_center|LOCUS_22250 8406 8481 gene locus_tag LOCUS_t00390 8406 8481 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 980 306 gene locus_tag LOCUS_22260 980 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4308 994 gene locus_tag LOCUS_22270 4308 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5531 4308 gene locus_tag LOCUS_22280 gene nrfD 5531 4308 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_22280 6688 5582 gene locus_tag LOCUS_22290 6688 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6997 6797 gene locus_tag LOCUS_22300 6997 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6890 7171 gene locus_tag LOCUS_22310 6890 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7783 7974 gene locus_tag LOCUS_22320 7783 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence123 <1 911 gene locus_tag LOCUS_22330 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228917.1:branched-chain amino acid ABC transporter permease/ATP-binding protein 908 1612 gene locus_tag LOCUS_22340 908 1612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_22340 1609 2367 gene locus_tag LOCUS_22350 1609 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2367 3506 gene locus_tag LOCUS_22360 2367 3506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_22360 3503 4405 gene locus_tag LOCUS_22370 3503 4405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_22370 4399 6012 gene locus_tag LOCUS_22380 4399 6012 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_22380 6009 6824 gene locus_tag LOCUS_22390 6009 6824 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_22390 8388 7516 gene locus_tag LOCUS_22400 8388 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence124 4538 1899 gene locus_tag LOCUS_22410 4538 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22410 6736 4541 gene locus_tag LOCUS_22420 6736 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 7605 6820 gene locus_tag LOCUS_22430 7605 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence125 643 1863 gene locus_tag LOCUS_22440 643 1863 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955127.1 protein_id gnl|my_center|LOCUS_22440 1860 4358 gene locus_tag LOCUS_22450 1860 4358 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211934313.1 protein_id gnl|my_center|LOCUS_22450 5397 4990 gene locus_tag LOCUS_22460 5397 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 7773 5425 gene locus_tag LOCUS_22470 7773 5425 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103211.1 protein_id gnl|my_center|LOCUS_22470 <8448 7770 gene locus_tag LOCUS_22480 <8448 7770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103210.1:tyrosine-type recombinase/integrase >Feature sequence126 154 945 gene locus_tag LOCUS_22490 154 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1052 1630 gene locus_tag LOCUS_22500 1052 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1671 2312 gene locus_tag LOCUS_22510 1671 2312 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_22510 4283 2529 gene locus_tag LOCUS_22520 4283 2529 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_22520 7065 5242 gene locus_tag LOCUS_22530 7065 5242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_22530 7712 7200 gene locus_tag LOCUS_22540 7712 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence127 <1 717 gene locus_tag LOCUS_22550 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392588.1:30S ribosomal protein S12 methylthiotransferase RimO 714 1310 gene locus_tag LOCUS_22560 gene pgsA 714 1310 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_22560 1324 2634 gene locus_tag LOCUS_22570 1324 2634 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_22570 2734 3081 gene locus_tag LOCUS_22580 2734 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3081 3416 gene locus_tag LOCUS_22590 3081 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3428 4006 gene locus_tag LOCUS_22600 gene thpR 3428 4006 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256208.1 protein_id gnl|my_center|LOCUS_22600 4123 5190 gene locus_tag LOCUS_22610 gene recA 4123 5190 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_22610 6394 5192 gene locus_tag LOCUS_22620 6394 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6470 7135 gene locus_tag LOCUS_22630 6470 7135 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_22630 7212 7742 gene locus_tag LOCUS_22640 7212 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7830 8252 gene locus_tag LOCUS_22650 7830 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence128 458 6 gene locus_tag LOCUS_22660 458 6 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_22660 725 471 gene locus_tag LOCUS_22670 725 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1407 1835 gene locus_tag LOCUS_22680 1407 1835 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_22680 2587 1979 gene locus_tag LOCUS_22690 2587 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2894 2571 gene locus_tag LOCUS_22700 2894 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4607 3345 gene locus_tag LOCUS_22710 4607 3345 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 protein_id gnl|my_center|LOCUS_22710 4694 5530 gene locus_tag LOCUS_22720 4694 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5553 5882 gene locus_tag LOCUS_22730 5553 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 <8246 6438 gene locus_tag LOCUS_22740 <8246 6438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546883.1:IS200/IS605 family accessory protein TnpB-related protein >Feature sequence129 1 234 gene locus_tag LOCUS_22750 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 231 1139 gene locus_tag LOCUS_22760 231 1139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 protein_id gnl|my_center|LOCUS_22760 1136 3160 gene locus_tag LOCUS_22770 1136 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3342 4721 gene locus_tag LOCUS_22780 3342 4721 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 protein_id gnl|my_center|LOCUS_22780 6468 4789 gene locus_tag LOCUS_22790 6468 4789 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence130 131 454 gene locus_tag LOCUS_22800 131 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 782 549 gene locus_tag LOCUS_22810 782 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 673 2571 gene locus_tag LOCUS_22820 673 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2636 3592 gene locus_tag LOCUS_22830 2636 3592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_22830 3589 4602 gene locus_tag LOCUS_22840 3589 4602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_22840 4912 5571 gene locus_tag LOCUS_22850 4912 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5597 5743 gene locus_tag LOCUS_22860 5597 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 6191 5784 gene locus_tag LOCUS_22870 6191 5784 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 protein_id gnl|my_center|LOCUS_22870 7399 6188 gene locus_tag LOCUS_22880 7399 6188 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_22880 7739 7410 gene locus_tag LOCUS_22890 7739 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence131 635 234 gene locus_tag LOCUS_22900 635 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1118 1765 gene locus_tag LOCUS_22910 1118 1765 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_22910 1950 4082 gene locus_tag LOCUS_22920 gene acs 1950 4082 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_22920 4274 4804 gene locus_tag LOCUS_22930 4274 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6293 4905 gene locus_tag LOCUS_22940 6293 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6859 6650 gene locus_tag LOCUS_22950 6859 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 8036 6879 gene locus_tag LOCUS_22960 gene thiO 8036 6879 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence132 402 1346 gene locus_tag LOCUS_22970 402 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1399 2253 gene locus_tag LOCUS_22980 1399 2253 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_22980 2243 3436 gene locus_tag LOCUS_22990 2243 3436 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_22990 3433 4536 gene locus_tag LOCUS_23000 3433 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4625 5530 gene locus_tag LOCUS_23010 gene pdxS 4625 5530 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_23010 5533 6159 gene locus_tag LOCUS_23020 gene pdxT 5533 6159 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_23020 6268 7017 gene locus_tag LOCUS_23030 6268 7017 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081500.1 protein_id gnl|my_center|LOCUS_23030 7105 7635 gene locus_tag LOCUS_23040 gene ruvC 7105 7635 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence133 <1 1304 gene locus_tag LOCUS_23050 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900188.1:SEC-C metal-binding domain-containing protein 1487 1723 gene locus_tag LOCUS_23060 1487 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23060 1754 3454 gene locus_tag LOCUS_23070 1754 3454 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23070 3501 5567 gene locus_tag LOCUS_23080 3501 5567 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125263880.1 protein_id gnl|my_center|LOCUS_23080 5564 6520 gene locus_tag LOCUS_23090 5564 6520 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_23090 6685 7035 gene locus_tag LOCUS_23100 6685 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence134 1147 113 gene locus_tag LOCUS_23110 1147 113 CDS product IS1595-like element ISSod11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071113.1 protein_id gnl|my_center|LOCUS_23110 1608 1216 gene locus_tag LOCUS_23120 1608 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1516 3222 gene locus_tag LOCUS_23130 1516 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3219 5045 gene locus_tag LOCUS_23140 3219 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 5042 7162 gene locus_tag LOCUS_23150 5042 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 7159 7584 gene locus_tag LOCUS_23160 7159 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence135 1142 699 gene locus_tag LOCUS_23170 1142 699 