>Feature sequence001 281 763 gene locus_tag LOCUS_00010 gene coaD 281 763 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_00010 756 1376 gene locus_tag LOCUS_00020 756 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1485 2057 gene locus_tag LOCUS_00030 1485 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2070 2249 gene locus_tag LOCUS_00040 gene rpmF 2070 2249 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_00040 2249 3298 gene locus_tag LOCUS_00050 gene plsX 2249 3298 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_00050 4204 3338 gene locus_tag LOCUS_00060 4204 3338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_00060 5491 4259 gene locus_tag LOCUS_00070 5491 4259 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_00070 5631 6173 gene locus_tag LOCUS_00080 5631 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6851 6063 gene locus_tag LOCUS_00090 6851 6063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 protein_id gnl|my_center|LOCUS_00090 6872 7651 gene locus_tag LOCUS_00100 6872 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7793 8845 gene locus_tag LOCUS_00110 7793 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9737 8823 gene locus_tag LOCUS_00120 9737 8823 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_00120 12427 9734 gene locus_tag LOCUS_00130 12427 9734 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911903.1 protein_id gnl|my_center|LOCUS_00130 13485 12505 gene locus_tag LOCUS_00140 13485 12505 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_00140 15122 13578 gene locus_tag LOCUS_00150 15122 13578 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_00150 15391 15687 gene locus_tag LOCUS_00160 gene acpP 15391 15687 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057709.1 protein_id gnl|my_center|LOCUS_00160 15818 16372 gene locus_tag LOCUS_00170 15818 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16365 17207 gene locus_tag LOCUS_00180 gene mutM 16365 17207 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_00180 17271 20924 gene locus_tag LOCUS_00190 gene smc 17271 20924 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950799.1 protein_id gnl|my_center|LOCUS_00190 20921 22129 gene locus_tag LOCUS_00200 20921 22129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22191 23750 gene locus_tag LOCUS_00210 gene ffh 22191 23750 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069602.1 protein_id gnl|my_center|LOCUS_00210 23824 24147 gene locus_tag LOCUS_00220 gene rpsP 23824 24147 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_00220 24144 24467 gene locus_tag LOCUS_00230 24144 24467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24478 24972 gene locus_tag LOCUS_00240 gene rimM 24478 24972 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_00240 25039 25794 gene locus_tag LOCUS_00250 gene trmD 25039 25794 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_00250 25814 26266 gene locus_tag LOCUS_00260 gene rplS 25814 26266 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_00260 26318 26620 gene locus_tag LOCUS_00270 26318 26620 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_00270 26617 26982 gene locus_tag LOCUS_00280 26617 26982 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_00280 27094 27888 gene locus_tag LOCUS_00290 27094 27888 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_00290 28091 29644 gene locus_tag LOCUS_00300 28091 29644 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_00300 29638 30840 gene locus_tag LOCUS_00310 29638 30840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31477 30911 gene locus_tag LOCUS_00320 31477 30911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31663 32553 gene locus_tag LOCUS_00330 31663 32553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32580 33851 gene locus_tag LOCUS_00340 32580 33851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34292 33885 gene locus_tag LOCUS_00350 34292 33885 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227968.1 protein_id gnl|my_center|LOCUS_00350 34366 35358 gene locus_tag LOCUS_00360 34366 35358 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871993.1 protein_id gnl|my_center|LOCUS_00360 35422 36909 gene locus_tag LOCUS_00370 gene fumC 35422 36909 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948622.1 protein_id gnl|my_center|LOCUS_00370 36986 38221 gene locus_tag LOCUS_00380 gene cyp142 36986 38221 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_00380 38270 38572 gene locus_tag LOCUS_00390 38270 38572 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_00390 39200 38586 gene locus_tag LOCUS_00400 39200 38586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_00400 40138 39200 gene locus_tag LOCUS_00410 gene htpX 40138 39200 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_00410 40430 40149 gene locus_tag LOCUS_00420 40430 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_00420 41212 40427 gene locus_tag LOCUS_00430 41212 40427 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_00430 41352 42248 gene locus_tag LOCUS_00440 gene mca 41352 42248 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_00440 42245 42649 gene locus_tag LOCUS_00450 42245 42649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43355 42627 gene locus_tag LOCUS_00460 43355 42627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44341 43508 gene locus_tag LOCUS_00470 44341 43508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 44606 44385 gene locus_tag LOCUS_00480 44606 44385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44642 45628 gene locus_tag LOCUS_00490 44642 45628 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_00490 46211 45681 gene locus_tag LOCUS_00500 gene purE 46211 45681 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907900.1 protein_id gnl|my_center|LOCUS_00500 46449 47354 gene locus_tag LOCUS_00510 46449 47354 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230804.1 protein_id gnl|my_center|LOCUS_00510 48036 47428 gene locus_tag LOCUS_00520 48036 47428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 48665 48093 gene locus_tag LOCUS_00530 48665 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 49483 48662 gene locus_tag LOCUS_00540 49483 48662 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_00540 50419 49493 gene locus_tag LOCUS_00550 50419 49493 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944890.1 protein_id gnl|my_center|LOCUS_00550 50487 51152 gene locus_tag LOCUS_00560 50487 51152 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_00560 51251 51802 gene locus_tag LOCUS_00570 51251 51802 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038743.1 protein_id gnl|my_center|LOCUS_00570 51831 52157 gene locus_tag LOCUS_00580 51831 52157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 52239 52448 gene locus_tag LOCUS_00590 52239 52448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 53229 52474 gene locus_tag LOCUS_00600 53229 52474 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_00600 53455 54231 gene locus_tag LOCUS_00610 53455 54231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00610 54346 54843 gene locus_tag LOCUS_00620 54346 54843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00620 55244 55660 gene locus_tag LOCUS_00630 55244 55660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 55895 55824 gene locus_tag LOCUS_t00010 55895 55824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 56696 56037 gene locus_tag LOCUS_00640 56696 56037 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228072.1 protein_id gnl|my_center|LOCUS_00640 56842 58092 gene locus_tag LOCUS_00650 56842 58092 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_00650 60613 58082 gene locus_tag LOCUS_00660 60613 58082 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268170.1 protein_id gnl|my_center|LOCUS_00660 61339 61920 gene locus_tag LOCUS_00670 61339 61920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 61957 62148 gene locus_tag LOCUS_00680 61957 62148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 62145 62432 gene locus_tag LOCUS_00690 62145 62432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 63212 62946 gene locus_tag LOCUS_00700 63212 62946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 63442 63209 gene locus_tag LOCUS_00710 63442 63209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 63641 63916 gene locus_tag LOCUS_00720 63641 63916 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229671.1 protein_id gnl|my_center|LOCUS_00720 63913 64269 gene locus_tag LOCUS_00730 63913 64269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 64266 64676 gene locus_tag LOCUS_00740 64266 64676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 65533 65185 gene locus_tag LOCUS_tm00010 65533 65185 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 66134 65673 gene locus_tag LOCUS_00750 gene smpB 66134 65673 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_00750 66307 66714 gene locus_tag LOCUS_00760 gene mec 66307 66714 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_00760 66844 67149 gene locus_tag LOCUS_00770 66844 67149 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_00770 67146 68093 gene locus_tag LOCUS_00780 67146 68093 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_00780 68105 68857 gene locus_tag LOCUS_00790 68105 68857 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_00790 68884 69618 gene locus_tag LOCUS_00800 gene rph 68884 69618 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_00800 69621 70223 gene locus_tag LOCUS_00810 gene rdgB 69621 70223 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_00810 71108 70278 gene locus_tag LOCUS_00820 71108 70278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 71516 72511 gene locus_tag LOCUS_00830 71516 72511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 72508 73359 gene locus_tag LOCUS_00840 72508 73359 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446672.1 protein_id gnl|my_center|LOCUS_00840 74488 73391 gene locus_tag LOCUS_00850 74488 73391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 77012 74652 gene locus_tag LOCUS_00860 77012 74652 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081546.1 protein_id gnl|my_center|LOCUS_00860 77111 77320 gene locus_tag LOCUS_00870 77111 77320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 78842 77253 gene locus_tag LOCUS_00880 78842 77253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 80106 79084 gene locus_tag LOCUS_00890 80106 79084 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_00890 80152 80226 gene locus_tag LOCUS_t00020 80152 80226 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 80518 80591 gene locus_tag LOCUS_t00030 80518 80591 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 81293 80757 gene locus_tag LOCUS_00900 81293 80757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 81344 82396 gene locus_tag LOCUS_00910 81344 82396 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_00910 82447 83016 gene locus_tag LOCUS_00920 82447 83016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 83117 86284 gene locus_tag LOCUS_00930 83117 86284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 83324 83407 gene locus_tag LOCUS_t00040 83324 83407 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 86363 87022 gene locus_tag LOCUS_00940 86363 87022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 87209 87463 gene locus_tag LOCUS_00950 87209 87463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 87875 87495 gene locus_tag LOCUS_00960 87875 87495 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_00960 88234 88422 gene locus_tag LOCUS_00970 88234 88422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 88419 89147 gene locus_tag LOCUS_00980 88419 89147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 89147 90148 gene locus_tag LOCUS_00990 89147 90148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 90218 90535 gene locus_tag LOCUS_01000 90218 90535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 91328 90591 gene locus_tag LOCUS_01010 91328 90591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_01010 91353 91362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91404 92564 gene locus_tag LOCUS_01020 91404 92564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 92568 93203 gene locus_tag LOCUS_01030 92568 93203 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095216.1 protein_id gnl|my_center|LOCUS_01030 93244 93834 gene locus_tag LOCUS_01040 93244 93834 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920931.1 protein_id gnl|my_center|LOCUS_01040 93831 94928 gene locus_tag LOCUS_01050 93831 94928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 94921 95922 gene locus_tag LOCUS_01060 94921 95922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 95919 96365 gene locus_tag LOCUS_01070 95919 96365 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 protein_id gnl|my_center|LOCUS_01070 96847 98031 gene locus_tag LOCUS_01080 gene nhaA 96847 98031 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 protein_id gnl|my_center|LOCUS_01080 98149 98631 gene locus_tag LOCUS_01090 98149 98631 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_01090 98725 99417 gene locus_tag LOCUS_01100 98725 99417 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937794.1 protein_id gnl|my_center|LOCUS_01100 99414 100307 gene locus_tag LOCUS_01110 99414 100307 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225293.1 protein_id gnl|my_center|LOCUS_01110 100318 100800 gene locus_tag LOCUS_01120 100318 100800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 100903 101310 gene locus_tag LOCUS_01130 gene mscL 100903 101310 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_01130 101564 101331 gene locus_tag LOCUS_01140 101564 101331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 101731 102375 gene locus_tag LOCUS_01150 101731 102375 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_01150 102459 103079 gene locus_tag LOCUS_01160 102459 103079 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_01160 104055 103084 gene locus_tag LOCUS_01170 104055 103084 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748902.1 protein_id gnl|my_center|LOCUS_01170 104449 105747 gene locus_tag LOCUS_01180 104449 105747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 105744 107162 gene locus_tag LOCUS_01190 105744 107162 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_01190 107159 108019 gene locus_tag LOCUS_01200 107159 108019 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_01200 109073 108027 gene locus_tag LOCUS_01210 109073 108027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 110659 109070 gene locus_tag LOCUS_01220 110659 109070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 111894 110656 gene locus_tag LOCUS_01230 111894 110656 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_01230 114377 111891 gene locus_tag LOCUS_01240 114377 111891 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_01240 114431 115084 gene locus_tag LOCUS_01250 114431 115084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 115783 115145 gene locus_tag LOCUS_01260 115783 115145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 116755 115790 gene locus_tag LOCUS_01270 116755 115790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 116822 118294 gene locus_tag LOCUS_01280 116822 118294 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_01280 118461 118536 gene locus_tag LOCUS_t00050 118461 118536 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 118606 118806 gene locus_tag LOCUS_01290 118606 118806 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_01290 119371 118910 gene locus_tag LOCUS_01300 119371 118910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 119611 120807 gene locus_tag LOCUS_01310 119611 120807 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_01310 122050 121007 gene locus_tag LOCUS_01320 122050 121007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 122500 122084 gene locus_tag LOCUS_01330 122500 122084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 122678 123877 gene locus_tag LOCUS_01340 122678 123877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 123877 124764 gene locus_tag LOCUS_01350 123877 124764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 124807 125223 gene locus_tag LOCUS_01360 124807 125223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 125238 126068 gene locus_tag LOCUS_01370 125238 126068 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_01370 126075 126899 gene locus_tag LOCUS_01380 126075 126899 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_01380 126904 128637 gene locus_tag LOCUS_01390 gene recN 126904 128637 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_01390 128810 130462 gene locus_tag LOCUS_01400 128810 130462 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_01400 130459 131049 gene locus_tag LOCUS_01410 130459 131049 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463851.1 protein_id gnl|my_center|LOCUS_01410 131053 132003 gene locus_tag LOCUS_01420 gene xerD 131053 132003 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 protein_id gnl|my_center|LOCUS_01420 132030 132371 gene locus_tag LOCUS_01430 132030 132371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 132385 133179 gene locus_tag LOCUS_01440 132385 133179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 133176 136118 gene locus_tag LOCUS_01450 133176 136118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 137056 136073 gene locus_tag LOCUS_01460 gene trpS 137056 136073 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_01460 137142 137912 gene locus_tag LOCUS_01470 137142 137912 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_01470 137916 138488 gene locus_tag LOCUS_01480 gene scpB 137916 138488 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_01480 138504 139301 gene locus_tag LOCUS_01490 138504 139301 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_01490 139314 139682 gene locus_tag LOCUS_01500 gene aroH 139314 139682 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_01500 139741 140805 gene locus_tag LOCUS_01510 139741 140805 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_01510 140802 142109 gene locus_tag LOCUS_01520 gene aroA 140802 142109 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_01520 142109 142828 gene locus_tag LOCUS_01530 gene cmk 142109 142828 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_01530 142810 143532 gene locus_tag LOCUS_01540 142810 143532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 144500 143580 gene locus_tag LOCUS_01550 144500 143580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 145048 144497 gene locus_tag LOCUS_01560 145048 144497 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_01560 146113 145076 gene locus_tag LOCUS_01570 146113 145076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 147239 146127 gene locus_tag LOCUS_01580 147239 146127 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 protein_id gnl|my_center|LOCUS_01580 147334 148836 gene locus_tag LOCUS_01590 147334 148836 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_01590 148833 150215 gene locus_tag LOCUS_01600 gene der 148833 150215 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_01600 150219 150416 gene locus_tag LOCUS_01610 150219 150416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 150515 150591 gene locus_tag LOCUS_t00060 150515 150591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 375 614 gene locus_tag LOCUS_01620 375 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 611 949 gene locus_tag LOCUS_01630 611 949 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_01630 1205 2773 gene locus_tag LOCUS_01640 1205 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2955 4862 gene locus_tag LOCUS_01650 2955 4862 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_01650 5757 4972 gene locus_tag LOCUS_01660 5757 4972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225174.1 protein_id gnl|my_center|LOCUS_01660 6254 5754 gene locus_tag LOCUS_01670 6254 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7090 6251 gene locus_tag LOCUS_01680 7090 6251 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_01680 7099 8859 gene locus_tag LOCUS_01690 gene ettA 7099 8859 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258061.1 protein_id gnl|my_center|LOCUS_01690 8950 9354 gene locus_tag LOCUS_01700 8950 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9351 10178 gene locus_tag LOCUS_01710 9351 10178 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_01710 10178 11077 gene locus_tag LOCUS_01720 10178 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 11074 11922 gene locus_tag LOCUS_01730 11074 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 13050 11965 gene locus_tag LOCUS_01740 13050 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 14296 13175 gene locus_tag LOCUS_01750 14296 13175 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112987.1 protein_id gnl|my_center|LOCUS_01750 14958 14299 gene locus_tag LOCUS_01760 14958 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 15122 16555 gene locus_tag LOCUS_01770 15122 16555 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_01770 17211 16654 gene locus_tag LOCUS_01780 17211 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 17977 17273 gene locus_tag LOCUS_01790 17977 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_01790 18404 18027 gene locus_tag LOCUS_01800 18404 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 19280 18492 gene locus_tag LOCUS_01810 gene fabI 19280 18492 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_01810 19343 20005 gene locus_tag LOCUS_01820 gene npdG 19343 20005 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_01820 20031 21179 gene locus_tag LOCUS_01830 gene cysS 20031 21179 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_01830 21380 23419 gene locus_tag LOCUS_01840 gene thrS 21380 23419 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_01840 23416 23985 gene locus_tag LOCUS_01850 23416 23985 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_01850 24088 24864 gene locus_tag LOCUS_01860 24088 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 24900 25832 gene locus_tag LOCUS_01870 24900 25832 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_01870 25849 27624 gene locus_tag LOCUS_01880 25849 27624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 27656 28813 gene locus_tag LOCUS_01890 27656 28813 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_01890 28836 30026 gene locus_tag LOCUS_01900 28836 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 30633 30091 gene locus_tag LOCUS_01910 30633 30091 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_01910 30764 31345 gene locus_tag LOCUS_01920 30764 31345 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_01920 32173 31409 gene locus_tag LOCUS_01930 32173 31409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 33411 32203 gene locus_tag LOCUS_01940 33411 32203 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522068.1 protein_id gnl|my_center|LOCUS_01940 33469 34170 gene locus_tag LOCUS_01950 33469 34170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 34167 36653 gene locus_tag LOCUS_01960 34167 36653 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_01960 36711 37091 gene locus_tag LOCUS_01970 gene gcvH 36711 37091 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_01970 37140 37622 gene locus_tag LOCUS_01980 37140 37622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 37660 39021 gene locus_tag LOCUS_01990 37660 39021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 39097 39615 gene locus_tag LOCUS_02000 39097 39615 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895101.1 protein_id gnl|my_center|LOCUS_02000 39812 40288 gene locus_tag LOCUS_02010 39812 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 41340 40285 gene locus_tag LOCUS_02020 41340 40285 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_02020 41538 43388 gene locus_tag LOCUS_02030 41538 43388 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_02030 43480 44961 gene locus_tag LOCUS_02040 43480 44961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 45631 44972 gene locus_tag LOCUS_02050 45631 44972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 46061 45660 gene locus_tag LOCUS_02060 46061 45660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 47180 46320 gene locus_tag LOCUS_02070 gene thiD 47180 46320 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_02070 48031 47177 gene locus_tag LOCUS_02080 48031 47177 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_02080 48275 48072 gene locus_tag LOCUS_02090 gene thiS 48275 48072 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_02090 49450 48272 gene locus_tag LOCUS_02100 gene thiO 49450 48272 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_02100 49585 54210 gene locus_tag LOCUS_02110 gene gltB 49585 54210 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_02110 54203 55711 gene locus_tag LOCUS_02120 54203 55711 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_02120 56988 55738 gene locus_tag LOCUS_02130 56988 55738 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900033.1 protein_id gnl|my_center|LOCUS_02130 57975 57043 gene locus_tag LOCUS_02140 57975 57043 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_02140 58153 59907 gene locus_tag LOCUS_02150 58153 59907 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_02150 59904 60170 gene locus_tag LOCUS_02160 59904 60170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 61301 60183 gene locus_tag LOCUS_02170 61301 60183 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_02170 63686 61311 gene locus_tag LOCUS_02180 63686 61311 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_02180 64548 63790 gene locus_tag LOCUS_02190 gene pgl 64548 63790 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407433.1 protein_id gnl|my_center|LOCUS_02190 66218 64545 gene locus_tag LOCUS_02200 gene zwf 66218 64545 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_02200 67342 66215 gene locus_tag LOCUS_02210 67342 66215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 69392 67386 gene locus_tag LOCUS_02220 gene tkt 69392 67386 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_02220 69538 69972 gene locus_tag LOCUS_02230 69538 69972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 70142 70474 gene locus_tag LOCUS_02240 70142 70474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 70471 70689 gene locus_tag LOCUS_02250 70471 70689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 70694 70912 gene locus_tag LOCUS_02260 70694 70912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 70909 71739 gene locus_tag LOCUS_02270 70909 71739 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_02270 72016 71780 gene locus_tag LOCUS_02280 72016 71780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 72512 74185 gene locus_tag LOCUS_02290 gene arc 72512 74185 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_02290 74242 75735 gene locus_tag LOCUS_02300 gene dop 74242 75735 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_02300 75747 75944 gene locus_tag LOCUS_02310 75747 75944 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061283.1 protein_id gnl|my_center|LOCUS_02310 75949 76764 gene locus_tag LOCUS_02320 gene prcB 75949 76764 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence003 511 1218 gene locus_tag LOCUS_02330 511 1218 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730572.1 protein_id gnl|my_center|LOCUS_02330 1215 2432 gene locus_tag LOCUS_02340 1215 2432 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_02340 2534 2619 gene locus_tag LOCUS_t00070 2534 2619 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3623 2706 gene locus_tag LOCUS_02350 3623 2706 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_02350 3800 4699 gene locus_tag LOCUS_02360 3800 4699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894961.1 protein_id gnl|my_center|LOCUS_02360 4772 5317 gene locus_tag LOCUS_02370 4772 5317 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_02370 5823 5413 gene locus_tag LOCUS_02380 5823 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5884 6411 gene locus_tag LOCUS_02390 5884 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 6509 7072 gene locus_tag LOCUS_02400 6509 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7069 8799 gene locus_tag LOCUS_02410 7069 8799 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_02410 10009 8768 gene locus_tag LOCUS_02420 10009 8768 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_02420 10875 10006 gene locus_tag LOCUS_02430 10875 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 11684 10935 gene locus_tag LOCUS_02440 11684 10935 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 protein_id gnl|my_center|LOCUS_02440 12224 11847 gene locus_tag LOCUS_02450 12224 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 14132 12372 gene locus_tag LOCUS_02460 14132 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14718 14143 gene locus_tag LOCUS_02470 14718 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 17054 14715 gene locus_tag LOCUS_02480 17054 14715 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_02480 17369 18238 gene locus_tag LOCUS_02490 17369 18238 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_02490 18303 19214 gene locus_tag LOCUS_02500 18303 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 19292 20665 gene locus_tag LOCUS_02510 19292 20665 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_02510 20835 20993 gene locus_tag LOCUS_02520 20835 20993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 21012 21236 gene locus_tag LOCUS_02530 21012 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 24763 21680 gene locus_tag LOCUS_02540 24763 21680 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 protein_id gnl|my_center|LOCUS_02540 26094 24760 gene locus_tag LOCUS_02550 26094 24760 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_02550 26495 27856 gene locus_tag LOCUS_02560 26495 27856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 27896 28957 gene locus_tag LOCUS_02570 27896 28957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 28954 30306 gene locus_tag LOCUS_02580 28954 30306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 