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230122.1 protein_id gnl|my_center|LOCUS_23170 3333 1144 gene locus_tag LOCUS_23180 3333 1144 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064868.1 protein_id gnl|my_center|LOCUS_23180 3544 4824 gene locus_tag LOCUS_23190 3544 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4931 6043 gene locus_tag LOCUS_23200 4931 6043 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727711.1 protein_id gnl|my_center|LOCUS_23200 6249 6908 gene locus_tag LOCUS_23210 6249 6908 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_23210 6905 7699 gene locus_tag LOCUS_23220 6905 7699 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence136 1235 732 gene locus_tag LOCUS_23230 gene moaC 1235 732 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417293.1 protein_id gnl|my_center|LOCUS_23230 1394 1753 gene locus_tag LOCUS_23240 1394 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3138 1777 gene locus_tag LOCUS_23250 3138 1777 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_23250 4730 3135 gene locus_tag LOCUS_23260 4730 3135 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_23260 4636 5082 gene locus_tag LOCUS_23270 4636 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 5185 7149 gene locus_tag LOCUS_23280 gene dxs 5185 7149 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_23280 <7911 7165 gene locus_tag LOCUS_23290 <7911 7165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022168.1:sugar phosphate nucleotidyltransferase >Feature sequence137 1901 2377 gene locus_tag LOCUS_23300 1901 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2388 3074 gene locus_tag LOCUS_23310 2388 3074 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_23310 6492 3142 gene locus_tag LOCUS_23320 6492 3142 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_23320 6593 6682 gene locus_tag LOCUS_t00400 6593 6682 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 <1 519 gene locus_tag LOCUS_23330 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029976.1:daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein 516 1340 gene locus_tag LOCUS_23340 516 1340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_23340 2614 1412 gene locus_tag LOCUS_23350 2614 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4026 2779 gene locus_tag LOCUS_23360 4026 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5704 4016 gene locus_tag LOCUS_23370 5704 4016 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_23370 <7738 5701 gene locus_tag LOCUS_23380 <7738 5701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052667156.1:TIGR02680 family protein >Feature sequence139 1531 131 gene locus_tag LOCUS_23390 1531 131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727681.1 protein_id gnl|my_center|LOCUS_23390 2366 1533 gene locus_tag LOCUS_23400 2366 1533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_23400 3150 2368 gene locus_tag LOCUS_23410 3150 2368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_23410 4232 3198 gene locus_tag LOCUS_23420 4232 3198 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530006.1 protein_id gnl|my_center|LOCUS_23420 5130 4240 gene locus_tag LOCUS_23430 5130 4240 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_23430 6586 5249 gene locus_tag LOCUS_23440 6586 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6700 7302 gene locus_tag LOCUS_23450 6700 7302 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence140 1467 1757 gene locus_tag LOCUS_23460 1467 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1754 2392 gene locus_tag LOCUS_23470 gene upp 1754 2392 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_23470 4838 2556 gene locus_tag LOCUS_23480 4838 2556 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145665688.1 protein_id gnl|my_center|LOCUS_23480 5756 5250 gene locus_tag LOCUS_23490 5756 5250 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_23490 5924 6937 gene locus_tag LOCUS_23500 5924 6937 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence141 29 604 gene locus_tag LOCUS_23510 29 604 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_23510 592 1806 gene locus_tag LOCUS_23520 592 1806 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079277.1 protein_id gnl|my_center|LOCUS_23520 1836 3263 gene locus_tag LOCUS_23530 gene argH 1836 3263 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_23530 3301 3885 gene locus_tag LOCUS_23540 3301 3885 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_23540 5033 3915 gene locus_tag LOCUS_23550 gene ald 5033 3915 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_23550 6550 5099 gene locus_tag LOCUS_23560 6550 5099 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_23560 6828 7364 gene locus_tag LOCUS_23570 6828 7364 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence142 395 721 gene locus_tag LOCUS_23580 395 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 660 938 gene locus_tag LOCUS_23590 660 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1837 1601 gene locus_tag LOCUS_23600 1837 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1719 3680 gene locus_tag LOCUS_23610 1719 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4050 4520 gene locus_tag LOCUS_23620 4050 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4547 5398 gene locus_tag LOCUS_23630 4547 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 5395 6777 gene locus_tag LOCUS_23640 5395 6777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence143 121 1539 gene locus_tag LOCUS_23650 121 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1631 2557 gene locus_tag LOCUS_23660 1631 2557 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527598.1 protein_id gnl|my_center|LOCUS_23660 3245 2586 gene locus_tag LOCUS_23670 3245 2586 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_23670 3618 3304 gene locus_tag LOCUS_23680 3618 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3742 4287 gene locus_tag LOCUS_23690 3742 4287 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058377.1 protein_id gnl|my_center|LOCUS_23690 4280 6577 gene locus_tag LOCUS_23700 gene katG 4280 6577 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_23700 6968 6468 gene locus_tag LOCUS_23710 6968 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence144 1948 1217 gene locus_tag LOCUS_23720 1948 1217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_23720 2307 1984 gene locus_tag LOCUS_23730 2307 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3749 2307 gene locus_tag LOCUS_23740 gene xseA 3749 2307 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_23740 4339 5493 gene locus_tag LOCUS_23750 4339 5493 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_23750 5829 5641 gene locus_tag LOCUS_23760 5829 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 <7511 5849 gene locus_tag LOCUS_23770 <7511 5849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230432.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence145 201 2954 gene locus_tag LOCUS_23780 201 2954 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_23780 2951 3337 gene locus_tag LOCUS_23790 2951 3337 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_23790 3334 3708 gene locus_tag LOCUS_23800 3334 3708 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_23800 3692 4111 gene locus_tag LOCUS_23810 3692 4111 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence146 1592 1188 gene locus_tag LOCUS_23820 1592 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1831 1589 gene locus_tag LOCUS_23830 1831 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1847 2164 gene locus_tag LOCUS_23840 1847 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3964 2501 gene locus_tag LOCUS_23850 3964 2501 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_23850 4502 4146 gene locus_tag LOCUS_23860 4502 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 6129 5188 gene locus_tag LOCUS_23870 6129 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23870 7196 6057 gene locus_tag LOCUS_23880 7196 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 >Feature sequence147 2812 458 gene locus_tag LOCUS_23890 2812 458 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_23890 5819 3090 gene locus_tag LOCUS_23900 5819 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6002 6694 gene locus_tag LOCUS_23910 6002 6694 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence148 30 2303 gene locus_tag LOCUS_23920 30 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3408 2290 gene locus_tag LOCUS_23930 3408 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3368 4882 gene locus_tag LOCUS_23940 3368 4882 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228807.1 protein_id gnl|my_center|LOCUS_23940 4879 5598 gene locus_tag LOCUS_23950 4879 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence149 526 600 gene locus_tag LOCUS_t00410 526 600 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 728 1903 gene locus_tag LOCUS_23960 728 1903 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_23960 2962 2216 gene locus_tag LOCUS_23970 2962 2216 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_23970 3786 3091 gene locus_tag LOCUS_23980 3786 3091 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_23980 5199 4609 gene locus_tag LOCUS_23990 5199 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 5783 6841 gene locus_tag LOCUS_24000 5783 6841 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence150 1349 966 gene locus_tag LOCUS_24010 1349 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2101 3216 gene locus_tag LOCUS_24020 2101 3216 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_24020 3218 4864 gene locus_tag LOCUS_24030 3218 4864 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973344.1 protein_id gnl|my_center|LOCUS_24030 4926 5975 gene locus_tag LOCUS_24040 4926 5975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061838.1 protein_id gnl|my_center|LOCUS_24040 6110 6949 gene locus_tag LOCUS_24050 6110 6949 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence151 708 292 gene locus_tag LOCUS_24060 708 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1296 979 gene locus_tag LOCUS_24070 1296 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1654 2130 gene locus_tag LOCUS_24080 1654 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3077 2208 gene locus_tag LOCUS_24090 3077 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3411 3683 gene locus_tag LOCUS_24100 3411 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3815 4270 gene locus_tag LOCUS_24110 3815 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 4864 4424 gene locus_tag LOCUS_24120 4864 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6219 5839 gene locus_tag LOCUS_24130 6219 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 6706 6921 gene locus_tag LOCUS_24140 6706 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence152 1005 4 gene locus_tag LOCUS_24150 1005 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1013 1351 gene locus_tag LOCUS_24160 1013 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2606 1491 gene locus_tag LOCUS_24170 2606 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4948 2603 gene locus_tag LOCUS_24180 gene tkt 4948 2603 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_24180 4951 5316 gene locus_tag LOCUS_24190 4951 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 5411 5629 gene locus_tag LOCUS_24200 5411 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 5634 5861 gene locus_tag LOCUS_24210 5634 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 5871 6698 gene locus_tag LOCUS_24220 5871 6698 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence153 1482 487 gene locus_tag LOCUS_24230 1482 487 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_24230 3851 1479 gene locus_tag LOCUS_24240 gene metE 3851 1479 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 protein_id gnl|my_center|LOCUS_24240 4287 3928 gene locus_tag LOCUS_24250 4287 3928 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_24250 4718 4332 gene locus_tag LOCUS_24260 4718 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4936 4715 gene locus_tag LOCUS_24270 4936 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5238 5005 gene locus_tag LOCUS_24280 5238 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 5129 6466 gene locus_tag LOCUS_24290 5129 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970961.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence154 94 753 gene locus_tag LOCUS_24300 94 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2429 768 gene locus_tag LOCUS_24310 gene cimA 2429 768 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_24310 3119 2805 gene locus_tag LOCUS_24320 3119 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 3590 3129 gene locus_tag LOCUS_24330 3590 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 3496 3834 gene locus_tag LOCUS_24340 3496 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3963 5339 gene locus_tag LOCUS_24350 3963 5339 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_24350 5341 6390 gene locus_tag LOCUS_24360 gene thrC 5341 6390 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_24360 6471 6782 gene locus_tag LOCUS_24370 6471 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence155 476 2266 gene locus_tag LOCUS_24380 476 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3590 2388 gene locus_tag LOCUS_24390 gene fabF 3590 2388 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_24390 3859 3590 gene locus_tag LOCUS_24400 gene acpP 3859 3590 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_24400 4747 3947 gene locus_tag LOCUS_24410 gene fabG 4747 3947 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_24410 6003 4744 gene locus_tag LOCUS_24420 6003 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence156 1075 584 gene locus_tag LOCUS_24430 1075 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1796 1338 gene locus_tag LOCUS_24440 1796 1338 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726705.1 protein_id gnl|my_center|LOCUS_24440 2172 1783 gene locus_tag LOCUS_24450 2172 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3112 2315 gene locus_tag LOCUS_24460 3112 2315 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_24460 4086 3109 gene locus_tag LOCUS_24470 4086 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 4322 4116 gene locus_tag LOCUS_24480 4322 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 5912 4881 gene locus_tag LOCUS_24490 5912 4881 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence157 680 1426 gene locus_tag LOCUS_24500 gene cobI 680 1426 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_24500 1423 2211 gene locus_tag LOCUS_24510 gene cobM 1423 2211 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_24510 2208 3896 gene locus_tag LOCUS_24520 gene cobJ 2208 3896 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_24520 3893 4519 gene locus_tag LOCUS_24530 3893 4519 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392611.1 protein_id gnl|my_center|LOCUS_24530 4512 5420 gene locus_tag LOCUS_24540 4512 5420 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_24540 5489 5986 gene locus_tag LOCUS_24550 gene cobO 5489 5986 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence158 1388 1143 gene locus_tag LOCUS_24560 1388 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1725 2147 gene locus_tag LOCUS_24570 gene tnpA 1725 2147 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_24570 2866 2186 gene locus_tag LOCUS_24580 2866 2186 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081890.1 protein_id gnl|my_center|LOCUS_24580 3031 3807 gene locus_tag LOCUS_24590 3031 3807 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_24590 4125 3874 gene locus_tag LOCUS_24600 gene rpmA 4125 3874 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 protein_id gnl|my_center|LOCUS_24600 4494 4150 gene locus_tag LOCUS_24610 gene rplU 4494 4150 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_24610 6200 4491 gene locus_tag LOCUS_24620 6200 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 >Feature sequence159 <1 688 gene locus_tag LOCUS_24630 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030294.1:urease subunit alpha 829 1221 gene locus_tag LOCUS_24640 829 1221 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_24640 2952 1297 gene locus_tag LOCUS_24650 gene merA 2952 1297 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_24650 3087 5504 gene locus_tag LOCUS_24660 3087 5504 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence160 2139 1381 gene locus_tag LOCUS_24670 2139 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2152 2682 gene locus_tag LOCUS_24680 2152 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2687 3028 gene locus_tag LOCUS_24690 2687 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3698 3036 gene locus_tag LOCUS_24700 3698 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4626 4165 gene locus_tag LOCUS_24710 4626 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5180 4623 gene locus_tag LOCUS_24720 5180 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5257 6024 gene locus_tag LOCUS_24730 5257 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 6152 6227 gene locus_tag LOCUS_t00420 6152 6227 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence161 369 109 gene locus_tag LOCUS_24740 369 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1432 2580 gene locus_tag LOCUS_24750 1432 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2948 3769 gene locus_tag LOCUS_24760 2948 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4108 4032 gene locus_tag LOCUS_t00430 4108 4032 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence162 <1 1074 gene locus_tag LOCUS_24770 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706020.1:diaminopropionate ammonia-lyase 1316 1104 gene locus_tag LOCUS_24780 1316 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2217 1321 gene locus_tag LOCUS_24790 gene hisG 2217 1321 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_24790 2779 2222 gene locus_tag LOCUS_24800 gene ribE 2779 2222 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_24800 4026 2785 gene locus_tag LOCUS_24810 4026 2785 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_24810 5080 4031 gene locus_tag LOCUS_24820 gene ribD 5080 4031 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208167.1 protein_id gnl|my_center|LOCUS_24820 5885 5187 gene locus_tag LOCUS_24830 gene rpe 5885 5187 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence163 866 168 gene locus_tag LOCUS_24840 866 168 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_24840 958 1455 gene locus_tag LOCUS_24850 958 1455 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_24850 1682 2545 gene locus_tag LOCUS_24860 1682 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2542 3450 gene locus_tag LOCUS_24870 2542 3450 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_24870 3463 4701 gene locus_tag LOCUS_24880 3463 4701 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_24880 6000 5023 gene locus_tag LOCUS_24890 6000 5023 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence164 124 1233 gene locus_tag LOCUS_24900 124 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1230 2786 gene locus_tag LOCUS_24910 1230 2786 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_24910 2777 3685 gene locus_tag LOCUS_24920 2777 3685 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_24920 3726 5180 gene locus_tag LOCUS_24930 gene yfmT 3726 5180 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244104.1 protein_id gnl|my_center|LOCUS_24930 5260 6033 gene locus_tag LOCUS_24940 5260 6033 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726819.1 protein_id gnl|my_center|LOCUS_24940 6254 6099 gene locus_tag LOCUS_24950 6254 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence165 514 1644 gene locus_tag LOCUS_24960 514 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1641 2114 gene locus_tag LOCUS_24970 1641 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2114 4330 gene locus_tag LOCUS_24980 2114 4330 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_24980 4525 6030 gene locus_tag LOCUS_24990 4525 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence166 