30303 31997 gene locus_tag LOCUS_02590 30303 31997 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_02590 32075 32989 gene locus_tag LOCUS_02600 32075 32989 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_02600 34114 33275 gene locus_tag LOCUS_02610 34114 33275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 35172 34198 gene locus_tag LOCUS_02620 35172 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 35603 35316 gene locus_tag LOCUS_02630 35603 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 40236 35821 gene locus_tag LOCUS_02640 40236 35821 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_02640 42515 40233 gene locus_tag LOCUS_02650 42515 40233 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776169.1 protein_id gnl|my_center|LOCUS_02650 43894 42512 gene locus_tag LOCUS_02660 43894 42512 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_02660 44888 43899 gene locus_tag LOCUS_02670 44888 43899 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_02670 51030 44947 gene locus_tag LOCUS_02680 51030 44947 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_02680 51897 51181 gene locus_tag LOCUS_02690 51897 51181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_02690 53531 51885 gene locus_tag LOCUS_02700 53531 51885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 55180 53528 gene locus_tag LOCUS_02710 55180 53528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02710 56151 55177 gene locus_tag LOCUS_02720 56151 55177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 56396 56923 gene locus_tag LOCUS_02730 56396 56923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 57950 57009 gene locus_tag LOCUS_02740 57950 57009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 58941 57943 gene locus_tag LOCUS_02750 58941 57943 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741117.1 protein_id gnl|my_center|LOCUS_02750 59048 60223 gene locus_tag LOCUS_02760 59048 60223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 61470 60280 gene locus_tag LOCUS_02770 61470 60280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 61582 62349 gene locus_tag LOCUS_02780 gene rfbF 61582 62349 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_02780 62334 63548 gene locus_tag LOCUS_02790 gene rfbG 62334 63548 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_02790 63628 64797 gene locus_tag LOCUS_02800 63628 64797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613583.1 protein_id gnl|my_center|LOCUS_02800 64794 65333 gene locus_tag LOCUS_02810 gene rfbC 64794 65333 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_02810 65330 66247 gene locus_tag LOCUS_02820 65330 66247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 66244 68040 gene locus_tag LOCUS_02830 66244 68040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834715.1 protein_id gnl|my_center|LOCUS_02830 69044 68049 gene locus_tag LOCUS_02840 69044 68049 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_02840 70159 69041 gene locus_tag LOCUS_02850 70159 69041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence004 1757 669 gene locus_tag LOCUS_02860 1757 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 1726 1735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2136 1762 gene locus_tag LOCUS_02870 2136 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3538 2129 gene locus_tag LOCUS_02880 gene lpdA 3538 2129 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_02880 4688 3786 gene locus_tag LOCUS_02890 4688 3786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227235.1 protein_id gnl|my_center|LOCUS_02890 5683 4688 gene locus_tag LOCUS_02900 5683 4688 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250095.1 protein_id gnl|my_center|LOCUS_02900 6234 5767 gene locus_tag LOCUS_02910 6234 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 6569 6267 gene locus_tag LOCUS_02920 6569 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 6864 9602 gene locus_tag LOCUS_02930 gene aceE 6864 9602 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_02930 9704 10279 gene locus_tag LOCUS_02940 9704 10279 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_02940 10276 10980 gene locus_tag LOCUS_02950 10276 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 11614 10985 gene locus_tag LOCUS_02960 11614 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12585 11938 gene locus_tag LOCUS_02970 12585 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13776 12661 gene locus_tag LOCUS_02980 13776 12661 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_02980 14012 14635 gene locus_tag LOCUS_02990 14012 14635 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 protein_id gnl|my_center|LOCUS_02990 16888 14714 gene locus_tag LOCUS_03000 16888 14714 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_03000 17355 16996 gene locus_tag LOCUS_03010 17355 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 17482 18261 gene locus_tag LOCUS_03020 gene sufC 17482 18261 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_03020 18249 19505 gene locus_tag LOCUS_03030 18249 19505 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_03030 19588 20094 gene locus_tag LOCUS_03040 19588 20094 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_03040 20887 20135 gene locus_tag LOCUS_03050 gene sufC 20887 20135 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_03050 21255 20884 gene locus_tag LOCUS_03060 21255 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 22698 21355 gene locus_tag LOCUS_03070 gene sufD 22698 21355 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_03070 21377 21386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22734 23648 gene locus_tag LOCUS_03080 22734 23648 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_03080 23652 24884 gene locus_tag LOCUS_03090 23652 24884 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_03090 25241 24897 gene locus_tag LOCUS_03100 25241 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 26705 25305 gene locus_tag LOCUS_03110 gene sufB 26705 25305 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_03110 26859 29156 gene locus_tag LOCUS_03120 26859 29156 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_03120 30168 29140 gene locus_tag LOCUS_03130 30168 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 31288 30281 gene locus_tag LOCUS_03140 31288 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 31931 31380 gene locus_tag LOCUS_03150 gene rfbC 31931 31380 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807148.1 protein_id gnl|my_center|LOCUS_03150 32439 31897 gene locus_tag LOCUS_03160 32439 31897 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_03160 33302 32439 gene locus_tag LOCUS_03170 33302 32439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_03170 33414 34283 gene locus_tag LOCUS_03180 33414 34283 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728075.1 protein_id gnl|my_center|LOCUS_03180 35256 34339 gene locus_tag LOCUS_03190 35256 34339 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_03190 35774 35262 gene locus_tag LOCUS_03200 35774 35262 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_03200 36265 35843 gene locus_tag LOCUS_03210 36265 35843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 36360 37007 gene locus_tag LOCUS_03220 36360 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 37010 38218 gene locus_tag LOCUS_03230 37010 38218 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230188.1 protein_id gnl|my_center|LOCUS_03230 38445 39851 gene locus_tag LOCUS_03240 38445 39851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 39841 41046 gene locus_tag LOCUS_03250 39841 41046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 41043 42794 gene locus_tag LOCUS_03260 41043 42794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 43985 42738 gene locus_tag LOCUS_03270 43985 42738 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230188.1 protein_id gnl|my_center|LOCUS_03270 44252 45883 gene locus_tag LOCUS_03280 44252 45883 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_03280 45468 45562 gene locus_tag LOCUS_t00080 45468 45562 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46880 46500 gene locus_tag LOCUS_03290 46880 46500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 47128 46877 gene locus_tag LOCUS_03300 47128 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 47209 47373 gene locus_tag LOCUS_03310 47209 47373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 47632 47781 gene locus_tag LOCUS_03320 47632 47781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 47815 48342 gene locus_tag LOCUS_03330 47815 48342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 49276 48425 gene locus_tag LOCUS_03340 49276 48425 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_03340 49188 49376 gene locus_tag LOCUS_03350 49188 49376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 49428 49901 gene locus_tag LOCUS_03360 49428 49901 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254192.1 protein_id gnl|my_center|LOCUS_03360 51143 49968 gene locus_tag LOCUS_03370 51143 49968 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_03370 52443 51205 gene locus_tag LOCUS_03380 52443 51205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_03380 53290 52478 gene locus_tag LOCUS_03390 53290 52478 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_03390 53476 54618 gene locus_tag LOCUS_03400 53476 54618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 54780 55754 gene locus_tag LOCUS_03410 54780 55754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 56370 56585 gene locus_tag LOCUS_03420 56370 56585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 57605 56574 gene locus_tag LOCUS_03430 57605 56574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 58185 57610 gene locus_tag LOCUS_03440 58185 57610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 58667 58176 gene locus_tag LOCUS_03450 58667 58176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 59596 58670 gene locus_tag LOCUS_03460 59596 58670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 59795 60904 gene locus_tag LOCUS_03470 59795 60904 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_03470 62000 60993 gene locus_tag LOCUS_03480 62000 60993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 62158 63708 gene locus_tag LOCUS_03490 gene fadD4 62158 63708 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_03490 65218 63725 gene locus_tag LOCUS_03500 65218 63725 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_03500 66260 65229 gene locus_tag LOCUS_03510 66260 65229 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence005 <1 1492 gene locus_tag LOCUS_03520 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224932.1:GDSL-type esterase/lipase family protein 2583 1468 gene locus_tag LOCUS_03530 2583 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2573 2929 gene locus_tag LOCUS_03540 2573 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3630 2890 gene locus_tag LOCUS_03550 3630 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4478 3627 gene locus_tag LOCUS_03560 4478 3627 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039612.1 protein_id gnl|my_center|LOCUS_03560 5341 4484 gene locus_tag LOCUS_03570 5341 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5631 6227 gene locus_tag LOCUS_03580 5631 6227 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 protein_id gnl|my_center|LOCUS_03580 6301 6858 gene locus_tag LOCUS_03590 6301 6858 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_03590 6884 7603 gene locus_tag LOCUS_03600 6884 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 7977 8804 gene locus_tag LOCUS_03610 7977 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_03610 8818 9969 gene locus_tag LOCUS_03620 8818 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 9996 13139 gene locus_tag LOCUS_03630 gene dnaE2 9996 13139 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908228.1 protein_id gnl|my_center|LOCUS_03630 13410 13985 gene locus_tag LOCUS_03640 13410 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 14991 13975 gene locus_tag LOCUS_03650 14991 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 15869 14988 gene locus_tag LOCUS_03660 gene folP 15869 14988 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730302.1 protein_id gnl|my_center|LOCUS_03660 16612 15893 gene locus_tag LOCUS_03670 16612 15893 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_03670 16679 17746 gene locus_tag LOCUS_03680 16679 17746 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_03680 17743 18648 gene locus_tag LOCUS_03690 17743 18648 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 protein_id gnl|my_center|LOCUS_03690 19547 20605 gene locus_tag LOCUS_03700 19547 20605 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_03700 23209 20699 gene locus_tag LOCUS_03710 gene leuS 23209 20699 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583912.1 protein_id gnl|my_center|LOCUS_03710 23482 23558 gene locus_tag LOCUS_t00090 23482 23558 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24947 23733 gene locus_tag LOCUS_03720 24947 23733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 24984 25217 gene locus_tag LOCUS_03730 24984 25217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 25480 26670 gene locus_tag LOCUS_03740 25480 26670 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_03740 27241 26957 gene locus_tag LOCUS_03750 gene relE 27241 26957 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_03750 27521 27225 gene locus_tag LOCUS_03760 gene relF 27521 27225 CDS product type II toxin-antitoxin system antitoxin RelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414599.1 protein_id gnl|my_center|LOCUS_03760 28038 27625 gene locus_tag LOCUS_03770 28038 27625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 28441 28031 gene locus_tag LOCUS_03780 28441 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 28819 28502 gene locus_tag LOCUS_03790 28819 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 29299 28871 gene locus_tag LOCUS_03800 29299 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 30945 29695 gene locus_tag LOCUS_03810 30945 29695 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_03810 33322 31079 gene locus_tag LOCUS_03820 33322 31079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 34920 33340 gene locus_tag LOCUS_03830 34920 33340 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214612.1 protein_id gnl|my_center|LOCUS_03830 35026 36081 gene locus_tag LOCUS_03840 35026 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 36203 37180 gene locus_tag LOCUS_03850 36203 37180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 38033 37221 gene locus_tag LOCUS_03860 38033 37221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 38216 38225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38521 39969 gene locus_tag LOCUS_03870 gene ahcY 38521 39969 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_03870 40810 40025 gene locus_tag LOCUS_03880 40810 40025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 40900 41199 gene locus_tag LOCUS_03890 40900 41199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 41400 43694 gene locus_tag LOCUS_03900 41400 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 45633 43849 gene locus_tag LOCUS_03910 45633 43849 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_03910 46194 45709 gene locus_tag LOCUS_03920 46194 45709 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_03920 46266 46829 gene locus_tag LOCUS_03930 46266 46829 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227904.1 protein_id gnl|my_center|LOCUS_03930 46826 47899 gene locus_tag LOCUS_03940 46826 47899 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_03940 47903 49114 gene locus_tag LOCUS_03950 gene bioB 47903 49114 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 protein_id gnl|my_center|LOCUS_03950 49346 49927 gene locus_tag LOCUS_03960 49346 49927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 51235 49949 gene locus_tag LOCUS_03970 51235 49949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 51334 52158 gene locus_tag LOCUS_03980 gene ubiE 51334 52158 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_03980 52158 52907 gene locus_tag LOCUS_03990 52158 52907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 53415 52948 gene locus_tag LOCUS_04000 53415 52948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 53839 53558 gene locus_tag LOCUS_04010 53839 53558 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_04010 53979 54575 gene locus_tag LOCUS_04020 53979 54575 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_04020 54563 55750 gene locus_tag LOCUS_04030 gene dusB 54563 55750 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_04030 55842 57440 gene locus_tag LOCUS_04040 55842 57440 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111673.1 protein_id gnl|my_center|LOCUS_04040 58504 57464 gene locus_tag LOCUS_04050 58504 57464 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226263.1 protein_id gnl|my_center|LOCUS_04050 58828 58616 gene locus_tag LOCUS_04060 58828 58616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 58981 59892 gene locus_tag LOCUS_04070 58981 59892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_04070 60616 59924 gene locus_tag LOCUS_04080 60616 59924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 61805 60606 gene locus_tag LOCUS_04090 gene bioF 61805 60606 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_04090 63304 61802 gene locus_tag LOCUS_04100 gene bioA 63304 61802 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_04100 63320 63796 gene locus_tag LOCUS_04110 gene ribC 63320 63796 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_04110 65155 63866 gene locus_tag LOCUS_04120 65155 63866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence006 4 1734 gene locus_tag LOCUS_04130 4 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1909 3411 gene locus_tag LOCUS_04140 gene zwf 1909 3411 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_04140 3539 4012 gene locus_tag LOCUS_04150 3539 4012 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804259.1 protein_id gnl|my_center|LOCUS_04150 4080 5090 gene locus_tag LOCUS_04160 4080 5090 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_04160 5224 5895 gene locus_tag LOCUS_04170 5224 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6651 5974 gene locus_tag LOCUS_04180 6651 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 7733 7005 gene locus_tag LOCUS_04190 7733 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8315 7845 gene locus_tag LOCUS_04200 8315 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 8537 9718 gene locus_tag LOCUS_04210 8537 9718 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_04210 10246 9896 gene locus_tag LOCUS_04220 10246 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 10343 10933 gene locus_tag LOCUS_04230 10343 10933 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_04230 12891 11038 gene locus_tag LOCUS_04240 gene pknB 12891 11038 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_04240 14401 13034 gene locus_tag LOCUS_04250 14401 13034 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_04250 14903 14403 gene locus_tag LOCUS_04260 14903 14403 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357360.1 protein_id gnl|my_center|LOCUS_04260 15583 14927 gene locus_tag LOCUS_04270 15583 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 15721 15805 gene locus_tag LOCUS_t00100 15721 15805 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15996 17060 gene locus_tag LOCUS_04280 15996 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 17532 19187 gene locus_tag LOCUS_04290 17532 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 20776 19247 gene locus_tag LOCUS_04300 20776 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 20903 22654 gene locus_tag LOCUS_04310 20903 22654 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_04310 22709 23803 gene locus_tag LOCUS_04320 22709 23803 CDS product arsenic transport integral membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419420.1 protein_id gnl|my_center|LOCUS_04320 24815 23841 gene locus_tag LOCUS_04330 24815 23841 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_04330 25044 26066 gene locus_tag LOCUS_04340 25044 26066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 26218 28620 gene locus_tag LOCUS_04350 26218 28620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 28679 29371 gene locus_tag LOCUS_04360 28679 29371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 29395 30426 gene locus_tag LOCUS_04370 gene mgrA 29395 30426 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_04370 30985 32562 gene locus_tag LOCUS_04380 30985 32562 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_04380 33485 32652 gene locus_tag LOCUS_04390 33485 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 33723 34652 gene locus_tag LOCUS_04400 33723 34652 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_04400 34788 35228 gene locus_tag LOCUS_04410 34788 35228 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_04410 35532 36335 gene locus_tag LOCUS_04420 35532 36335 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_04420 36983 36516 gene locus_tag LOCUS_04430 36983 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 38140 37313 gene locus_tag LOCUS_04440 38140 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 39185 38130 gene locus_tag LOCUS_04450 39185 38130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 41289 39613 gene locus_tag LOCUS_04460 41289 39613 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_04460 41399 41737 gene locus_tag LOCUS_04470 41399 41737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 42431 42054 gene locus_tag LOCUS_04480 42431 42054 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_04480 42718 42428 gene locus_tag LOCUS_04490 42718 42428 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413167.1 protein_id gnl|my_center|LOCUS_04490 43305 43229 gene locus_tag LOCUS_t00110 43305 43229 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 44722 43553 gene locus_tag LOCUS_04500 44722 43553 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_04500 45123 44719 gene locus_tag LOCUS_04510 45123 44719 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_04510 45569 45165 gene locus_tag LOCUS_04520 45569 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04520 46120 45566 gene locus_tag LOCUS_04530 46120 45566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04530 47628 46126 gene locus_tag LOCUS_04540 47628 46126 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782908.1 protein_id gnl|my_center|LOCUS_04540 47879 48886 gene locus_tag LOCUS_04550 47879 48886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 49848 48919 gene locus_tag LOCUS_04560 49848 48919 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_04560 51041 49929 gene locus_tag LOCUS_04570 51041 49929 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_04570 51250 52740 gene locus_tag LOCUS_04580 51250 52740 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_04580 52740 54479 gene locus_tag LOCUS_04590 52740 54479 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088410.1 protein_id gnl|my_center|LOCUS_04590 57055 54572 gene locus_tag LOCUS_04600 gene gyrA 57055 54572 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_04600 59112 57163 gene locus_tag LOCUS_04610 gene gyrB 59112 57163 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_04610 59591 59280 gene locus_tag LOCUS_04620 59591 59280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 60706 59588 gene locus_tag LOCUS_04630 gene recF 60706 59588 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_04630 61875 60721 gene locus_tag LOCUS_04640 gene dnaN 61875 60721 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_04640 63587 62217 gene locus_tag LOCUS_04650 63587 62217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 64240 64521 gene locus_tag LOCUS_04660 64240 64521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 64518 64847 gene locus_tag LOCUS_04670 64518 64847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04670 >Feature sequence007 380 949 gene locus_tag LOCUS_04680 gene ilvN 380 949 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_04680 955 1980 gene locus_tag LOCUS_04690 gene ilvC 955 1980 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_04690 2058 3263 gene locus_tag LOCUS_04700 2058 3263 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_04700 4525 3299 gene locus_tag LOCUS_04710 gene serC 4525 3299 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_04710 4419 5678 gene locus_tag LOCUS_04720 4419 5678 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_04720 5820 7385 gene locus_tag LOCUS_04730 gene serA 5820 7385 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_04730 7904 7683 gene locus_tag LOCUS_04740 7904 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 9241 7901 gene locus_tag LOCUS_04750 9241 7901 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730104.1 protein_id gnl|my_center|LOCUS_04750 10383 9238 gene locus_tag LOCUS_04760 10383 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 11318 10380 gene locus_tag LOCUS_04770 11318 10380 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_04770 11668 11324 gene locus_tag LOCUS_04780 11668 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13091 11745 gene locus_tag LOCUS_04790 13091 11745 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229769.1 protein_id gnl|my_center|LOCUS_04790 13755 13084 gene locus_tag LOCUS_04800 13755 13084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869465.1 protein_id gnl|my_center|LOCUS_04800 14655 13777 gene locus_tag LOCUS_04810 14655 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 15666 15073 gene locus_tag LOCUS_04820 gene leuD 15666 15073 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_04820 17078 15666 gene locus_tag LOCUS_04830 gene leuC 17078 15666 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_04830 17577 17092 gene locus_tag LOCUS_04840 gene greA 17577 17092 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_04840 17753 18559 gene locus_tag LOCUS_04850 17753 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 18457 18885 gene locus_tag LOCUS_04860 18457 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 20383 18968 gene locus_tag LOCUS_04870 20383 18968 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_04870 21829 20528 gene locus_tag LOCUS_04880 gene purD 21829 20528 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_04880 22098 23498 gene locus_tag LOCUS_04890 22098 23498 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_04890 23561 24622 gene locus_tag LOCUS_04900 23561 24622 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_04900 25180 24626 gene locus_tag LOCUS_04910 25180 24626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 25325 25720 gene locus_tag LOCUS_04920 25325 25720 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225753.1 protein_id gnl|my_center|LOCUS_04920 25854 26966 gene locus_tag LOCUS_04930 25854 26966 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929894.1 protein_id gnl|my_center|LOCUS_04930 28665 27058 gene locus_tag LOCUS_04940 28665 27058 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112031.1 protein_id gnl|my_center|LOCUS_04940 28756 29265 gene locus_tag LOCUS_04950 28756 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 29262 30566 gene locus_tag LOCUS_04960 29262 30566 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_04960 30577 31878 gene locus_tag LOCUS_04970 30577 31878 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113078.1 protein_id gnl|my_center|LOCUS_04970 32119 32379 gene locus_tag LOCUS_04980 32119 32379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 32427 32957 gene locus_tag LOCUS_04990 32427 32957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 32954 33736 gene locus_tag LOCUS_05000 gene atpB 32954 33736 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878188.1 protein_id gnl|my_center|LOCUS_05000 33837 34085 gene locus_tag LOCUS_05010 33837 34085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 34203 34739 gene locus_tag LOCUS_05020 34203 34739 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908159.1 protein_id gnl|my_center|LOCUS_05020 34736 35683 gene locus_tag LOCUS_05030 34736 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 35683 37206 gene locus_tag LOCUS_05040 gene atpA 35683 37206 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356555.1 protein_id gnl|my_center|LOCUS_05040 37210 38190 gene locus_tag LOCUS_05050 37210 38190 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074370.1 protein_id gnl|my_center|LOCUS_05050 38255 39700 gene locus_tag LOCUS_05060 gene atpD 38255 39700 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 protein_id gnl|my_center|LOCUS_05060 39716 40240 gene locus_tag LOCUS_05070 39716 40240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 41328 40333 gene locus_tag LOCUS_05080 gene glpX 41328 40333 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_05080 41389 42699 gene locus_tag LOCUS_05090 gene murA 41389 42699 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_05090 42729 43832 gene locus_tag LOCUS_05100 gene meaB 42729 43832 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_05100 43829 45667 gene locus_tag LOCUS_05110 gene treS 43829 45667 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897929.1 protein_id gnl|my_center|LOCUS_05110 45664 47013 gene locus_tag LOCUS_05120 45664 47013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 47020 48072 gene locus_tag LOCUS_05130 47020 48072 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_05130 49101 48112 gene locus_tag LOCUS_05140 gene galT 49101 48112 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_05140 49314 49799 gene locus_tag LOCUS_05150 49314 49799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 50508 49870 gene locus_tag LOCUS_05160 50508 49870 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_05160 51881 50514 gene locus_tag LOCUS_05170 51881 50514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 52879 51884 gene locus_tag LOCUS_05180 gene cysD 52879 51884 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060060.1 protein_id gnl|my_center|LOCUS_05180 53183 53857 gene locus_tag