863 2452 gene locus_tag LOCUS_25000 863 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2593 3303 gene locus_tag LOCUS_25010 2593 3303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_25010 4644 3385 gene locus_tag LOCUS_25020 4644 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 5131 4637 gene locus_tag LOCUS_25030 5131 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 5719 5264 gene locus_tag LOCUS_25040 5719 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence167 <1 698 gene locus_tag LOCUS_25050 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975394.1:hydroxyacid dehydrogenase 770 2011 gene locus_tag LOCUS_25060 770 2011 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_25060 2012 2839 gene locus_tag LOCUS_25070 2012 2839 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_25070 2858 3277 gene locus_tag LOCUS_25080 2858 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 5964 4207 gene locus_tag LOCUS_25090 5964 4207 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence168 2197 656 gene locus_tag LOCUS_25100 2197 656 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_25100 3241 2243 gene locus_tag LOCUS_25110 3241 2243 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_25110 4257 3238 gene locus_tag LOCUS_25120 4257 3238 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_25120 4934 4224 gene locus_tag LOCUS_25130 gene hpaI 4934 4224 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_25130 <6017 4946 gene locus_tag LOCUS_25140 <6017 4946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005115449.1:indolepyruvate ferredoxin oxidoreductase family protein >Feature sequence169 667 1557 gene locus_tag LOCUS_25150 667 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1568 2650 gene locus_tag LOCUS_25160 1568 2650 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417097.1 protein_id gnl|my_center|LOCUS_25160 2755 3639 gene locus_tag LOCUS_25170 gene galE1 2755 3639 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_25170 4423 3692 gene locus_tag LOCUS_25180 4423 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 5357 4410 gene locus_tag LOCUS_25190 gene cofD 5357 4410 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence170 1971 1237 gene locus_tag LOCUS_25200 1971 1237 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_25200 3139 2147 gene locus_tag LOCUS_25210 3139 2147 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191003.1 protein_id gnl|my_center|LOCUS_25210 4335 3172 gene locus_tag LOCUS_25220 4335 3172 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878464.1 protein_id gnl|my_center|LOCUS_25220 4893 4399 gene locus_tag LOCUS_25230 4893 4399 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_25230 5804 4890 gene locus_tag LOCUS_25240 5804 4890 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence171 1140 3137 gene locus_tag LOCUS_25250 gene ftsH 1140 3137 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_25250 3200 4267 gene locus_tag LOCUS_25260 3200 4267 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_25260 4367 4948 gene locus_tag LOCUS_25270 gene pdxH 4367 4948 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence172 1089 316 gene locus_tag LOCUS_25280 gene prcA 1089 316 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_25280 1919 1086 gene locus_tag LOCUS_25290 1919 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2123 1926 gene locus_tag LOCUS_25300 2123 1926 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 protein_id gnl|my_center|LOCUS_25300 3707 2217 gene locus_tag LOCUS_25310 gene dop 3707 2217 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_25310 <5732 3729 gene locus_tag LOCUS_25320 <5732 3729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027900.1:proteasome ATPase >Feature sequence173 1463 207 gene locus_tag LOCUS_25330 1463 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2181 1507 gene locus_tag LOCUS_25340 2181 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2462 2163 gene locus_tag LOCUS_25350 2462 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3773 2613 gene locus_tag LOCUS_25360 gene dprA 3773 2613 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_25360 3939 5372 gene locus_tag LOCUS_25370 3939 5372 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence174 1239 856 gene locus_tag LOCUS_25380 1239 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1714 1397 gene locus_tag LOCUS_25390 1714 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2199 1711 gene locus_tag LOCUS_25400 2199 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2330 2548 gene locus_tag LOCUS_25410 2330 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3385 4488 gene locus_tag LOCUS_25420 3385 4488 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328108.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence175 1777 536 gene locus_tag LOCUS_25430 1777 536 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_25430 2574 1774 gene locus_tag LOCUS_25440 gene sufC 2574 1774 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_25440 3151 2654 gene locus_tag LOCUS_25450 3151 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3068 4459 gene locus_tag LOCUS_25460 3068 4459 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_25460 4463 5215 gene locus_tag LOCUS_25470 4463 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence176 1 294 gene locus_tag LOCUS_25480 1 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1004 564 gene locus_tag LOCUS_25490 1004 564 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_25490 1236 988 gene locus_tag LOCUS_25500 1236 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1803 1579 gene locus_tag LOCUS_25510 1803 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2347 3030 gene locus_tag LOCUS_25520 2347 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3691 3398 gene locus_tag LOCUS_25530 3691 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4322 4606 gene locus_tag LOCUS_25540 4322 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4701 5237 gene locus_tag LOCUS_25550 4701 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 5234 5470 gene locus_tag LOCUS_25560 5234 5470 CDS product type II toxin-antitoxin system antitoxin VapB27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403139.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence177 397 4116 gene locus_tag LOCUS_25570 397 4116 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026932.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence178 1307 219 gene locus_tag LOCUS_25580 1307 219 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_25580 1659 1291 gene locus_tag LOCUS_25590 gene aroH 1659 1291 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_25590 2564 1671 gene locus_tag LOCUS_25600 2564 1671 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_25600 3147 2548 gene locus_tag LOCUS_25610 gene scpB 3147 2548 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_25610 3993 3169 gene locus_tag LOCUS_25620 3993 3169 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408432.1 protein_id gnl|my_center|LOCUS_25620 4075 5052 gene locus_tag LOCUS_25630 gene trpS 4075 5052 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence179 263 334 gene locus_tag LOCUS_t00440 263 334 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1351 305 gene locus_tag LOCUS_25640 1351 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1235 1594 gene locus_tag LOCUS_25650 1235 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2232 1648 gene locus_tag LOCUS_25660 2232 1648 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729581.1 protein_id gnl|my_center|LOCUS_25660 3120 2242 gene locus_tag LOCUS_25670 3120 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3433 4941 gene locus_tag LOCUS_25680 3433 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 4938 5291 gene locus_tag LOCUS_25690 4938 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence180 485 835 gene locus_tag LOCUS_25700 485 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1240 4608 gene locus_tag LOCUS_25710 1240 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5315 4590 gene locus_tag LOCUS_25720 5315 4590 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459344.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence181 201 1856 gene locus_tag LOCUS_25730 gene zwf 201 1856 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_25730 1853 4282 gene locus_tag LOCUS_25740 1853 4282 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_25740 4279 5337 gene locus_tag LOCUS_25750 4279 5337 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence182 1152 520 gene locus_tag LOCUS_25760 1152 520 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 protein_id gnl|my_center|LOCUS_25760 2045 1149 gene locus_tag LOCUS_25770 gene prmC 2045 1149 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 protein_id gnl|my_center|LOCUS_25770 3148 2042 gene locus_tag LOCUS_25780 gene prfA 3148 2042 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_25780 3409 3182 gene locus_tag LOCUS_25790 gene rpmE 3409 3182 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908151.1 protein_id gnl|my_center|LOCUS_25790 5325 3493 gene locus_tag LOCUS_25800 5325 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence183 44 895 gene locus_tag LOCUS_25810 44 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 898 1449 gene locus_tag LOCUS_25820 898 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1828 1541 gene locus_tag LOCUS_25830 1828 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1788 2714 gene locus_tag LOCUS_25840 1788 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2711 3748 gene locus_tag LOCUS_25850 2711 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence184 1043 3 gene locus_tag LOCUS_25860 1043 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1360 1040 gene locus_tag LOCUS_25870 gene clpS 1360 1040 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_25870 1433 2161 gene locus_tag LOCUS_25880 1433 2161 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804965.1 protein_id gnl|my_center|LOCUS_25880 2143 2892 gene locus_tag LOCUS_25890 2143 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 4019 3234 gene locus_tag LOCUS_25900 4019 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence185 1109 2542 gene locus_tag LOCUS_25910 1109 2542 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_25910 2590 3978 gene locus_tag LOCUS_25920 gene der 2590 3978 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396062.1 protein_id gnl|my_center|LOCUS_25920 3992 4195 gene locus_tag LOCUS_25930 3992 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence186 <1 3390 gene locus_tag LOCUS_25940 <1 3390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030150.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit 3418 5130 gene locus_tag LOCUS_25950 3418 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence187 2369 1119 gene locus_tag LOCUS_25960 2369 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2292 3680 gene locus_tag LOCUS_25970 2292 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 4232 4663 gene locus_tag LOCUS_25980 4232 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence188 364 780 gene locus_tag LOCUS_25990 364 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 794 1639 gene locus_tag LOCUS_26000 794 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2042 2692 gene locus_tag LOCUS_26010 2042 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2689 3411 gene locus_tag LOCUS_26020 2689 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3532 3723 gene locus_tag LOCUS_26030 3532 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 5126 3951 gene locus_tag LOCUS_26040 5126 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence189 3895 380 gene locus_tag LOCUS_26050 gene metH 3895 380 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_26050 3941 4540 gene locus_tag LOCUS_26060 3941 4540 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918615.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence190 108 776 gene locus_tag LOCUS_26070 108 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1317 661 gene locus_tag LOCUS_26080 1317 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1300 1503 gene locus_tag LOCUS_26090 1300 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1506 1784 gene locus_tag LOCUS_26100 1506 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1796 2050 gene locus_tag LOCUS_26110 1796 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2204 3397 gene locus_tag LOCUS_26120 2204 3397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_26120 4069 4338 gene locus_tag LOCUS_26130 4069 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4643 4855 gene locus_tag LOCUS_26140 4643 4855 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence191 267 1259 gene locus_tag LOCUS_26150 gene pheA 267 1259 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_26150 1272 2555 gene locus_tag LOCUS_26160 gene serA 1272 2555 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_26160 3034 2606 gene locus_tag LOCUS_26170 3034 2606 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_26170 4734 3097 gene locus_tag LOCUS_26180 4734 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence192 2 880 gene locus_tag LOCUS_26190 2 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 988 3213 gene locus_tag LOCUS_26200 gene relA 988 3213 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_26200 3216 4523 gene locus_tag LOCUS_26210 gene hisS 3216 4523 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082383.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence193 613 939 gene locus_tag LOCUS_26220 613 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 945 1565 gene locus_tag LOCUS_26230 945 1565 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_26230 2024 1572 gene locus_tag LOCUS_26240 2024 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2464 2009 gene locus_tag LOCUS_26250 2464 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3720 2542 gene locus_tag LOCUS_26260 3720 2542 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_26260 4711 3746 gene locus_tag LOCUS_26270 4711 3746 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence194 1243 38 gene locus_tag LOCUS_26280 1243 38 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400885.1 protein_id gnl|my_center|LOCUS_26280 2672 1401 gene locus_tag LOCUS_26290 2672 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3030 3530 gene locus_tag LOCUS_26300 3030 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3527 4450 gene locus_tag LOCUS_26310 3527 4450 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence195 45 635 gene locus_tag LOCUS_26320 45 635 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_26320 1152 694 gene locus_tag LOCUS_26330 1152 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1347 2492 gene locus_tag LOCUS_26340 1347 2492 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_26340 2626 3117 gene locus_tag LOCUS_26350 2626 3117 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_26350 3212 3880 gene locus_tag LOCUS_26360 3212 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4558 3920 gene locus_tag LOCUS_26370 4558 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence196 1245 139 gene locus_tag LOCUS_26380 1245 139 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890422.1 protein_id gnl|my_center|LOCUS_26380 1916 1305 gene locus_tag LOCUS_26390 1916 1305 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886075.1 protein_id gnl|my_center|LOCUS_26390 2462 2091 gene locus_tag LOCUS_26400 gene trxA 2462 2091 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_26400 3958 2627 gene locus_tag LOCUS_26410 3958 2627 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence197 1004 3382 gene locus_tag LOCUS_26420 1004 3382 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927044.1 protein_id gnl|my_center|LOCUS_26420 3491 4498 gene locus_tag LOCUS_26430 3491 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence198 1360 104 gene locus_tag LOCUS_26440 gene nagA 1360 104 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_26440 1566 1357 gene locus_tag LOCUS_26450 1566 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3022 1625 gene locus_tag LOCUS_26460 3022 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3668 3153 gene locus_tag LOCUS_26470 3668 3153 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_26470 3928 4263 gene locus_tag LOCUS_26480 3928 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 4632 4408 gene locus_tag LOCUS_26490 4632 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence199 639 151 gene locus_tag LOCUS_26500 639 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1085 636 gene locus_tag LOCUS_26510 1085 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2508 1216 gene locus_tag LOCUS_26520 gene eno 2508 1216 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_26520 4225 2537 gene locus_tag LOCUS_26530 4225 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 <4813 4222 gene locus_tag LOCUS_26540 <4813 4222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919615.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence200 250 1044 gene locus_tag LOCUS_26550 250 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1041 1565 gene locus_tag LOCUS_26560 1041 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 4135 2648 gene locus_tag LOCUS_26570 4135 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4243 4656 gene locus_tag LOCUS_26580 4243 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence201 920 225 gene locus_tag LOCUS_26590 gene thiE 920 225 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_26590 1603 917 gene locus_tag LOCUS_26600 1603 917 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_26600 3898 1616 gene locus_tag LOCUS_26610 3898 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 4445 3993 gene locus_tag LOCUS_26620 4445 3993 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224919.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence202 3789 274 gene locus_tag LOCUS_26630 3789 274 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_26630 4637 3786 gene locus_tag LOCUS_26640 4637 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence203 2065 839 gene locus_tag LOCUS_26650 2065 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2402 2857 gene locus_tag LOCUS_26660 2402 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2862 4262 gene locus_tag LOCUS_26670 2862 4262 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence204 390 929 gene locus_tag LOCUS_26680 390 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1863 1006 gene locus_tag LOCUS_26690 gene rapZ 1863 1006 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_26690 3941 1860 gene locus_tag LOCUS_26700 gene uvrC 3941 1860 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence205 291 22 gene locus_tag LOCUS_26710 291 22 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_26710 481 987 gene locus_tag LOCUS_26720 481 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2177 1263 gene locus_tag LOCUS_26730 2177 1263 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_26730 3342 2230 gene locus_tag LOCUS_26740 3342 2230 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_26740 3581 4456 gene locus_tag LOCUS_26750 3581 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence206 371 538 gene locus_tag LOCUS_26760 371 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1906 596 gene locus_tag LOCUS_26770 1906 596 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528948.1 protein_id gnl|my_center|LOCUS_26770 3018 2068 gene locus_tag LOCUS_26780 3018 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3433 3095 gene locus_tag LOCUS_26790 3433 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence207 510 791 gene locus_tag LOCUS_26800 510 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1163 1672 gene locus_tag LOCUS_26810 1163 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1843 3336 gene locus_tag LOCUS_26820 1843 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 <4608 3365 gene locus_tag LOCUS_26830 <4608 3365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036462762.1:TIGR01777 family