LOCUS_05190 53183 53857 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228433.1 protein_id gnl|my_center|LOCUS_05190 53815 55671 gene locus_tag LOCUS_05200 53815 55671 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_05200 55668 56930 gene locus_tag LOCUS_05210 55668 56930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 56927 57352 gene locus_tag LOCUS_05220 56927 57352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 57397 58152 gene locus_tag LOCUS_05230 57397 58152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 60260 58149 gene locus_tag LOCUS_05240 60260 58149 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_05240 60334 60861 gene locus_tag LOCUS_05250 60334 60861 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226322.1 protein_id gnl|my_center|LOCUS_05250 61008 62093 gene locus_tag LOCUS_05260 gene ychF 61008 62093 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_05260 62090 62947 gene locus_tag LOCUS_05270 62090 62947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence008 2087 690 gene locus_tag LOCUS_05280 2087 690 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_05280 3381 2272 gene locus_tag LOCUS_05290 3381 2272 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_05290 3704 3940 gene locus_tag LOCUS_05300 3704 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3918 4919 gene locus_tag LOCUS_05310 3918 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4919 6121 gene locus_tag LOCUS_05320 4919 6121 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_05320 6206 6850 gene locus_tag LOCUS_05330 6206 6850 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_05330 6854 7777 gene locus_tag LOCUS_05340 6854 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7780 9348 gene locus_tag LOCUS_05350 7780 9348 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728009.1 protein_id gnl|my_center|LOCUS_05350 9680 9390 gene locus_tag LOCUS_05360 9680 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 9879 10688 gene locus_tag LOCUS_05370 9879 10688 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_05370 10867 11646 gene locus_tag LOCUS_05380 10867 11646 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_05380 11671 12642 gene locus_tag LOCUS_05390 11671 12642 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056737.1 protein_id gnl|my_center|LOCUS_05390 14606 12771 gene locus_tag LOCUS_05400 14606 12771 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814302.1 protein_id gnl|my_center|LOCUS_05400 15674 14913 gene locus_tag LOCUS_05410 15674 14913 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_05410 16150 15635 gene locus_tag LOCUS_05420 16150 15635 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_05420 16770 16147 gene locus_tag LOCUS_05430 16770 16147 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_05430 18027 16903 gene locus_tag LOCUS_05440 18027 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 18058 18879 gene locus_tag LOCUS_05450 18058 18879 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_05450 19375 18911 gene locus_tag LOCUS_05460 gene bcp 19375 18911 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_05460 19605 21371 gene locus_tag LOCUS_05470 gene thiC 19605 21371 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_05470 21611 22876 gene locus_tag LOCUS_05480 21611 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05480 22849 23652 gene locus_tag LOCUS_05490 22849 23652 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_05490 23633 24466 gene locus_tag LOCUS_05500 23633 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 24463 25200 gene locus_tag LOCUS_05510 24463 25200 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_05510 25339 27441 gene locus_tag LOCUS_05520 25339 27441 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463958.1 protein_id gnl|my_center|LOCUS_05520 27711 27929 gene locus_tag LOCUS_05530 27711 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 27929 28357 gene locus_tag LOCUS_05540 27929 28357 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406304.1 protein_id gnl|my_center|LOCUS_05540 31155 28447 gene locus_tag LOCUS_05550 gene acnA 31155 28447 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_05550 31309 31677 gene locus_tag LOCUS_05560 31309 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 protein_id gnl|my_center|LOCUS_05560 32561 31731 gene locus_tag LOCUS_05570 32561 31731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_05570 33571 32558 gene locus_tag LOCUS_05580 33571 32558 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_05580 33911 34318 gene locus_tag LOCUS_05590 33911 34318 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 protein_id gnl|my_center|LOCUS_05590 34725 35189 gene locus_tag LOCUS_05600 34725 35189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 35189 35716 gene locus_tag LOCUS_05610 35189 35716 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_05610 36773 35838 gene locus_tag LOCUS_05620 36773 35838 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_05620 37037 37690 gene locus_tag LOCUS_05630 37037 37690 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 protein_id gnl|my_center|LOCUS_05630 37965 37892 gene locus_tag LOCUS_t00120 37965 37892 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38095 39735 gene locus_tag LOCUS_05640 gene argS 38095 39735 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_05640 39738 41033 gene locus_tag LOCUS_05650 gene lysA 39738 41033 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_05650 41073 42386 gene locus_tag LOCUS_05660 41073 42386 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_05660 42383 43450 gene locus_tag LOCUS_05670 gene thrC 42383 43450 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_05670 43759 45777 gene locus_tag LOCUS_05680 43759 45777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 45865 46101 gene locus_tag LOCUS_05690 gene rpmE 45865 46101 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059822.1 protein_id gnl|my_center|LOCUS_05690 46172 47254 gene locus_tag LOCUS_05700 gene prfA 46172 47254 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_05700 47262 48233 gene locus_tag LOCUS_05710 47262 48233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 48230 48898 gene locus_tag LOCUS_05720 48230 48898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 49189 50208 gene locus_tag LOCUS_05730 49189 50208 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_05730 50242 51141 gene locus_tag LOCUS_05740 50242 51141 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_05740 51131 53011 gene locus_tag LOCUS_05750 gene cimA 51131 53011 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_05750 53008 53529 gene locus_tag LOCUS_05760 53008 53529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 54199 53651 gene locus_tag LOCUS_05770 54199 53651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 54262 55314 gene locus_tag LOCUS_05780 54262 55314 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_05780 57457 56144 gene locus_tag LOCUS_05790 57457 56144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 57837 58289 gene locus_tag LOCUS_05800 57837 58289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 59552 58347 gene locus_tag LOCUS_05810 59552 58347 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_05810 59968 59753 gene locus_tag LOCUS_05820 59968 59753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence009 442 2565 gene locus_tag LOCUS_05830 442 2565 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_05830 3045 2623 gene locus_tag LOCUS_05840 3045 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4285 3137 gene locus_tag LOCUS_05850 4285 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4489 5031 gene locus_tag LOCUS_05860 4489 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5194 5871 gene locus_tag LOCUS_05870 5194 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6125 5829 gene locus_tag LOCUS_05880 6125 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6203 7846 gene locus_tag LOCUS_05890 6203 7846 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_05890 7880 8218 gene locus_tag LOCUS_05900 7880 8218 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_05900 9124 8369 gene locus_tag LOCUS_05910 gene gpmA 9124 8369 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940195.1 protein_id gnl|my_center|LOCUS_05910 9392 11239 gene locus_tag LOCUS_05920 gene dnaK 9392 11239 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_05920 11246 12172 gene locus_tag LOCUS_05930 11246 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 12177 13301 gene locus_tag LOCUS_05940 gene dnaJ 12177 13301 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_05940 13303 13710 gene locus_tag LOCUS_05950 13303 13710 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_05950 13838 16330 gene locus_tag LOCUS_05960 gene clpB 13838 16330 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_05960 17016 16471 gene locus_tag LOCUS_05970 17016 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 17132 18517 gene locus_tag LOCUS_05980 17132 18517 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_05980 18514 19824 gene locus_tag LOCUS_05990 gene purB 18514 19824 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_05990 19821 20726 gene locus_tag LOCUS_06000 19821 20726 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_06000 20727 20999 gene locus_tag LOCUS_06010 20727 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 20999 21700 gene locus_tag LOCUS_06020 gene purQ 20999 21700 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101895.1 protein_id gnl|my_center|LOCUS_06020 22263 21832 gene locus_tag LOCUS_06030 22263 21832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 22434 24800 gene locus_tag LOCUS_06040 gene purL 22434 24800 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_06040 25695 24847 gene locus_tag LOCUS_06050 25695 24847 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_06050 25864 27330 gene locus_tag LOCUS_06060 gene purF 25864 27330 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_06060 27327 28412 gene locus_tag LOCUS_06070 gene purM 27327 28412 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 protein_id gnl|my_center|LOCUS_06070 28345 29034 gene locus_tag LOCUS_06080 28345 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 29067 30380 gene locus_tag LOCUS_06090 29067 30380 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_06090 30493 32085 gene locus_tag LOCUS_06100 30493 32085 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_06100 32150 33010 gene locus_tag LOCUS_06110 32150 33010 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_06110 33815 33060 gene locus_tag LOCUS_06120 33815 33060 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731408.1 protein_id gnl|my_center|LOCUS_06120 33877 35274 gene locus_tag LOCUS_06130 33877 35274 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_06130 36427 35360 gene locus_tag LOCUS_06140 36427 35360 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_06140 36500 37153 gene locus_tag LOCUS_06150 36500 37153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172307.1 protein_id gnl|my_center|LOCUS_06150 37320 37508 gene locus_tag LOCUS_06160 37320 37508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 37611 38738 gene locus_tag LOCUS_06170 37611 38738 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_06170 39962 38817 gene locus_tag LOCUS_06180 39962 38817 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_06180 40851 40063 gene locus_tag LOCUS_06190 40851 40063 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_06190 41669 40851 gene locus_tag LOCUS_06200 41669 40851 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224750.1 protein_id gnl|my_center|LOCUS_06200 42406 41666 gene locus_tag LOCUS_06210 42406 41666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 44288 42477 gene locus_tag LOCUS_06220 44288 42477 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_06220 46387 44285 gene locus_tag LOCUS_06230 46387 44285 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_06230 48021 46384 gene locus_tag LOCUS_06240 48021 46384 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110566.1 protein_id gnl|my_center|LOCUS_06240 48110 49471 gene locus_tag LOCUS_06250 48110 49471 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_06250 49544 51172 gene locus_tag LOCUS_06260 49544 51172 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_06260 51169 52983 gene locus_tag LOCUS_06270 51169 52983 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_06270 <53977 53063 gene locus_tag LOCUS_06280 <53977 53063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103932.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence010 1543 143 gene locus_tag LOCUS_06290 gene murL 1543 143 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_06290 2094 1618 gene locus_tag LOCUS_06300 2094 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2680 2138 gene locus_tag LOCUS_06310 2680 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2784 3764 gene locus_tag LOCUS_06320 2784 3764 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_06320 4242 3784 gene locus_tag LOCUS_06330 4242 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4384 4839 gene locus_tag LOCUS_06340 4384 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6748 4874 gene locus_tag LOCUS_06350 6748 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7193 6738 gene locus_tag LOCUS_06360 7193 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8124 7309 gene locus_tag LOCUS_06370 8124 7309 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_06370 8446 8165 gene locus_tag LOCUS_06380 8446 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 9494 8355 gene locus_tag LOCUS_06390 9494 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 8511 8520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9568 10650 gene locus_tag LOCUS_06400 9568 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 10638 11537 gene locus_tag LOCUS_06410 10638 11537 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243106.1 protein_id gnl|my_center|LOCUS_06410 11633 12370 gene locus_tag LOCUS_06420 11633 12370 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927242.1 protein_id gnl|my_center|LOCUS_06420 13699 12413 gene locus_tag LOCUS_06430 13699 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13964 13752 gene locus_tag LOCUS_06440 13964 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 14512 13961 gene locus_tag LOCUS_06450 14512 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 14850 16109 gene locus_tag LOCUS_06460 14850 16109 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_06460 17028 16114 gene locus_tag LOCUS_06470 17028 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965847.1 protein_id gnl|my_center|LOCUS_06470 17085 17651 gene locus_tag LOCUS_06480 17085 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 18096 17866 gene locus_tag LOCUS_06490 18096 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 18401 18096 gene locus_tag LOCUS_06500 18401 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 18941 18866 gene locus_tag LOCUS_t00130 18941 18866 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20435 18993 gene locus_tag LOCUS_06510 20435 18993 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_06510 20883 20443 gene locus_tag LOCUS_06520 gene dut 20883 20443 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_06520 21080 21721 gene locus_tag LOCUS_06530 gene orn 21080 21721 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096508.1 protein_id gnl|my_center|LOCUS_06530 21718 23538 gene locus_tag LOCUS_06540 21718 23538 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_06540 24604 23600 gene locus_tag LOCUS_06550 24604 23600 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_06550 25571 24678 gene locus_tag LOCUS_06560 gene truB 25571 24678 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_06560 26008 25568 gene locus_tag LOCUS_06570 26008 25568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 29088 26065 gene locus_tag LOCUS_06580 29088 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 30774 29449 gene locus_tag LOCUS_06590 30774 29449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 31322 30771 gene locus_tag LOCUS_06600 31322 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 33312 31600 gene locus_tag LOCUS_06610 33312 31600 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_06610 34647 33400 gene locus_tag LOCUS_06620 gene ispG 34647 33400 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_06620 36040 34703 gene locus_tag LOCUS_06630 gene rip 36040 34703 CDS product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 protein_id gnl|my_center|LOCUS_06630 37227 36037 gene locus_tag LOCUS_06640 37227 36037 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_06640 39365 37248 gene locus_tag LOCUS_06650 39365 37248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 40022 39453 gene locus_tag LOCUS_06660 gene frr 40022 39453 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 protein_id gnl|my_center|LOCUS_06660 40839 40117 gene locus_tag LOCUS_06670 gene pyrH 40839 40117 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_06670 41638 40844 gene locus_tag LOCUS_06680 gene tsf 41638 40844 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 protein_id gnl|my_center|LOCUS_06680 42519 41641 gene locus_tag LOCUS_06690 gene rpsB 42519 41641 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893880.1 protein_id gnl|my_center|LOCUS_06690 43609 42740 gene locus_tag LOCUS_06700 gene whiG 43609 42740 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_06700 44514 43606 gene locus_tag LOCUS_06710 44514 43606 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_06710 44636 45313 gene locus_tag LOCUS_06720 44636 45313 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_06720 45318 46907 gene locus_tag LOCUS_06730 45318 46907 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_06730 46904 47599 gene locus_tag LOCUS_06740 46904 47599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 48068 47628 gene locus_tag LOCUS_06750 gene rsfS 48068 47628 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_06750 49068 48460 gene locus_tag LOCUS_06760 gene nadD 49068 48460 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 49999 49070 gene locus_tag LOCUS_06770 49999 49070 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_06770 50037 51395 gene locus_tag LOCUS_06780 50037 51395 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence011 90 329 gene locus_tag LOCUS_06790 90 329 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_06790 332 1153 gene locus_tag LOCUS_06800 332 1153 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_06800 1418 1239 gene locus_tag LOCUS_06810 1418 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1440 2195 gene locus_tag LOCUS_06820 1440 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2158 2703 gene locus_tag LOCUS_06830 2158 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3332 2754 gene locus_tag LOCUS_06840 3332 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3662 5017 gene locus_tag LOCUS_06850 3662 5017 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_06850 5177 6400 gene locus_tag LOCUS_06860 5177 6400 CDS product DUF222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110436.1 protein_id gnl|my_center|LOCUS_06860 7798 6545 gene locus_tag LOCUS_06870 gene larC 7798 6545 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_06870 8937 7933 gene locus_tag LOCUS_06880 8937 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 8961 9971 gene locus_tag LOCUS_06890 gene pheA 8961 9971 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_06890 10272 10357 gene locus_tag LOCUS_t00140 10272 10357 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10767 10576 gene locus_tag LOCUS_06900 10767 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 10748 12970 gene locus_tag LOCUS_06910 10748 12970 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_06910 14676 13423 gene locus_tag LOCUS_06920 14676 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 17051 14943 gene locus_tag LOCUS_06930 gene mrdA 17051 14943 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_06930 17643 20510 gene locus_tag LOCUS_06940 17643 20510 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_06940 22366 20654 gene locus_tag LOCUS_06950 22366 20654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_06950 24018 22369 gene locus_tag LOCUS_06960 24018 22369 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_06960 25256 24018 gene locus_tag LOCUS_06970 25256 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 26490 25267 gene locus_tag LOCUS_06980 gene porA 26490 25267 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_06980 27103 26504 gene locus_tag LOCUS_06990 27103 26504 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_06990 27516 27860 gene locus_tag LOCUS_07000 gene trxA 27516 27860 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_07000 27868 28458 gene locus_tag LOCUS_07010 27868 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 28455 30002 gene locus_tag LOCUS_07020 28455 30002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 29999 31519 gene locus_tag LOCUS_07030 29999 31519 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730410.1 protein_id gnl|my_center|LOCUS_07030 33248 31560 gene locus_tag LOCUS_07040 33248 31560 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_07040 33425 34150 gene locus_tag LOCUS_07050 33425 34150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 34403 34501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35934 35026 gene locus_tag LOCUS_07060 35934 35026 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_07060 36154 38001 gene locus_tag LOCUS_07070 36154 38001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 39297 38386 gene locus_tag LOCUS_07080 39297 38386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 40303 39305 gene locus_tag LOCUS_07090 40303 39305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 40641 41945 gene locus_tag LOCUS_07100 40641 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 42623 41958 gene locus_tag LOCUS_07110 42623 41958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence012 164 1171 gene locus_tag LOCUS_07120 164 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2191 1391 gene locus_tag LOCUS_07130 2191 1391 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_07130 2892 2230 gene locus_tag LOCUS_07140 2892 2230 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_07140 3587 2889 gene locus_tag LOCUS_07150 3587 2889 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_07150 3683 6211 gene locus_tag LOCUS_07160 3683 6211 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_07160 6514 8916 gene locus_tag LOCUS_07170 6514 8916 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257190.1 protein_id gnl|my_center|LOCUS_07170 8996 11929 gene locus_tag LOCUS_07180 gene topA 8996 11929 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_07180 11952 12593 gene locus_tag LOCUS_07190 gene tmk 11952 12593 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057890.1 protein_id gnl|my_center|LOCUS_07190 12590 13735 gene locus_tag LOCUS_07200 12590 13735 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419637.1 protein_id gnl|my_center|LOCUS_07200 14569 13859 gene locus_tag LOCUS_07210 14569 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_07210 14853 14927 gene locus_tag LOCUS_t00150 14853 14927 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15361 16854 gene locus_tag LOCUS_07220 15361 16854 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_07220 17030 18466 gene locus_tag LOCUS_07230 17030 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029003.1 protein_id gnl|my_center|LOCUS_07230 18471 19148 gene locus_tag LOCUS_07240 18471 19148 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028998.1 protein_id gnl|my_center|LOCUS_07240 19145 19903 gene locus_tag LOCUS_07250 19145 19903 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039796.1 protein_id gnl|my_center|LOCUS_07250 19956 20528 gene locus_tag LOCUS_07260 19956 20528 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074025.1 protein_id gnl|my_center|LOCUS_07260 20525 20815 gene locus_tag LOCUS_07270 20525 20815 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067031882.1 protein_id gnl|my_center|LOCUS_07270 20863 21327 gene locus_tag LOCUS_07280 20863 21327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 21615 22436 gene locus_tag LOCUS_07290 21615 22436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 23035 22391 gene locus_tag LOCUS_07300 gene lspA 23035 22391 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053323.1 protein_id gnl|my_center|LOCUS_07300 23140 24501 gene locus_tag LOCUS_07310 23140 24501 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_07310 25230 24532 gene locus_tag LOCUS_07320 25230 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 26008 25283 gene locus_tag LOCUS_07330 26008 25283 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_07330 26223 27785 gene locus_tag LOCUS_07340 26223 27785 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020644771.1 protein_id gnl|my_center|LOCUS_07340 28182 27946 gene locus_tag LOCUS_07350 28182 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 28535 28179 gene locus_tag LOCUS_07360 28535 28179 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_07360 30137 28890 gene locus_tag LOCUS_07370 30137 28890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 34192 30134 gene locus_tag LOCUS_07380 34192 30134 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_07380 32679 32589 gene locus_tag LOCUS_t00160 32679 32589 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35427 34189 gene locus_tag LOCUS_07390 35427 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 37030 35420 gene locus_tag LOCUS_07400 37030 35420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 37222 38736 gene locus_tag LOCUS_07410 gene lysS 37222 38736 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359372.1 protein_id gnl|my_center|LOCUS_07410 39715 38777 gene locus_tag LOCUS_07420 39715 38777 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 protein_id gnl|my_center|LOCUS_07420 39887 41086 gene locus_tag LOCUS_07430 39887 41086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 41592 41110 gene locus_tag LOCUS_07440 41592 41110 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964989.