oxidoreductase >Feature sequence208 281 1339 gene locus_tag LOCUS_26840 281 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2498 1446 gene locus_tag LOCUS_26850 2498 1446 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_26850 4364 2505 gene locus_tag LOCUS_26860 4364 2505 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_26860 4252 4461 gene locus_tag LOCUS_26870 4252 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence209 200 781 gene locus_tag LOCUS_26880 200 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414195.1 protein_id gnl|my_center|LOCUS_26880 831 2207 gene locus_tag LOCUS_26890 831 2207 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_26890 2204 3019 gene locus_tag LOCUS_26900 2204 3019 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_26900 3214 3711 gene locus_tag LOCUS_26910 3214 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence210 2116 182 gene locus_tag LOCUS_26920 2116 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3162 2113 gene locus_tag LOCUS_26930 gene xerC 3162 2113 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925924.1 protein_id gnl|my_center|LOCUS_26930 4456 3218 gene locus_tag LOCUS_26940 4456 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence211 <1 1329 gene locus_tag LOCUS_26950 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973370.1:aspartate aminotransferase family protein 1352 2770 gene locus_tag LOCUS_26960 1352 2770 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_26960 2801 3061 gene locus_tag LOCUS_26970 2801 3061 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence212 4007 138 gene locus_tag LOCUS_26980 4007 138 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_26980 4405 4007 gene locus_tag LOCUS_26990 4405 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence213 <4368 13 gene locus_tag LOCUS_27000 <4368 13 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147933.1:DEAD/DEAH box helicase >Feature sequence214 94 2568 gene locus_tag LOCUS_27010 94 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3620 2499 gene locus_tag LOCUS_27020 3620 2499 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_27020 <4339 3669 gene locus_tag LOCUS_27030 <4339 3669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405061.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence215 307 582 gene locus_tag LOCUS_27040 307 582 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417918.1 protein_id gnl|my_center|LOCUS_27040 582 974 gene locus_tag LOCUS_27050 582 974 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_27050 2233 1664 gene locus_tag LOCUS_27060 2233 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2812 2282 gene locus_tag LOCUS_27070 2812 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3247 3026 gene locus_tag LOCUS_27080 3247 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3775 3422 gene locus_tag LOCUS_27090 3775 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence216 129 1196 gene locus_tag LOCUS_27100 129 1196 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414172.1 protein_id gnl|my_center|LOCUS_27100 1267 2139 gene locus_tag LOCUS_27110 1267 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2130 2687 gene locus_tag LOCUS_27120 2130 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3745 2891 gene locus_tag LOCUS_27130 3745 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence217 2591 1794 gene locus_tag LOCUS_27140 2591 1794 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_27140 <4243 2718 gene locus_tag LOCUS_27150 <4243 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256247.1:DNA mismatch repair protein MutS >Feature sequence218 201 2831 gene locus_tag LOCUS_27160 gene xdh 201 2831 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_27160 2864 3865 gene locus_tag LOCUS_27170 gene mer 2864 3865 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence219 2697 958 gene locus_tag LOCUS_27180 gene aspS 2697 958 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_27180 3752 2739 gene locus_tag LOCUS_27190 3752 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence220 379 1134 gene locus_tag LOCUS_27200 gene gpmA 379 1134 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940195.1 protein_id gnl|my_center|LOCUS_27200 2632 1139 gene locus_tag LOCUS_27210 2632 1139 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_27210 3015 3275 gene locus_tag LOCUS_27220 3015 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 <4006 3322 gene locus_tag LOCUS_27230 <4006 3322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029156.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence221 438 1862 gene locus_tag LOCUS_27240 438 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1991 3049 gene locus_tag LOCUS_27250 gene ispH 1991 3049 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence222 347 1825 gene locus_tag LOCUS_27260 347 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2698 1916 gene locus_tag LOCUS_27270 2698 1916 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_27270 3867 2695 gene locus_tag LOCUS_27280 3867 2695 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence223 1279 107 gene locus_tag LOCUS_27290 1279 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27290 1799 1293 gene locus_tag LOCUS_27300 1799 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3386 1899 gene locus_tag LOCUS_27310 3386 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence224 <1 1005 gene locus_tag LOCUS_27320 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230137.1:TIGR03767 family metallophosphoesterase 1002 1277 gene locus_tag LOCUS_27330 1002 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1691 1374 gene locus_tag LOCUS_27340 gene pemK 1691 1374 CDS product type II toxin-antitoxin system toxin endoribonuclease PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416110.1 protein_id gnl|my_center|LOCUS_27340 1917 1678 gene locus_tag LOCUS_27350 1917 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2052 3185 gene locus_tag LOCUS_27360 2052 3185 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065244.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence225 1354 299 gene locus_tag LOCUS_27370 1354 299 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_27370 1665 1351 gene locus_tag LOCUS_27380 1665 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3055 1694 gene locus_tag LOCUS_27390 3055 1694 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_27390 3853 3068 gene locus_tag LOCUS_27400 3853 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence226 228 1592 gene locus_tag LOCUS_27410 228 1592 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 protein_id gnl|my_center|LOCUS_27410 2235 2858 gene locus_tag LOCUS_27420 2235 2858 CDS product IS607-like element IS1535 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence227 1070 312 gene locus_tag LOCUS_27430 1070 312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_27430 1831 1067 gene locus_tag LOCUS_27440 1831 1067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_27440 <3745 1832 gene locus_tag LOCUS_27450 <3745 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228917.1:branched-chain amino acid ABC transporter permease/ATP-binding protein >Feature sequence228 752 450 gene locus_tag LOCUS_27460 752 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1064 903 gene locus_tag LOCUS_27470 1064 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence229 2332 1481 gene locus_tag LOCUS_27480 2332 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 <3686 2332 gene locus_tag LOCUS_27490 <3686 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024251.1:hydrogenase large subunit >Feature sequence230 1543 320 gene locus_tag LOCUS_27500 1543 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2351 1536 gene locus_tag LOCUS_27510 2351 1536 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_27510 <3679 2348 gene locus_tag LOCUS_27520 <3679 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917061.1:DDE-type integrase/transposase/recombinase >Feature sequence231 259 807 gene locus_tag LOCUS_27530 259 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 804 3323 gene locus_tag LOCUS_27540 804 3323 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence232 755 471 gene locus_tag LOCUS_27550 755 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1661 1374 gene locus_tag LOCUS_27560 1661 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1903 1661 gene locus_tag LOCUS_27570 1903 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3072 2623 gene locus_tag LOCUS_27580 3072 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence233 1892 2596 gene locus_tag LOCUS_27590 1892 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence234 221 1438 gene locus_tag LOCUS_27600 221 1438 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_27600 2219 1452 gene locus_tag LOCUS_27610 2219 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3533 2346 gene locus_tag LOCUS_27620 3533 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence235 1779 2588 gene locus_tag LOCUS_27630 1779 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2841 3458 gene locus_tag LOCUS_27640 2841 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence236 242 508 gene locus_tag LOCUS_27650 242 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1458 505 gene locus_tag LOCUS_27660 1458 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1665 2483 gene locus_tag LOCUS_27670 1665 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2745 3026 gene locus_tag LOCUS_27680 2745 3026 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_27680 3040 3249 gene locus_tag LOCUS_27690 3040 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27690 >Feature sequence237 1689 655 gene locus_tag LOCUS_27700 1689 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2646 1813 gene locus_tag LOCUS_27710 2646 1813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888943.1 protein_id gnl|my_center|LOCUS_27710 3587 2643 gene locus_tag LOCUS_27720 3587 2643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence238 282 863 gene locus_tag LOCUS_27730 282 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1944 982 gene locus_tag LOCUS_27740 1944 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2251 3210 gene locus_tag LOCUS_27750 2251 3210 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence239 788 715 gene locus_tag LOCUS_t00450 788 715 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 913 2310 gene locus_tag LOCUS_27760 gene lysA 913 2310 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_27760 2428 3261 gene locus_tag LOCUS_27770 2428 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence240 45 2915 gene locus_tag LOCUS_27780 45 2915 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_27780 3310 2873 gene locus_tag LOCUS_27790 3310 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence241 896 609 gene locus_tag LOCUS_27800 896 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2282 924 gene locus_tag LOCUS_27810 2282 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2512 2279 gene locus_tag LOCUS_27820 2512 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3506 3270 gene locus_tag LOCUS_27830 3506 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence242 580 233 gene locus_tag LOCUS_27840 580 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2043 577 gene locus_tag LOCUS_27850 2043 577 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_27850 2188 2367 gene locus_tag LOCUS_27860 2188 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3020 2778 gene locus_tag LOCUS_27870 3020 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2937 3134 gene locus_tag LOCUS_27880 2937 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence243 494 2446 gene locus_tag LOCUS_27890 494 2446 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_27890 2443 3039 gene locus_tag LOCUS_27900 2443 3039 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_27900 3036 3470 gene locus_tag LOCUS_27910 3036 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence244 <1 1330 gene locus_tag LOCUS_27920 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031263.1:ATP-binding protein 1609 3156 gene locus_tag LOCUS_27930 1609 3156 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094791896.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence245 <1 906 gene locus_tag LOCUS_27940 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975461.1:ATP-dependent Clp protease ATP-binding subunit 921 2210 gene locus_tag LOCUS_27950 921 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2340 2816 gene locus_tag LOCUS_27960 2340 2816 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence246 1150 107 gene locus_tag LOCUS_27970 gene pheA 1150 107 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_27970 1175 1996 gene locus_tag LOCUS_27980 gene larB 1175 1996 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_27980 1993 3243 gene locus_tag LOCUS_27990 gene larC 1993 3243 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence247 <1 1545 gene locus_tag LOCUS_28000 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003903979.1:recombinase family protein 1907 1542 gene locus_tag LOCUS_28010 1907 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence248 128 1063 gene locus_tag LOCUS_28020 128 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1067 1861 gene locus_tag LOCUS_28030 gene tsf 1067 1861 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950794.1 protein_id gnl|my_center|LOCUS_28030 1904 2623 gene locus_tag LOCUS_28040 gene pyrH 1904 2623 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 protein_id gnl|my_center|LOCUS_28040 2623 3192 gene locus_tag LOCUS_28050 gene frr 2623 3192 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081622.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence249 <1 1386 gene locus_tag LOCUS_28060 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528919.1:glucose-6-phosphate dehydrogenase 2689 1376 gene locus_tag LOCUS_28070 2689 1376 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706112.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence250 1204 884 gene locus_tag LOCUS_28080 1204 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1267 1650 gene locus_tag LOCUS_28090 1267 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence251 2089 1121 gene locus_tag LOCUS_28100 2089 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2724 2071 gene locus_tag LOCUS_28110 2724 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence252 1690 332 gene locus_tag LOCUS_28120 1690 332 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_28120 2351 1719 gene locus_tag LOCUS_28130 2351 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2709 2527 gene locus_tag LOCUS_28140 2709 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence253 287 637 gene locus_tag LOCUS_28150 287 637 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 protein_id gnl|my_center|LOCUS_28150 634 1206 gene locus_tag LOCUS_28160 634 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1742 1593 gene locus_tag LOCUS_28170 1742 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2906 1893 gene locus_tag LOCUS_28180 2906 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence254 264 947 gene locus_tag LOCUS_28190 264 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 937 2307 gene locus_tag LOCUS_28200 937 2307 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence255 876 235 gene locus_tag LOCUS_28210 876 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1014 1307 gene locus_tag LOCUS_28220 1014 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1304 2599 gene locus_tag LOCUS_28230 1304 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2735 2935 gene locus_tag LOCUS_28240 2735 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence256 672 139 gene locus_tag LOCUS_28250 672 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 923 696 gene locus_tag LOCUS_28260 923 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 991 1821 gene locus_tag LOCUS_28270 991 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2332 1790 gene locus_tag LOCUS_28280 2332 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence257 1 2037 gene locus_tag LOCUS_28290 1 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2048 2731 gene locus_tag LOCUS_28300 2048 2731 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence258 1283 231 gene locus_tag LOCUS_28310 1283 231 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_28310 2172 1453 gene locus_tag LOCUS_28320 2172 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence259 418 660 gene locus_tag LOCUS_28330 418 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28330 965 1255 gene locus_tag LOCUS_28340 965 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2358 1318 gene locus_tag LOCUS_28350 2358 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence260 2651 1902 gene locus_tag LOCUS_28360 gene cobF 2651 1902 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence261 689 1489 gene locus_tag LOCUS_28370 689 1489 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929965.1 protein_id gnl|my_center|LOCUS_28370 2060 1680 gene locus_tag LOCUS_28380 2060 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence262 33 108 gene locus_tag LOCUS_t00460 33 108 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 222 695 gene locus_tag LOCUS_28390 222 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 932 1210 gene locus_tag LOCUS_28400 932 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1207 1482 gene locus_tag LOCUS_28410 1207 1482 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_28410 1687 1433 gene locus_tag LOCUS_28420 1687 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2266 1814 gene locus_tag LOCUS_28430 2266 1814 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_28430 2530 2279 gene locus_tag LOCUS_28440 2530 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence263 621 1550 gene locus_tag LOCUS_28450 621 1550 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085687.1 protein_id gnl|my_center|LOCUS_28450 1667 2779 gene locus_tag LOCUS_28460 1667 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence264 1218 271 gene locus_tag LOCUS_28470 1218 271 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence265 157 636 gene locus_tag LOCUS_28480 157 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 633 1334 gene locus_tag LOCUS_28490 633 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1331 2002 gene locus_tag LOCUS_28500 1331 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence266 1091 1543 gene locus_tag LOCUS_28510 1091 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1522 2085 gene locus_tag LOCUS_28520 1522 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence267 939 136 gene locus_tag LOCUS_28530 939 136 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_28530 1039 1443 gene locus_tag LOCUS_28540 1039 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2406 1495 gene locus_tag LOCUS_28550 2406 1495 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence268 1957 1508 gene locus_tag LOCUS_28560 1957 1508 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222376.1 protein_id gnl|my_center|LOCUS_28560 2260 1967 gene locus_tag LOCUS_28570 2260 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence269 1210 422 gene locus_tag LOCUS_28580 gene istB 1210 422 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727958.1 protein_id gnl|my_center|LOCUS_28580 2565 1207 gene locus_tag LOCUS_28590 2565 1207 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727957.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence270 1848 115 gene locus_tag LOCUS_28600 1848 115 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_28600 2547 2239 gene locus_tag LOCUS_28610 2547 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence271 <2664 295 gene locus_tag LOCUS_28620 <2664 295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227069.