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence013 468 893 gene locus_tag LOCUS_07450 468 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 902 2392 gene locus_tag LOCUS_07460 902 2392 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_07460 2389 3102 gene locus_tag LOCUS_07470 gene nuoE 2389 3102 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728122.1 protein_id gnl|my_center|LOCUS_07470 3102 4406 gene locus_tag LOCUS_07480 gene nuoF 3102 4406 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_07480 4399 7179 gene locus_tag LOCUS_07490 4399 7179 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222458.1 protein_id gnl|my_center|LOCUS_07490 7176 8438 gene locus_tag LOCUS_07500 gene nuoH 7176 8438 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_07500 8438 9373 gene locus_tag LOCUS_07510 8438 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9370 10134 gene locus_tag LOCUS_07520 9370 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10131 10463 gene locus_tag LOCUS_07530 gene nuoK 10131 10463 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_07530 10471 12399 gene locus_tag LOCUS_07540 gene nuoL 10471 12399 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900642.1 protein_id gnl|my_center|LOCUS_07540 12399 13976 gene locus_tag LOCUS_07550 12399 13976 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_07550 13976 15664 gene locus_tag LOCUS_07560 13976 15664 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_07560 15845 16141 gene locus_tag LOCUS_07570 15845 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 16938 16138 gene locus_tag LOCUS_07580 16938 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 17115 18389 gene locus_tag LOCUS_07590 17115 18389 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_07590 18394 19764 gene locus_tag LOCUS_07600 18394 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 23044 19805 gene locus_tag LOCUS_07610 23044 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 23130 23693 gene locus_tag LOCUS_07620 23130 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 23693 25996 gene locus_tag LOCUS_07630 23693 25996 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225396.1 protein_id gnl|my_center|LOCUS_07630 26672 26989 gene locus_tag LOCUS_07640 26672 26989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 29087 27564 gene locus_tag LOCUS_07650 gene hemG 29087 27564 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_07650 30121 29084 gene locus_tag LOCUS_07660 gene hemH 30121 29084 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228058.1 protein_id gnl|my_center|LOCUS_07660 31194 30118 gene locus_tag LOCUS_07670 gene hemE 31194 30118 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_07670 31318 33645 gene locus_tag LOCUS_07680 31318 33645 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_07680 33812 34438 gene locus_tag LOCUS_07690 33812 34438 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907992.1 protein_id gnl|my_center|LOCUS_07690 34451 35389 gene locus_tag LOCUS_07700 34451 35389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 35386 36324 gene locus_tag LOCUS_07710 35386 36324 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_07710 36321 37805 gene locus_tag LOCUS_07720 36321 37805 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 protein_id gnl|my_center|LOCUS_07720 39104 37866 gene locus_tag LOCUS_07730 39104 37866 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224442.1 protein_id gnl|my_center|LOCUS_07730 39121 40131 gene locus_tag LOCUS_07740 39121 40131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 40116 40640 gene locus_tag LOCUS_07750 gene fae 40116 40640 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227996.1 protein_id gnl|my_center|LOCUS_07750 41073 40681 gene locus_tag LOCUS_07760 41073 40681 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_07760 <42608 41070 gene locus_tag LOCUS_07770 <42608 41070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227525.1:cytochrome c oxidase subunit I >Feature sequence014 2549 1140 gene locus_tag LOCUS_07780 2549 1140 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_07780 3654 2701 gene locus_tag LOCUS_07790 3654 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5216 3888 gene locus_tag LOCUS_07800 5216 3888 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_07800 6669 5233 gene locus_tag LOCUS_07810 6669 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9162 7105 gene locus_tag LOCUS_07820 9162 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9409 10644 gene locus_tag LOCUS_07830 9409 10644 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_07830 12029 10731 gene locus_tag LOCUS_07840 12029 10731 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_07840 12442 12026 gene locus_tag LOCUS_07850 12442 12026 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_07850 12998 12603 gene locus_tag LOCUS_07860 12998 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13118 14173 gene locus_tag LOCUS_07870 13118 14173 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_07870 14201 15382 gene locus_tag LOCUS_07880 14201 15382 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_07880 15386 16333 gene locus_tag LOCUS_07890 15386 16333 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_07890 16341 17279 gene locus_tag LOCUS_07900 16341 17279 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_07900 17397 18314 gene locus_tag LOCUS_07910 17397 18314 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_07910 18537 19511 gene locus_tag LOCUS_07920 18537 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 19518 21380 gene locus_tag LOCUS_07930 19518 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 21373 22701 gene locus_tag LOCUS_07940 21373 22701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 24612 23173 gene locus_tag LOCUS_07950 gene gatB 24612 23173 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_07950 26066 24609 gene locus_tag LOCUS_07960 gene gatA 26066 24609 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_07960 26374 26063 gene locus_tag LOCUS_07970 gene gatC 26374 26063 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_07970 27096 26371 gene locus_tag LOCUS_07980 27096 26371 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_07980 27456 27863 gene locus_tag LOCUS_07990 27456 27863 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_07990 29705 27912 gene locus_tag LOCUS_08000 29705 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 30538 29657 gene locus_tag LOCUS_08010 30538 29657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_08010 31848 30730 gene locus_tag LOCUS_08020 31848 30730 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_08020 32176 31856 gene locus_tag LOCUS_08030 32176 31856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 34386 32173 gene locus_tag LOCUS_08040 34386 32173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 36580 34472 gene locus_tag LOCUS_08050 gene ligA 36580 34472 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_08050 37665 36583 gene locus_tag LOCUS_08060 gene mnmA 37665 36583 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_08060 <38557 37676 gene locus_tag LOCUS_08070 <38557 37676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257333.1:cysteine desulfurase family protein >Feature sequence015 <1 1576 gene locus_tag LOCUS_08080 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046135324.1:acetate--CoA ligase family protein 1944 3272 gene locus_tag LOCUS_08090 1944 3272 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_08090 3298 5568 gene locus_tag LOCUS_08100 3298 5568 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_08100 5574 6284 gene locus_tag LOCUS_08110 5574 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 6397 7272 gene locus_tag LOCUS_08120 6397 7272 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_08120 7339 8574 gene locus_tag LOCUS_08130 7339 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 9165 8788 gene locus_tag LOCUS_08140 9165 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 9425 9165 gene locus_tag LOCUS_08150 9425 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 10030 9482 gene locus_tag LOCUS_08160 10030 9482 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094783.1 protein_id gnl|my_center|LOCUS_08160 10176 10412 gene locus_tag LOCUS_08170 10176 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10409 10759 gene locus_tag LOCUS_08180 10409 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11366 11851 gene locus_tag LOCUS_08190 11366 11851 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_08190 11848 13869 gene locus_tag LOCUS_08200 11848 13869 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_08200 13866 14828 gene locus_tag LOCUS_08210 13866 14828 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_08210 14825 15484 gene locus_tag LOCUS_08220 14825 15484 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_08220 15484 16944 gene locus_tag LOCUS_08230 15484 16944 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950336.1 protein_id gnl|my_center|LOCUS_08230 16941 18473 gene locus_tag LOCUS_08240 16941 18473 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_08240 18625 18984 gene locus_tag LOCUS_08250 18625 18984 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_08250 19136 19211 gene locus_tag LOCUS_t00170 19136 19211 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19831 19427 gene locus_tag LOCUS_08260 19831 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 20070 19828 gene locus_tag LOCUS_08270 20070 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 21772 20219 gene locus_tag LOCUS_08280 21772 20219 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08280 22108 21782 gene locus_tag LOCUS_08290 22108 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08290 23357 22353 gene locus_tag LOCUS_08300 gene bsh 23357 22353 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337598.1 protein_id gnl|my_center|LOCUS_08300 23946 23485 gene locus_tag LOCUS_08310 23946 23485 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226514.1 protein_id gnl|my_center|LOCUS_08310 24449 24784 gene locus_tag LOCUS_08320 24449 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 24794 25822 gene locus_tag LOCUS_08330 24794 25822 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_08330 28052 25830 gene locus_tag LOCUS_08340 28052 25830 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 protein_id gnl|my_center|LOCUS_08340 28911 28063 gene locus_tag LOCUS_08350 28911 28063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 29772 28924 gene locus_tag LOCUS_08360 29772 28924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 30089 29817 gene locus_tag LOCUS_08370 30089 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 31620 30166 gene locus_tag LOCUS_08380 31620 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 32321 31725 gene locus_tag LOCUS_08390 32321 31725 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230204.1 protein_id gnl|my_center|LOCUS_08390 32700 34109 gene locus_tag LOCUS_08400 32700 34109 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205459.1 protein_id gnl|my_center|LOCUS_08400 34106 36577 gene locus_tag LOCUS_08410 34106 36577 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_08410 36567 37814 gene locus_tag LOCUS_08420 36567 37814 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence016 654 3299 gene locus_tag LOCUS_08430 gene valS 654 3299 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_08430 4036 3284 gene locus_tag LOCUS_08440 4036 3284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_08440 4929 4033 gene locus_tag LOCUS_08450 4929 4033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_08450 6856 4916 gene locus_tag LOCUS_08460 6856 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8207 6918 gene locus_tag LOCUS_08470 8207 6918 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087085.1 protein_id gnl|my_center|LOCUS_08470 9695 8307 gene locus_tag LOCUS_08480 9695 8307 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407371.1 protein_id gnl|my_center|LOCUS_08480 9798 11324 gene locus_tag LOCUS_08490 9798 11324 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_08490 12505 11381 gene locus_tag LOCUS_08500 12505 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 14618 12681 gene locus_tag LOCUS_08510 gene pcrA 14618 12681 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 16061 14793 gene locus_tag LOCUS_08520 16061 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 16607 16302 gene locus_tag LOCUS_08530 16607 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 16489 17379 gene locus_tag LOCUS_08540 16489 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 18558 17476 gene locus_tag LOCUS_08550 18558 17476 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_08550 18836 19621 gene locus_tag LOCUS_08560 18836 19621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 19618 20313 gene locus_tag LOCUS_08570 19618 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 20303 21571 gene locus_tag LOCUS_08580 20303 21571 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026916.1 protein_id gnl|my_center|LOCUS_08580 23033 21549 gene locus_tag LOCUS_08590 23033 21549 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_08590 23154 23396 gene locus_tag LOCUS_08600 23154 23396 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_08600 23422 24237 gene locus_tag LOCUS_08610 gene ygiD 23422 24237 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 protein_id gnl|my_center|LOCUS_08610 25616 24156 gene locus_tag LOCUS_08620 25616 24156 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_08620 25615 27108 gene locus_tag LOCUS_08630 gene uxaC 25615 27108 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 protein_id gnl|my_center|LOCUS_08630 27105 28493 gene locus_tag LOCUS_08640 27105 28493 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777067.1 protein_id gnl|my_center|LOCUS_08640 28490 30016 gene locus_tag LOCUS_08650 28490 30016 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399854.1 protein_id gnl|my_center|LOCUS_08650 30710 30144 gene locus_tag LOCUS_08660 30710 30144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08660 31841 31035 gene locus_tag LOCUS_08670 31841 31035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 32445 31942 gene locus_tag LOCUS_08680 32445 31942 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014268.1 protein_id gnl|my_center|LOCUS_08680 32996 32529 gene locus_tag LOCUS_08690 32996 32529 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230647.1 protein_id gnl|my_center|LOCUS_08690 34220 33798 gene locus_tag LOCUS_08700 gene vapC26 34220 33798 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_08700 34520 34224 gene locus_tag LOCUS_08710 34520 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 35538 35020 gene locus_tag LOCUS_08720 35538 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08720 35873 35529 gene locus_tag LOCUS_08730 35873 35529 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_08730 36288 35998 gene locus_tag LOCUS_08740 36288 35998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence017 <1 529 gene locus_tag LOCUS_08750 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804675.1:recombinase RecA 2330 594 gene locus_tag LOCUS_08760 2330 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2719 3675 gene locus_tag LOCUS_08770 2719 3675 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_08770 3672 4253 gene locus_tag LOCUS_08780 3672 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4459 5235 gene locus_tag LOCUS_08790 4459 5235 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_08790 6200 5319 gene locus_tag LOCUS_08800 6200 5319 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224690.1 protein_id gnl|my_center|LOCUS_08800 7824 6571 gene locus_tag LOCUS_08810 7824 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8367 9143 gene locus_tag LOCUS_08820 8367 9143 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_08820 9919 9371 gene locus_tag LOCUS_08830 9919 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10185 9916 gene locus_tag LOCUS_08840 10185 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10694 11272 gene locus_tag LOCUS_08850 10694 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 11272 13857 gene locus_tag LOCUS_08860 11272 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 13964 15298 gene locus_tag LOCUS_08870 13964 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 15295 15618 gene locus_tag LOCUS_08880 15295 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 15618 16547 gene locus_tag LOCUS_08890 15618 16547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 16617 16892 gene locus_tag LOCUS_08900 16617 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 16885 18105 gene locus_tag LOCUS_08910 16885 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 18105 21008 gene locus_tag LOCUS_08920 18105 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 21974 21084 gene locus_tag LOCUS_08930 21974 21084 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_08930 23397 22096 gene locus_tag LOCUS_08940 23397 22096 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_08940 23554 24714 gene locus_tag LOCUS_08950 23554 24714 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_08950 24711 25886 gene locus_tag LOCUS_08960 24711 25886 CDS product bifunctional MaoC family dehydratase N-terminal/OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 protein_id gnl|my_center|LOCUS_08960 25886 27073 gene locus_tag LOCUS_08970 25886 27073 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_08970 27070 27528 gene locus_tag LOCUS_08980 27070 27528 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 protein_id gnl|my_center|LOCUS_08980 27525 28715 gene locus_tag LOCUS_08990 27525 28715 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_08990 28977 30956 gene locus_tag LOCUS_09000 28977 30956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 31602 31111 gene locus_tag LOCUS_09010 31602 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 31854 31645 gene locus_tag LOCUS_09020 gene rpmB 31854 31645 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_09020 31916 33646 gene locus_tag LOCUS_09030 31916 33646 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905189.1 protein_id gnl|my_center|LOCUS_09030 33643 35934 gene locus_tag LOCUS_09040 gene recG 33643 35934 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence018 2099 1635 gene locus_tag LOCUS_09050 2099 1635 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742062.1 protein_id gnl|my_center|LOCUS_09050 4696 2153 gene locus_tag LOCUS_09060 4696 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4966 5460 gene locus_tag LOCUS_09070 4966 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 5464 6294 gene locus_tag LOCUS_09080 5464 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6291 7190 gene locus_tag LOCUS_09090 6291 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8307 7153 gene locus_tag LOCUS_09100 8307 7153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_09100 9947 8304 gene locus_tag LOCUS_09110 9947 8304 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123435.1 protein_id gnl|my_center|LOCUS_09110 11009 9981 gene locus_tag LOCUS_09120 11009 9981 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 protein_id gnl|my_center|LOCUS_09120 11254 11871 gene locus_tag LOCUS_09130 11254 11871 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115357.1 protein_id gnl|my_center|LOCUS_09130 11916 12452 gene locus_tag LOCUS_09140 11916 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14388 12469 gene locus_tag LOCUS_09150 14388 12469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_09150 14809 14468 gene locus_tag LOCUS_09160 14809 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15012 14806 gene locus_tag LOCUS_09170 15012 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 16222 15131 gene locus_tag LOCUS_09180 16222 15131 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 protein_id gnl|my_center|LOCUS_09180 17078 16290 gene locus_tag LOCUS_09190 17078 16290 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_09190 17189 17713 gene locus_tag LOCUS_09200 17189 17713 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 protein_id gnl|my_center|LOCUS_09200 17706 18488 gene locus_tag LOCUS_09210 17706 18488 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230233.1 protein_id gnl|my_center|LOCUS_09210 19062 18544 gene locus_tag LOCUS_09220 19062 18544 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_09220 19271 20776 gene locus_tag LOCUS_09230 19271 20776 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296542.1 protein_id gnl|my_center|LOCUS_09230 20773 21351 gene locus_tag LOCUS_09240 20773 21351 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_09240 22850 21306 gene locus_tag LOCUS_09250 22850 21306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 22995 23450 gene locus_tag LOCUS_09260 22995 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09260 23450 23962 gene locus_tag LOCUS_09270 23450 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09270 23959 25035 gene locus_tag LOCUS_09280 23959 25035 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 protein_id gnl|my_center|LOCUS_09280 25035 26189 gene locus_tag LOCUS_09290 25035 26189 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_09290 26936 26265 gene locus_tag LOCUS_09300 26936 26265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 27083 28750 gene locus_tag LOCUS_09310 27083 28750 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_09310 28818 29015 gene locus_tag LOCUS_09320 28818 29015 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_09320 29022 30557 gene locus_tag LOCUS_09330 gene gltX 29022 30557 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_09330 30561 31208 gene locus_tag LOCUS_09340 30561 31208 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_09340 31255 32796 gene locus_tag LOCUS_09350 31255 32796 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_09350 33585 32815 gene locus_tag LOCUS_09360 33585 32815 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_09360 34775 33633 gene locus_tag LOCUS_09370 34775 33633 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084716.1 protein_id gnl|my_center|LOCUS_09370 34867 34940 gene locus_tag LOCUS_t00180 34867 34940 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 35039 35112 gene locus_tag LOCUS_t00190 35039 35112 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 2398 1544 gene locus_tag LOCUS_09380 2398 1544 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056709.1 protein_id gnl|my_center|LOCUS_09380 2597 3316 gene locus_tag LOCUS_09390 2597 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5802 3349 gene locus_tag LOCUS_09400 5802 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6868 5990 gene locus_tag LOCUS_09410 6868 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8078 6936 gene locus_tag LOCUS_09420 8078 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 8373 9812 gene locus_tag LOCUS_09430 8373 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9816 11054 gene locus_tag LOCUS_09440 9816 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 11930 11067 gene locus_tag LOCUS_09450 11930 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 12192 12689 gene locus_tag LOCUS_09460 12192 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 13832 12978 gene locus_tag LOCUS_09470 13832 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 14226 15113 gene locus_tag LOCUS_09480 14226 15113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_09480 15116 15925 gene locus_tag LOCUS_09490 15116 15925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222533.1 protein_id gnl|my_center|LOCUS_09490 15973 17256 gene locus_tag LOCUS_09500 15973 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17256 18494 gene locus_tag LOCUS_09510 17256 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 18491 19771 gene locus_tag LOCUS_09520 18491 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 19768 21207 gene locus_tag LOCUS_09530 19768 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 21381 22337 gene locus_tag LOCUS_09540 21381 22337 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223669.1 protein_id gnl|my_center|LOCUS_09540 22334 23734 gene locus_tag LOCUS_09550 22334 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 23731 24690 gene locus_tag LOCUS_09560 23731 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 24923 25522 gene locus_tag LOCUS_09570 24923 25522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 26614 27117 gene locus_tag LOCUS_09580 26614 27117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 >Feature sequence020 1084 2160 gene locus_tag LOCUS_09590 1084 2160 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_09590 2157 3077 gene locus_tag LOCUS_09600 2157 3077 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731621.1 protein_id gnl|my_center|LOCUS_09600 4983 3049 gene locus_tag LOCUS_09610 4983 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3651 3660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5347 6183 gene locus_tag LOCUS_09620 5347 6183 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898653.1 protein_id gnl|my_center|LOCUS_09620 6319 7521 gene locus_tag LOCUS_09630 gene pstS 6319 7521 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_09630 7532 8632 gene locus_tag LOCUS_09640 gene pstC 7532 8632 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_09640 8634 9581 gene locus_tag LOCUS_09650 gene pstA 8634 9581 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_09650 10416 9625 gene locus_tag LOCUS_09660 10416 9625 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_09660 11008 10640 gene locus_tag LOCUS_09670 gene crcB 11008 10640 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728181.1 protein_id gnl|my_center|LOCUS_09670 11361 11005 gene locus_tag LOCUS_09680 11361 11005 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_09680 11882 11358 gene locus_tag LOCUS_09690 11882 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 12964 12116 gene locus_tag LOCUS_09700 gene regX 12964 12116 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_09700 13415 14863 gene locus_tag LOCUS_09710 13415 14863 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_09710 15013 16671 gene locus_tag LOCUS_09720 gene pgi 15013 16671 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404830.1 protein_id gnl|my_center|LOCUS_09720 16835 17272 gene locus_tag LOCUS_09730 16835 17272 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_09730 18361 17426 gene locus_tag LOCUS_09740 18361 17426 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265954.1 protein_id gnl|my_center|LOCUS_09740 18401 19153 gene locus_tag LOCUS_09750 18401 19153 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_09750 19249 20097 gene locus_tag LOCUS_09760 19249 20097 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110110.1 protein_id gnl|my_center|LOCUS_09760 21336 20182 gene locus_tag LOCUS_09770 21336 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 22786 21440 gene locus_tag LOCUS_09780 22786 21440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_09780 23624 22791 gene locus_tag LOCUS_09790 23624 22791 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_09790 24879 23665 gene locus_tag LOCUS_09800 24879 23665 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_09800 26545 25034 gene locus_tag LOCUS_09810 26545 25034 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 protein_id gnl|my_center|LOCUS_09810 27517 26783 gene locus_tag LOCUS_09820 27517 26783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_09820 28539 27517 gene locus_tag LOCUS_09830 28539 27517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224694.1 protein_id gnl|my_center|LOCUS_09830 28567 29889 gene locus_tag LOCUS_09840 gene serS 28567 29889 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_09840 30809 29862 gene locus_tag LOCUS_09850 30809 29862 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_09850 32073 30835 gene locus_tag LOCUS_09860 gene senX3 32073 30835 CDS product two-component system sensor histidine kinase SenX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876913.1 protein_id gnl|my_center|LOCUS_09860 32191 32565 gene locus_tag LOCUS_09870 32191 32565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence021 2019 823 gene locus_tag LOCUS_09880 gene fabF 2019 823 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_09880 2258 2019 gene locus_tag LOCUS_09890 gene acpP 2258 2019 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057709.1 protein_id gnl|my_center|LOCUS_09890 3276 2515 gene locus_tag LOCUS_09900 gene fabG 3276 2515 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_09900 4526 3273 gene locus_tag LOCUS_09910 4526 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4694 4611 gene locus_tag LOCUS_t00200 4694 4611 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4757 6040 gene locus_tag LOCUS_09920 gene menC 4757 6040 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_09920 6183 6425 gene locus_tag LOCUS_09930 6183 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6562 7170 gene locus_tag LOCUS_09940 6562 7170 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_09940 7160 10039 gene locus_tag LOCUS_09950 gene polA 7160 10039 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_09950 10073 11620 gene locus_tag LOCUS_09960 gene rpsA 10073 11620 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950568.1 protein_id gnl|my_center|LOCUS_09960 12705 11677 gene locus_tag LOCUS_09970 12705 11677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_09970 13820 12702 gene locus_tag LOCUS_09980 13820 12702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_09980 14776 13817 gene locus_tag LOCUS_09990 14776 13817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537951.1 protein_id gnl|my_center|LOCUS_09990 15724 14780 gene locus_tag LOCUS_10000 15724 14780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_10000 17387 15756 gene locus_tag LOCUS_10010 gene gsiB 17387 15756 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065128.1 protein_id gnl|my_center|LOCUS_10010 17721 18338 gene locus_tag LOCUS_10020 gene coaE 17721 18338 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_10020 18361 20487 gene locus_tag LOCUS_10030 gene uvrB 18361 20487 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_10030 20511 23588 gene locus_tag LOCUS_10040 gene uvrA 20511 23588 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_10040 24732 23620 gene locus_tag LOCUS_10050 gene nadA 24732 23620 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_10050 24926 26869 gene locus_tag LOCUS_10060 gene uvrC 24926 26869 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_10060 26866 27717 gene locus_tag LOCUS_10070 gene rapZ 26866 27717 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_10070 27714 28592 gene locus_tag LOCUS_10080 gene yvcK 27714 28592 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_10080 28713 29738 gene locus_tag LOCUS_10090 gene gap 28713 29738 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_10090 29766 30983 gene locus_tag LOCUS_10100 29766 30983 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_10100 30980 31768 gene locus_tag LOCUS_10110 gene tpiA 30980 31768 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057795.1 protein_id gnl|my_center|LOCUS_10110 31815 32045 gene locus_tag LOCUS_10120 gene secG 31815 32045 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence022 2270 1080 gene locus_tag LOCUS_10130 2270 1080 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_10130 2610 2275 gene locus_tag LOCUS_10140 2610 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2836 2762 gene locus_tag LOCUS_t00210 2836 2762 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3588 2827 gene locus_tag LOCUS_10150 3588 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3637 4194 gene locus_tag LOCUS_10160 3637 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4191 4634 gene locus_tag LOCUS_10170 4191 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4547 4849 gene locus_tag LOCUS_10180 4547 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7088 4773 gene locus_tag LOCUS_10190 7088 4773 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909022.1 protein_id gnl|my_center|LOCUS_10190 8784 7327 gene locus_tag LOCUS_10200 8784 7327 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_10200 8992 10104 gene locus_tag LOCUS_10210 8992 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112423.1 protein_id gnl|my_center|LOCUS_10210 11107 10088 gene locus_tag LOCUS_10220 11107 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11586 11104 gene locus_tag LOCUS_10230 11586 11104 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_10230 11857 13107 gene locus_tag LOCUS_10240 11857 13107 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_10240 13104 13931 gene locus_tag LOCUS_10250 13104 13931 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_10250 13928 15145 gene locus_tag LOCUS_10260 13928 15145 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_10260 16067 15126 gene locus_tag LOCUS_10270 16067 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 16562 16164 gene locus_tag LOCUS_10280 16562 16164 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062283.1 protein_id gnl|my_center|LOCUS_10280 17434 16559 gene locus_tag LOCUS_10290 17434 16559 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079434.1 protein_id gnl|my_center|LOCUS_10290 17835 17470 gene locus_tag LOCUS_10300 17835 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 18088 18014 gene locus_tag LOCUS_t00220 18088 18014 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19133 18543 gene locus_tag LOCUS_10310 19133 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 19281 19208 gene locus_tag LOCUS_t00230 19281 19208 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 19428 19664 gene locus_tag LOCUS_10320 19428 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 21170 19749 gene locus_tag LOCUS_10330 21170 19749 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805037.1 protein_id gnl|my_center|LOCUS_10330 23083 21167 gene locus_tag LOCUS_10340 23083 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 26030 23190 gene locus_tag LOCUS_10350 gene ppdK 26030 23190 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_10350 27510 26131 gene locus_tag LOCUS_10360 27510 26131 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_10360 28735 27599 gene locus_tag LOCUS_10370 gene hemW 28735 27599 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_10370 30141 28732 gene locus_tag LOCUS_10380 30141 28732 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_10380 30839 30138 gene locus_tag LOCUS_10390 30839 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 31285 30860 gene locus_tag LOCUS_10400 31285 30860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 <31782 31282 gene locus_tag LOCUS_10410 <31782 31282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976293.1:isoprenyl transferase >Feature sequence023 <1 1114 gene locus_tag LOCUS_10420 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411460.1:lipoyl synthase 1111 2304 gene locus_tag LOCUS_10430 1111 2304 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_10430 2372 3097 gene locus_tag LOCUS_10440 2372 3097 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_10440 3620 3150 gene locus_tag LOCUS_10450 3620 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4727 3723 gene locus_tag LOCUS_10460 4727 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 8343 4834 gene locus_tag LOCUS_10470 gene metH 8343 4834 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_10470 8437 9099 gene locus_tag LOCUS_10480 8437 9099 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_10480 9096 10709 gene locus_tag LOCUS_10490 9096 10709 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775677.1 protein_id gnl|my_center|LOCUS_10490 11518 10607 gene locus_tag LOCUS_10500 11518 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12381 11782 gene locus_tag LOCUS_10510 12381 11782 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939694.1 protein_id gnl|my_center|LOCUS_10510 12542 13729 gene locus_tag LOCUS_10520 gene moeB 12542 13729 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_10520 13786 15393 gene locus_tag LOCUS_10530 13786 15393 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_10530 16622 15402 gene locus_tag LOCUS_10540 16622 15402 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088379.1 protein_id gnl|my_center|LOCUS_10540 18497 16728 gene locus_tag LOCUS_10550 18497 16728 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_10550 18615 19436 gene locus_tag LOCUS_10560 18615 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 19449 20477 gene locus_tag LOCUS_10570 gene rfbB 19449 20477 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_10570 20438 21397 gene locus_tag LOCUS_10580 gene rfbD 20438 21397 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_10580 21444 23009 gene locus_tag LOCUS_10590 21444 23009 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_10590 23006 23977 gene locus_tag LOCUS_10600 23006 23977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975318.1 protein_id gnl|my_center|LOCUS_10600 23974 24723 gene locus_tag LOCUS_10610 23974 24723 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_10610 24720 25643 gene locus_tag LOCUS_10620 24720 25643 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907906.1 protein_id gnl|my_center|LOCUS_10620 25658 26467 gene locus_tag LOCUS_10630 25658 26467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 26464 27555 gene locus_tag LOCUS_10640 26464 27555 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_10640 27560 28522 gene locus_tag LOCUS_10650 gene galE1 27560 28522 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_10650 28679 30100 gene locus_tag LOCUS_10660 28679 30100 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_10660 30150 30503 gene locus_tag LOCUS_10670 30150 30503 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence024 114 734 gene locus_tag LOCUS_10680 gene lexA 114 734 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_10680 1862 777 gene locus_tag LOCUS_10690 gene dapE 1862 777 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_10690 2700 1873 gene locus_tag LOCUS_10700 2700 1873 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_10700 3931 2741 gene locus_tag LOCUS_10710 3931 2741 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_10710 5238 3928 gene locus_tag LOCUS_10720 gene hflX 5238 3928 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_10720 6068 5235 gene locus_tag LOCUS_10730 gene dapF 6068 5235 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 protein_id gnl|my_center|LOCUS_10730 7043 6084 gene locus_tag LOCUS_10740 gene miaA 7043 6084 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_10740 8522 7047 gene locus_tag LOCUS_10750 gene miaB 8522 7047 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296630.1 protein_id gnl|my_center|LOCUS_10750 8921 8526 gene locus_tag LOCUS_10760 8921 8526 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_10760 9957 8971 gene locus_tag LOCUS_10770 gene thrB 9957 8971 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_10770 11400 10060 gene locus_tag LOCUS_10780 11400 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10780 13772 11460 gene locus_tag LOCUS_10790 13772 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 15892 14009 gene locus_tag LOCUS_10800 15892 14009 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_10800 16869 15961 gene locus_tag LOCUS_10810 gene dapA 16869 15961 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081807.1 protein_id gnl|my_center|LOCUS_10810 18110 16989 gene locus_tag LOCUS_10820 18110 16989 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_10820 18931 18107 gene locus_tag LOCUS_10830 18931 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 19603 18983 gene locus_tag LOCUS_10840 19603 18983 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_10840 20430 19618 gene locus_tag LOCUS_10850 gene dapB 20430 19618 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_10850 21739 20483 gene locus_tag LOCUS_10860 21739 20483 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_10860 24198 21736 gene locus_tag LOCUS_10870 24198 21736 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081771.1 protein_id gnl|my_center|LOCUS_10870 24703 24446 gene locus_tag LOCUS_10880 gene rpsO 24703 24446 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_10880 25523 24888 gene locus_tag LOCUS_10890 25523 24888 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_10890 25800 26522 gene locus_tag LOCUS_10900 25800 26522 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482817.1 protein_id gnl|my_center|LOCUS_10900 29083 26519 gene locus_tag LOCUS_10910 29083 26519 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727490.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence025 <1 1091 gene locus_tag LOCUS_10920 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037868.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 1088 2149 gene locus_tag LOCUS_10930 1088 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3099 2251 gene locus_tag LOCUS_10940 3099 2251 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_10940 3221 3718 gene locus_tag LOCUS_10950 3221 3718 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_10950 3718 4584 gene locus_tag LOCUS_10960 3718 4584 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_10960 4625 5074 gene locus_tag LOCUS_10970 4625 5074 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080323.1 protein_id gnl|my_center|LOCUS_10970 5172 5591 gene locus_tag LOCUS_10980 5172 5591 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_10980 5599 7455 gene locus_tag LOCUS_10990 5599 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 9424 7505 gene locus_tag LOCUS_11000 9424 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 9623 10966 gene locus_tag LOCUS_11010 9623 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 10963 13065 gene locus_tag LOCUS_11020 10963 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11020 13062 13826 gene locus_tag LOCUS_11030 13062 13826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930184.1 protein_id gnl|my_center|LOCUS_11030 13823 14554 gene locus_tag LOCUS_11040 13823 14554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_11040 15490 14588 gene locus_tag LOCUS_11050 15490 14588 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_11050 15693 16508 gene locus_tag LOCUS_11060 gene fabG 15693 16508 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_11060 16640 17596 gene locus_tag LOCUS_11070 16640 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 17688 17606 gene locus_tag LOCUS_t00240 17688 17606 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17908 19053 gene locus_tag LOCUS_11080 17908 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 19050 20174 gene locus_tag LOCUS_11090 19050 20174 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_11090 20171 21418 gene locus_tag LOCUS_11100 20171 21418 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_11100 21423 22439 gene locus_tag LOCUS_11110 21423 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 22436 23599 gene locus_tag LOCUS_11120 22436 23599 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_11120 23611 24273 gene locus_tag LOCUS_11130 23611 24273 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_11130 24270 25259 gene locus_tag LOCUS_11140 24270 25259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261977.1 protein_id gnl|my_center|LOCUS_11140 25262 26533 gene locus_tag LOCUS_11150 25262 26533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965625.1 protein_id gnl|my_center|LOCUS_11150 26530 27618 gene locus_tag LOCUS_11160 26530 27618 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence026 1178 198 gene locus_tag LOCUS_11170 1178 198 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 protein_id gnl|my_center|LOCUS_11170 1540 3183 gene locus_tag LOCUS_11180 1540 3183 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_11180 5080 3254 gene locus_tag LOCUS_11190 5080 3254 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_11190 5281 6339 gene locus_tag LOCUS_11200 5281 6339 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551207.1 protein_id gnl|my_center|LOCUS_11200 6387 6827 gene locus_tag LOCUS_11210 6387 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6930 8081 gene locus_tag LOCUS_11220 6930 8081 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_11220 8078 9535 gene locus_tag LOCUS_11230 8078 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9532 10704 gene locus_tag LOCUS_11240 9532 10704 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_11240 10785 11660 gene locus_tag LOCUS_11250 10785 11660 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_11250 11657 12436 gene locus_tag LOCUS_11260 11657 12436 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_11260 13277 12465 gene locus_tag LOCUS_11270 13277 12465 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_11270 14036 13287 gene locus_tag LOCUS_11280 14036 13287 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_11280 15195 14038 gene locus_tag LOCUS_11290 15195 14038 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040561.1 protein_id gnl|my_center|LOCUS_11290 15289 16143 gene locus_tag LOCUS_11300 15289 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16182 17426 gene locus_tag LOCUS_11310 16182 17426 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_11310 17502 18203 gene locus_tag LOCUS_11320 17502 18203 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545581.1 protein_id gnl|my_center|LOCUS_11320 18288 19067 gene locus_tag LOCUS_11330 gene menB 18288 19067 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132444.1 protein_id gnl|my_center|LOCUS_11330 19064 20737 gene locus_tag LOCUS_11340 19064 20737 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_11340 20734 21531 gene locus_tag LOCUS_11350 20734 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 21598 23247 gene locus_tag LOCUS_11360 21598 23247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 26623 23240 gene locus_tag LOCUS_11370 26623 23240 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence027 <1 1728 gene locus_tag LOCUS_11380 <1 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742114.1:ATP-dependent DNA helicase UvrD2 2559 1705 gene locus_tag LOCUS_11390 2559 1705 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_11390 2987 2562 gene locus_tag LOCUS_11400 gene fabZ 2987 2562 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_11400 4325 3039 gene locus_tag LOCUS_11410 4325 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8171 4413 gene locus_tag LOCUS_11420 8171 4413 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_11420 8056 8628 gene locus_tag LOCUS_11430 8056 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8625 9302 gene locus_tag LOCUS_11440 gene queC 8625 9302 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_11440 9299 10090 gene locus_tag LOCUS_11450 9299 10090 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797963.1 protein_id gnl|my_center|LOCUS_11450 10557 10249 gene locus_tag LOCUS_11460 10557 10249 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_11460 10853 10533 gene locus_tag LOCUS_11470 10853 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 10770 11693 gene locus_tag LOCUS_11480 10770 11693 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927079.1 protein_id gnl|my_center|LOCUS_11480 11690 12622 gene locus_tag LOCUS_11490 11690 12622 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_11490 13614 12715 gene locus_tag LOCUS_11500 13614 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 13511 15019 gene locus_tag LOCUS_11510 13511 15019 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_11510 15775 15050 gene locus_tag LOCUS_11520 15775 15050 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_11520 17319 15772 gene locus_tag LOCUS_11530 17319 15772 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_11530 17504 17791 gene locus_tag LOCUS_11540 17504 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 17788 20493 gene locus_tag LOCUS_11550 17788 20493 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 protein_id gnl|my_center|LOCUS_11550 21831 20413 gene locus_tag LOCUS_11560 21831 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 22835 21828 gene locus_tag LOCUS_11570 22835 21828 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727444.1 protein_id gnl|my_center|LOCUS_11570 22961 23557 gene locus_tag LOCUS_11580 22961 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 23554 24435 gene locus_tag LOCUS_11590 23554 24435 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_11590 24921 24514 gene locus_tag LOCUS_11600 24921 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 25232 26689 gene locus_tag LOCUS_11610 25232 26689 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230432.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence028 <1 660 gene locus_tag LOCUS_11620 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899219.1:glycine cleavage system aminomethyltransferase GcvT 758 2104 gene locus_tag LOCUS_11630 gene gcvPA 758 2104 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_11630 2101 3663 gene locus_tag LOCUS_11640 gene gcvPB 2101 3663 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_11640 3858 4625 gene locus_tag LOCUS_11650 3858 4625 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_11650 5687 4716 gene locus_tag LOCUS_11660 gene gap 5687 4716 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_11660 5928 6887 gene locus_tag LOCUS_11670 5928 6887 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028646.1 protein_id gnl|my_center|LOCUS_11670 6891 8255 gene locus_tag LOCUS_11680 6891 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 8257 9588 gene locus_tag LOCUS_11690 8257 9588 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_11690 10505 9603 gene locus_tag LOCUS_11700 10505 9603 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_11700 11457 10495 gene locus_tag LOCUS_11710 11457 10495 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_11710 12610 11450 gene locus_tag LOCUS_11720 gene ugpC 12610 11450 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389015.1 protein_id gnl|my_center|LOCUS_11720 14049 12628 gene locus_tag LOCUS_11730 14049 12628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060595.1 protein_id gnl|my_center|LOCUS_11730 14295 16976 gene locus_tag LOCUS_11740 14295 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 17169 18083 gene locus_tag LOCUS_11750 17169 18083 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_11750 18209 18766 gene locus_tag LOCUS_11760 18209 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 18769 19644 gene locus_tag LOCUS_11770 18769 19644 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_11770 19807 22224 gene locus_tag LOCUS_11780 gene ppsA 19807 22224 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022627.1 protein_id gnl|my_center|LOCUS_11780 22300 23583 gene locus_tag LOCUS_11790 22300 23583 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_11790 24435 23683 gene locus_tag LOCUS_11800 24435 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 25295 24531 gene locus_tag LOCUS_11810 25295 24531 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_11810 26095 25484 gene locus_tag LOCUS_11820 26095 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 26164 26173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence029 719 1822 gene locus_tag LOCUS_11830 719 1822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_11830 2030 4327 gene locus_tag LOCUS_11840 2030 4327 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_11840 4442 4858 gene locus_tag LOCUS_11850 4442 4858 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877671.1 protein_id gnl|my_center|LOCUS_11850 5671 4877 gene locus_tag LOCUS_11860 5671 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5956 5684 gene locus_tag LOCUS_11870 5956 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7476 5977 gene locus_tag LOCUS_11880 7476 5977 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_11880 7754 7473 gene locus_tag LOCUS_11890 7754 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 7710 8333 gene locus_tag LOCUS_11900 7710 8333 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_11900 9477 8359 gene locus_tag LOCUS_11910 gene ald 9477 8359 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_11910 11027 9474 gene locus_tag LOCUS_11920 11027 9474 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_11920 12548 11085 gene locus_tag LOCUS_11930 12548 11085 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_11930 12768 13310 gene locus_tag LOCUS_11940 12768 13310 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_11940 13307 14680 gene locus_tag LOCUS_11950 13307 14680 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_11950 14677 16068 gene locus_tag LOCUS_11960 14677 16068 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_11960 17529 16126 gene locus_tag LOCUS_11970 17529 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 17957 18544 gene locus_tag LOCUS_11980 17957 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 20123 18588 gene locus_tag LOCUS_11990 20123 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 21339 20374 gene locus_tag LOCUS_12000 21339 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 21824 21444 gene locus_tag LOCUS_12010 21824 21444 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228875.1 protein_id gnl|my_center|LOCUS_12010 22198 21821 gene locus_tag LOCUS_12020 gene trxA 22198 21821 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_12020 23225 23776 gene locus_tag LOCUS_12030 23225 23776 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_12030 23773 25023 gene locus_tag LOCUS_12040 23773 25023 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence030 2 394 gene locus_tag LOCUS_12050 2 394 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_12050 519 878 gene locus_tag LOCUS_12060 519 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 884 1198 gene locus_tag LOCUS_12070 884 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1747 1226 gene locus_tag LOCUS_12080 1747 1226 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_12080 1905 4091 gene locus_tag LOCUS_12090 1905 4091 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_12090 4140 4724 gene locus_tag LOCUS_12100 4140 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5826 4861 gene locus_tag LOCUS_12110 5826 4861 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_12110 6004 6783 gene locus_tag LOCUS_12120 6004 6783 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083761.1 protein_id gnl|my_center|LOCUS_12120 6876 7667 gene locus_tag LOCUS_12130 6876 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7694 8152 gene locus_tag LOCUS_12140 7694 8152 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 protein_id gnl|my_center|LOCUS_12140 8212 8625 gene locus_tag LOCUS_12150 8212 8625 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080665811.1 protein_id gnl|my_center|LOCUS_12150 8806 8729 gene locus_tag LOCUS_t00250 8806 8729 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9990 8845 gene locus_tag LOCUS_12160 9990 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 10454 10020 gene locus_tag LOCUS_12170 10454 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11657 10509 gene locus_tag LOCUS_12180 11657 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 12886 11654 gene locus_tag LOCUS_12190 12886 11654 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897588.1 protein_id gnl|my_center|LOCUS_12190 12964 13221 gene locus_tag LOCUS_12200 12964 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 14111 13236 gene locus_tag LOCUS_12210 14111 13236 CDS product DUF929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979644.1 protein_id gnl|my_center|LOCUS_12210 14606 14115 gene locus_tag LOCUS_12220 14606 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 14539 14784 gene locus_tag LOCUS_12230 14539 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15812 14682 gene locus_tag LOCUS_12240 15812 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 15938 16843 gene locus_tag LOCUS_12250 15938 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 16948 17823 gene locus_tag LOCUS_12260 16948 17823 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_12260 17796 18710 gene locus_tag LOCUS_12270 17796 18710 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 protein_id gnl|my_center|LOCUS_12270 19903 18647 gene locus_tag LOCUS_12280 19903 18647 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_12280 20167 20532 gene locus_tag LOCUS_12290 20167 20532 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_12290 20591 22345 gene locus_tag LOCUS_12300 20591 22345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 22342 22707 gene locus_tag LOCUS_12310 22342 22707 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_12310 24012 22762 gene locus_tag LOCUS_12320 24012 22762 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_12320 <24732 24178 gene locus_tag LOCUS_12330 <24732 24178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029474.1:two-component system response regulator GlnR >Feature sequence031 607 1497 gene locus_tag LOCUS_12340 607 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1502 3949 gene locus_tag LOCUS_12350 1502 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3994 5832 gene locus_tag LOCUS_12360 gene typA 3994 5832 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_12360 7342 5858 gene locus_tag LOCUS_12370 7342 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7478 7948 gene locus_tag LOCUS_12380 7478 7948 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_12380 8074 8000 gene locus_tag LOCUS_t00260 8074 8000 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8246 8929 gene locus_tag LOCUS_12390 8246 8929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063392.1 protein_id gnl|my_center|LOCUS_12390 8958 10379 gene locus_tag LOCUS_12400 8958 10379 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_12400 11592 10717 gene locus_tag LOCUS_12410 gene ispE 11592 10717 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_12410 12494 11598 gene locus_tag LOCUS_12420 gene rsmA 12494 11598 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804943.1 protein_id gnl|my_center|LOCUS_12420 13232 12531 gene locus_tag LOCUS_12430 13232 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 14322 13396 gene locus_tag LOCUS_12440 14322 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 15861 14356 gene locus_tag LOCUS_12450 gene metG 15861 14356 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_12450 16523 15981 gene locus_tag LOCUS_12460 gene msrA 16523 15981 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_12460 17594 16674 gene locus_tag LOCUS_12470 gene rsmI 17594 16674 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_12470 17977 17591 gene locus_tag LOCUS_12480 17977 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 19120 18287 gene locus_tag LOCUS_12490 19120 18287 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_12490 19197 19796 gene locus_tag LOCUS_12500 19197 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 20977 19838 gene locus_tag LOCUS_12510 gene wecB 20977 19838 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776765.1 protein_id gnl|my_center|LOCUS_12510 22271 20994 gene locus_tag LOCUS_12520 22271 20994 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 protein_id gnl|my_center|LOCUS_12520 22962 22285 gene locus_tag LOCUS_12530 22962 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 <23951 23058 gene locus_tag LOCUS_12540 <23951 23058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence032 252 1418 gene locus_tag LOCUS_12550 252 1418 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_12550 1421 1951 gene locus_tag LOCUS_12560 1421 1951 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_12560 2157 5723 gene locus_tag LOCUS_12570 gene dnaE 2157 5723 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_12570 6019 6693 gene locus_tag LOCUS_12580 6019 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 6773 7222 gene locus_tag LOCUS_12590 6773 7222 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_12590 7305 8510 gene locus_tag LOCUS_12600 7305 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 9078 8503 gene locus_tag LOCUS_12610 9078 8503 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_12610 9216 10178 gene locus_tag LOCUS_12620 9216 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 11200 10259 gene locus_tag LOCUS_12630 11200 10259 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_12630 11634 11197 gene locus_tag LOCUS_12640 11634 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 12479 11700 gene locus_tag LOCUS_12650 12479 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13449 12679 gene locus_tag LOCUS_12660 13449 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 13814 13557 gene locus_tag LOCUS_12670 13814 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 14449 13892 gene locus_tag LOCUS_12680 14449 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 15305 14622 gene locus_tag LOCUS_12690 15305 14622 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_12690 15784 15302 gene locus_tag LOCUS_12700 15784 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 17197 16073 gene locus_tag LOCUS_12710 gene ftsZ 17197 16073 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_12710 18155 17346 gene locus_tag LOCUS_12720 18155 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 18454 18152 gene locus_tag LOCUS_12730 18454 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 20495 19101 gene locus_tag LOCUS_12740 gene murC 20495 19101 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_12740 21681 20488 gene locus_tag LOCUS_12750 gene murG 21681 20488 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_12750 <22528 21678 gene locus_tag LOCUS_12760 <22528 21678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460697.1:stage V sporulation protein E >Feature sequence033 1754 333 gene locus_tag LOCUS_12770 1754 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2689 1751 gene locus_tag LOCUS_12780 2689 1751 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532718.1 protein_id gnl|my_center|LOCUS_12780 2802 3734 gene locus_tag LOCUS_12790 gene cysD 2802 3734 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911471.1 protein_id gnl|my_center|LOCUS_12790 3734 4984 gene locus_tag LOCUS_12800 3734 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 4998 5621 gene locus_tag LOCUS_12810 4998 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12810 5618 6676 gene locus_tag LOCUS_12820 5618 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6996 8114 gene locus_tag LOCUS_12830 6996 8114 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_12830 10206 8212 gene locus_tag LOCUS_12840 10206 8212 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909022.1 protein_id gnl|my_center|LOCUS_12840 11221 10448 gene locus_tag LOCUS_12850 11221 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 11599 16089 gene locus_tag LOCUS_12860 11599 16089 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_12860 17414 16086 gene locus_tag LOCUS_12870 17414 16086 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_12870 18922 17411 gene locus_tag LOCUS_12880 18922 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 20474 18897 gene locus_tag LOCUS_12890 20474 18897 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_12890 21881 20691 gene locus_tag LOCUS_12900 21881 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence034 1262 624 gene locus_tag LOCUS_12910 1262 624 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_12910 1554 1282 gene locus_tag LOCUS_12920 1554 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1713 4976 gene locus_tag LOCUS_12930 gene ileS 1713 4976 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_12930 4973 6532 gene locus_tag LOCUS_12940 4973 6532 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_12940 7501 6626 gene locus_tag LOCUS_12950 7501 6626 CDS product TIGR03560 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225208.1 protein_id gnl|my_center|LOCUS_12950 8592 7618 gene locus_tag LOCUS_12960 8592 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10423 