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence272 664 461 gene locus_tag LOCUS_28630 664 461 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 protein_id gnl|my_center|LOCUS_28630 868 719 gene locus_tag LOCUS_28640 868 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1165 941 gene locus_tag LOCUS_28650 1165 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1241 1495 gene locus_tag LOCUS_28660 1241 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 1492 1869 gene locus_tag LOCUS_28670 1492 1869 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_28670 2349 2639 gene locus_tag LOCUS_28680 2349 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence273 680 366 gene locus_tag LOCUS_28690 680 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 743 1033 gene locus_tag LOCUS_28700 743 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1423 1079 gene locus_tag LOCUS_28710 1423 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2268 1768 gene locus_tag LOCUS_28720 2268 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence274 1650 289 gene locus_tag LOCUS_28730 1650 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 1996 1652 gene locus_tag LOCUS_28740 1996 1652 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_28740 2152 2364 gene locus_tag LOCUS_28750 2152 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence275 888 265 gene locus_tag LOCUS_28760 888 265 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence276 2189 1248 gene locus_tag LOCUS_28770 2189 1248 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624176.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence277 675 460 gene locus_tag LOCUS_28780 675 460 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_28780 871 668 gene locus_tag LOCUS_28790 871 668 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_28790 1299 2558 gene locus_tag LOCUS_28800 1299 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence278 295 1908 gene locus_tag LOCUS_28810 295 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence279 <1 570 gene locus_tag LOCUS_28820 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544852.1:metalloregulator ArsR/SmtB family transcription factor 620 970 gene locus_tag LOCUS_28830 620 970 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707068.1 protein_id gnl|my_center|LOCUS_28830 1053 2273 gene locus_tag LOCUS_28840 1053 2273 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence280 237 2117 gene locus_tag LOCUS_28850 237 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence281 680 249 gene locus_tag LOCUS_28860 680 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 904 677 gene locus_tag LOCUS_28870 904 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1019 1429 gene locus_tag LOCUS_28880 1019 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1927 1505 gene locus_tag LOCUS_28890 1927 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2136 1924 gene locus_tag LOCUS_28900 2136 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence282 4 2055 gene locus_tag LOCUS_28910 4 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence283 724 368 gene locus_tag LOCUS_28920 724 368 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_28920 942 1919 gene locus_tag LOCUS_28930 942 1919 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence284 181 1866 gene locus_tag LOCUS_28940 181 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence285 1737 1808 gene locus_tag LOCUS_t00470 1737 1808 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence286 659 871 gene locus_tag LOCUS_28950 659 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 868 1257 gene locus_tag LOCUS_28960 868 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1785 1243 gene locus_tag LOCUS_28970 1785 1243 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 protein_id gnl|my_center|LOCUS_28970 2137 1868 gene locus_tag LOCUS_28980 2137 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence287 <1 1211 gene locus_tag LOCUS_28990 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030309.1:DAK2 domain-containing protein >Feature sequence288 2035 242 gene locus_tag LOCUS_29000 2035 242 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110404.1 protein_id gnl|my_center|LOCUS_29000 2320 2111 gene locus_tag LOCUS_29010 2320 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence289 245 1825 gene locus_tag LOCUS_29020 245 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29020 >Feature sequence290 <1 1207 gene locus_tag LOCUS_29030 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890424.1:MFS transporter 1539 1793 gene locus_tag LOCUS_29040 1539 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2110 1775 gene locus_tag LOCUS_29050 2110 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence291 1275 661 gene locus_tag LOCUS_29060 1275 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence292 1818 1420 gene locus_tag LOCUS_29070 1818 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence293 665 1057 gene locus_tag LOCUS_29080 665 1057 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546499.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence294 348 1868 gene locus_tag LOCUS_29090 348 1868 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816116.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence295 1 1083 gene locus_tag LOCUS_29100 1 1083 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742135.1 protein_id gnl|my_center|LOCUS_29100 1080 1328 gene locus_tag LOCUS_29110 1080 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 <2159 1347 gene locus_tag LOCUS_29120 <2159 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029853.1:RNA-guided endonuclease TnpB family protein >Feature sequence296 569 1369 gene locus_tag LOCUS_29130 gene fabI 569 1369 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_29130 1723 1379 gene locus_tag LOCUS_29140 1723 1379 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence297 442 1524 gene locus_tag LOCUS_29150 442 1524 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 protein_id gnl|my_center|LOCUS_29150 1587 1925 gene locus_tag LOCUS_29160 1587 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence298 1634 348 gene locus_tag LOCUS_29170 1634 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence299 377 2107 gene locus_tag LOCUS_29180 377 2107 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence300 1982 441 gene locus_tag LOCUS_29190 1982 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29190 >Feature sequence301 162 1928 gene locus_tag LOCUS_29200 162 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence302 508 1296 gene locus_tag LOCUS_29210 508 1296 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073373.1 protein_id gnl|my_center|LOCUS_29210 <2083 1379 gene locus_tag LOCUS_29220 <2083 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143168.1:HAD family phosphatase >Feature sequence303 1142 894 gene locus_tag LOCUS_29230 1142 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 1906 1139 gene locus_tag LOCUS_29240 gene istB 1906 1139 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence304 666 980 gene locus_tag LOCUS_29250 666 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29250 1412 1089 gene locus_tag LOCUS_29260 1412 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 1600 1409 gene locus_tag LOCUS_29270 1600 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29270 1812 1597 gene locus_tag LOCUS_29280 1812 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29280 >Feature sequence305 791 522 gene locus_tag LOCUS_29290 791 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1081 788 gene locus_tag LOCUS_29300 1081 788 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467266.1 protein_id gnl|my_center|LOCUS_29300 1207 1398 gene locus_tag LOCUS_29310 1207 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence306 732 331 gene locus_tag LOCUS_29320 732 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence307 <2013 810 gene locus_tag LOCUS_29330 <2013 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222654.1:xylulokinase >Feature sequence308 1043 312 gene locus_tag LOCUS_29340 1043 312 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence309 <1958 107 gene locus_tag LOCUS_29350 <1958 107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089481.1:FAD-dependent oxidoreductase >Feature sequence310 333 791 gene locus_tag LOCUS_29360 333 791 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence311 3 173 gene locus_tag LOCUS_29370 3 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1731 259 gene locus_tag LOCUS_29380 1731 259 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227524.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence312 240 848 gene locus_tag LOCUS_29390 240 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1005 1313 gene locus_tag LOCUS_29400 1005 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence313 >Feature sequence314 253 1671 gene locus_tag LOCUS_29410 253 1671 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence315 1303 944 gene locus_tag LOCUS_29420 1303 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 1713 1300 gene locus_tag LOCUS_29430 1713 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence316 1239 172 gene locus_tag LOCUS_29440 1239 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 <1738 1223 gene locus_tag LOCUS_29450 <1738 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814412.1:RNA polymerase sigma factor SigX >Feature sequence317 190 612 gene locus_tag LOCUS_29460 190 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 942 1397 gene locus_tag LOCUS_29470 942 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence318 >Feature sequence319 799 146 gene locus_tag LOCUS_29480 799 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 924 1304 gene locus_tag LOCUS_29490 924 1304 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence320 <1624 234 gene locus_tag LOCUS_29500 <1624 234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392514.1:MFS transporter >Feature sequence321 688 1032 gene locus_tag LOCUS_29510 688 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence322 >Feature sequence323 507 193 gene locus_tag LOCUS_29520 507 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1026 715 gene locus_tag LOCUS_29530 1026 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence324 257 173 gene locus_tag LOCUS_t00480 257 173 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38