8678 gene locus_tag LOCUS_12970 gene leuA 10423 8678 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_12970 11087 12688 gene locus_tag LOCUS_12980 11087 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 13439 14365 gene locus_tag LOCUS_12990 13439 14365 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_12990 14814 15080 gene locus_tag LOCUS_13000 14814 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 17471 16080 gene locus_tag LOCUS_13010 17471 16080 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_13010 18384 17608 gene locus_tag LOCUS_13020 18384 17608 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_13020 18469 19278 gene locus_tag LOCUS_13030 18469 19278 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_13030 19275 20684 gene locus_tag LOCUS_13040 19275 20684 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_13040 20963 20766 gene locus_tag LOCUS_13050 20963 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 20857 21624 gene locus_tag LOCUS_13060 20857 21624 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence035 <1 774 gene locus_tag LOCUS_13070 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230264.1:S53 family serine peptidase 852 1265 gene locus_tag LOCUS_13080 852 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1269 1649 gene locus_tag LOCUS_13090 1269 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1661 4261 gene locus_tag LOCUS_13100 gene alaS 1661 4261 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_13100 4254 4736 gene locus_tag LOCUS_13110 gene ruvX 4254 4736 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_13110 4733 5857 gene locus_tag LOCUS_13120 4733 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5868 6809 gene locus_tag LOCUS_13130 gene aroE 5868 6809 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_13130 6830 7963 gene locus_tag LOCUS_13140 gene rodA 6830 7963 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_13140 7960 8532 gene locus_tag LOCUS_13150 7960 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10000 8573 gene locus_tag LOCUS_13160 gene rodA 10000 8573 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_13160 10095 12413 gene locus_tag LOCUS_13170 10095 12413 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056904.1 protein_id gnl|my_center|LOCUS_13170 12937 13731 gene locus_tag LOCUS_13180 12937 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13728 14957 gene locus_tag LOCUS_13190 13728 14957 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_13190 14967 15737 gene locus_tag LOCUS_13200 14967 15737 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_13200 15895 16695 gene locus_tag LOCUS_13210 15895 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 18095 16692 gene locus_tag LOCUS_13220 18095 16692 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_13220 18859 18092 gene locus_tag LOCUS_13230 gene ubiE 18859 18092 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_13230 19659 18856 gene locus_tag LOCUS_13240 19659 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 20230 19775 gene locus_tag LOCUS_13250 20230 19775 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_13250 20359 21060 gene locus_tag LOCUS_13260 20359 21060 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_13260 <21738 21096 gene locus_tag LOCUS_13270 <21738 21096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974818.1:mycothiol synthase >Feature sequence036 38 418 gene locus_tag LOCUS_13280 gene folB 38 418 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113138.1 protein_id gnl|my_center|LOCUS_13280 415 915 gene locus_tag LOCUS_13290 415 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13290 998 1780 gene locus_tag LOCUS_13300 998 1780 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_13300 1777 2697 gene locus_tag LOCUS_13310 gene panC 1777 2697 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976190.1 protein_id gnl|my_center|LOCUS_13310 2732 3130 gene locus_tag LOCUS_13320 2732 3130 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083440.1 protein_id gnl|my_center|LOCUS_13320 3127 4869 gene locus_tag LOCUS_13330 3127 4869 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_13330 4871 5818 gene locus_tag LOCUS_13340 gene nadC 4871 5818 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_13340 5820 6665 gene locus_tag LOCUS_13350 5820 6665 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_13350 6811 7212 gene locus_tag LOCUS_13360 6811 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 8282 7305 gene locus_tag LOCUS_13370 8282 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8400 10958 gene locus_tag LOCUS_13380 8400 10958 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_13380 11211 12596 gene locus_tag LOCUS_13390 gene radA 11211 12596 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419487.1 protein_id gnl|my_center|LOCUS_13390 12593 13684 gene locus_tag LOCUS_13400 gene disA 12593 13684 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_13400 13869 14345 gene locus_tag LOCUS_13410 gene carD 13869 14345 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731020.1 protein_id gnl|my_center|LOCUS_13410 14372 15025 gene locus_tag LOCUS_13420 gene ispD 14372 15025 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_13420 15022 15546 gene locus_tag LOCUS_13430 gene ispF 15022 15546 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_13430 15837 16511 gene locus_tag LOCUS_13440 gene rlmB 15837 16511 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_13440 16854 16558 gene locus_tag LOCUS_13450 16854 16558 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_13450 17007 18377 gene locus_tag LOCUS_13460 17007 18377 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_13460 19397 18402 gene locus_tag LOCUS_13470 gene egtD 19397 18402 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_13470 20789 19497 gene locus_tag LOCUS_13480 gene egtB 20789 19497 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence037 4 3702 gene locus_tag LOCUS_13490 4 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4041 5279 gene locus_tag LOCUS_13500 4041 5279 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_13500 7490 5289 gene locus_tag LOCUS_13510 gene katG 7490 5289 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 protein_id gnl|my_center|LOCUS_13510 8101 7517 gene locus_tag LOCUS_13520 8101 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9210 8272 gene locus_tag LOCUS_13530 9210 8272 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616319.1 protein_id gnl|my_center|LOCUS_13530 10207 9212 gene locus_tag LOCUS_13540 gene argF 10207 9212 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_13540 11494 10274 gene locus_tag LOCUS_13550 11494 10274 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_13550 13068 11548 gene locus_tag LOCUS_13560 13068 11548 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030990.1 protein_id gnl|my_center|LOCUS_13560 13342 14502 gene locus_tag LOCUS_13570 13342 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 14686 15957 gene locus_tag LOCUS_13580 14686 15957 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_13580 16833 15967 gene locus_tag LOCUS_13590 16833 15967 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_13590 16938 18122 gene locus_tag LOCUS_13600 16938 18122 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_13600 18217 18717 gene locus_tag LOCUS_13610 18217 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 19369 18668 gene locus_tag LOCUS_13620 19369 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence038 <1 1288 gene locus_tag LOCUS_13630 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094791896.1:type IV secretory system conjugative DNA transfer family protein 2272 1304 gene locus_tag LOCUS_13640 2272 1304 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_13640 4137 2269 gene locus_tag LOCUS_13650 4137 2269 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_13650 4558 4139 gene locus_tag LOCUS_13660 4558 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 protein_id gnl|my_center|LOCUS_13660 5340 4555 gene locus_tag LOCUS_13670 5340 4555 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223487.1 protein_id gnl|my_center|LOCUS_13670 6518 5337 gene locus_tag LOCUS_13680 6518 5337 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_13680 6852 7463 gene locus_tag LOCUS_13690 gene satP 6852 7463 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 protein_id gnl|my_center|LOCUS_13690 7535 9532 gene locus_tag LOCUS_13700 gene acs 7535 9532 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_13700 10354 9608 gene locus_tag LOCUS_13710 10354 9608 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112376.1 protein_id gnl|my_center|LOCUS_13710 10613 10900 gene locus_tag LOCUS_13720 10613 10900 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_13720 10897 11187 gene locus_tag LOCUS_13730 10897 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11177 12856 gene locus_tag LOCUS_13740 11177 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 12876 13373 gene locus_tag LOCUS_13750 gene ogt 12876 13373 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 protein_id gnl|my_center|LOCUS_13750 14323 13343 gene locus_tag LOCUS_13760 14323 13343 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_13760 15016 14420 gene locus_tag LOCUS_13770 15016 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 15382 16557 gene locus_tag LOCUS_13780 15382 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888440.1 protein_id gnl|my_center|LOCUS_13780 17399 16668 gene locus_tag LOCUS_13790 17399 16668 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_13790 17950 17624 gene locus_tag LOCUS_13800 17950 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 18773 18546 gene locus_tag LOCUS_13810 18773 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 18654 19064 gene locus_tag LOCUS_13820 18654 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 19061 19615 gene locus_tag LOCUS_13830 19061 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 20408 19620 gene locus_tag LOCUS_13840 20408 19620 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence039 1899 895 gene locus_tag LOCUS_13850 1899 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2904 1933 gene locus_tag LOCUS_13860 gene gmd 2904 1933 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_13860 3931 2936 gene locus_tag LOCUS_13870 3931 2936 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_13870 4169 5083 gene locus_tag LOCUS_13880 4169 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5340 6014 gene locus_tag LOCUS_13890 5340 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6979 6104 gene locus_tag LOCUS_13900 6979 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7677 6976 gene locus_tag LOCUS_13910 7677 6976 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_13910 7846 8316 gene locus_tag LOCUS_13920 7846 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 8437 9339 gene locus_tag LOCUS_13930 8437 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9336 10112 gene locus_tag LOCUS_13940 9336 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10261 11043 gene locus_tag LOCUS_13950 10261 11043 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803950.1 protein_id gnl|my_center|LOCUS_13950 11130 11648 gene locus_tag LOCUS_13960 11130 11648 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_13960 12143 11652 gene locus_tag LOCUS_13970 12143 11652 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804863.1 protein_id gnl|my_center|LOCUS_13970 12322 14007 gene locus_tag LOCUS_13980 12322 14007 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_13980 14004 14771 gene locus_tag LOCUS_13990 14004 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 14899 15189 gene locus_tag LOCUS_14000 14899 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 16539 15325 gene locus_tag LOCUS_14010 16539 15325 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_14010 17319 16900 gene locus_tag LOCUS_14020 17319 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 17786 17325 gene locus_tag LOCUS_14030 17786 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 18934 17783 gene locus_tag LOCUS_14040 18934 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 <20063 19200 gene locus_tag LOCUS_14050 <20063 19200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284151.1:cysteine--tRNA ligase >Feature sequence040 159 1313 gene locus_tag LOCUS_14060 159 1313 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_14060 1399 2037 gene locus_tag LOCUS_14070 1399 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2009 2497 gene locus_tag LOCUS_14080 2009 2497 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_14080 2502 3266 gene locus_tag LOCUS_14090 2502 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4072 3290 gene locus_tag LOCUS_14100 gene fabG 4072 3290 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_14100 4464 4072 gene locus_tag LOCUS_14110 4464 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4494 5150 gene locus_tag LOCUS_14120 4494 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5942 5229 gene locus_tag LOCUS_14130 5942 5229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_14130 7053 5935 gene locus_tag LOCUS_14140 7053 5935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_14140 7314 7946 gene locus_tag LOCUS_14150 gene frnE 7314 7946 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_14150 8998 8018 gene locus_tag LOCUS_14160 8998 8018 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 protein_id gnl|my_center|LOCUS_14160 10622 9015 gene locus_tag LOCUS_14170 10622 9015 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_14170 10941 10633 gene locus_tag LOCUS_14180 10941 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 12196 11099 gene locus_tag LOCUS_14190 12196 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13415 12288 gene locus_tag LOCUS_14200 13415 12288 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_14200 14625 13450 gene locus_tag LOCUS_14210 14625 13450 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_14210 14978 16183 gene locus_tag LOCUS_14220 14978 16183 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_14220 16759 16277 gene locus_tag LOCUS_14230 16759 16277 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230299.1 protein_id gnl|my_center|LOCUS_14230 16920 18749 gene locus_tag LOCUS_14240 16920 18749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence041 2 322 gene locus_tag LOCUS_14250 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 475 1815 gene locus_tag LOCUS_14260 475 1815 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964654.1 protein_id gnl|my_center|LOCUS_14260 2095 2805 gene locus_tag LOCUS_14270 gene purN 2095 2805 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_14270 2802 4346 gene locus_tag LOCUS_14280 gene purH 2802 4346 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_14280 4474 5328 gene locus_tag LOCUS_14290 4474 5328 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222732.1 protein_id gnl|my_center|LOCUS_14290 5325 5702 gene locus_tag LOCUS_14300 5325 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5896 6498 gene locus_tag LOCUS_14310 5896 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6900 6514 gene locus_tag LOCUS_14320 6900 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 6836 7429 gene locus_tag LOCUS_14330 6836 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 7510 8379 gene locus_tag LOCUS_14340 7510 8379 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_14340 8446 9519 gene locus_tag LOCUS_14350 8446 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 9530 10525 gene locus_tag LOCUS_14360 9530 10525 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_14360 11816 10911 gene locus_tag LOCUS_14370 11816 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 12461 12054 gene locus_tag LOCUS_14380 12461 12054 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920799.1 protein_id gnl|my_center|LOCUS_14380 13917 12538 gene locus_tag LOCUS_14390 13917 12538 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_14390 14391 13945 gene locus_tag LOCUS_14400 14391 13945 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_14400 14872 14453 gene locus_tag LOCUS_14410 14872 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 15941 14940 gene locus_tag LOCUS_14420 15941 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 17788 15941 gene locus_tag LOCUS_14430 17788 15941 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401322.1 protein_id gnl|my_center|LOCUS_14430 18671 17847 gene locus_tag LOCUS_14440 18671 17847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence042 98 952 gene locus_tag LOCUS_14450 98 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1106 2338 gene locus_tag LOCUS_14460 gene aroC 1106 2338 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_14460 2331 3002 gene locus_tag LOCUS_14470 2331 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2999 4045 gene locus_tag LOCUS_14480 2999 4045 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_14480 4042 4500 gene locus_tag LOCUS_14490 gene aroQ 4042 4500 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312617.1 protein_id gnl|my_center|LOCUS_14490 4497 5645 gene locus_tag LOCUS_14500 gene papA 4497 5645 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_14500 5659 6219 gene locus_tag LOCUS_14510 gene efp 5659 6219 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_14510 6229 6636 gene locus_tag LOCUS_14520 6229 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6725 7294 gene locus_tag LOCUS_14530 gene pyrR 6725 7294 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_14530 7291 8343 gene locus_tag LOCUS_14540 7291 8343 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_14540 8336 9652 gene locus_tag LOCUS_14550 8336 9652 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805076.1 protein_id gnl|my_center|LOCUS_14550 9649 10878 gene locus_tag LOCUS_14560 gene carA 9649 10878 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_14560 10878 14192 gene locus_tag LOCUS_14570 gene carB 10878 14192 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_14570 14189 15217 gene locus_tag LOCUS_14580 14189 15217 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_14580 15187 16092 gene locus_tag LOCUS_14590 gene pyrF 15187 16092 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_14590 17819 16293 gene locus_tag LOCUS_14600 17819 16293 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_14600 17963 18193 gene locus_tag LOCUS_14610 17963 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 <19086 18526 gene locus_tag LOCUS_14620 <19086 18526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729039.1:HNH endonuclease signature motif containing protein >Feature sequence043 3630 2467 gene locus_tag LOCUS_14630 3630 2467 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086601.1 protein_id gnl|my_center|LOCUS_14630 3575 3814 gene locus_tag LOCUS_14640 3575 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4014 5168 gene locus_tag LOCUS_14650 4014 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5214 6185 gene locus_tag LOCUS_14660 5214 6185 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032836384.1 protein_id gnl|my_center|LOCUS_14660 6524 7171 gene locus_tag LOCUS_14670 6524 7171 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485035.1 protein_id gnl|my_center|LOCUS_14670 7277 7831 gene locus_tag LOCUS_14680 gene pth 7277 7831 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_14680 7914 8834 gene locus_tag LOCUS_14690 7914 8834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_14690 8831 9592 gene locus_tag LOCUS_14700 8831 9592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230182.1 protein_id gnl|my_center|LOCUS_14700 9713 13324 gene locus_tag LOCUS_14710 gene mfd 9713 13324 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_14710 13335 14519 gene locus_tag LOCUS_14720 13335 14519 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349607.1 protein_id gnl|my_center|LOCUS_14720 14512 16005 gene locus_tag LOCUS_14730 gene mazG 14512 16005 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_14730 16118 17404 gene locus_tag LOCUS_14740 gene eno 16118 17404 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_14740 17539 18033 gene locus_tag LOCUS_14750 17539 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 18038 18553 gene locus_tag LOCUS_14760 18038 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 18607 18963 gene locus_tag LOCUS_14770 18607 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence044 34 488 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtgctccccgcgcatgcgggggtgatcc 1277 822 gene locus_tag LOCUS_14780 1277 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1402 2784 gene locus_tag LOCUS_14790 1402 2784 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_14790 2790 3149 gene locus_tag LOCUS_14800 2790 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3163 4632 gene locus_tag LOCUS_14810 3163 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4643 5302 gene locus_tag LOCUS_14820 4643 5302 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081890.1 protein_id gnl|my_center|LOCUS_14820 5526 6572 gene locus_tag LOCUS_14830 gene hrcA 5526 6572 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_14830 6569 7726 gene locus_tag LOCUS_14840 gene dnaJ 6569 7726 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124172.1 protein_id gnl|my_center|LOCUS_14840 7749 8516 gene locus_tag LOCUS_14850 7749 8516 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729879.1 protein_id gnl|my_center|LOCUS_14850 8639 9238 gene locus_tag LOCUS_14860 gene bldD 8639 9238 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_14860 9310 9567 gene locus_tag LOCUS_14870 9310 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 9564 9914 gene locus_tag LOCUS_14880 9564 9914 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_14880 9978 10940 gene locus_tag LOCUS_14890 9978 10940 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_14890 10930 11436 gene locus_tag LOCUS_14900 gene ybeY 10930 11436 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_14900 11497 12813 gene locus_tag LOCUS_14910 11497 12813 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931023.1 protein_id gnl|my_center|LOCUS_14910 12810 13901 gene locus_tag LOCUS_14920 12810 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 16087 14009 gene locus_tag LOCUS_14930 16087 14009 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_14930 16893 16135 gene locus_tag LOCUS_14940 16893 16135 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence045 476 808 gene locus_tag LOCUS_14950 476 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4154 1254 gene locus_tag LOCUS_14960 4154 1254 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_14960 4645 6177 gene locus_tag LOCUS_14970 gene glpK 4645 6177 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931879.1 protein_id gnl|my_center|LOCUS_14970 6821 6198 gene locus_tag LOCUS_14980 6821 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_14980 7655 6825 gene locus_tag LOCUS_14990 7655 6825 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 protein_id gnl|my_center|LOCUS_14990 7693 8361 gene locus_tag LOCUS_15000 7693 8361 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_15000 9547 8345 gene locus_tag LOCUS_15010 9547 8345 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_15010 10279 9581 gene locus_tag LOCUS_15020 10279 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 10790 10350 gene locus_tag LOCUS_15030 10790 10350 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411354.1 protein_id gnl|my_center|LOCUS_15030 11982 10840 gene locus_tag LOCUS_15040 11982 10840 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_15040 13121 11979 gene locus_tag LOCUS_15050 13121 11979 CDS product DUF1730 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392044.1 protein_id gnl|my_center|LOCUS_15050 13562 13248 gene locus_tag LOCUS_15060 13562 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 14617 13697 gene locus_tag LOCUS_15070 14617 13697 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 protein_id gnl|my_center|LOCUS_15070 14840 16375 gene locus_tag LOCUS_15080 14840 16375 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_15080 <17131 16445 gene locus_tag LOCUS_15090 <17131 16445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223022.1:alpha/beta fold hydrolase >Feature sequence046 998 1645 gene locus_tag LOCUS_15100 998 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2654 1671 gene locus_tag LOCUS_15110 2654 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2710 3321 gene locus_tag LOCUS_15120 gene pdxH 2710 3321 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_15120 3722 3327 gene locus_tag LOCUS_15130 3722 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3672 3902 gene locus_tag LOCUS_15140 3672 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4076 4495 gene locus_tag LOCUS_15150 4076 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4933 4529 gene locus_tag LOCUS_15160 4933 4529 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975057.1 protein_id gnl|my_center|LOCUS_15160 5798 5016 gene locus_tag LOCUS_15170 5798 5016 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_15170 5926 6990 gene locus_tag LOCUS_15180 5926 6990 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_15180 8106 6997 gene locus_tag LOCUS_15190 8106 6997 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975670.1 protein_id gnl|my_center|LOCUS_15190 8194 9708 gene locus_tag LOCUS_15200 8194 9708 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030570.1 protein_id gnl|my_center|LOCUS_15200 10656 9757 gene locus_tag LOCUS_15210 10656 9757 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_15210 10689 11240 gene locus_tag LOCUS_15220 10689 11240 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730621.1 protein_id gnl|my_center|LOCUS_15220 11468 11541 gene locus_tag LOCUS_t00270 11468 11541 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12451 11672 gene locus_tag LOCUS_15230 12451 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 12605 13240 gene locus_tag LOCUS_15240 12605 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13278 14435 gene locus_tag LOCUS_15250 13278 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 16182 14521 gene locus_tag LOCUS_15260 16182 14521 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032668525.1 protein_id gnl|my_center|LOCUS_15260 16932 16321 gene locus_tag LOCUS_15270 16932 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence047 <1 1028 gene locus_tag LOCUS_15280 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888377.1:glucose-6-phosphate isomerase 2368 1073 gene locus_tag LOCUS_15290 2368 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2832 2365 gene locus_tag LOCUS_15300 2832 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3113 5158 gene locus_tag LOCUS_15310 3113 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6202 5309 gene locus_tag LOCUS_15320 6202 5309 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_15320 6105 6317 gene locus_tag LOCUS_15330 6105 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8683 6347 gene locus_tag LOCUS_15340 8683 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8997 9623 gene locus_tag LOCUS_15350 8997 9623 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_15350 10724 9678 gene locus_tag LOCUS_15360 10724 9678 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_15360 11795 10728 gene locus_tag LOCUS_15370 11795 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 12839 11826 gene locus_tag LOCUS_15380 12839 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 14253 12949 gene locus_tag LOCUS_15390 14253 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 14534 16213 gene locus_tag LOCUS_15400 14534 16213 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence048 <1 591 gene locus_tag LOCUS_15410 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776424.1:YceI family protein 734 1516 gene locus_tag LOCUS_15420 734 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_15420 1840 1631 gene locus_tag LOCUS_15430 1840 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1963 2229 gene locus_tag LOCUS_15440 1963 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2921 2334 gene locus_tag LOCUS_15450 2921 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3515 2946 gene locus_tag LOCUS_15460 3515 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3931 3482 gene locus_tag LOCUS_15470 3931 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5390 4104 gene locus_tag LOCUS_15480 gene tyrS 5390 4104 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_15480 5591 6934 gene locus_tag LOCUS_15490 5591 6934 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_15490 9163 7115 gene locus_tag LOCUS_15500 gene menD 9163 7115 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_15500 9169 10023 gene locus_tag LOCUS_15510 gene menH 9169 10023 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_15510 11134 10139 gene locus_tag LOCUS_15520 11134 10139 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 protein_id gnl|my_center|LOCUS_15520 12291 11299 gene locus_tag LOCUS_15530 gene menB 12291 11299 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_15530 12344 13471 gene locus_tag LOCUS_15540 gene menE 12344 13471 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081439373.1 protein_id gnl|my_center|LOCUS_15540 14282 13503 gene locus_tag LOCUS_15550 14282 13503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence049 1732 926 gene locus_tag LOCUS_15560 1732 926 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_15560 3225 1729 gene locus_tag LOCUS_15570 3225 1729 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_15570 4210 3242 gene locus_tag LOCUS_15580 4210 3242 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_15580 5439 4207 gene locus_tag LOCUS_15590 5439 4207 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_15590 6812 5556 gene locus_tag LOCUS_15600 gene proB 6812 5556 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906819.1 protein_id gnl|my_center|LOCUS_15600 6943 8055 gene locus_tag LOCUS_15610 6943 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 8992 8147 gene locus_tag LOCUS_15620 8992 8147 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_15620 9997 9098 gene locus_tag LOCUS_15630 9997 9098 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_15630 10294 11694 gene locus_tag LOCUS_15640 10294 11694 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_15640 11807 12835 gene locus_tag LOCUS_15650 11807 12835 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_15650 12928 13107 gene locus_tag LOCUS_15660 12928 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 14347 13136 gene locus_tag LOCUS_15670 14347 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence050 1363 2856 gene locus_tag LOCUS_15680 gene pbpA 1363 2856 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_15680 2964 3797 gene locus_tag LOCUS_15690 2964 3797 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_15690 4058 5878 gene locus_tag LOCUS_15700 4058 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6601 5897 gene locus_tag LOCUS_15710 6601 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 7427 6654 gene locus_tag LOCUS_15720 7427 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 8031 7498 gene locus_tag LOCUS_15730 8031 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 9451 8045 gene locus_tag LOCUS_15740 9451 8045 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 protein_id gnl|my_center|LOCUS_15740 10306 9506 gene locus_tag LOCUS_15750 10306 9506 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_15750 10643 10389 gene locus_tag LOCUS_15760 gene rpmA 10643 10389 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_15760 11027 10713 gene locus_tag LOCUS_15770 gene rplU 11027 10713 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_15770 13106 11040 gene locus_tag LOCUS_15780 13106 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 13919 13107 gene locus_tag LOCUS_15790 13919 13107 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_15790 16007 13920 gene locus_tag LOCUS_15800 16007 13920 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence051 1489 125 gene locus_tag LOCUS_15810 1489 125 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142436.1 protein_id gnl|my_center|LOCUS_15810 2193 1495 gene locus_tag LOCUS_15820 2193 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3725 2190 gene locus_tag LOCUS_15830 gene rimO 3725 2190 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392588.1 protein_id gnl|my_center|LOCUS_15830 3883 3794 gene locus_tag LOCUS_t00280 3883 3794 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4071 4298 gene locus_tag LOCUS_15840 4071 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4328 4540 gene locus_tag LOCUS_15850 4328 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5330 4962 gene locus_tag LOCUS_15860 5330 4962 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_15860 5533 5327 gene locus_tag LOCUS_15870 5533 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5551 5745 gene locus_tag LOCUS_15880 5551 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5802 7316 gene locus_tag LOCUS_15890 5802 7316 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_15890 7313 8731 gene locus_tag LOCUS_15900 7313 8731 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_15900 9287 8817 gene locus_tag LOCUS_15910 9287 8817 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110027.1 protein_id gnl|my_center|LOCUS_15910 9415 10701 gene locus_tag LOCUS_15920 9415 10701 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_15920 10705 11481 gene locus_tag LOCUS_15930 10705 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 13223 11535 gene locus_tag LOCUS_15940 13223 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 13555 14604 gene locus_tag LOCUS_15950 13555 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 15144 14677 gene locus_tag LOCUS_15960 15144 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence052 219 1067 gene locus_tag LOCUS_15970 219 1067 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485387.1 protein_id gnl|my_center|LOCUS_15970 1077 1865 gene locus_tag LOCUS_15980 1077 1865 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_15980 1862 2749 gene locus_tag LOCUS_15990 1862 2749 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_15990 3586 2753 gene locus_tag LOCUS_16000 3586 2753 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_16000 3724 4203 gene locus_tag LOCUS_16010 3724 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4707 4240 gene locus_tag LOCUS_16020 4707 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6121 4724 gene locus_tag LOCUS_16030 gene dnaB 6121 4724 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_16030 6963 6502 gene locus_tag LOCUS_16040 gene rplI 6963 6502 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_16040 7399 6965 gene locus_tag LOCUS_16050 7399 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7947 7474 gene locus_tag LOCUS_16060 7947 7474 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064618.1 protein_id gnl|my_center|LOCUS_16060 8285 7950 gene locus_tag LOCUS_16070 gene rpsF 8285 7950 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_16070 9218 8403 gene locus_tag LOCUS_16080 gene panB 9218 8403 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080134253.1 protein_id gnl|my_center|LOCUS_16080 9796 9341 gene locus_tag LOCUS_16090 9796 9341 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_16090 10019 10726 gene locus_tag LOCUS_16100 10019 10726 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899787.1 protein_id gnl|my_center|LOCUS_16100 10723 11820 gene locus_tag LOCUS_16110 10723 11820 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_16110 13222 11834 gene locus_tag LOCUS_16120 13222 11834 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_16120 13402 14991 gene locus_tag LOCUS_16130 13402 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence053 1322 174 gene locus_tag LOCUS_16140 gene sucC 1322 174 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_16140 1859 1467 gene locus_tag LOCUS_16150 1859 1467 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_16150 2096 3085 gene locus_tag LOCUS_16160 2096 3085 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222176.1 protein_id gnl|my_center|LOCUS_16160 3082 4734 gene locus_tag LOCUS_16170 3082 4734 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_16170 4731 5492 gene locus_tag LOCUS_16180 4731 5492 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_16180 6337 5504 gene locus_tag LOCUS_16190 gene ppk2 6337 5504 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_16190 8999 6405 gene locus_tag LOCUS_16200 gene pcrA 8999 6405 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013929.1 protein_id gnl|my_center|LOCUS_16200 10633 8996 gene locus_tag LOCUS_16210 gene guaA 10633 8996 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_16210 11793 10630 gene locus_tag LOCUS_16220 11793 10630 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_16220 12672 11914 gene locus_tag LOCUS_16230 12672 11914 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258068.1 protein_id gnl|my_center|LOCUS_16230 12776 13186 gene locus_tag LOCUS_16240 12776 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 13191 13415 gene locus_tag LOCUS_16250 13191 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 13457 14155 gene locus_tag LOCUS_16260 13457 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 14086 14325 gene locus_tag LOCUS_16270 14086 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16270 >Feature sequence054 405 1862 gene locus_tag LOCUS_16280 405 1862 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_16280 1872 2018 gene locus_tag LOCUS_16290 1872 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2332 2256 gene locus_tag LOCUS_t00290 2332 2256 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2520 3512 gene locus_tag LOCUS_16300 2520 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 6569 3495 gene locus_tag LOCUS_16310 6569 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6826 7314 gene locus_tag LOCUS_16320 6826 7314 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_16320 7391 8725 gene locus_tag LOCUS_16330 gene tig 7391 8725 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_16330 8722 9375 gene locus_tag LOCUS_16340 gene clpP 8722 9375 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_16340 9641 10924 gene locus_tag LOCUS_16350 gene clpX 9641 10924 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_16350 11004 12353 gene locus_tag LOCUS_16360 11004 12353 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_16360 12366 12776 gene locus_tag LOCUS_16370 gene ndk 12366 12776 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412592.1 protein_id gnl|my_center|LOCUS_16370 12974 14005 gene locus_tag LOCUS_16380 12974 14005 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence055 2072 603 gene locus_tag LOCUS_16390 2072 603 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_16390 4001 2256 gene locus_tag LOCUS_16400 4001 2256 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_16400 4139 5050 gene locus_tag LOCUS_16410 4139 5050 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 protein_id gnl|my_center|LOCUS_16410 5047 5619 gene locus_tag LOCUS_16420 5047 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5736 6629 gene locus_tag LOCUS_16430 gene htdY 5736 6629 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_16430 7595 6648 gene locus_tag LOCUS_16440 7595 6648 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 protein_id gnl|my_center|LOCUS_16440 7939 9645 gene locus_tag LOCUS_16450 7939 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 10662 9679 gene locus_tag LOCUS_16460 10662 9679 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113157.1 protein_id gnl|my_center|LOCUS_16460 11927 10713 gene locus_tag LOCUS_16470 11927 10713 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_16470 13169 11970 gene locus_tag LOCUS_16480 13169 11970 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_16480 14079 13264 gene locus_tag LOCUS_16490 14079 13264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence056 <1 693 gene locus_tag LOCUS_16500 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229550.1:SDR family oxidoreductase 1550 783 gene locus_tag LOCUS_16510 1550 783 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_16510 2752 1619 gene locus_tag LOCUS_16520 gene rlmN 2752 1619 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_16520 4283 2781 gene locus_tag LOCUS_16530 4283 2781 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_16530 4604 5251 gene locus_tag LOCUS_16540 4604 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 5373 6566 gene locus_tag LOCUS_16550 5373 6566 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_16550 6563 7726 gene locus_tag LOCUS_16560 6563 7726 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_16560 7723 8148 gene locus_tag LOCUS_16570 7723 8148 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_16570 8145 9782 gene locus_tag LOCUS_16580 8145 9782 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_16580 9847 11067 gene locus_tag LOCUS_16590 gene rnd 9847 11067 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_16590 12166 11174 gene locus_tag LOCUS_16600 12166 11174 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 protein_id gnl|my_center|LOCUS_16600 12199 12843 gene locus_tag LOCUS_16610 12199 12843 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_16610 13395 12895 gene locus_tag LOCUS_16620 13395 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence057 342 1616 gene locus_tag LOCUS_16630 342 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1777 3597 gene locus_tag LOCUS_16640 1777 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3594 4988 gene locus_tag LOCUS_16650 3594 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5139 7250 gene locus_tag LOCUS_16660 5139 7250 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_16660 9079 7247 gene locus_tag LOCUS_16670 9079 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 11216 9144 gene locus_tag LOCUS_16680 11216 9144 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_16680 12960 11731 gene locus_tag LOCUS_16690 12960 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence058 1797 4571 gene locus_tag LOCUS_16700 1797 4571 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_16700 6018 4654 gene locus_tag LOCUS_16710 6018 4654 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_16710 6217 7566 gene locus_tag LOCUS_16720 6217 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 8129 7653 gene locus_tag LOCUS_16730 8129 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 8765 8169 gene locus_tag LOCUS_16740 8765 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 9214 8756 gene locus_tag LOCUS_16750 9214 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 11325 9661 gene locus_tag LOCUS_16760 11325 9661 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_16760 <13360 11338 gene locus_tag LOCUS_16770 <13360 11338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226708.1:DEAD/DEAH box helicase >Feature sequence059 1589 426 gene locus_tag LOCUS_16780 1589 426 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_16780 1822 2091 gene locus_tag LOCUS_16790 1822 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2178 2265 gene locus_tag LOCUS_t00300 2178 2265 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2506 2949 gene locus_tag LOCUS_16800 gene tadA 2506 2949 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_16800 3047 3286 gene locus_tag LOCUS_16810 3047 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3283 3639 gene locus_tag LOCUS_16820 3283 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4389 3700 gene locus_tag LOCUS_16830 4389 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5434 4418 gene locus_tag LOCUS_16840 5434 4418 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080843023.1 protein_id gnl|my_center|LOCUS_16840 6138 5842 gene locus_tag LOCUS_16850 6138 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7030 6086 gene locus_tag LOCUS_16860 7030 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7366 8157 gene locus_tag LOCUS_16870 7366 8157 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_16870 8154 10361 gene locus_tag LOCUS_16880 8154 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10358 11041 gene locus_tag LOCUS_16890 10358 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence060 168 668 gene locus_tag LOCUS_16900 168 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16900 759 1313 gene locus_tag LOCUS_16910 759 1313 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403256.1 protein_id gnl|my_center|LOCUS_16910 1971 1297 gene locus_tag LOCUS_16920 1971 1297 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727024.1 protein_id gnl|my_center|LOCUS_16920 2697 1999 gene locus_tag LOCUS_16930 2697 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2922 3851 gene locus_tag LOCUS_16940 2922 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5676 4039 gene locus_tag LOCUS_16950 5676 4039 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727566.1 protein_id gnl|my_center|LOCUS_16950 5874 8060 gene locus_tag LOCUS_16960 5874 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 9524 8070 gene locus_tag LOCUS_16970 9524 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 9857 10744 gene locus_tag LOCUS_16980 9857 10744 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_16980 10836 11678 gene locus_tag LOCUS_16990 10836 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16990 >Feature sequence061 390 599 gene locus_tag LOCUS_17000 390 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2882 618 gene locus_tag LOCUS_17010 2882 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4917 2959 gene locus_tag LOCUS_17020 gene dxs 4917 2959 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_17020 6183 4987 gene locus_tag LOCUS_17030 6183 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 6667 6332 gene locus_tag LOCUS_17040 6667 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 6789 8183 gene locus_tag LOCUS_17050 6789 8183 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_17050 8180 9586 gene locus_tag LOCUS_17060 8180 9586 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_17060 10339 9602 gene locus_tag LOCUS_17070 10339 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 11259 10336 gene locus_tag LOCUS_17080 11259 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 12024 11425 gene locus_tag LOCUS_17090 12024 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17090 >Feature sequence062 75 1757 gene locus_tag LOCUS_17100 75 1757 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114470298.1 protein_id gnl|my_center|LOCUS_17100 1839 2246 gene locus_tag LOCUS_17110 1839 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2260 3507 gene locus_tag LOCUS_17120 2260 3507 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929834.1 protein_id gnl|my_center|LOCUS_17120 3497 4387 gene locus_tag LOCUS_17130 3497 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4384 4833 gene locus_tag LOCUS_17140 4384 4833 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807885.1 protein_id gnl|my_center|LOCUS_17140 4992 6377 gene locus_tag LOCUS_17150 4992 6377 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_17150 6377 7549 gene locus_tag LOCUS_17160 6377 7549 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225718.1 protein_id gnl|my_center|LOCUS_17160 7791 8885 gene locus_tag LOCUS_17170 7791 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 9080 9904 gene locus_tag LOCUS_17180 9080 9904 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_17180 11248 9944 gene locus_tag LOCUS_17190 11248 9944 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 protein_id gnl|my_center|LOCUS_17190 11421 12230 gene locus_tag LOCUS_17200 11421 12230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence063 587 162 gene locus_tag LOCUS_17210 587 162 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_17210 749 1441 gene locus_tag LOCUS_17220 749 1441 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_17220 2712 1531 gene locus_tag LOCUS_17230 2712 1531 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_17230 3068 4297 gene locus_tag LOCUS_17240 gene ccrA 3068 4297 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_17240 4368 4778 gene locus_tag LOCUS_17250 gene mce 4368 4778 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_17250 4786 5706 gene locus_tag LOCUS_17260 4786 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5775 6152 gene locus_tag LOCUS_17270 5775 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6239 7783 gene locus_tag LOCUS_17280 6239 7783 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_17280 7780 8010 gene locus_tag LOCUS_17290 7780 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 8431 8099 gene locus_tag LOCUS_17300 8431 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9521 8499 gene locus_tag LOCUS_17310 9521 8499 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_17310 10053 9448 gene locus_tag LOCUS_17320 gene recR 10053 9448 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence064 357 629 gene locus_tag LOCUS_17330 357 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1108 2376 gene locus_tag LOCUS_17340 1108 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3471 2416 gene locus_tag LOCUS_17350 3471 2416 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_17350 3495 6119 gene locus_tag LOCUS_17360 3495 6119 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_17360 6790 6533 gene locus_tag LOCUS_17370 6790 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7458 6787 gene locus_tag LOCUS_17380 7458 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7757 8344 gene locus_tag LOCUS_17390 7757 8344 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_17390 8475 9173 gene locus_tag LOCUS_17400 8475 9173 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_17400 10344 9244 gene locus_tag LOCUS_17410 10344 9244 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_17410 11192 10341 gene locus_tag LOCUS_17420 11192 10341 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence065 746 1120 gene locus_tag LOCUS_17430 746 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3743 1167 gene locus_tag LOCUS_17440 gene pheT 3743 1167 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_17440 4811 3777 gene locus_tag LOCUS_17450 gene pheS 4811 3777 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_17450 5640 4921 gene locus_tag LOCUS_17460 5640 4921 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_17460 6119 5730 gene locus_tag LOCUS_17470 gene rplT 6119 5730 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_17470 6449 6255 gene locus_tag LOCUS_17480 gene rpmI 6449 6255 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_17480 7057 6455 gene locus_tag LOCUS_17490 7057 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 6989 7444 gene locus_tag LOCUS_17500 6989 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 7594 7956 gene locus_tag LOCUS_17510 7594 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8028 9641 gene locus_tag LOCUS_17520 8028 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 10799 9903 gene locus_tag LOCUS_17530 gene hisG 10799 9903 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence066 216 1715 gene locus_tag LOCUS_17540 216 1715 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_17540 1712 3745 gene locus_tag LOCUS_17550 1712 3745 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_17550 4063 4338 gene locus_tag LOCUS_17560 4063 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5297 4446 gene locus_tag LOCUS_17570 gene ftcD 5297 4446 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_17570 5585 5319 gene locus_tag LOCUS_17580 5585 5319 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003835265.1 protein_id gnl|my_center|LOCUS_17580 6160 5951 gene locus_tag LOCUS_17590 6160 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 6042 7205 gene locus_tag LOCUS_17600 6042 7205 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_17600 7245 7601 gene locus_tag LOCUS_17610 7245 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 8888 7623 gene locus_tag LOCUS_17620 8888 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 10211 8898 gene locus_tag LOCUS_17630 10211 8898 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930000.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17630 >Feature sequence067 458 1600 gene locus_tag LOCUS_17640 458 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1597 3750 gene locus_tag LOCUS_17650 1597 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4928 3687 gene locus_tag LOCUS_17660 4928 3687 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228975.1 protein_id gnl|my_center|LOCUS_17660 5668 4925 gene locus_tag LOCUS_17670 5668 4925 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_17670 6165 5665 gene locus_tag LOCUS_17680 gene def 6165 5665 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_17680 6788 6192 gene locus_tag LOCUS_17690 6788 6192 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_17690 6956 8548 gene locus_tag LOCUS_17700 6956 8548 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_17700 9022 8591 gene locus_tag LOCUS_17710 9022 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 10547 9057 gene locus_tag LOCUS_17720 gene xseA 10547 9057 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064088.1 protein_id gnl|my_center|LOCUS_17720 10745 10557 gene locus_tag LOCUS_17730 10745 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence068 830 360 gene locus_tag LOCUS_17740 830 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1189 917 gene locus_tag LOCUS_17750 1189 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1277 2773 gene locus_tag LOCUS_17760 1277 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2978 5368 gene locus_tag LOCUS_17770 2978 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6672 5410 gene locus_tag LOCUS_17780 6672 5410 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080481.1 protein_id gnl|my_center|LOCUS_17780 7903 6725 gene locus_tag LOCUS_17790 gene trpD 7903 6725 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_17790 9072 7891 gene locus_tag LOCUS_17800 9072 7891 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064857.1 protein_id gnl|my_center|LOCUS_17800 9159 10355 gene locus_tag LOCUS_17810 9159 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence069 2245 389 gene locus_tag LOCUS_17820 gene glmS 2245 389 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077531.1 protein_id gnl|my_center|LOCUS_17820 3672 2305 gene locus_tag LOCUS_17830 gene glmM 3672 2305 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_17830 4075 3677 gene locus_tag LOCUS_17840 4075 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4587 4120 gene locus_tag LOCUS_17850 gene rplM 4587 4120 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_17850 5632 4775 gene locus_tag LOCUS_17860 gene truA 5632 4775 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 6159 5806 gene locus_tag LOCUS_17870 6159 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7107 6169 gene locus_tag LOCUS_17880 7107 6169 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418351.1 protein_id gnl|my_center|LOCUS_17880 7864 7217 gene locus_tag LOCUS_17890 gene rpsD 7864 7217 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_17890 8303 7896 gene locus_tag LOCUS_17900 gene rpsK 8303 7896 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_17900 8681 8304 gene locus_tag LOCUS_17910 gene rpsM 8681 8304 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_17910 9347 9051 gene locus_tag LOCUS_17920 9347 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 10032 9532 gene locus_tag LOCUS_17930 10032 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence070 347 700 gene locus_tag LOCUS_17940 347 700 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_17940 802 1305 gene locus_tag LOCUS_17950 802 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1431 1784 gene locus_tag LOCUS_17960 1431 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2079 1867 gene locus_tag LOCUS_17970 2079 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2400 3113 gene locus_tag LOCUS_17980 2400 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 3114 4310 gene locus_tag LOCUS_17990 gene metK 3114 4310 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_17990 4346 6169 gene locus_tag LOCUS_18000 4346 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 6276 6827 gene locus_tag LOCUS_18010 gene def 6276 6827 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_18010 6885 7805 gene locus_tag LOCUS_18020 gene fmt 6885 7805 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_18020 7741 8520 gene locus_tag LOCUS_18030 gene rpe 7741 8520 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_18030 8553 9599 gene locus_tag LOCUS_18040 gene ribD 8553 9599 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence071 2416 1283 gene locus_tag LOCUS_18050 2416 1283 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_18050 3005 2517 gene locus_tag LOCUS_18060 3005 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3523 3002 gene locus_tag LOCUS_18070 3523 3002 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115562.1 protein_id gnl|my_center|LOCUS_18070 4731 3520 gene locus_tag LOCUS_18080 4731 3520 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_18080 5915 4734 gene locus_tag LOCUS_18090 5915 4734 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_18090 6092 7537 gene locus_tag LOCUS_18100 6092 7537 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_18100 7650 8840 gene locus_tag LOCUS_18110 7650 8840 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_18110 9430 8786 gene locus_tag LOCUS_18120 9430 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence072 403 1149 gene locus_tag LOCUS_18130 403 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_18130 2083 1292 gene locus_tag LOCUS_18140 2083 1292 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073799.1 protein_id gnl|my_center|LOCUS_18140 2558 2238 gene locus_tag LOCUS_18150 2558 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2809 3027 gene locus_tag LOCUS_18160 2809 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3268 3645 gene locus_tag LOCUS_18170 3268 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3884 3642 gene locus_tag LOCUS_18180 3884 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 4095 4021 gene locus_tag LOCUS_t00310 4095 4021 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4434 4198 gene locus_tag LOCUS_18190 4434 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4546 5547 gene locus_tag LOCUS_18200 4546 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7089 5902 gene locus_tag LOCUS_18210 7089 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7468 7232 gene locus_tag LOCUS_18220 7468 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8569 7472 gene locus_tag LOCUS_18230 gene moaA 8569 7472 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence073 3298 2573 gene locus_tag LOCUS_18240 3298 2573 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402311.1 protein_id gnl|my_center|LOCUS_18240 4047 3295 gene locus_tag LOCUS_18250 4047 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4838 4044 gene locus_tag LOCUS_18260 4838 4044 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897311.1 protein_id gnl|my_center|LOCUS_18260 6499 4976 gene locus_tag LOCUS_18270 6499 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7679 6519 gene locus_tag LOCUS_18280 7679 6519 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730961.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence074 287 1498 gene locus_tag LOCUS_18290 287 1498 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_18290 1645 2676 gene locus_tag LOCUS_18300 1645 2676 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_18300 3425 2775 gene locus_tag LOCUS_18310 gene phoU 3425 2775 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_18310 4833 3553 gene locus_tag LOCUS_18320 4833 3553 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_18320 5171 6616 gene locus_tag LOCUS_18330 5171 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence075 <1 882 gene locus_tag LOCUS_18340 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296542.1:AarF/UbiB family protein 1661 846 gene locus_tag LOCUS_18350 gene trpA 1661 846 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_18350 2890 1658 gene locus_tag LOCUS_18360 gene trpB 2890 1658 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331302.1 protein_id gnl|my_center|LOCUS_18360 3639 2887 gene locus_tag LOCUS_18370 3639 2887 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_18370 4433 3642 gene locus_tag LOCUS_18380 gene trpC 4433 3642 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_18380 4508 5215 gene locus_tag LOCUS_18390 4508 5215 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461794.1 protein_id gnl|my_center|LOCUS_18390 5212 6630 gene locus_tag LOCUS_18400 5212 6630 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228142.1 protein_id gnl|my_center|LOCUS_18400 7595 6588 gene locus_tag LOCUS_18410 7595 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 <8740 7592 gene locus_tag LOCUS_18420 <8740 7592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118826697.1:anthranilate synthase component I >Feature sequence076 1100 1336 gene locus_tag LOCUS_18430 1100 1336 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_18430 2515 1370 gene locus_tag LOCUS_18440 2515 1370 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_18440 2768 3139 gene locus_tag LOCUS_18450 2768 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3325 4419 gene locus_tag LOCUS_18460 gene galK 3325 4419 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_18460 4867 4373 gene locus_tag LOCUS_18470 4867 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6050 4875 gene locus_tag LOCUS_18480 6050 4875 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_18480 7633 6047 gene locus_tag LOCUS_18490 7633 6047 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_18490 <8359 7630 gene locus_tag LOCUS_18500 <8359 7630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228947.1:alpha/beta fold hydrolase >Feature sequence077 1544 666 gene locus_tag LOCUS_18510 1544 666 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_18510 2664 1642 gene locus_tag LOCUS_18520 2664 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2600 3013 gene locus_tag LOCUS_18530 2600 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4268 3042 gene locus_tag LOCUS_18540 4268 3042 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_18540 4520 5380 gene locus_tag LOCUS_18550 gene pdxS 4520 5380 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907728.1 protein_id gnl|my_center|LOCUS_18550 5408 6040 gene locus_tag LOCUS_18560 gene pdxT 5408 6040 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_18560 6105 6854 gene locus_tag LOCUS_18570 6105 6854 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_18570 6940 7503 gene locus_tag LOCUS_18580 gene ruvC 6940 7503 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_18580 7500 8096 gene locus_tag LOCUS_18590 gene ruvA 7500 8096 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence078 702 2492 gene locus_tag LOCUS_18600 702 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2740 5445 gene locus_tag LOCUS_18610 2740 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5547 6689 gene locus_tag LOCUS_18620 5547 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6686 7906 gene locus_tag LOCUS_18630 6686 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence079 795 331 gene locus_tag LOCUS_18640 795 331 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_18640 1898 792 gene locus_tag LOCUS_18650 gene arsB 1898 792 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_18650 2362 1895 gene locus_tag LOCUS_18660 2362 1895 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_18660 2445 2807 gene locus_tag LOCUS_18670 2445 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3031 3192 gene locus_tag LOCUS_18680 3031 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18680 3529 3278 gene locus_tag LOCUS_18690 3529 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3909 4724 gene locus_tag LOCUS_18700 3909 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4839 5132 gene locus_tag LOCUS_18710 4839 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 5143 5910 gene locus_tag LOCUS_18720 5143 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6541 5948 gene locus_tag LOCUS_18730 6541 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7348 6545 gene locus_tag LOCUS_18740 7348 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 <8019 7345 gene locus_tag LOCUS_18750 <8019 7345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940907.1:YceH family protein >Feature sequence080 248 257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 289 447 gene locus_tag LOCUS_18760 289 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1392 457 gene locus_tag LOCUS_18770 1392 457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_18770 3467 1494 gene locus_tag LOCUS_18780 3467 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3576 4028 gene locus_tag LOCUS_18790 3576 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 4025 4270 gene locus_tag LOCUS_18800 4025 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 4359 5441 gene locus_tag LOCUS_18810 4359 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5538 6896 gene locus_tag LOCUS_18820 5538 6896 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_18820 <7463 6893 gene locus_tag LOCUS_18830 <7463 6893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978135.1:flavin reductase family protein >Feature sequence081 741 1775 gene locus_tag LOCUS_18840 741 1775 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_18840 2552 1797 gene locus_tag LOCUS_18850 2552 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2579 4372 gene locus_tag LOCUS_18860 gene ilvD 2579 4372 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_18860 5933 4422 gene locus_tag LOCUS_18870 5933 4422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 protein_id gnl|my_center|LOCUS_18870 6115 6804 gene locus_tag LOCUS_18880 6115 6804 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence082 <1 570 gene locus_tag LOCUS_18890 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546067.1:porphobilinogen synthase 563 1897 gene locus_tag LOCUS_18900 gene hemL 563 1897 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_18900 2059 2871 gene locus_tag LOCUS_18910 2059 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3116 4561 gene locus_tag LOCUS_18920 3116 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5921 4617 gene locus_tag LOCUS_18930 5921 4617 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_18930 6119 6664 gene locus_tag LOCUS_18940 6119 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence083 277 660 gene locus_tag LOCUS_18950 277 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 752 1228 gene locus_tag LOCUS_18960 gene nrdR 752 1228 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_18960 1249 1947 gene locus_tag LOCUS_18970 1249 1947 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_18970 1940 3409 gene locus_tag LOCUS_18980 gene dinB 1940 3409 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_18980 3537 3935 gene locus_tag LOCUS_18990 3537 3935 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729665.1 protein_id gnl|my_center|LOCUS_18990 3968 4846 gene locus_tag LOCUS_19000 3968 4846 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_19000 5385 5840 gene locus_tag LOCUS_19010 5385 5840 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_19010 5924 6610 gene locus_tag LOCUS_19020 5924 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence084 <1 1358 gene locus_tag LOCUS_19030 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027383.1:SDR family oxidoreductase 1402 2559 gene locus_tag LOCUS_19040 1402 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3520 2549 gene locus_tag LOCUS_19050 3520 2549 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_19050 4223 3564 gene locus_tag LOCUS_19060 4223 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5079 4441 gene locus_tag LOCUS_19070 5079 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 6003 5083 gene locus_tag LOCUS_19080 6003 5083 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence085 1290 1015 gene locus_tag LOCUS_19090 1290 1015 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_19090 2609 1287 gene locus_tag LOCUS_19100 gene thrC 2609 1287 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_19100 2886 3725 gene locus_tag LOCUS_19110 2886 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3787 5202 gene locus_tag LOCUS_19120 3787 5202 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_19120 6137 5208 gene locus_tag LOCUS_19130 gene otsB 6137 5208 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence086 <1 739 gene locus_tag LOCUS_19140 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064632335.1:carboxylesterase/lipase family protein 747 2228 gene locus_tag LOCUS_19150 747 2228 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_19150 2282 3304 gene locus_tag LOCUS_19160 2282 3304 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_19160 3301 3915 gene locus_tag LOCUS_19170 3301 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3912 5303 gene locus_tag LOCUS_19180 3912 5303 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_19180 5626 5357 gene locus_tag LOCUS_19190 5626 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence087 <1 1091 gene locus_tag LOCUS_19200 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977314.1:GTP pyrophosphokinase 1099 2415 gene locus_tag LOCUS_19210 gene hisS 1099 2415 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_19210 2412 4184 gene locus_tag LOCUS_19220 gene aspS 2412 4184 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_19220 4191 5540 gene locus_tag LOCUS_19230 4191 5540 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence088 374 1747 gene locus_tag LOCUS_19240 374 1747 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_19240 1811 3373 gene locus_tag LOCUS_19250 1811 3373 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_19250 4367 3759 gene locus_tag LOCUS_19260 4367 3759 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072654.1 protein_id gnl|my_center|LOCUS_19260 5167 4364 gene locus_tag LOCUS_19270 5167 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5510 5208 gene locus_tag LOCUS_19280 5510 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence089 709 1305 gene locus_tag LOCUS_19290 709 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1562 1206 gene locus_tag LOCUS_19300 1562 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1504 1896 gene locus_tag LOCUS_19310 1504 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3401 1890 gene locus_tag LOCUS_19320 3401 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4119 3406 gene locus_tag LOCUS_19330 4119 3406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_19330 4568 4365 gene locus_tag LOCUS_19340 4568 4365 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_19340 4828 5535 gene locus_tag LOCUS_19350 4828 5535 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence090 971 2095 gene locus_tag LOCUS_19360 971 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2194 2685 gene locus_tag LOCUS_19370 2194 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4827 2776 gene locus_tag LOCUS_19380 4827 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5435 4941 gene locus_tag LOCUS_19390 5435 4941 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262519.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence091 <1 555 gene locus_tag LOCUS_19400 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405880.1:decarboxylating 6-phosphogluconate dehydrogenase 557 1237 gene locus_tag LOCUS_19410 557 1237 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877395.1 protein_id gnl|my_center|LOCUS_19410 1478 3007 gene locus_tag LOCUS_19420 1478 3007 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911847.1 protein_id gnl|my_center|LOCUS_19420 5279 3036 gene locus_tag LOCUS_19430 5279 3036 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence092 637 68 gene locus_tag LOCUS_19440 gene folE 637 68 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_19440 1240 647 gene locus_tag LOCUS_19450 gene hpt 1240 647 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_19450 2202 1240 gene locus_tag LOCUS_19460 2202 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3349 2177 gene locus_tag LOCUS_19470 3349 2177 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_19470 3731 3435 gene locus_tag LOCUS_19480 3731 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4317 3739 gene locus_tag LOCUS_19490 gene sigR 4317 3739 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_19490 5620 4403 gene locus_tag LOCUS_19500 5620 4403 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence093 <1 626 gene locus_tag LOCUS_19510 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188387.1:PBP1A family penicillin-binding protein 873 791 gene locus_tag LOCUS_t00320 873 791 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 852 1406 gene locus_tag LOCUS_19520 852 1406 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_19520 1779 1498 gene locus_tag LOCUS_19530 1779 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2686 1772 gene locus_tag LOCUS_19540 2686 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3931 2744 gene locus_tag LOCUS_19550 3931 2744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 protein_id gnl|my_center|LOCUS_19550 <5102 3915 gene locus_tag LOCUS_19560 <5102 3915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385517.1:iron ABC transporter permease >Feature sequence094 <1 506 gene locus_tag LOCUS_19570 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225236.1:CoA transferase subunit A 503 1324 gene locus_tag LOCUS_19580 503 1324 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_19580 1321 2712 gene locus_tag LOCUS_19590 1321 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2426 2435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4494 3334 gene locus_tag LOCUS_19600 4494 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence095 1322 2311 gene locus_tag LOCUS_19610 1322 2311 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_19610 2431 4692 gene locus_tag LOCUS_19620 2431 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence096 78 329 gene locus_tag LOCUS_19630 78 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 314 718 gene locus_tag LOCUS_19640 314 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1150 2349 gene locus_tag LOCUS_19650 1150 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2346 3023 gene locus_tag LOCUS_19660 2346 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3037 4203 gene locus_tag LOCUS_19670 3037 4203 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526210.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence097 <1 917 gene locus_tag LOCUS_19680 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225796.1:long-chain-fatty-acid--CoA ligase 1039 2514 gene locus_tag LOCUS_19690 1039 2514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_19690 4282 3461 gene locus_tag LOCUS_19700 4282 3461 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence098 60 1319 gene locus_tag LOCUS_19710 gene rsmH 60 1319 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411221.1 protein_id gnl|my_center|LOCUS_19710 1451 1801 gene locus_tag LOCUS_19720 1451 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1798 3636 gene locus_tag LOCUS_19730 gene ftsI 1798 3636 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence099 <1 646 gene locus_tag LOCUS_19740 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_191243275.1:zinc-binding dehydrogenase 1925 726 gene locus_tag LOCUS_19750 1925 726 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408054.1 protein_id gnl|my_center|LOCUS_19750 2442 1918 gene locus_tag LOCUS_19760 2442 1918 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804300.1 protein_id gnl|my_center|LOCUS_19760 3832 2570 gene locus_tag LOCUS_19770 3832 2570 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_19770 3991 4067 gene locus_tag LOCUS_t00330 3991 4067 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4195 4410 gene locus_tag LOCUS_19780 4195 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence100 360 887 gene locus_tag LOCUS_19790 360 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1478 960 gene locus_tag LOCUS_19800 1478 960 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_19800 1655 2587 gene locus_tag LOCUS_19810 gene cysK 1655 2587 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_19810 2590 3291 gene locus_tag LOCUS_19820 gene cysE 2590 3291 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411985.1 protein_id gnl|my_center|LOCUS_19820 4336 3317 gene locus_tag LOCUS_19830 4336 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence101 478 71 gene locus_tag LOCUS_19840 478 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 953 486 gene locus_tag LOCUS_19850 953 486 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_19850 1864 1253 gene locus_tag LOCUS_19860 1864 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2618 2004 gene locus_tag LOCUS_19870 2618 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3973 2615 gene locus_tag LOCUS_19880 3973 2615 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence102 662 588 gene locus_tag LOCUS_t00340 662 588 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3272 891 gene locus_tag LOCUS_19890 3272 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3656 3665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence103 1475 51 gene locus_tag LOCUS_19900 1475 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1640 1482 gene locus_tag LOCUS_19910 1640 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1978 2763 gene locus_tag LOCUS_19920 1978 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3033 3632 gene locus_tag LOCUS_19930 3033 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence104 1495 2625 gene locus_tag LOCUS_19940 1495 2625 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_19940 3387 2563 gene locus_tag LOCUS_19950 3387 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence105 <1 627 gene locus_tag LOCUS_19960 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546632.1:diaminopimelate epimerase 630 1907 gene locus_tag LOCUS_19970 gene hflX 630 1907 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_19970 1904 3055 gene locus_tag LOCUS_19980 1904 3055 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence106 48 1400 gene locus_tag LOCUS_19990 48 1400 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_19990 1601 1380 gene locus_tag LOCUS_20000 1601 1380 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_20000 2085 1681 gene locus_tag LOCUS_20010 2085 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2282 2791 gene locus_tag LOCUS_20020 gene thpR 2282 2791 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228104.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence107 2750 1170 gene locus_tag LOCUS_20030 2750 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3360 2755 gene locus_tag LOCUS_20040 3360 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence108 191 1564 gene locus_tag LOCUS_20050 gene gabT 191 1564 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223100.1 protein_id gnl|my_center|LOCUS_20050 1671 2594 gene locus_tag LOCUS_20060 1671 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence109 <1 841 gene locus_tag LOCUS_20070 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030715.1:GDP-mannose 4,6-dehydratase 834 1556 gene locus_tag LOCUS_20080 834 1556 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_20080 1556 2536 gene locus_tag LOCUS_20090 1556 2536 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907906.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence110 383 979 gene locus_tag LOCUS_20100 383 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1104 2138 gene locus_tag LOCUS_20110 gene tsaD 1104 2138 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082750.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence111 269 278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1054 2010 gene locus_tag LOCUS_20120 1054 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 <2686 2095 gene locus_tag LOCUS_20130 <2686 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056273.1:glycosyltransferase family 1 protein >Feature sequence112 2288 1119 gene locus_tag LOCUS_20140 2288 1119 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence113 <2326 174 gene locus_tag LOCUS_20150 <2326 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731328.1:glycogen debranching protein GlgX >Feature sequence114 1189 638 gene locus_tag LOCUS_20160 1189 638 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_20160 2042 1308 gene locus_tag LOCUS_20170 2042 1308 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence115 <1 1406 gene locus_tag LOCUS_20180 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908056.1:intein-containing recombinase RecA >Feature sequence116 500 102 gene locus_tag LOCUS_20190 500 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1016 510 gene locus_tag LOCUS_20200 1016 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1242 1616 gene locus_tag LOCUS_20210 1242 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence117 855 148 gene locus_tag LOCUS_20220 855 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1412 1185 gene locus_tag LOCUS_20230 1412 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence118 204 1013 gene locus_tag LOCUS_20240 gene folP 204 1013 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence119 881 300 gene locus_tag LOCUS_20250 881 300 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084186.1 protein_id gnl|my_center|LOCUS_20250 1207 1380 gene locus_tag LOCUS_20260 1207 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence120 >Feature sequence121 >Feature sequence122 1 324 gene locus_tag LOCUS_20270 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 804 813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence123 <1 868 gene locus_tag LOCUS_20280 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110557.1:DUF1446 domain-containing protein >Feature sequence124 137 418 gene locus_tag LOCUS_20290 137 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 434 >1063 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgcatgcgggggtgatcc >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128 >Feature sequence129 121 474 gene locus_tag LOCUS_20300 121 474 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_20300 471 740 gene locus_tag LOCUS_20310 471 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 684 693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence130 614 18 gene locus_tag LOCUS_20320 614 18 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence131 473 114 gene locus_tag LOCUS_20330 473 114 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence132 >Feature sequence133 >Feature sequence134 287 296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 369 443 gene locus_tag LOCUS_t00350 369 443 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 470 381 gene locus_tag LOCUS_t00360 470 381 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 553 708 gene locus_tag LOCUS_20340 553 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence136 >Feature sequence137 3 440 gene locus_tag LOCUS_20350 3 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence138 >Feature sequence139 2 844 gene locus_tag LOCUS_20360 2 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence140 >Feature sequence141 <1 642 gene locus_tag LOCUS_20370 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411690.1:FAD-binding oxidoreductase >Feature sequence142 >Feature sequence143 >Feature sequence144 >Feature sequence145 >Feature sequence146 439 448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 >Feature sequence148 105 395 gene locus_tag LOCUS_20380 105 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence149 >Feature sequence150 >Feature sequence151 647 219 gene locus_tag LOCUS_20390 647 219 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence152 >Feature sequence153 322 522 gene locus_tag LOCUS_20400 322 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20400 506 515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence154 115 190 gene locus_tag LOCUS_t00370 115 190 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 415 263 gene locus_tag LOCUS_20410 415 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 392 400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 703 536 gene locus_tag LOCUS_20420 703 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence155 245 757 gene locus_tag LOCUS_20430 245 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence156 479 488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 >Feature sequence158 >Feature sequence159 373 295 gene locus_tag LOCUS_t00380 373 295 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 727 557 gene locus_tag LOCUS_20440 727 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence161 266 275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence162 453 746 gene locus_tag LOCUS_20450 453 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence163 >Feature sequence164 401 410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence165 >Feature sequence166 184 579 gene locus_tag LOCUS_20460 184 579 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_20460 406 415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence167 >Feature sequence168 <1 584 gene locus_tag LOCUS_20470 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123435.1:iron ABC transporter permease >Feature sequence169 >Feature sequence170 2 331 gene locus_tag LOCUS_20480 2 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20480 299 308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence171 2 457 gene locus_tag LOCUS_20490 2 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence172 442 368 gene locus_tag LOCUS_t00390 442 368 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence173 >Feature sequence174 >Feature sequence175 >Feature sequence176 >Feature sequence177 >Feature sequence178 >Feature sequence179 >Feature sequence180 >Feature sequence181 >Feature sequence182 >Feature sequence183 73 507 gene locus_tag LOCUS_20500 73 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence184 267 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence185 >Feature sequence186 >Feature sequence187 >Feature sequence188 >Feature sequence189 >Feature sequence190 316 325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence191 <664 151 gene locus_tag LOCUS_20510 <664 151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228390.1:DNA repair protein RecO >Feature sequence192 193 594 gene locus_tag LOCUS_20520 193 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence193 >Feature sequence194 154 447 gene locus_tag LOCUS_20530 154 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence195 >Feature sequence196 585 106 gene locus_tag LOCUS_20540 gene ispF 585 106 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence197 >Feature sequence198 >Feature sequence199 >Feature sequence200 >Feature sequence201 >Feature sequence202 >Feature sequence203 >Feature sequence204 >Feature sequence205 1 585 gene locus_tag LOCUS_20550 1 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence206 >Feature sequence207 260 269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence208 >Feature sequence209 >Feature sequence210 >Feature sequence211 268 277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence212 >Feature sequence213 300 309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence214 >Feature sequence215 >Feature sequence216 >Feature sequence217 334 343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence218 >Feature sequence219 >Feature sequence220 >Feature sequence221 150 73 gene locus_tag LOCUS_t00400 150 73 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence222 >Feature sequence223 >Feature sequence224 >Feature sequence225 >Feature sequence226 310 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence227 >Feature sequence228 >Feature sequence229 >Feature sequence230 >Feature sequence231 >Feature sequence232 396 469 gene locus_tag LOCUS_t00410 396 469 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence233 >Feature sequence234 >Feature sequence235 428 352 gene locus_tag LOCUS_t00420 428 352 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 >Feature sequence237 >Feature sequence238 >Feature sequence239 >Feature sequence240 267 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence241 >Feature sequence242 >Feature sequence243 >Feature sequence244 >Feature sequence245 >Feature sequence246 >Feature sequence247 256 265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence248 266 108 gene locus_tag LOCUS_20560 266 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence249 >Feature sequence250 >Feature sequence251 >Feature sequence252 30 512 gene locus_tag LOCUS_20570 30 512 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230647.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence253 >Feature sequence254 >Feature sequence255 393 318 gene locus_tag LOCUS_t00430 393 318 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence256 >Feature sequence257 >Feature sequence258 >Feature sequence259 69 323 gene locus_tag LOCUS_20580 69 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 311 463 gene locus_tag LOCUS_20590 311 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence260 >Feature sequence261 >Feature sequence262 80 409 gene locus_tag LOCUS_20600 80 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence263 >Feature sequence264 175 372 gene locus_tag LOCUS_20610 175 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence265 444 55 gene locus_tag LOCUS_20620 444 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence266 >Feature sequence267 >Feature sequence268 >Feature sequence269 >Feature sequence270 >Feature sequence271 >Feature sequence272 >Feature sequence273 >Feature sequence274 >Feature sequence275 >Feature sequence276 >Feature sequence277 >Feature sequence278 >Feature sequence279 >Feature sequence280 >Feature sequence281 >Feature sequence282 >Feature sequence283 >Feature sequence284 3 254 gene locus_tag LOCUS_20630 3 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence285 >Feature sequence286 229 238 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends