>Feature sequence001 <1 666 gene locus_tag LOCUS_00010 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031610.1:NAD(P)-dependent alcohol dehydrogenase 918 1145 gene locus_tag LOCUS_00020 918 1145 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_00020 2851 1256 gene locus_tag LOCUS_00030 2851 1256 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_00030 3311 2853 gene locus_tag LOCUS_00040 3311 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3608 4129 gene locus_tag LOCUS_00050 3608 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5179 4241 gene locus_tag LOCUS_00060 5179 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5461 5721 gene locus_tag LOCUS_00070 5461 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6795 5788 gene locus_tag LOCUS_00080 6795 5788 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_00080 7241 6795 gene locus_tag LOCUS_00090 7241 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7593 7393 gene locus_tag LOCUS_00100 7593 7393 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_00100 7996 7574 gene locus_tag LOCUS_00110 7996 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9635 7935 gene locus_tag LOCUS_00120 9635 7935 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_00120 10759 9632 gene locus_tag LOCUS_00130 gene porB 10759 9632 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_00130 12028 10778 gene locus_tag LOCUS_00140 gene porA 12028 10778 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_00140 12713 12012 gene locus_tag LOCUS_00150 12713 12012 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_00150 12926 14752 gene locus_tag LOCUS_00160 gene ppsA 12926 14752 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00160 14816 15277 gene locus_tag LOCUS_00170 14816 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00170 17713 15362 gene locus_tag LOCUS_00180 17713 15362 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_00180 17851 20280 gene locus_tag LOCUS_00190 17851 20280 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_00190 21019 20195 gene locus_tag LOCUS_00200 21019 20195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_00200 22130 21012 gene locus_tag LOCUS_00210 22130 21012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_00210 23474 22239 gene locus_tag LOCUS_00220 23474 22239 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_00220 23697 25835 gene locus_tag LOCUS_00230 23697 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25832 26503 gene locus_tag LOCUS_00240 25832 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27708 26566 gene locus_tag LOCUS_00250 27708 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27780 28442 gene locus_tag LOCUS_00260 27780 28442 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_00260 28523 29572 gene locus_tag LOCUS_00270 28523 29572 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_00270 29640 33098 gene locus_tag LOCUS_00280 gene recC 29640 33098 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950425.1 protein_id gnl|my_center|LOCUS_00280 33095 36631 gene locus_tag LOCUS_00290 gene recB 33095 36631 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092099.1 protein_id gnl|my_center|LOCUS_00290 36628 38529 gene locus_tag LOCUS_00300 gene recD 36628 38529 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 protein_id gnl|my_center|LOCUS_00300 39049 38657 gene locus_tag LOCUS_00310 39049 38657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38970 40046 gene locus_tag LOCUS_00320 38970 40046 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_00320 40096 40977 gene locus_tag LOCUS_00330 40096 40977 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 protein_id gnl|my_center|LOCUS_00330 41052 42365 gene locus_tag LOCUS_00340 41052 42365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_00340 42563 44581 gene locus_tag LOCUS_00350 gene pcrA 42563 44581 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_00350 44667 45899 gene locus_tag LOCUS_00360 44667 45899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45961 47358 gene locus_tag LOCUS_00370 45961 47358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_00370 47493 48776 gene locus_tag LOCUS_00380 47493 48776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 48882 50840 gene locus_tag LOCUS_00390 48882 50840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50878 51708 gene locus_tag LOCUS_00400 50878 51708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_00400 51705 52451 gene locus_tag LOCUS_00410 51705 52451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889519.1 protein_id gnl|my_center|LOCUS_00410 55178 52497 gene locus_tag LOCUS_00420 gene valS 55178 52497 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_00420 55197 56597 gene locus_tag LOCUS_00430 gene cysS 55197 56597 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_00430 56747 56950 gene locus_tag LOCUS_00440 56747 56950 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_00440 57246 58460 gene locus_tag LOCUS_00450 57246 58460 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_00450 59004 59915 gene locus_tag LOCUS_00460 59004 59915 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_00460 61143 59992 gene locus_tag LOCUS_00470 61143 59992 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_00470 63082 61250 gene locus_tag LOCUS_00480 63082 61250 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_00480 66273 63079 gene locus_tag LOCUS_00490 66273 63079 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_00490 66539 67084 gene locus_tag LOCUS_00500 66539 67084 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059290.1 protein_id gnl|my_center|LOCUS_00500 67841 67122 gene locus_tag LOCUS_00510 67841 67122 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_00510 67970 68521 gene locus_tag LOCUS_00520 67970 68521 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 protein_id gnl|my_center|LOCUS_00520 69045 68551 gene locus_tag LOCUS_00530 69045 68551 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_00530 70031 69135 gene locus_tag LOCUS_00540 70031 69135 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803950.1 protein_id gnl|my_center|LOCUS_00540 70170 70751 gene locus_tag LOCUS_00550 gene sigK 70170 70751 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 protein_id gnl|my_center|LOCUS_00550 70748 71626 gene locus_tag LOCUS_00560 70748 71626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72368 71700 gene locus_tag LOCUS_00570 72368 71700 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_00570 73590 72394 gene locus_tag LOCUS_00580 73590 72394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73575 74432 gene locus_tag LOCUS_00590 73575 74432 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973077.1 protein_id gnl|my_center|LOCUS_00590 74498 75466 gene locus_tag LOCUS_00600 gene gmd 74498 75466 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_00600 75484 76365 gene locus_tag LOCUS_00610 75484 76365 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_00610 76538 77353 gene locus_tag LOCUS_00620 76538 77353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 77343 78014 gene locus_tag LOCUS_00630 77343 78014 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 protein_id gnl|my_center|LOCUS_00630 78011 79012 gene locus_tag LOCUS_00640 78011 79012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 79009 79158 gene locus_tag LOCUS_00650 79009 79158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 79155 79631 gene locus_tag LOCUS_00660 79155 79631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence002 2351 1983 gene locus_tag LOCUS_00670 2351 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4032 2965 gene locus_tag LOCUS_00680 4032 2965 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_00680 4289 4032 gene locus_tag LOCUS_00690 4289 4032 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_00690 5719 4334 gene locus_tag LOCUS_00700 5719 4334 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_00700 6676 5861 gene locus_tag LOCUS_00710 6676 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9231 6739 gene locus_tag LOCUS_00720 9231 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 9935 9234 gene locus_tag LOCUS_00730 9935 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 9823 10182 gene locus_tag LOCUS_00740 9823 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 10349 12592 gene locus_tag LOCUS_00750 gene ftsH 10349 12592 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_00750 14165 12705 gene locus_tag LOCUS_00760 14165 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 17539 14162 gene locus_tag LOCUS_00770 17539 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 17702 18100 gene locus_tag LOCUS_00780 17702 18100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 19242 18325 gene locus_tag LOCUS_00790 19242 18325 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_00790 20464 19244 gene locus_tag LOCUS_00800 20464 19244 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_00800 21599 20457 gene locus_tag LOCUS_00810 21599 20457 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_00810 22807 21605 gene locus_tag LOCUS_00820 22807 21605 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_00820 23006 23944 gene locus_tag LOCUS_00830 gene cofD 23006 23944 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_00830 23941 24678 gene locus_tag LOCUS_00840 gene cofE 23941 24678 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_00840 25669 24701 gene locus_tag LOCUS_00850 gene galE1 25669 24701 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_00850 26764 25673 gene locus_tag LOCUS_00860 26764 25673 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_00860 27567 26761 gene locus_tag LOCUS_00870 27567 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 28506 27589 gene locus_tag LOCUS_00880 gene wbbL 28506 27589 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901582.1 protein_id gnl|my_center|LOCUS_00880 29279 28503 gene locus_tag LOCUS_00890 29279 28503 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_00890 30246 29272 gene locus_tag LOCUS_00900 30246 29272 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_00900 31904 30243 gene locus_tag LOCUS_00910 31904 30243 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_00910 32859 31921 gene locus_tag LOCUS_00920 gene rfbD 32859 31921 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_00920 33881 32856 gene locus_tag LOCUS_00930 gene rfbB 33881 32856 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_00930 34762 33995 gene locus_tag LOCUS_00940 34762 33995 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_00940 34882 36651 gene locus_tag LOCUS_00950 34882 36651 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_00950 36665 37864 gene locus_tag LOCUS_00960 36665 37864 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088379.1 protein_id gnl|my_center|LOCUS_00960 37938 38483 gene locus_tag LOCUS_00970 37938 38483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 38480 39742 gene locus_tag LOCUS_00980 38480 39742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_00980 39781 41295 gene locus_tag LOCUS_00990 39781 41295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 protein_id gnl|my_center|LOCUS_00990 42937 41342 gene locus_tag LOCUS_01000 42937 41342 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_01000 44042 42981 gene locus_tag LOCUS_01010 44042 42981 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_01010 45288 44104 gene locus_tag LOCUS_01020 gene moeB 45288 44104 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_01020 46273 45440 gene locus_tag LOCUS_01030 46273 45440 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_01030 47798 46314 gene locus_tag LOCUS_01040 47798 46314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_01040 48013 48831 gene locus_tag LOCUS_01050 48013 48831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 48822 49424 gene locus_tag LOCUS_01060 48822 49424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 50627 49482 gene locus_tag LOCUS_01070 50627 49482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 51251 50760 gene locus_tag LOCUS_01080 51251 50760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 51679 51248 gene locus_tag LOCUS_01090 51679 51248 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_01090 51986 52954 gene locus_tag LOCUS_01100 51986 52954 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_01100 53507 53094 gene locus_tag LOCUS_01110 53507 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 53566 55110 gene locus_tag LOCUS_01120 53566 55110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 55107 57653 gene locus_tag LOCUS_01130 55107 57653 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_01130 57673 57972 gene locus_tag LOCUS_01140 57673 57972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945981.1 protein_id gnl|my_center|LOCUS_01140 57969 58886 gene locus_tag LOCUS_01150 gene fabI 57969 58886 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_01150 58985 59764 gene locus_tag LOCUS_01160 58985 59764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 59761 60615 gene locus_tag LOCUS_01170 59761 60615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_01170 60986 61690 gene locus_tag LOCUS_01180 60986 61690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 61701 62672 gene locus_tag LOCUS_01190 61701 62672 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_01190 63520 62669 gene locus_tag LOCUS_01200 63520 62669 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_01200 63734 65659 gene locus_tag LOCUS_01210 63734 65659 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965832.1 protein_id gnl|my_center|LOCUS_01210 66744 65701 gene locus_tag LOCUS_01220 66744 65701 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388189.1 protein_id gnl|my_center|LOCUS_01220 67789 67103 gene locus_tag LOCUS_01230 67789 67103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_01230 70467 67786 gene locus_tag LOCUS_01240 70467 67786 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_01240 70716 71090 gene locus_tag LOCUS_01250 70716 71090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 71087 71401 gene locus_tag LOCUS_01260 71087 71401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 >Feature sequence003 1070 225 gene locus_tag LOCUS_01270 1070 225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 protein_id gnl|my_center|LOCUS_01270 2361 1063 gene locus_tag LOCUS_01280 gene ychF 2361 1063 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059441.1 protein_id gnl|my_center|LOCUS_01280 2666 2256 gene locus_tag LOCUS_01290 2666 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 3958 2663 gene locus_tag LOCUS_01300 3958 2663 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496803.1 protein_id gnl|my_center|LOCUS_01300 5646 3955 gene locus_tag LOCUS_01310 5646 3955 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141556.1 protein_id gnl|my_center|LOCUS_01310 6392 5709 gene locus_tag LOCUS_01320 6392 5709 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084994.1 protein_id gnl|my_center|LOCUS_01320 6689 7657 gene locus_tag LOCUS_01330 gene cysD 6689 7657 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060060.1 protein_id gnl|my_center|LOCUS_01330 7660 8970 gene locus_tag LOCUS_01340 7660 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 8979 9746 gene locus_tag LOCUS_01350 8979 9746 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_01350 10663 9710 gene locus_tag LOCUS_01360 10663 9710 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_01360 11238 10660 gene locus_tag LOCUS_01370 11238 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11538 12563 gene locus_tag LOCUS_01380 gene galT 11538 12563 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_01380 13946 12642 gene locus_tag LOCUS_01390 13946 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 15811 13943 gene locus_tag LOCUS_01400 gene treS 15811 13943 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_01400 16882 15863 gene locus_tag LOCUS_01410 gene meaB 16882 15863 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_01410 18305 16977 gene locus_tag LOCUS_01420 gene murA 18305 16977 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_01420 18403 19398 gene locus_tag LOCUS_01430 gene glpX 18403 19398 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_01430 19996 19475 gene locus_tag LOCUS_01440 19996 19475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 20941 20033 gene locus_tag LOCUS_01450 20941 20033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01450 21484 20942 gene locus_tag LOCUS_01460 21484 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01460 22570 21617 gene locus_tag LOCUS_01470 22570 21617 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_01470 24097 22574 gene locus_tag LOCUS_01480 gene atpA 24097 22574 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356555.1 protein_id gnl|my_center|LOCUS_01480 25068 24097 gene locus_tag LOCUS_01490 25068 24097 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_01490 25613 25065 gene locus_tag LOCUS_01500 25613 25065 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059844.1 protein_id gnl|my_center|LOCUS_01500 25994 25728 gene locus_tag LOCUS_01510 25994 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 26856 26071 gene locus_tag LOCUS_01520 gene atpB 26856 26071 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406681.1 protein_id gnl|my_center|LOCUS_01520 27336 26860 gene locus_tag LOCUS_01530 27336 26860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 27710 27408 gene locus_tag LOCUS_01540 27710 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 29196 27859 gene locus_tag LOCUS_01550 29196 27859 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_01550 30540 29233 gene locus_tag LOCUS_01560 30540 29233 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_01560 31127 30537 gene locus_tag LOCUS_01570 31127 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 31187 32752 gene locus_tag LOCUS_01580 31187 32752 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_01580 32889 33878 gene locus_tag LOCUS_01590 32889 33878 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_01590 33884 34762 gene locus_tag LOCUS_01600 33884 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 35970 34843 gene locus_tag LOCUS_01610 35970 34843 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_01610 36103 36591 gene locus_tag LOCUS_01620 gene greA 36103 36591 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_01620 36588 38012 gene locus_tag LOCUS_01630 gene leuC 36588 38012 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_01630 38009 38602 gene locus_tag LOCUS_01640 gene leuD 38009 38602 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_01640 39111 39677 gene locus_tag LOCUS_01650 39111 39677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 39763 40425 gene locus_tag LOCUS_01660 39763 40425 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869465.1 protein_id gnl|my_center|LOCUS_01660 40422 41810 gene locus_tag LOCUS_01670 40422 41810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 43744 42179 gene locus_tag LOCUS_01680 gene serA 43744 42179 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_01680 45141 43867 gene locus_tag LOCUS_01690 45141 43867 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_01690 45083 46243 gene locus_tag LOCUS_01700 gene serC 45083 46243 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_01700 46472 47926 gene locus_tag LOCUS_01710 46472 47926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 48051 48863 gene locus_tag LOCUS_01720 48051 48863 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_01720 50008 48845 gene locus_tag LOCUS_01730 50008 48845 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_01730 51324 50299 gene locus_tag LOCUS_01740 gene ilvC 51324 50299 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_01740 51934 51329 gene locus_tag LOCUS_01750 gene ilvN 51934 51329 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_01750 53718 51934 gene locus_tag LOCUS_01760 53718 51934 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_01760 53811 54149 gene locus_tag LOCUS_01770 53811 54149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 55798 54074 gene locus_tag LOCUS_01780 gene ilvD 55798 54074 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_01780 56437 56539 gene locus_tag LOCUS_t00010 56437 56539 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 1404 457 gene locus_tag LOCUS_01790 1404 457 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_01790 2572 1406 gene locus_tag LOCUS_01800 2572 1406 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_01800 3780 2734 gene locus_tag LOCUS_01810 3780 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3779 4444 gene locus_tag LOCUS_01820 3779 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5743 4520 gene locus_tag LOCUS_01830 5743 4520 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_01830 6447 5794 gene locus_tag LOCUS_01840 6447 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8128 6527 gene locus_tag LOCUS_01850 8128 6527 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_01850 9508 8231 gene locus_tag LOCUS_01860 9508 8231 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_01860 9961 11430 gene locus_tag LOCUS_01870 9961 11430 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_01870 11424 12215 gene locus_tag LOCUS_01880 11424 12215 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_01880 12212 13315 gene locus_tag LOCUS_01890 12212 13315 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_01890 14088 14849 gene locus_tag LOCUS_01900 14088 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15682 14948 gene locus_tag LOCUS_01910 15682 14948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_01910 16266 15679 gene locus_tag LOCUS_01920 16266 15679 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_01920 19022 16419 gene locus_tag LOCUS_01930 19022 16419 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_01930 19006 20130 gene locus_tag LOCUS_01940 19006 20130 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_01940 20484 20834 gene locus_tag LOCUS_01950 20484 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 22784 21933 gene locus_tag LOCUS_01960 22784 21933 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_01960 23094 22804 gene locus_tag LOCUS_01970 23094 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 24276 23674 gene locus_tag LOCUS_01980 24276 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 24303 25184 gene locus_tag LOCUS_01990 24303 25184 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_01990 25459 25295 gene locus_tag LOCUS_02000 25459 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 25486 25806 gene locus_tag LOCUS_02010 25486 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 25803 26831 gene locus_tag LOCUS_02020 gene rsmI 25803 26831 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_02020 26897 27448 gene locus_tag LOCUS_02030 gene msrA 26897 27448 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_02030 27513 29021 gene locus_tag LOCUS_02040 gene metG 27513 29021 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_02040 29132 30025 gene locus_tag LOCUS_02050 29132 30025 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_02050 30488 30784 gene locus_tag LOCUS_02060 30488 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 30807 31748 gene locus_tag LOCUS_02070 gene rsmA 30807 31748 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 protein_id gnl|my_center|LOCUS_02070 31745 32731 gene locus_tag LOCUS_02080 31745 32731 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_02080 34279 32906 gene locus_tag LOCUS_02090 34279 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 35502 34828 gene locus_tag LOCUS_02100 gene mprA 35502 34828 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_02100 35642 35715 gene locus_tag LOCUS_t00020 35642 35715 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37656 35731 gene locus_tag LOCUS_02110 gene typA 37656 35731 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_02110 39617 37629 gene locus_tag LOCUS_02120 39617 37629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 40518 39751 gene locus_tag LOCUS_02130 40518 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 43259 40662 gene locus_tag LOCUS_02140 43259 40662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 44676 43504 gene locus_tag LOCUS_02150 44676 43504 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086601.1 protein_id gnl|my_center|LOCUS_02150 46547 44730 gene locus_tag LOCUS_02160 46547 44730 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_02160 48898 46544 gene locus_tag LOCUS_02170 48898 46544 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082909.1 protein_id gnl|my_center|LOCUS_02170 50559 48961 gene locus_tag LOCUS_02180 50559 48961 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110566.1 protein_id gnl|my_center|LOCUS_02180 50775 51797 gene locus_tag LOCUS_02190 50775 51797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 52106 53077 gene locus_tag LOCUS_02200 52106 53077 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804951.1 protein_id gnl|my_center|LOCUS_02200 54673 53267 gene locus_tag LOCUS_02210 54673 53267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence005 304 1005 gene locus_tag LOCUS_02220 304 1005 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_02220 1017 3857 gene locus_tag LOCUS_02230 gene polA 1017 3857 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111138.1 protein_id gnl|my_center|LOCUS_02230 4036 5451 gene locus_tag LOCUS_02240 gene rpsA 4036 5451 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408066.1 protein_id gnl|my_center|LOCUS_02240 6627 5599 gene locus_tag LOCUS_02250 6627 5599 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_02250 7814 6624 gene locus_tag LOCUS_02260 7814 6624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_02260 8728 7811 gene locus_tag LOCUS_02270 8728 7811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537951.1 protein_id gnl|my_center|LOCUS_02270 9688 8744 gene locus_tag LOCUS_02280 9688 8744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813354.1 protein_id gnl|my_center|LOCUS_02280 11395 9707 gene locus_tag LOCUS_02290 gene gsiB 11395 9707 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065128.1 protein_id gnl|my_center|LOCUS_02290 11741 13354 gene locus_tag LOCUS_02300 11741 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 13390 14604 gene locus_tag LOCUS_02310 13390 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 13536 13615 gene locus_tag LOCUS_t00030 13536 13615 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14794 16374 gene locus_tag LOCUS_02320 14794 16374 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_02320 16349 17884 gene locus_tag LOCUS_02330 16349 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 18010 19224 gene locus_tag LOCUS_02340 18010 19224 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_02340 19324 21375 gene locus_tag LOCUS_02350 gene fusA 19324 21375 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_02350 25973 21372 gene locus_tag LOCUS_02360 25973 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 26149 26982 gene locus_tag LOCUS_02370 26149 26982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 27009 27644 gene locus_tag LOCUS_02380 gene coaE 27009 27644 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_02380 28665 27616 gene locus_tag LOCUS_02390 28665 27616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 28822 30993 gene locus_tag LOCUS_02400 gene uvrB 28822 30993 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_02400 31052 34174 gene locus_tag LOCUS_02410 gene uvrA 31052 34174 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_02410 36488 34101 gene locus_tag LOCUS_02420 36488 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 37588 36485 gene locus_tag LOCUS_02430 37588 36485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 38600 37590 gene locus_tag LOCUS_02440 38600 37590 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_02440 38752 40725 gene locus_tag LOCUS_02450 38752 40725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 41923 40802 gene locus_tag LOCUS_02460 gene nadA 41923 40802 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_02460 42170 44164 gene locus_tag LOCUS_02470 gene uvrC 42170 44164 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407347.1 protein_id gnl|my_center|LOCUS_02470 44161 45012 gene locus_tag LOCUS_02480 gene rapZ 44161 45012 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_02480 45009 45923 gene locus_tag LOCUS_02490 gene yvcK 45009 45923 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_02490 46081 47103 gene locus_tag LOCUS_02500 gene gap 46081 47103 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_02500 47141 48325 gene locus_tag LOCUS_02510 47141 48325 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_02510 48363 49148 gene locus_tag LOCUS_02520 gene tpiA 48363 49148 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_02520 49145 49429 gene locus_tag LOCUS_02530 49145 49429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 49426 51261 gene locus_tag LOCUS_02540 49426 51261 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519688.1 protein_id gnl|my_center|LOCUS_02540 51276 51360 gene locus_tag LOCUS_t00040 51276 51360 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51333 51692 gene locus_tag LOCUS_02550 51333 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 51693 52241 gene locus_tag LOCUS_02560 51693 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence006 <1 638 gene locus_tag LOCUS_02570 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940897.1:cytochrome c oxidase subunit II 635 2401 gene locus_tag LOCUS_02580 gene ctaD 635 2401 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 protein_id gnl|my_center|LOCUS_02580 2398 2790 gene locus_tag LOCUS_02590 2398 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 2947 7542 gene locus_tag LOCUS_02600 2947 7542 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202536.1 protein_id gnl|my_center|LOCUS_02600 8968 7484 gene locus_tag LOCUS_02610 8968 7484 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_02610 9906 8965 gene locus_tag LOCUS_02620 9906 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 10628 9903 gene locus_tag LOCUS_02630 10628 9903 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_02630 10561 10869 gene locus_tag LOCUS_02640 10561 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 11411 10806 gene locus_tag LOCUS_02650 11411 10806 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_02650 13896 11599 gene locus_tag LOCUS_02660 13896 11599 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_02660 14034 15203 gene locus_tag LOCUS_02670 gene hemE 14034 15203 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_02670 15200 16186 gene locus_tag LOCUS_02680 gene hemH 15200 16186 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_02680 16183 17706 gene locus_tag LOCUS_02690 gene hemG 16183 17706 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_02690 17703 19499 gene locus_tag LOCUS_02700 gene lnt 17703 19499 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805197.1 protein_id gnl|my_center|LOCUS_02700 19800 19492 gene locus_tag LOCUS_02710 19800 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20398 19865 gene locus_tag LOCUS_02720 20398 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 20747 24022 gene locus_tag LOCUS_02730 20747 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 24875 24108 gene locus_tag LOCUS_02740 24875 24108 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978333.1 protein_id gnl|my_center|LOCUS_02740 25263 24883 gene locus_tag LOCUS_02750 25263 24883 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_02750 25447 26829 gene locus_tag LOCUS_02760 25447 26829 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_02760 26915 27514 gene locus_tag LOCUS_02770 26915 27514 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_02770 29557 27797 gene locus_tag LOCUS_02780 29557 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 29681 30385 gene locus_tag LOCUS_02790 29681 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 30517 30837 gene locus_tag LOCUS_02800 30517 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02800 31399 31043 gene locus_tag LOCUS_02810 31399 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 33223 31559 gene locus_tag LOCUS_02820 33223 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 34863 33220 gene locus_tag LOCUS_02830 34863 33220 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_02830 36851 34959 gene locus_tag LOCUS_02840 gene nuoL 36851 34959 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110664.1 protein_id gnl|my_center|LOCUS_02840 37164 36859 gene locus_tag LOCUS_02850 gene nuoK 37164 36859 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_02850 37898 37161 gene locus_tag LOCUS_02860 37898 37161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 38821 37898 gene locus_tag LOCUS_02870 38821 37898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 40110 38821 gene locus_tag LOCUS_02880 gene nuoH 40110 38821 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114281.1 protein_id gnl|my_center|LOCUS_02880 42899 40107 gene locus_tag LOCUS_02890 42899 40107 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_02890 44196 42892 gene locus_tag LOCUS_02900 gene nuoF 44196 42892 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_02900 44843 44196 gene locus_tag LOCUS_02910 44843 44196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 <45977 44840 gene locus_tag LOCUS_02920 <45977 44840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222455.1:NADH-quinone oxidoreductase subunit D >Feature sequence007 690 2324 gene locus_tag LOCUS_02930 690 2324 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_02930 2389 2886 gene locus_tag LOCUS_02940 2389 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3312 2941 gene locus_tag LOCUS_02950 3312 2941 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_02950 3946 3587 gene locus_tag LOCUS_02960 3946 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4086 5144 gene locus_tag LOCUS_02970 4086 5144 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 protein_id gnl|my_center|LOCUS_02970 5266 6156 gene locus_tag LOCUS_02980 5266 6156 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_02980 6259 6897 gene locus_tag LOCUS_02990 6259 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10393 6962 gene locus_tag LOCUS_03000 10393 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 10754 11890 gene locus_tag LOCUS_03010 10754 11890 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_03010 13446 11860 gene locus_tag LOCUS_03020 13446 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14779 13610 gene locus_tag LOCUS_03030 14779 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 15181 16551 gene locus_tag LOCUS_03040 15181 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 16548 17612 gene locus_tag LOCUS_03050 16548 17612 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_03050 17644 19890 gene locus_tag LOCUS_03060 17644 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 20828 19851 gene locus_tag LOCUS_03070 20828 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 20982 22544 gene locus_tag LOCUS_03080 20982 22544 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_03080 22573 23406 gene locus_tag LOCUS_03090 22573 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 24745 23429 gene locus_tag LOCUS_03100 24745 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 25020 27200 gene locus_tag LOCUS_03110 25020 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 28493 27276 gene locus_tag LOCUS_03120 28493 27276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 30829 28475 gene locus_tag LOCUS_03130 30829 28475 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_03130 31205 31897 gene locus_tag LOCUS_03140 31205 31897 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_03140 31894 32271 gene locus_tag LOCUS_03150 31894 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 32851 32192 gene locus_tag LOCUS_03160 32851 32192 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_03160 33114 35930 gene locus_tag LOCUS_03170 33114 35930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 36168 38360 gene locus_tag LOCUS_03180 36168 38360 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030047.1 protein_id gnl|my_center|LOCUS_03180 38344 39174 gene locus_tag LOCUS_03190 38344 39174 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894024.1 protein_id gnl|my_center|LOCUS_03190 39261 40496 gene locus_tag LOCUS_03200 39261 40496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 41081 40554 gene locus_tag LOCUS_03210 41081 40554 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225705.1 protein_id gnl|my_center|LOCUS_03210 41914 41168 gene locus_tag LOCUS_03220 41914 41168 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_03220 42127 42693 gene locus_tag LOCUS_03230 42127 42693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 44533 42710 gene locus_tag LOCUS_03240 gene oatA 44533 42710 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence008 <1 879 gene locus_tag LOCUS_03250 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089497.1:bifunctional transaldolase/phosoglucose isomerase 920 1606 gene locus_tag LOCUS_03260 gene pgl 920 1606 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_03260 1662 4010 gene locus_tag LOCUS_03270 1662 4010 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 protein_id gnl|my_center|LOCUS_03270 4012 5106 gene locus_tag LOCUS_03280 4012 5106 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_03280 5299 5075 gene locus_tag LOCUS_03290 5299 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 6933 5296 gene locus_tag LOCUS_03300 6933 5296 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_03300 7267 8190 gene locus_tag LOCUS_03310 7267 8190 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_03310 10162 8258 gene locus_tag LOCUS_03320 10162 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 11751 10249 gene locus_tag LOCUS_03330 11751 10249 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_03330 16330 11744 gene locus_tag LOCUS_03340 gene gltB 16330 11744 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 protein_id gnl|my_center|LOCUS_03340 16569 17699 gene locus_tag LOCUS_03350 gene thiO 16569 17699 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_03350 17696 17944 gene locus_tag LOCUS_03360 gene thiS 17696 17944 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_03360 17941 18783 gene locus_tag LOCUS_03370 17941 18783 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265951.1 protein_id gnl|my_center|LOCUS_03370 18780 19721 gene locus_tag LOCUS_03380 gene thiD 18780 19721 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_03380 20059 20484 gene locus_tag LOCUS_03390 20059 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 21823 20468 gene locus_tag LOCUS_03400 21823 20468 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196385.1 protein_id gnl|my_center|LOCUS_03400 21967 22635 gene locus_tag LOCUS_03410 21967 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 23978 22542 gene locus_tag LOCUS_03420 23978 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 26079 23983 gene locus_tag LOCUS_03430 26079 23983 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_03430 26100 27116 gene locus_tag LOCUS_03440 26100 27116 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_03440 27605 27174 gene locus_tag LOCUS_03450 27605 27174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 28351 27830 gene locus_tag LOCUS_03460 28351 27830 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_03460 29762 28422 gene locus_tag LOCUS_03470 29762 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 30363 29794 gene locus_tag LOCUS_03480 30363 29794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 30748 30368 gene locus_tag LOCUS_03490 gene gcvH 30748 30368 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_03490 33312 30826 gene locus_tag LOCUS_03500 33312 30826 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_03500 34061 33309 gene locus_tag LOCUS_03510 34061 33309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 34153 35463 gene locus_tag LOCUS_03520 34153 35463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 protein_id gnl|my_center|LOCUS_03520 36069 35545 gene locus_tag LOCUS_03530 36069 35545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 37200 36166 gene locus_tag LOCUS_03540 37200 36166 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_03540 39146 37197 gene locus_tag LOCUS_03550 39146 37197 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_03550 40580 39531 gene locus_tag LOCUS_03560 40580 39531 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_03560 41320 40592 gene locus_tag LOCUS_03570 41320 40592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence009 25 1575 gene locus_tag LOCUS_03580 gene xseA 25 1575 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064088.1 protein_id gnl|my_center|LOCUS_03580 1575 1937 gene locus_tag LOCUS_03590 1575 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1972 2430 gene locus_tag LOCUS_03600 1972 2430 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_03600 4013 2427 gene locus_tag LOCUS_03610 4013 2427 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_03610 4079 4786 gene locus_tag LOCUS_03620 4079 4786 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_03620 4783 6120 gene locus_tag LOCUS_03630 4783 6120 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_03630 8179 6050 gene locus_tag LOCUS_03640 8179 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9099 8176 gene locus_tag LOCUS_03650 9099 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 10186 9149 gene locus_tag LOCUS_03660 10186 9149 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_03660 11778 10309 gene locus_tag LOCUS_03670 gene glpK 11778 10309 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_03670 13348 11816 gene locus_tag LOCUS_03680 13348 11816 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_03680 15225 13345 gene locus_tag LOCUS_03690 15225 13345 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878744.1 protein_id gnl|my_center|LOCUS_03690 15453 18296 gene locus_tag LOCUS_03700 15453 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 18496 18987 gene locus_tag LOCUS_03710 18496 18987 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_03710 19130 19549 gene locus_tag LOCUS_03720 19130 19549 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_03720 19689 21014 gene locus_tag LOCUS_03730 19689 21014 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_03730 21011 21652 gene locus_tag LOCUS_03740 21011 21652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 21811 22233 gene locus_tag LOCUS_03750 21811 22233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 22230 22502 gene locus_tag LOCUS_03760 22230 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 22952 22473 gene locus_tag LOCUS_03770 gene msrB 22952 22473 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_03770 23259 23618 gene locus_tag LOCUS_03780 gene trxA 23259 23618 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_03780 23728 24096 gene locus_tag LOCUS_03790 23728 24096 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_03790 24268 25476 gene locus_tag LOCUS_03800 24268 25476 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_03800 25476 26294 gene locus_tag LOCUS_03810 25476 26294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_03810 26370 28100 gene locus_tag LOCUS_03820 26370 28100 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_03820 28184 29290 gene locus_tag LOCUS_03830 28184 29290 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_03830 29349 29906 gene locus_tag LOCUS_03840 29349 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 30049 31752 gene locus_tag LOCUS_03850 30049 31752 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 protein_id gnl|my_center|LOCUS_03850 31755 32591 gene locus_tag LOCUS_03860 31755 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 32588 34273 gene locus_tag LOCUS_03870 32588 34273 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_03870 36160 34292 gene locus_tag LOCUS_03880 36160 34292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_03880 36445 36993 gene locus_tag LOCUS_03890 36445 36993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 37404 37012 gene locus_tag LOCUS_03900 37404 37012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 37582 38229 gene locus_tag LOCUS_03910 37582 38229 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227863.1 protein_id gnl|my_center|LOCUS_03910 39526 38318 gene locus_tag LOCUS_03920 39526 38318 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_03920 39985 40698 gene locus_tag LOCUS_03930 39985 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence010 2321 1422 gene locus_tag LOCUS_03940 2321 1422 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 protein_id gnl|my_center|LOCUS_03940 3008 2460 gene locus_tag LOCUS_03950 3008 2460 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_03950 2907 3635 gene locus_tag LOCUS_03960 2907 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4788 3712 gene locus_tag LOCUS_03970 4788 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5386 4826 gene locus_tag LOCUS_03980 5386 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5754 8528 gene locus_tag LOCUS_03990 5754 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9822 8509 gene locus_tag LOCUS_04000 9822 8509 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_04000 9937 10602 gene locus_tag LOCUS_04010 9937 10602 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228072.1 protein_id gnl|my_center|LOCUS_04010 11254 10631 gene locus_tag LOCUS_04020 11254 10631 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081822.1 protein_id gnl|my_center|LOCUS_04020 11873 11262 gene locus_tag LOCUS_04030 11873 11262 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892027.1 protein_id gnl|my_center|LOCUS_04030 12145 11870 gene locus_tag LOCUS_04040 12145 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 12131 12204 gene locus_tag LOCUS_t00050 12131 12204 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12848 12264 gene locus_tag LOCUS_04050 12848 12264 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223328.1 protein_id gnl|my_center|LOCUS_04050 12955 13899 gene locus_tag LOCUS_04060 12955 13899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_04060 14070 14408 gene locus_tag LOCUS_04070 14070 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 14509 14880 gene locus_tag LOCUS_04080 14509 14880 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_04080 14967 16451 gene locus_tag LOCUS_04090 14967 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16530 17300 gene locus_tag LOCUS_04100 16530 17300 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_04100 17507 17337 gene locus_tag LOCUS_04110 17507 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 17818 17576 gene locus_tag LOCUS_04120 17818 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 18603 17971 gene locus_tag LOCUS_04130 18603 17971 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_04130 18741 19637 gene locus_tag LOCUS_04140 18741 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 19647 20474 gene locus_tag LOCUS_04150 19647 20474 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04150 20471 21076 gene locus_tag LOCUS_04160 20471 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 21141 21749 gene locus_tag LOCUS_04170 21141 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 22713 21808 gene locus_tag LOCUS_04180 22713 21808 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_04180 23738 22782 gene locus_tag LOCUS_04190 23738 22782 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776825.1 protein_id gnl|my_center|LOCUS_04190 24709 23735 gene locus_tag LOCUS_04200 24709 23735 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_04200 24761 25135 gene locus_tag LOCUS_04210 24761 25135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 25194 26027 gene locus_tag LOCUS_04220 gene chbG 25194 26027 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593465.1 protein_id gnl|my_center|LOCUS_04220 26024 26740 gene locus_tag LOCUS_04230 26024 26740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 27649 26723 gene locus_tag LOCUS_04240 gene mca 27649 26723 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_04240 27721 28524 gene locus_tag LOCUS_04250 27721 28524 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_04250 28521 29477 gene locus_tag LOCUS_04260 gene htpX 28521 29477 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_04260 29477 30094 gene locus_tag LOCUS_04270 29477 30094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_04270 30454 30146 gene locus_tag LOCUS_04280 30454 30146 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_04280 31686 30451 gene locus_tag LOCUS_04290 gene cyp142 31686 30451 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_04290 33268 31877 gene locus_tag LOCUS_04300 gene fumC 33268 31877 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948622.1 protein_id gnl|my_center|LOCUS_04300 33806 33324 gene locus_tag LOCUS_04310 gene perR 33806 33324 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_04310 34724 33816 gene locus_tag LOCUS_04320 34724 33816 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_04320 35629 34721 gene locus_tag LOCUS_04330 35629 34721 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_04330 36509 35637 gene locus_tag LOCUS_04340 36509 35637 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_04340 37411 36506 gene locus_tag LOCUS_04350 37411 36506 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_04350 38689 37790 gene locus_tag LOCUS_04360 gene nfo 38689 37790 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_04360 38887 39288 gene locus_tag LOCUS_04370 38887 39288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 40340 39357 gene locus_tag LOCUS_04380 40340 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence011 696 1625 gene locus_tag LOCUS_04390 gene dapA 696 1625 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_04390 1618 3309 gene locus_tag LOCUS_04400 1618 3309 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_04400 3817 3602 gene locus_tag LOCUS_04410 3817 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3999 4433 gene locus_tag LOCUS_04420 3999 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5067 7457 gene locus_tag LOCUS_04430 5067 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 7547 8878 gene locus_tag LOCUS_04440 7547 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8851 9891 gene locus_tag LOCUS_04450 gene thrB 8851 9891 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_04450 9895 10245 gene locus_tag LOCUS_04460 9895 10245 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_04460 10320 11786 gene locus_tag LOCUS_04470 gene miaB 10320 11786 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414001.1 protein_id gnl|my_center|LOCUS_04470 11860 12831 gene locus_tag LOCUS_04480 gene miaA 11860 12831 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_04480 12865 13698 gene locus_tag LOCUS_04490 gene dapF 12865 13698 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 protein_id gnl|my_center|LOCUS_04490 13688 14998 gene locus_tag LOCUS_04500 gene hflX 13688 14998 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_04500 14995 16230 gene locus_tag LOCUS_04510 14995 16230 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_04510 16241 17068 gene locus_tag LOCUS_04520 16241 17068 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_04520 17065 18165 gene locus_tag LOCUS_04530 gene dapE 17065 18165 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 protein_id gnl|my_center|LOCUS_04530 18345 19103 gene locus_tag LOCUS_04540 18345 19103 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_04540 19100 19504 gene locus_tag LOCUS_04550 19100 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19501 20304 gene locus_tag LOCUS_04560 19501 20304 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_04560 20309 21256 gene locus_tag LOCUS_04570 20309 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21253 22146 gene locus_tag LOCUS_04580 21253 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 22782 22162 gene locus_tag LOCUS_04590 gene lexA 22782 22162 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_04590 22942 23511 gene locus_tag LOCUS_04600 22942 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 23597 24088 gene locus_tag LOCUS_04610 gene nrdR 23597 24088 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203682.1 protein_id gnl|my_center|LOCUS_04610 24137 24847 gene locus_tag LOCUS_04620 24137 24847 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_04620 24861 26243 gene locus_tag LOCUS_04630 gene dinB 24861 26243 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_04630 26383 26757 gene locus_tag LOCUS_04640 26383 26757 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729665.1 protein_id gnl|my_center|LOCUS_04640 26732 27685 gene locus_tag LOCUS_04650 26732 27685 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_04650 27682 28029 gene locus_tag LOCUS_04660 27682 28029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 28026 28634 gene locus_tag LOCUS_04670 28026 28634 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_04670 28759 29436 gene locus_tag LOCUS_04680 28759 29436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 29748 30167 gene locus_tag LOCUS_04690 gene mraZ 29748 30167 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_04690 30302 31474 gene locus_tag LOCUS_04700 gene rsmH 30302 31474 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 protein_id gnl|my_center|LOCUS_04700 31471 31965 gene locus_tag LOCUS_04710 31471 31965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 31980 33863 gene locus_tag LOCUS_04720 31980 33863 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_04720 34294 33755 gene locus_tag LOCUS_04730 34294 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 34208 35467 gene locus_tag LOCUS_04740 34208 35467 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04740 34678 34764 gene locus_tag LOCUS_t00060 34678 34764 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35464 36495 gene locus_tag LOCUS_04750 gene mraY 35464 36495 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_04750 36518 37972 gene locus_tag LOCUS_04760 36518 37972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 37969 39108 gene locus_tag LOCUS_04770 gene murG 37969 39108 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228037.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence012 1313 651 gene locus_tag LOCUS_04780 gene rplC 1313 651 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_04780 1678 1376 gene locus_tag LOCUS_04790 1678 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2073 1744 gene locus_tag LOCUS_04800 gene rpsJ 2073 1744 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_04800 3293 2106 gene locus_tag LOCUS_04810 gene tuf 3293 2106 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_04810 5567 3471 gene locus_tag LOCUS_04820 gene fusA 5567 3471 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_04820 6187 5717 gene locus_tag LOCUS_04830 gene rpsG 6187 5717 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908590.1 protein_id gnl|my_center|LOCUS_04830 6560 6189 gene locus_tag LOCUS_04840 gene rpsL 6560 6189 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_04840 10779 6739 gene locus_tag LOCUS_04850 10779 6739 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_04850 14354 10779 gene locus_tag LOCUS_04860 gene rpoB 14354 10779 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_04860 15102 14704 gene locus_tag LOCUS_04870 gene rplL 15102 14704 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 protein_id gnl|my_center|LOCUS_04870 15775 15194 gene locus_tag LOCUS_04880 gene rplJ 15775 15194 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892752.1 protein_id gnl|my_center|LOCUS_04880 16749 16024 gene locus_tag LOCUS_04890 gene rplA 16749 16024 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_04890 17224 16793 gene locus_tag LOCUS_04900 gene rplK 17224 16793 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_04900 18124 17282 gene locus_tag LOCUS_04910 18124 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 18423 18130 gene locus_tag LOCUS_04920 18423 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 18657 18584 gene locus_tag LOCUS_t00070 18657 18584 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 18954 18790 gene locus_tag LOCUS_04930 gene rpmG 18954 18790 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_04930 19166 19092 gene locus_tag LOCUS_t00080 19166 19092 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19246 19173 gene locus_tag LOCUS_t00090 19246 19173 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19406 19894 gene locus_tag LOCUS_04940 19406 19894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887825.1 protein_id gnl|my_center|LOCUS_04940 21660 19984 gene locus_tag LOCUS_04950 21660 19984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 22518 21868 gene locus_tag LOCUS_04960 22518 21868 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_04960 23669 22515 gene locus_tag LOCUS_04970 23669 22515 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_04970 26291 23673 gene locus_tag LOCUS_04980 26291 23673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 28727 26382 gene locus_tag LOCUS_04990 gene metE 28727 26382 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 protein_id gnl|my_center|LOCUS_04990 29203 28736 gene locus_tag LOCUS_05000 29203 28736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 29845 29420 gene locus_tag LOCUS_05010 29845 29420 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728177.1 protein_id gnl|my_center|LOCUS_05010 30306 29866 gene locus_tag LOCUS_05020 30306 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 30524 30303 gene locus_tag LOCUS_05030 30524 30303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 30806 31102 gene locus_tag LOCUS_05040 30806 31102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 31281 32546 gene locus_tag LOCUS_05050 31281 32546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 33577 32612 gene locus_tag LOCUS_05060 33577 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 34526 33858 gene locus_tag LOCUS_05070 34526 33858 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_05070 35040 34594 gene locus_tag LOCUS_05080 35040 34594 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_05080 36701 35025 gene locus_tag LOCUS_05090 36701 35025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 37118 36825 gene locus_tag LOCUS_05100 37118 36825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence013 2487 976 gene locus_tag LOCUS_05110 gene secD 2487 976 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467234.1 protein_id gnl|my_center|LOCUS_05110 2970 2494 gene locus_tag LOCUS_05120 2970 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4261 3146 gene locus_tag LOCUS_05130 gene tgt 4261 3146 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_05130 5361 4258 gene locus_tag LOCUS_05140 gene queA 5361 4258 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_05140 6640 5489 gene locus_tag LOCUS_05150 gene ruvB 6640 5489 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467235.1 protein_id gnl|my_center|LOCUS_05150 7236 6637 gene locus_tag LOCUS_05160 gene ruvA 7236 6637 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_05160 7799 7233 gene locus_tag LOCUS_05170 gene ruvC 7799 7233 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_05170 8622 7873 gene locus_tag LOCUS_05180 8622 7873 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_05180 9311 8706 gene locus_tag LOCUS_05190 gene pdxT 9311 8706 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_05190 10277 9357 gene locus_tag LOCUS_05200 gene pdxS 10277 9357 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413468.1 protein_id gnl|my_center|LOCUS_05200 10993 10412 gene locus_tag LOCUS_05210 10993 10412 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_05210 11187 11786 gene locus_tag LOCUS_05220 11187 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 12684 11824 gene locus_tag LOCUS_05230 12684 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 14094 12982 gene locus_tag LOCUS_05240 gene pimA 14094 12982 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728703.1 protein_id gnl|my_center|LOCUS_05240 16032 14107 gene locus_tag LOCUS_05250 16032 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 16958 16029 gene locus_tag LOCUS_05260 16958 16029 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_05260 17813 17022 gene locus_tag LOCUS_05270 17813 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 18436 17900 gene locus_tag LOCUS_05280 18436 17900 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_05280 20430 18433 gene locus_tag LOCUS_05290 gene thrS 20430 18433 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_05290 21560 20427 gene locus_tag LOCUS_05300 gene mshC 21560 20427 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_05300 22301 21642 gene locus_tag LOCUS_05310 gene npdG 22301 21642 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_05310 22412 23200 gene locus_tag LOCUS_05320 gene fabI 22412 23200 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_05320 24475 23354 gene locus_tag LOCUS_05330 24475 23354 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_05330 25458 24502 gene locus_tag LOCUS_05340 25458 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 27109 25469 gene locus_tag LOCUS_05350 27109 25469 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_05350 27550 28779 gene locus_tag LOCUS_05360 27550 28779 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_05360 30322 28889 gene locus_tag LOCUS_05370 30322 28889 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_05370 30596 31243 gene locus_tag LOCUS_05380 30596 31243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 31260 32381 gene locus_tag LOCUS_05390 31260 32381 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409518.1 protein_id gnl|my_center|LOCUS_05390 32427 33164 gene locus_tag LOCUS_05400 32427 33164 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_05400 33344 34498 gene locus_tag LOCUS_05410 33344 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 34687 35685 gene locus_tag LOCUS_05420 34687 35685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 35689 37278 gene locus_tag LOCUS_05430 gene asnB 35689 37278 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 protein_id gnl|my_center|LOCUS_05430 37425 37249 gene locus_tag LOCUS_05440 37425 37249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence014 815 108 gene locus_tag LOCUS_05450 815 108 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_05450 1268 915 gene locus_tag LOCUS_05460 1268 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2208 1270 gene locus_tag LOCUS_05470 gene xerD 2208 1270 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 protein_id gnl|my_center|LOCUS_05470 2831 2244 gene locus_tag LOCUS_05480 2831 2244 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_05480 4536 2839 gene locus_tag LOCUS_05490 4536 2839 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_05490 6236 4584 gene locus_tag LOCUS_05500 gene recN 6236 4584 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_05500 7054 6233 gene locus_tag LOCUS_05510 7054 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7811 7059 gene locus_tag LOCUS_05520 gene tlyA 7811 7059 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_05520 8497 7913 gene locus_tag LOCUS_05530 8497 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9327 8581 gene locus_tag LOCUS_05540 9327 8581 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_05540 10511 9369 gene locus_tag LOCUS_05550 10511 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 10941 10504 gene locus_tag LOCUS_05560 10941 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 10880 11209 gene locus_tag LOCUS_05570 10880 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776823.1 protein_id gnl|my_center|LOCUS_05570 12621 11356 gene locus_tag LOCUS_05580 12621 11356 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_05580 12509 13054 gene locus_tag LOCUS_05590 12509 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 13712 13083 gene locus_tag LOCUS_05600 13712 13083 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556057.1 protein_id gnl|my_center|LOCUS_05600 14206 13709 gene locus_tag LOCUS_05610 14206 13709 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_05610 14416 15645 gene locus_tag LOCUS_05620 14416 15645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 16205 15708 gene locus_tag LOCUS_05630 16205 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 16864 16247 gene locus_tag LOCUS_05640 16864 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 17335 16880 gene locus_tag LOCUS_05650 17335 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19432 17783 gene locus_tag LOCUS_05660 19432 17783 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_05660 21550 19445 gene locus_tag LOCUS_05670 21550 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 22296 21547 gene locus_tag LOCUS_05680 gene tatC 22296 21547 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05680 22840 22352 gene locus_tag LOCUS_05690 22840 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 23549 22890 gene locus_tag LOCUS_05700 gene lepB 23549 22890 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920934.1 protein_id gnl|my_center|LOCUS_05700 25120 23762 gene locus_tag LOCUS_05710 gene pafA 25120 23762 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_05710 25856 25185 gene locus_tag LOCUS_05720 gene prcA 25856 25185 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_05720 26662 25859 gene locus_tag LOCUS_05730 gene prcB 26662 25859 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_05730 26862 26668 gene locus_tag LOCUS_05740 26862 26668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 28369 26876 gene locus_tag LOCUS_05750 gene dop 28369 26876 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_05750 30258 28465 gene locus_tag LOCUS_05760 gene arc 30258 28465 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_05760 30588 30824 gene locus_tag LOCUS_05770 30588 30824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 31730 30873 gene locus_tag LOCUS_05780 31730 30873 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_05780 31951 31727 gene locus_tag LOCUS_05790 31951 31727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 32177 31956 gene locus_tag LOCUS_05800 32177 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 32554 32174 gene locus_tag LOCUS_05810 32554 32174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 33142 32708 gene locus_tag LOCUS_05820 33142 32708 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240402.1 protein_id gnl|my_center|LOCUS_05820 33184 34224 gene locus_tag LOCUS_05830 33184 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_05830 34284 36332 gene locus_tag LOCUS_05840 gene tkt 34284 36332 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence015 183 512 gene locus_tag LOCUS_05850 183 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1795 752 gene locus_tag LOCUS_05860 1795 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2234 1869 gene locus_tag LOCUS_05870 gene erpA 2234 1869 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_05870 2206 3681 gene locus_tag LOCUS_05880 2206 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4647 3721 gene locus_tag LOCUS_05890 4647 3721 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 protein_id gnl|my_center|LOCUS_05890 5564 4644 gene locus_tag LOCUS_05900 5564 4644 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_05900 6444 5626 gene locus_tag LOCUS_05910 6444 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6790 7884 gene locus_tag LOCUS_05920 6790 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 7901 8419 gene locus_tag LOCUS_05930 7901 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 8416 9306 gene locus_tag LOCUS_05940 8416 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9640 9383 gene locus_tag LOCUS_05950 9640 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9735 10994 gene locus_tag LOCUS_05960 9735 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 10991 12229 gene locus_tag LOCUS_05970 10991 12229 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_05970 12239 12664 gene locus_tag LOCUS_05980 12239 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 12697 13728 gene locus_tag LOCUS_05990 12697 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 13836 13913 gene locus_tag LOCUS_t00100 13836 13913 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13956 14177 gene locus_tag LOCUS_06000 13956 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 15199 14345 gene locus_tag LOCUS_06010 15199 14345 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_06010 15422 17182 gene locus_tag LOCUS_06020 15422 17182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_06020 18382 17165 gene locus_tag LOCUS_06030 18382 17165 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900033.1 protein_id gnl|my_center|LOCUS_06030 20444 18714 gene locus_tag LOCUS_06040 20444 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 20619 21746 gene locus_tag LOCUS_06050 20619 21746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 22515 21781 gene locus_tag LOCUS_06060 22515 21781 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_06060 22597 23574 gene locus_tag LOCUS_06070 22597 23574 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265954.1 protein_id gnl|my_center|LOCUS_06070 25205 23544 gene locus_tag LOCUS_06080 gene pgi 25205 23544 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404830.1 protein_id gnl|my_center|LOCUS_06080 25539 26360 gene locus_tag LOCUS_06090 25539 26360 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_06090 26525 27067 gene locus_tag LOCUS_06100 26525 27067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 27064 27414 gene locus_tag LOCUS_06110 27064 27414 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_06110 27416 27784 gene locus_tag LOCUS_06120 27416 27784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 28014 28907 gene locus_tag LOCUS_06130 28014 28907 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224879.1 protein_id gnl|my_center|LOCUS_06130 29929 29003 gene locus_tag LOCUS_06140 gene pstA 29929 29003 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_06140 31064 29931 gene locus_tag LOCUS_06150 gene pstC 31064 29931 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_06150 32262 31075 gene locus_tag LOCUS_06160 gene pstS 32262 31075 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_06160 33268 32432 gene locus_tag LOCUS_06170 33268 32432 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898653.1 protein_id gnl|my_center|LOCUS_06170 34369 33386 gene locus_tag LOCUS_06180 34369 33386 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence016 1288 2535 gene locus_tag LOCUS_06190 1288 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2620 3369 gene locus_tag LOCUS_06200 2620 3369 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_06200 3399 4094 gene locus_tag LOCUS_06210 3399 4094 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 protein_id gnl|my_center|LOCUS_06210 4102 5634 gene locus_tag LOCUS_06220 4102 5634 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 protein_id gnl|my_center|LOCUS_06220 5631 6467 gene locus_tag LOCUS_06230 5631 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 7873 6482 gene locus_tag LOCUS_06240 7873 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 8640 7870 gene locus_tag LOCUS_06250 gene ubiE 8640 7870 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_06250 9497 8637 gene locus_tag LOCUS_06260 9497 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 10029 9574 gene locus_tag LOCUS_06270 10029 9574 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_06270 10151 10846 gene locus_tag LOCUS_06280 10151 10846 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_06280 11866 10889 gene locus_tag LOCUS_06290 gene mshD 11866 10889 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_06290 11887 12555 gene locus_tag LOCUS_06300 gene nth 11887 12555 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419724.1 protein_id gnl|my_center|LOCUS_06300 12925 13236 gene locus_tag LOCUS_06310 12925 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 13233 13670 gene locus_tag LOCUS_06320 13233 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 13902 13705 gene locus_tag LOCUS_06330 13902 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 13960 15258 gene locus_tag LOCUS_06340 gene hisD 13960 15258 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_06340 15255 16325 gene locus_tag LOCUS_06350 15255 16325 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_06350 16322 16963 gene locus_tag LOCUS_06360 gene hisB 16322 16963 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_06360 17013 17672 gene locus_tag LOCUS_06370 gene hisH 17013 17672 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_06370 17672 18442 gene locus_tag LOCUS_06380 gene hisA 17672 18442 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_06380 18424 19203 gene locus_tag LOCUS_06390 gene hisF 18424 19203 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_06390 19213 19581 gene locus_tag LOCUS_06400 19213 19581 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_06400 19625 21190 gene locus_tag LOCUS_06410 19625 21190 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_06410 21187 22179 gene locus_tag LOCUS_06420 21187 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 23600 22188 gene locus_tag LOCUS_06430 23600 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 24387 23689 gene locus_tag LOCUS_06440 24387 23689 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_06440 24653 25495 gene locus_tag LOCUS_06450 gene trpC 24653 25495 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_06450 25492 26205 gene locus_tag LOCUS_06460 25492 26205 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227693.1 protein_id gnl|my_center|LOCUS_06460 26202 27419 gene locus_tag LOCUS_06470 gene trpB 26202 27419 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 protein_id gnl|my_center|LOCUS_06470 27416 28192 gene locus_tag LOCUS_06480 gene trpA 27416 28192 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_06480 29824 28118 gene locus_tag LOCUS_06490 29824 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 31071 29869 gene locus_tag LOCUS_06500 gene fabF 31071 29869 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_06500 31445 31071 gene locus_tag LOCUS_06510 31445 31071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 32227 31442 gene locus_tag LOCUS_06520 gene fabG 32227 31442 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_06520 33516 32224 gene locus_tag LOCUS_06530 33516 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 33745 33662 gene locus_tag LOCUS_t00110 33745 33662 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33831 35168 gene locus_tag LOCUS_06540 gene menC 33831 35168 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence017 1327 425 gene locus_tag LOCUS_06550 gene hisG 1327 425 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_06550 1857 1324 gene locus_tag LOCUS_06560 gene ribE 1857 1324 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_06560 3082 1844 gene locus_tag LOCUS_06570 3082 1844 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_06570 4226 3126 gene locus_tag LOCUS_06580 gene ribD 4226 3126 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 protein_id gnl|my_center|LOCUS_06580 4897 4205 gene locus_tag LOCUS_06590 gene rpe 4897 4205 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392431.1 protein_id gnl|my_center|LOCUS_06590 5823 4909 gene locus_tag LOCUS_06600 gene fmt 5823 4909 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805211.1 protein_id gnl|my_center|LOCUS_06600 6380 5835 gene locus_tag LOCUS_06610 gene def 6380 5835 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_06610 6536 7201 gene locus_tag LOCUS_06620 6536 7201 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_06620 8918 7275 gene locus_tag LOCUS_06630 8918 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9269 11995 gene locus_tag LOCUS_06640 9269 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 13874 12039 gene locus_tag LOCUS_06650 13874 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 15112 13916 gene locus_tag LOCUS_06660 gene metK 15112 13916 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_06660 16523 15300 gene locus_tag LOCUS_06670 gene coaBC 16523 15300 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_06670 16888 16544 gene locus_tag LOCUS_06680 16888 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17570 16977 gene locus_tag LOCUS_06690 gene gmk 17570 16977 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_06690 17926 17609 gene locus_tag LOCUS_06700 17926 17609 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_06700 18094 19044 gene locus_tag LOCUS_06710 18094 19044 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_06710 20029 19142 gene locus_tag LOCUS_06720 gene pyrF 20029 19142 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224621.1 protein_id gnl|my_center|LOCUS_06720 21020 20022 gene locus_tag LOCUS_06730 21020 20022 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_06730 24335 21027 gene locus_tag LOCUS_06740 gene carB 24335 21027 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_06740 25447 24335 gene locus_tag LOCUS_06750 gene carA 25447 24335 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_06750 26733 25444 gene locus_tag LOCUS_06760 26733 25444 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805076.1 protein_id gnl|my_center|LOCUS_06760 27802 26726 gene locus_tag LOCUS_06770 27802 26726 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_06770 28401 27799 gene locus_tag LOCUS_06780 gene pyrR 28401 27799 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_06780 28881 28459 gene locus_tag LOCUS_06790 gene nusB 28881 28459 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_06790 29444 28878 gene locus_tag LOCUS_06800 gene efp 29444 28878 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_06800 30613 29492 gene locus_tag LOCUS_06810 30613 29492 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907770.1 protein_id gnl|my_center|LOCUS_06810 31680 30610 gene locus_tag LOCUS_06820 31680 30610 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_06820 32243 31677 gene locus_tag LOCUS_06830 32243 31677 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_06830 33472 32240 gene locus_tag LOCUS_06840 gene aroC 33472 32240 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_06840 <34299 33533 gene locus_tag LOCUS_06850 <34299 33533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029725.1:A24 family peptidase >Feature sequence018 195 2003 gene locus_tag LOCUS_06860 gene thiC 195 2003 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_06860 2120 3508 gene locus_tag LOCUS_06870 2120 3508 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 protein_id gnl|my_center|LOCUS_06870 3498 4256 gene locus_tag LOCUS_06880 3498 4256 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_06880 4253 5020 gene locus_tag LOCUS_06890 4253 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5017 5688 gene locus_tag LOCUS_06900 5017 5688 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_06900 5809 6414 gene locus_tag LOCUS_06910 5809 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 9229 6500 gene locus_tag LOCUS_06920 gene acnA 9229 6500 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_06920 10073 9267 gene locus_tag LOCUS_06930 10073 9267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_06930 11107 10070 gene locus_tag LOCUS_06940 11107 10070 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_06940 11396 11211 gene locus_tag LOCUS_06950 11396 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 11316 11774 gene locus_tag LOCUS_06960 11316 11774 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894605.1 protein_id gnl|my_center|LOCUS_06960 11835 12491 gene locus_tag LOCUS_06970 11835 12491 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027536.1 protein_id gnl|my_center|LOCUS_06970 14370 12565 gene locus_tag LOCUS_06980 14370 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 15147 15073 gene locus_tag LOCUS_t00120 15147 15073 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15273 16514 gene locus_tag LOCUS_06990 15273 16514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06990 16521 16913 gene locus_tag LOCUS_07000 16521 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07000 16970 18295 gene locus_tag LOCUS_07010 gene lysA 16970 18295 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_07010 18401 19774 gene locus_tag LOCUS_07020 18401 19774 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 protein_id gnl|my_center|LOCUS_07020 19771 20850 gene locus_tag LOCUS_07030 gene thrC 19771 20850 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_07030 21172 23157 gene locus_tag LOCUS_07040 21172 23157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 23244 23477 gene locus_tag LOCUS_07050 gene rpmE 23244 23477 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_07050 23556 24635 gene locus_tag LOCUS_07060 gene prfA 23556 24635 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_07060 24632 25492 gene locus_tag LOCUS_07070 gene prmC 24632 25492 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141753.1 protein_id gnl|my_center|LOCUS_07070 25489 26127 gene locus_tag LOCUS_07080 25489 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 26612 27631 gene locus_tag LOCUS_07090 26612 27631 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_07090 27635 28564 gene locus_tag LOCUS_07100 27635 28564 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_07100 28554 30371 gene locus_tag LOCUS_07110 gene cimA 28554 30371 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_07110 30379 30939 gene locus_tag LOCUS_07120 30379 30939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 31374 31012 gene locus_tag LOCUS_07130 31374 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 32232 31564 gene locus_tag LOCUS_07140 32232 31564 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_07140 32750 32229 gene locus_tag LOCUS_07150 32750 32229 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_07150 32993 34150 gene locus_tag LOCUS_07160 32993 34150 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence019 1564 83 gene locus_tag LOCUS_07170 1564 83 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227524.1 protein_id gnl|my_center|LOCUS_07170 1699 2385 gene locus_tag LOCUS_07180 1699 2385 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401643.1 protein_id gnl|my_center|LOCUS_07180 3700 2444 gene locus_tag LOCUS_07190 3700 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5244 3697 gene locus_tag LOCUS_07200 5244 3697 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_07200 5666 5244 gene locus_tag LOCUS_07210 5666 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6358 5663 gene locus_tag LOCUS_07220 6358 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7265 6432 gene locus_tag LOCUS_07230 7265 6432 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_07230 8007 7258 gene locus_tag LOCUS_07240 8007 7258 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001204.1 protein_id gnl|my_center|LOCUS_07240 8241 10511 gene locus_tag LOCUS_07250 8241 10511 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_07250 10590 11159 gene locus_tag LOCUS_07260 10590 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 11156 12868 gene locus_tag LOCUS_07270 11156 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 12975 13886 gene locus_tag LOCUS_07280 12975 13886 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_07280 14990 13944 gene locus_tag LOCUS_07290 14990 13944 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_07290 16128 15079 gene locus_tag LOCUS_07300 16128 15079 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888962.1 protein_id gnl|my_center|LOCUS_07300 17433 16132 gene locus_tag LOCUS_07310 gene rlmN 17433 16132 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_07310 17455 18738 gene locus_tag LOCUS_07320 17455 18738 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266325.1 protein_id gnl|my_center|LOCUS_07320 20416 18755 gene locus_tag LOCUS_07330 20416 18755 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032668525.1 protein_id gnl|my_center|LOCUS_07330 21627 20509 gene locus_tag LOCUS_07340 21627 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 21691 22365 gene locus_tag LOCUS_07350 21691 22365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 22419 23366 gene locus_tag LOCUS_07360 22419 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 24267 23287 gene locus_tag LOCUS_07370 24267 23287 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_07370 24330 25532 gene locus_tag LOCUS_07380 24330 25532 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_07380 25635 26876 gene locus_tag LOCUS_07390 25635 26876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 28451 26916 gene locus_tag LOCUS_07400 28451 26916 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_07400 28614 29534 gene locus_tag LOCUS_07410 28614 29534 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_07410 29646 29963 gene locus_tag LOCUS_07420 29646 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29978 31279 gene locus_tag LOCUS_07430 29978 31279 CDS product DUF1730 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392044.1 protein_id gnl|my_center|LOCUS_07430 31276 32418 gene locus_tag LOCUS_07440 31276 32418 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_07440 32469 32912 gene locus_tag LOCUS_07450 32469 32912 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060860.1 protein_id gnl|my_center|LOCUS_07450 32929 33648 gene locus_tag LOCUS_07460 32929 33648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence020 1334 648 gene locus_tag LOCUS_07470 1334 648 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_07470 3423 1405 gene locus_tag LOCUS_07480 3423 1405 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_07480 3872 3510 gene locus_tag LOCUS_07490 3872 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4266 5099 gene locus_tag LOCUS_07500 4266 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7343 5130 gene locus_tag LOCUS_07510 gene mrdA 7343 5130 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_07510 7994 7443 gene locus_tag LOCUS_07520 7994 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8773 7976 gene locus_tag LOCUS_07530 8773 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07530 9890 8859 gene locus_tag LOCUS_07540 9890 8859 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_07540 10403 10128 gene locus_tag LOCUS_07550 10403 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11937 10618 gene locus_tag LOCUS_07560 11937 10618 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_07560 13244 11961 gene locus_tag LOCUS_07570 gene clpX 13244 11961 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_07570 13981 13328 gene locus_tag LOCUS_07580 gene clpP 13981 13328 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_07580 15408 13978 gene locus_tag LOCUS_07590 gene tig 15408 13978 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412652.1 protein_id gnl|my_center|LOCUS_07590 19267 15524 gene locus_tag LOCUS_07600 19267 15524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_07600 19889 19401 gene locus_tag LOCUS_07610 19889 19401 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_07610 20344 23580 gene locus_tag LOCUS_07620 20344 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 24681 23641 gene locus_tag LOCUS_07630 24681 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 24853 24927 gene locus_tag LOCUS_t00130 24853 24927 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26930 25035 gene locus_tag LOCUS_07640 26930 25035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 27447 28514 gene locus_tag LOCUS_07650 27447 28514 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_07650 29373 28612 gene locus_tag LOCUS_07660 29373 28612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 30231 29446 gene locus_tag LOCUS_07670 30231 29446 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_07670 30576 31298 gene locus_tag LOCUS_07680 30576 31298 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_07680 <33578 31617 gene locus_tag LOCUS_07690 <33578 31617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975373.1:acetate--CoA ligase >Feature sequence021 411 827 gene locus_tag LOCUS_07700 411 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 835 1362 gene locus_tag LOCUS_07710 835 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1359 2045 gene locus_tag LOCUS_07720 gene fliP 1359 2045 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_07720 2042 2314 gene locus_tag LOCUS_07730 gene fliQ 2042 2314 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_07730 2354 3121 gene locus_tag LOCUS_07740 gene fliR 2354 3121 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_07740 3125 4231 gene locus_tag LOCUS_07750 gene flhB 3125 4231 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_07750 4413 5108 gene locus_tag LOCUS_07760 4413 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5130 5441 gene locus_tag LOCUS_07770 5130 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5480 5971 gene locus_tag LOCUS_07780 5480 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7081 6047 gene locus_tag LOCUS_07790 7081 6047 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_07790 8101 7208 gene locus_tag LOCUS_07800 8101 7208 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_07800 8355 9515 gene locus_tag LOCUS_07810 8355 9515 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_07810 9512 10588 gene locus_tag LOCUS_07820 9512 10588 CDS product bifunctional MaoC family dehydratase N-terminal/OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 protein_id gnl|my_center|LOCUS_07820 10588 11742 gene locus_tag LOCUS_07830 10588 11742 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 protein_id gnl|my_center|LOCUS_07830 11739 12206 gene locus_tag LOCUS_07840 11739 12206 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_07840 12203 13387 gene locus_tag LOCUS_07850 12203 13387 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 protein_id gnl|my_center|LOCUS_07850 15189 13528 gene locus_tag LOCUS_07860 15189 13528 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088410.1 protein_id gnl|my_center|LOCUS_07860 15401 16621 gene locus_tag LOCUS_07870 15401 16621 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_07870 16695 16982 gene locus_tag LOCUS_07880 16695 16982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 17638 16979 gene locus_tag LOCUS_07890 17638 16979 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104261.1 protein_id gnl|my_center|LOCUS_07890 19326 17677 gene locus_tag LOCUS_07900 19326 17677 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_07900 21421 19466 gene locus_tag LOCUS_07910 gene dxs 21421 19466 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_07910 21935 21558 gene locus_tag LOCUS_07920 21935 21558 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869325.1 protein_id gnl|my_center|LOCUS_07920 22140 23522 gene locus_tag LOCUS_07930 22140 23522 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_07930 23519 24889 gene locus_tag LOCUS_07940 23519 24889 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_07940 25066 26247 gene locus_tag LOCUS_07950 25066 26247 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_07950 26393 27526 gene locus_tag LOCUS_07960 26393 27526 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_07960 28324 27581 gene locus_tag LOCUS_07970 28324 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 30015 28321 gene locus_tag LOCUS_07980 30015 28321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 31303 30182 gene locus_tag LOCUS_07990 31303 30182 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_07990 31943 31548 gene locus_tag LOCUS_08000 31943 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 32078 32560 gene locus_tag LOCUS_08010 gene moaC 32078 32560 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence022 939 142 gene locus_tag LOCUS_08020 939 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2652 1156 gene locus_tag LOCUS_08030 2652 1156 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_08030 3702 2875 gene locus_tag LOCUS_08040 3702 2875 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730812.1 protein_id gnl|my_center|LOCUS_08040 4237 5157 gene locus_tag LOCUS_08050 4237 5157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_08050 5154 5885 gene locus_tag LOCUS_08060 5154 5885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_08060 5919 7052 gene locus_tag LOCUS_08070 5919 7052 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730004.1 protein_id gnl|my_center|LOCUS_08070 7241 8137 gene locus_tag LOCUS_08080 7241 8137 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_08080 8680 8318 gene locus_tag LOCUS_08090 8680 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9742 8963 gene locus_tag LOCUS_08100 9742 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 10494 9739 gene locus_tag LOCUS_08110 10494 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 10593 10877 gene locus_tag LOCUS_08120 10593 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 11518 10940 gene locus_tag LOCUS_08130 11518 10940 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225073.1 protein_id gnl|my_center|LOCUS_08130 11627 12319 gene locus_tag LOCUS_08140 11627 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12392 12844 gene locus_tag LOCUS_08150 12392 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08150 12995 13861 gene locus_tag LOCUS_08160 12995 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 14095 15882 gene locus_tag LOCUS_08170 14095 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 18124 15911 gene locus_tag LOCUS_08180 18124 15911 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_08180 18596 19552 gene locus_tag LOCUS_08190 18596 19552 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727807.1 protein_id gnl|my_center|LOCUS_08190 20261 19635 gene locus_tag LOCUS_08200 20261 19635 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_08200 20711 21115 gene locus_tag LOCUS_08210 20711 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 21076 21876 gene locus_tag LOCUS_08220 21076 21876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 22681 21863 gene locus_tag LOCUS_08230 22681 21863 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_08230 23443 22727 gene locus_tag LOCUS_08240 23443 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_08240 23612 23824 gene locus_tag LOCUS_08250 23612 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 25126 24362 gene locus_tag LOCUS_08260 25126 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 25819 25307 gene locus_tag LOCUS_08270 25819 25307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_08270 25929 26135 gene locus_tag LOCUS_08280 25929 26135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 26152 26415 gene locus_tag LOCUS_08290 26152 26415 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_08290 28798 26717 gene locus_tag LOCUS_08300 28798 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 29072 29722 gene locus_tag LOCUS_08310 29072 29722 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_08310 30633 29749 gene locus_tag LOCUS_08320 30633 29749 CDS product TIGR03560 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225208.1 protein_id gnl|my_center|LOCUS_08320 30715 31038 gene locus_tag LOCUS_08330 30715 31038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 31667 31113 gene locus_tag LOCUS_08340 31667 31113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence023 <1 1151 gene locus_tag LOCUS_08350 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175647404.1:NADH-quinone oxidoreductase subunit NuoF family protein note possible pseudo, frameshifted 1148 1387 gene locus_tag LOCUS_08360 1148 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1384 1782 gene locus_tag LOCUS_08370 1384 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1779 3317 gene locus_tag LOCUS_08380 1779 3317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345476.1 protein_id gnl|my_center|LOCUS_08380 3314 3988 gene locus_tag LOCUS_08390 3314 3988 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_08390 4881 4105 gene locus_tag LOCUS_08400 4881 4105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_08400 5139 4891 gene locus_tag LOCUS_08410 5139 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5099 7162 gene locus_tag LOCUS_08420 5099 7162 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969300.1 protein_id gnl|my_center|LOCUS_08420 7159 8994 gene locus_tag LOCUS_08430 7159 8994 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_08430 9048 10178 gene locus_tag LOCUS_08440 9048 10178 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_08440 10175 10948 gene locus_tag LOCUS_08450 10175 10948 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_08450 10945 12165 gene locus_tag LOCUS_08460 10945 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12165 13292 gene locus_tag LOCUS_08470 12165 13292 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_08470 13295 13693 gene locus_tag LOCUS_08480 13295 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13690 15408 gene locus_tag LOCUS_08490 13690 15408 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_08490 15465 16211 gene locus_tag LOCUS_08500 15465 16211 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_08500 16334 17191 gene locus_tag LOCUS_08510 16334 17191 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929678.1 protein_id gnl|my_center|LOCUS_08510 18041 17229 gene locus_tag LOCUS_08520 18041 17229 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_08520 18872 19957 gene locus_tag LOCUS_08530 18872 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 19942 21582 gene locus_tag LOCUS_08540 19942 21582 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205510.1 protein_id gnl|my_center|LOCUS_08540 21579 22844 gene locus_tag LOCUS_08550 21579 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 22841 24154 gene locus_tag LOCUS_08560 22841 24154 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_08560 24155 24511 gene locus_tag LOCUS_08570 24155 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_08570 24508 25605 gene locus_tag LOCUS_08580 24508 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 25602 26654 gene locus_tag LOCUS_08590 25602 26654 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_08590 27885 28730 gene locus_tag LOCUS_08600 27885 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 28789 29610 gene locus_tag LOCUS_08610 28789 29610 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_08610 29818 30291 gene locus_tag LOCUS_08620 29818 30291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence024 2 163 gene locus_tag LOCUS_08630 2 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 265 1440 gene locus_tag LOCUS_08640 265 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08640 2649 1495 gene locus_tag LOCUS_08650 2649 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 3455 2646 gene locus_tag LOCUS_08660 3455 2646 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227237.1 protein_id gnl|my_center|LOCUS_08660 5586 3532 gene locus_tag LOCUS_08670 gene asnB 5586 3532 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_08670 5717 6655 gene locus_tag LOCUS_08680 5717 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7551 6580 gene locus_tag LOCUS_08690 7551 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7656 8498 gene locus_tag LOCUS_08700 7656 8498 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_08700 9765 8578 gene locus_tag LOCUS_08710 9765 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10732 9758 gene locus_tag LOCUS_08720 10732 9758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_08720 10795 11976 gene locus_tag LOCUS_08730 10795 11976 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_08730 11973 13217 gene locus_tag LOCUS_08740 11973 13217 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808460.1 protein_id gnl|my_center|LOCUS_08740 14380 13142 gene locus_tag LOCUS_08750 14380 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15858 14368 gene locus_tag LOCUS_08760 15858 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 15894 17006 gene locus_tag LOCUS_08770 15894 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 18355 17003 gene locus_tag LOCUS_08780 18355 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 20086 18374 gene locus_tag LOCUS_08790 20086 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 20747 22678 gene locus_tag LOCUS_08800 20747 22678 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_08800 22675 23967 gene locus_tag LOCUS_08810 22675 23967 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_08810 24035 24970 gene locus_tag LOCUS_08820 24035 24970 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_08820 24975 25670 gene locus_tag LOCUS_08830 24975 25670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 25864 27249 gene locus_tag LOCUS_08840 25864 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 27401 28666 gene locus_tag LOCUS_08850 27401 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence025 1096 467 gene locus_tag LOCUS_08860 1096 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1314 1829 gene locus_tag LOCUS_08870 1314 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1826 3355 gene locus_tag LOCUS_08880 1826 3355 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_08880 4195 3476 gene locus_tag LOCUS_08890 gene cysE 4195 3476 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907956.1 protein_id gnl|my_center|LOCUS_08890 5130 4198 gene locus_tag LOCUS_08900 gene cysK 5130 4198 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_08900 5606 6313 gene locus_tag LOCUS_08910 5606 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6456 7079 gene locus_tag LOCUS_08920 6456 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7160 7630 gene locus_tag LOCUS_08930 7160 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8754 8131 gene locus_tag LOCUS_08940 8754 8131 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 protein_id gnl|my_center|LOCUS_08940 9696 9244 gene locus_tag LOCUS_08950 9696 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 10007 9932 gene locus_tag LOCUS_t00140 10007 9932 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10116 10043 gene locus_tag LOCUS_t00150 10116 10043 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10409 11494 gene locus_tag LOCUS_08960 10409 11494 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_08960 11491 12801 gene locus_tag LOCUS_08970 11491 12801 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_08970 12795 13604 gene locus_tag LOCUS_08980 12795 13604 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878672.1 protein_id gnl|my_center|LOCUS_08980 14392 13733 gene locus_tag LOCUS_08990 14392 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 15937 14396 gene locus_tag LOCUS_09000 gene gltX 15937 14396 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_09000 16143 15946 gene locus_tag LOCUS_09010 16143 15946 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_09010 17490 16333 gene locus_tag LOCUS_09020 17490 16333 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_09020 18590 17490 gene locus_tag LOCUS_09030 18590 17490 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_09030 19093 18587 gene locus_tag LOCUS_09040 19093 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09040 19554 19090 gene locus_tag LOCUS_09050 19554 19090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09050 19746 21332 gene locus_tag LOCUS_09060 19746 21332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 21975 21550 gene locus_tag LOCUS_09070 21975 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 24197 22665 gene locus_tag LOCUS_09080 24197 22665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 24354 25013 gene locus_tag LOCUS_09090 24354 25013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 25010 25798 gene locus_tag LOCUS_09100 25010 25798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_09100 25915 27015 gene locus_tag LOCUS_09110 25915 27015 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_09110 27078 28982 gene locus_tag LOCUS_09120 27078 28982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_09120 29298 29080 gene locus_tag LOCUS_09130 29298 29080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence026 357 1577 gene locus_tag LOCUS_09140 357 1577 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125903.1 protein_id gnl|my_center|LOCUS_09140 3317 1773 gene locus_tag LOCUS_09150 gene aslA 3317 1773 CDS product arylsulfatase AslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395836.1 protein_id gnl|my_center|LOCUS_09150 3418 4017 gene locus_tag LOCUS_09160 3418 4017 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417984.1 protein_id gnl|my_center|LOCUS_09160 4208 3984 gene locus_tag LOCUS_09170 4208 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4588 4226 gene locus_tag LOCUS_09180 4588 4226 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_09180 4810 5616 gene locus_tag LOCUS_09190 4810 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5708 6871 gene locus_tag LOCUS_09200 5708 6871 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_09200 6955 9210 gene locus_tag LOCUS_09210 gene pcrA 6955 9210 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_09210 10090 9329 gene locus_tag LOCUS_09220 10090 9329 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_09220 11682 10087 gene locus_tag LOCUS_09230 11682 10087 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_09230 12653 11679 gene locus_tag LOCUS_09240 12653 11679 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897810.1 protein_id gnl|my_center|LOCUS_09240 12863 13261 gene locus_tag LOCUS_09250 12863 13261 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_09250 13406 14554 gene locus_tag LOCUS_09260 gene sucC 13406 14554 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_09260 14551 15441 gene locus_tag LOCUS_09270 gene sucD 14551 15441 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_09270 15450 16157 gene locus_tag LOCUS_09280 gene hxpB 15450 16157 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_09280 17506 16331 gene locus_tag LOCUS_09290 17506 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 18726 17548 gene locus_tag LOCUS_09300 18726 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 20263 18734 gene locus_tag LOCUS_09310 20263 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 24510 20260 gene locus_tag LOCUS_09320 24510 20260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 25182 25835 gene locus_tag LOCUS_09330 gene purN 25182 25835 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 protein_id gnl|my_center|LOCUS_09330 25832 27373 gene locus_tag LOCUS_09340 gene purH 25832 27373 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_09340 27434 28288 gene locus_tag LOCUS_09350 27434 28288 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_09350 28341 28742 gene locus_tag LOCUS_09360 28341 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence027 1416 2099 gene locus_tag LOCUS_09370 1416 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2314 2751 gene locus_tag LOCUS_09380 2314 2751 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 protein_id gnl|my_center|LOCUS_09380 3270 2806 gene locus_tag LOCUS_09390 3270 2806 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_09390 3342 4331 gene locus_tag LOCUS_09400 3342 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4328 5440 gene locus_tag LOCUS_09410 4328 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5619 7091 gene locus_tag LOCUS_09420 5619 7091 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731449.1 protein_id gnl|my_center|LOCUS_09420 7261 8244 gene locus_tag LOCUS_09430 7261 8244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_09430 8249 9094 gene locus_tag LOCUS_09440 8249 9094 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_09440 9183 10784 gene locus_tag LOCUS_09450 9183 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10787 11464 gene locus_tag LOCUS_09460 10787 11464 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_09460 11850 13541 gene locus_tag LOCUS_09470 gene kdpA 11850 13541 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_09470 13542 15641 gene locus_tag LOCUS_09480 gene kdpB 13542 15641 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_09480 15641 16201 gene locus_tag LOCUS_09490 gene kdpC 15641 16201 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919467.1 protein_id gnl|my_center|LOCUS_09490 16198 16533 gene locus_tag LOCUS_09500 16198 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 16523 17749 gene locus_tag LOCUS_09510 16523 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 17842 18378 gene locus_tag LOCUS_09520 17842 18378 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859014.1 protein_id gnl|my_center|LOCUS_09520 19236 18475 gene locus_tag LOCUS_09530 19236 18475 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_09530 19463 20479 gene locus_tag LOCUS_09540 19463 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 20605 21570 gene locus_tag LOCUS_09550 20605 21570 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_09550 24016 21500 gene locus_tag LOCUS_09560 24016 21500 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742242.1 protein_id gnl|my_center|LOCUS_09560 24081 24578 gene locus_tag LOCUS_09570 24081 24578 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_09570 25159 24725 gene locus_tag LOCUS_09580 25159 24725 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412347.1 protein_id gnl|my_center|LOCUS_09580 26229 25378 gene locus_tag LOCUS_09590 gene purU 26229 25378 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_09590 26289 26993 gene locus_tag LOCUS_09600 26289 26993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_09600 27147 27223 gene locus_tag LOCUS_t00160 27147 27223 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27395 27634 gene locus_tag LOCUS_09610 27395 27634 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_09610 27631 28005 gene locus_tag LOCUS_09620 27631 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence028 547 1746 gene locus_tag LOCUS_09630 547 1746 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_09630 1780 3015 gene locus_tag LOCUS_09640 1780 3015 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_09640 3000 3992 gene locus_tag LOCUS_09650 3000 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4082 5029 gene locus_tag LOCUS_09660 4082 5029 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 protein_id gnl|my_center|LOCUS_09660 5082 5369 gene locus_tag LOCUS_09670 5082 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6390 5557 gene locus_tag LOCUS_09680 6390 5557 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 protein_id gnl|my_center|LOCUS_09680 6566 8296 gene locus_tag LOCUS_09690 6566 8296 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_09690 8359 9843 gene locus_tag LOCUS_09700 8359 9843 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969982.1 protein_id gnl|my_center|LOCUS_09700 9852 10850 gene locus_tag LOCUS_09710 9852 10850 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_09710 11850 10873 gene locus_tag LOCUS_09720 11850 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 11982 12587 gene locus_tag LOCUS_09730 gene kstR 11982 12587 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_09730 12584 13549 gene locus_tag LOCUS_09740 12584 13549 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085793.1 protein_id gnl|my_center|LOCUS_09740 13546 14343 gene locus_tag LOCUS_09750 13546 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14515 16245 gene locus_tag LOCUS_09760 14515 16245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_09760 16860 16303 gene locus_tag LOCUS_09770 16860 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 20999 16860 gene locus_tag LOCUS_09780 20999 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 22750 20996 gene locus_tag LOCUS_09790 22750 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 24375 22894 gene locus_tag LOCUS_09800 24375 22894 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143220.1 protein_id gnl|my_center|LOCUS_09800 24414 25964 gene locus_tag LOCUS_09810 24414 25964 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110545.1 protein_id gnl|my_center|LOCUS_09810 26091 26864 gene locus_tag LOCUS_09820 26091 26864 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_09820 26905 27339 gene locus_tag LOCUS_09830 26905 27339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 27484 27723 gene locus_tag LOCUS_09840 27484 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence029 <1 514 gene locus_tag LOCUS_09850 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403337.1:UDP-N-acetylmuramate--L-alanine ligase 508 1455 gene locus_tag LOCUS_09860 gene murB 508 1455 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_09860 1452 2261 gene locus_tag LOCUS_09870 1452 2261 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_09870 2404 3522 gene locus_tag LOCUS_09880 gene ftsZ 2404 3522 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_09880 3585 4292 gene locus_tag LOCUS_09890 gene pgeF 3585 4292 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038202.1 protein_id gnl|my_center|LOCUS_09890 4289 4987 gene locus_tag LOCUS_09900 4289 4987 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_09900 5011 5562 gene locus_tag LOCUS_09910 5011 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5603 5860 gene locus_tag LOCUS_09920 5603 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5956 6702 gene locus_tag LOCUS_09930 5956 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7313 6825 gene locus_tag LOCUS_09940 7313 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7272 7435 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgaagagcgccgccaaggccccggcga 7845 8426 gene locus_tag LOCUS_09950 7845 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 8423 9502 gene locus_tag LOCUS_09960 8423 9502 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_09960 10504 9572 gene locus_tag LOCUS_09970 10504 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 10799 11374 gene locus_tag LOCUS_09980 10799 11374 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_09980 12542 11367 gene locus_tag LOCUS_09990 12542 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 13030 12569 gene locus_tag LOCUS_10000 13030 12569 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_10000 13844 13173 gene locus_tag LOCUS_10010 13844 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 17631 14008 gene locus_tag LOCUS_10020 gene dnaE 17631 14008 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_10020 18464 17907 gene locus_tag LOCUS_10030 18464 17907 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_10030 19630 18461 gene locus_tag LOCUS_10040 19630 18461 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_10040 20494 19688 gene locus_tag LOCUS_10050 20494 19688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 22590 20491 gene locus_tag LOCUS_10060 22590 20491 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_10060 22683 23465 gene locus_tag LOCUS_10070 22683 23465 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_10070 24697 23573 gene locus_tag LOCUS_10080 gene menE 24697 23573 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496096.1 protein_id gnl|my_center|LOCUS_10080 24763 25695 gene locus_tag LOCUS_10090 gene menB 24763 25695 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_10090 25719 26705 gene locus_tag LOCUS_10100 25719 26705 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_10100 27568 26753 gene locus_tag LOCUS_10110 gene menH 27568 26753 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence030 <1 2803 gene locus_tag LOCUS_10120 <1 2803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729733.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type 3187 3768 gene locus_tag LOCUS_10130 3187 3768 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_10130 3765 4457 gene locus_tag LOCUS_10140 3765 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5060 4545 gene locus_tag LOCUS_10150 5060 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5819 5148 gene locus_tag LOCUS_10160 5819 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6106 5816 gene locus_tag LOCUS_10170 6106 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7322 6207 gene locus_tag LOCUS_10180 7322 6207 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_10180 7513 8136 gene locus_tag LOCUS_10190 7513 8136 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_10190 10417 8189 gene locus_tag LOCUS_10200 10417 8189 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_10200 10652 10422 gene locus_tag LOCUS_10210 10652 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10542 11297 gene locus_tag LOCUS_10220 gene sufC 10542 11297 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_10220 11294 12610 gene locus_tag LOCUS_10230 11294 12610 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_10230 12681 13202 gene locus_tag LOCUS_10240 12681 13202 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_10240 13551 13261 gene locus_tag LOCUS_10250 13551 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 13991 13626 gene locus_tag LOCUS_10260 13991 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 14861 14112 gene locus_tag LOCUS_10270 gene sufC 14861 14112 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_10270 15175 14858 gene locus_tag LOCUS_10280 15175 14858 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_10280 16514 15168 gene locus_tag LOCUS_10290 gene sufD 16514 15168 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_10290 16660 17526 gene locus_tag LOCUS_10300 16660 17526 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_10300 17908 17573 gene locus_tag LOCUS_10310 17908 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 19364 17964 gene locus_tag LOCUS_10320 gene sufB 19364 17964 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 protein_id gnl|my_center|LOCUS_10320 19500 21713 gene locus_tag LOCUS_10330 19500 21713 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_10330 22809 21718 gene locus_tag LOCUS_10340 22809 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 24346 22916 gene locus_tag LOCUS_10350 24346 22916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_10350 25099 24548 gene locus_tag LOCUS_10360 gene rfbC 25099 24548 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159758.1 protein_id gnl|my_center|LOCUS_10360 25632 25102 gene locus_tag LOCUS_10370 25632 25102 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_10370 26495 25629 gene locus_tag LOCUS_10380 26495 25629 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence031 225 151 gene locus_tag LOCUS_t00170 225 151 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1618 713 gene locus_tag LOCUS_10390 1618 713 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_10390 1843 2199 gene locus_tag LOCUS_10400 1843 2199 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_10400 2543 4243 gene locus_tag LOCUS_10410 2543 4243 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_10410 6697 4529 gene locus_tag LOCUS_10420 6697 4529 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803817.1 protein_id gnl|my_center|LOCUS_10420 7705 6890 gene locus_tag LOCUS_10430 gene fetB 7705 6890 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_10430 8361 7702 gene locus_tag LOCUS_10440 8361 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8705 8358 gene locus_tag LOCUS_10450 8705 8358 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418948.1 protein_id gnl|my_center|LOCUS_10450 10661 9078 gene locus_tag LOCUS_10460 10661 9078 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_10460 11641 10658 gene locus_tag LOCUS_10470 11641 10658 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_10470 12336 11638 gene locus_tag LOCUS_10480 12336 11638 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_10480 12981 13553 gene locus_tag LOCUS_10490 12981 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13778 14218 gene locus_tag LOCUS_10500 13778 14218 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_10500 14215 16926 gene locus_tag LOCUS_10510 14215 16926 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_10510 18680 16995 gene locus_tag LOCUS_10520 18680 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 19550 18864 gene locus_tag LOCUS_10530 19550 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 20210 19827 gene locus_tag LOCUS_10540 20210 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 20409 21002 gene locus_tag LOCUS_10550 20409 21002 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_10550 21046 21948 gene locus_tag LOCUS_10560 21046 21948 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_10560 22651 21938 gene locus_tag LOCUS_10570 22651 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 24510 22648 gene locus_tag LOCUS_10580 24510 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 24687 26684 gene locus_tag LOCUS_10590 24687 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence032 538 260 gene locus_tag LOCUS_10600 538 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1414 2796 gene locus_tag LOCUS_10610 1414 2796 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_10610 2793 4109 gene locus_tag LOCUS_10620 2793 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6984 4204 gene locus_tag LOCUS_10630 6984 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8519 7125 gene locus_tag LOCUS_10640 8519 7125 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_10640 8812 9171 gene locus_tag LOCUS_10650 8812 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 9400 11445 gene locus_tag LOCUS_10660 9400 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13082 11442 gene locus_tag LOCUS_10670 13082 11442 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_10670 14098 13079 gene locus_tag LOCUS_10680 gene gnd 14098 13079 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_10680 15422 14328 gene locus_tag LOCUS_10690 15422 14328 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_10690 15511 16422 gene locus_tag LOCUS_10700 15511 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 17654 16449 gene locus_tag LOCUS_10710 17654 16449 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_10710 18586 17666 gene locus_tag LOCUS_10720 18586 17666 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_10720 19845 18583 gene locus_tag LOCUS_10730 19845 18583 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_10730 19914 20255 gene locus_tag LOCUS_10740 19914 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 20249 21355 gene locus_tag LOCUS_10750 20249 21355 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405157.1 protein_id gnl|my_center|LOCUS_10750 22451 21339 gene locus_tag LOCUS_10760 22451 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112423.1 protein_id gnl|my_center|LOCUS_10760 22618 24075 gene locus_tag LOCUS_10770 22618 24075 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_10770 25730 24132 gene locus_tag LOCUS_10780 25730 24132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence033 224 1723 gene locus_tag LOCUS_10790 224 1723 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_10790 2860 1760 gene locus_tag LOCUS_10800 2860 1760 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_10800 3937 3017 gene locus_tag LOCUS_10810 3937 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10810 4188 3934 gene locus_tag LOCUS_10820 4188 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4142 5842 gene locus_tag LOCUS_10830 4142 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5850 6311 gene locus_tag LOCUS_10840 5850 6311 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 protein_id gnl|my_center|LOCUS_10840 6620 7192 gene locus_tag LOCUS_10850 6620 7192 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_10850 7230 7922 gene locus_tag LOCUS_10860 7230 7922 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937794.1 protein_id gnl|my_center|LOCUS_10860 7999 8529 gene locus_tag LOCUS_10870 7999 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8663 9070 gene locus_tag LOCUS_10880 gene mscL 8663 9070 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_10880 9314 9090 gene locus_tag LOCUS_10890 9314 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 9380 10012 gene locus_tag LOCUS_10900 9380 10012 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_10900 10131 10694 gene locus_tag LOCUS_10910 10131 10694 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_10910 11729 10815 gene locus_tag LOCUS_10920 11729 10815 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225528.1 protein_id gnl|my_center|LOCUS_10920 11990 13375 gene locus_tag LOCUS_10930 11990 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 13438 14772 gene locus_tag LOCUS_10940 13438 14772 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_10940 14766 15608 gene locus_tag LOCUS_10950 14766 15608 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_10950 16677 15628 gene locus_tag LOCUS_10960 16677 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 18263 16674 gene locus_tag LOCUS_10970 18263 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 19501 18260 gene locus_tag LOCUS_10980 19501 18260 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_10980 21957 19498 gene locus_tag LOCUS_10990 21957 19498 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_10990 22020 22679 gene locus_tag LOCUS_11000 22020 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 23391 22702 gene locus_tag LOCUS_11010 23391 22702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 24655 23498 gene locus_tag LOCUS_11020 24655 23498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 24548 25969 gene locus_tag LOCUS_11030 24548 25969 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence034 1615 722 gene locus_tag LOCUS_11040 1615 722 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_11040 2035 2469 gene locus_tag LOCUS_11050 2035 2469 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227629.1 protein_id gnl|my_center|LOCUS_11050 3612 2575 gene locus_tag LOCUS_11060 3612 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3874 5055 gene locus_tag LOCUS_11070 3874 5055 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064857.1 protein_id gnl|my_center|LOCUS_11070 5057 6175 gene locus_tag LOCUS_11080 gene trpD 5057 6175 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_11080 6414 6857 gene locus_tag LOCUS_11090 6414 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6868 7653 gene locus_tag LOCUS_11100 6868 7653 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_11100 7653 8492 gene locus_tag LOCUS_11110 7653 8492 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_11110 8492 8992 gene locus_tag LOCUS_11120 8492 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9098 9583 gene locus_tag LOCUS_11130 9098 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 9598 11010 gene locus_tag LOCUS_11140 gene flgK 9598 11010 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_11140 11084 12037 gene locus_tag LOCUS_11150 gene flgL 11084 12037 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212764.1 protein_id gnl|my_center|LOCUS_11150 12081 12572 gene locus_tag LOCUS_11160 12081 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 12877 12533 gene locus_tag LOCUS_11170 12877 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 13411 13052 gene locus_tag LOCUS_11180 13411 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 15078 13417 gene locus_tag LOCUS_11190 15078 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 17098 15053 gene locus_tag LOCUS_11200 gene flhA 17098 15053 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_11200 17950 17249 gene locus_tag LOCUS_11210 17950 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 18918 17947 gene locus_tag LOCUS_11220 18918 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 19673 18915 gene locus_tag LOCUS_11230 19673 18915 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267107.1 protein_id gnl|my_center|LOCUS_11230 20880 19675 gene locus_tag LOCUS_11240 20880 19675 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_11240 22193 20877 gene locus_tag LOCUS_11250 22193 20877 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_11250 <25483 22193 gene locus_tag LOCUS_11260 <25483 22193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930460.1:glycosyltransferase >Feature sequence035 1025 940 gene locus_tag LOCUS_t00180 1025 940 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1536 1129 gene locus_tag LOCUS_11270 1536 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11270 2103 1579 gene locus_tag LOCUS_11280 2103 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11280 2127 3002 gene locus_tag LOCUS_11290 gene larB 2127 3002 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224946.1 protein_id gnl|my_center|LOCUS_11290 2999 4369 gene locus_tag LOCUS_11300 gene larC 2999 4369 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_11300 5977 4679 gene locus_tag LOCUS_11310 5977 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 7558 6167 gene locus_tag LOCUS_11320 7558 6167 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_11320 8052 7726 gene locus_tag LOCUS_11330 8052 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 8069 8416 gene locus_tag LOCUS_11340 8069 8416 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_11340 9210 8512 gene locus_tag LOCUS_11350 9210 8512 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_11350 9718 9203 gene locus_tag LOCUS_11360 9718 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 10584 9886 gene locus_tag LOCUS_11370 10584 9886 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_11370 10733 10915 gene locus_tag LOCUS_11380 10733 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 11243 11004 gene locus_tag LOCUS_11390 11243 11004 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_11390 12271 11240 gene locus_tag LOCUS_11400 gene larE 12271 11240 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_11400 13041 12268 gene locus_tag LOCUS_11410 13041 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 13470 13084 gene locus_tag LOCUS_11420 13470 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 15453 13831 gene locus_tag LOCUS_11430 gene groL 15453 13831 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_11430 15982 15707 gene locus_tag LOCUS_11440 15982 15707 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_11440 17283 15979 gene locus_tag LOCUS_11450 gene thrC 17283 15979 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_11450 17464 18462 gene locus_tag LOCUS_11460 17464 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 18540 20042 gene locus_tag LOCUS_11470 18540 20042 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_11470 20868 20083 gene locus_tag LOCUS_11480 gene otsB 20868 20083 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_11480 21405 20872 gene locus_tag LOCUS_11490 21405 20872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 22673 21672 gene locus_tag LOCUS_11500 22673 21672 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_11500 22794 22867 gene locus_tag LOCUS_t00190 22794 22867 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23373 23155 gene locus_tag LOCUS_11510 23373 23155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 25016 24378 gene locus_tag LOCUS_11520 25016 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence036 2145 1030 gene locus_tag LOCUS_11530 2145 1030 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_11530 2668 2339 gene locus_tag LOCUS_11540 2668 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3019 2681 gene locus_tag LOCUS_11550 3019 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11550 3259 3056 gene locus_tag LOCUS_11560 3259 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11560 3950 3336 gene locus_tag LOCUS_11570 3950 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4103 4030 gene locus_tag LOCUS_t00200 4103 4030 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5305 4217 gene locus_tag LOCUS_11580 5305 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5960 5316 gene locus_tag LOCUS_11590 5960 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 8932 5957 gene locus_tag LOCUS_11600 gene topA 8932 5957 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_11600 11380 9050 gene locus_tag LOCUS_11610 11380 9050 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_11610 14162 11700 gene locus_tag LOCUS_11620 14162 11700 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_11620 14274 14999 gene locus_tag LOCUS_11630 14274 14999 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_11630 14996 15658 gene locus_tag LOCUS_11640 14996 15658 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_11640 15661 16476 gene locus_tag LOCUS_11650 15661 16476 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_11650 17775 16786 gene locus_tag LOCUS_11660 17775 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 18600 17986 gene locus_tag LOCUS_11670 18600 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 20383 18593 gene locus_tag LOCUS_11680 20383 18593 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_11680 20759 21769 gene locus_tag LOCUS_11690 20759 21769 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_11690 21993 23354 gene locus_tag LOCUS_11700 gene glnA 21993 23354 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_11700 23395 24075 gene locus_tag LOCUS_11710 23395 24075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 protein_id gnl|my_center|LOCUS_11710 24514 24134 gene locus_tag LOCUS_11720 24514 24134 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence037 2166 133 gene locus_tag LOCUS_11730 gene dgcA 2166 133 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_11730 4214 2163 gene locus_tag LOCUS_11740 4214 2163 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_11740 5432 4218 gene locus_tag LOCUS_11750 gene mftC 5432 4218 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_11750 5824 5429 gene locus_tag LOCUS_11760 5824 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5984 5841 gene locus_tag LOCUS_11770 5984 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6075 6686 gene locus_tag LOCUS_11780 gene mftR 6075 6686 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112053.1 protein_id gnl|my_center|LOCUS_11780 6869 8020 gene locus_tag LOCUS_11790 6869 8020 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_11790 8322 9734 gene locus_tag LOCUS_11800 8322 9734 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_11800 9731 10987 gene locus_tag LOCUS_11810 9731 10987 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_11810 10975 11451 gene locus_tag LOCUS_11820 gene rpiB 10975 11451 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_11820 11964 11437 gene locus_tag LOCUS_11830 11964 11437 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222256.1 protein_id gnl|my_center|LOCUS_11830 12363 11980 gene locus_tag LOCUS_11840 12363 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 12548 13351 gene locus_tag LOCUS_11850 12548 13351 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_11850 14957 13413 gene locus_tag LOCUS_11860 14957 13413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_11860 15388 15197 gene locus_tag LOCUS_11870 15388 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 15504 16217 gene locus_tag LOCUS_11880 15504 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 16214 17005 gene locus_tag LOCUS_11890 16214 17005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_11890 17752 17069 gene locus_tag LOCUS_11900 17752 17069 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_11900 17927 21241 gene locus_tag LOCUS_11910 gene ileS 17927 21241 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_11910 21238 22818 gene locus_tag LOCUS_11920 21238 22818 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_11920 21617 21698 gene locus_tag LOCUS_t00210 21617 21698 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23237 22851 gene locus_tag LOCUS_11930 23237 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 25053 23317 gene locus_tag LOCUS_11940 gene leuA 25053 23317 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence038 110 610 gene locus_tag LOCUS_11950 110 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 698 1723 gene locus_tag LOCUS_11960 698 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1730 2770 gene locus_tag LOCUS_11970 1730 2770 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_11970 3880 2813 gene locus_tag LOCUS_11980 3880 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3860 4834 gene locus_tag LOCUS_11990 3860 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5331 4759 gene locus_tag LOCUS_12000 5331 4759 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_12000 5928 7784 gene locus_tag LOCUS_12010 5928 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10562 8022 gene locus_tag LOCUS_12020 10562 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 11610 10678 gene locus_tag LOCUS_12030 11610 10678 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_12030 12179 11607 gene locus_tag LOCUS_12040 12179 11607 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 protein_id gnl|my_center|LOCUS_12040 12658 12176 gene locus_tag LOCUS_12050 12658 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 14301 12997 gene locus_tag LOCUS_12060 gene eno 14301 12997 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_12060 15865 14369 gene locus_tag LOCUS_12070 gene mazG 15865 14369 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142588.1 protein_id gnl|my_center|LOCUS_12070 17105 15885 gene locus_tag LOCUS_12080 17105 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20761 17192 gene locus_tag LOCUS_12090 gene mfd 20761 17192 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_12090 21425 20913 gene locus_tag LOCUS_12100 gene pth 21425 20913 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12100 22120 21482 gene locus_tag LOCUS_12110 22120 21482 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_12110 22478 22942 gene locus_tag LOCUS_12120 22478 22942 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079984.1 protein_id gnl|my_center|LOCUS_12120 22988 23986 gene locus_tag LOCUS_12130 22988 23986 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 protein_id gnl|my_center|LOCUS_12130 23986 24780 gene locus_tag LOCUS_12140 23986 24780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence039 1249 2211 gene locus_tag LOCUS_12150 1249 2211 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_12150 2208 2654 gene locus_tag LOCUS_12160 2208 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2704 3720 gene locus_tag LOCUS_12170 2704 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3797 4648 gene locus_tag LOCUS_12180 3797 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5462 4737 gene locus_tag LOCUS_12190 5462 4737 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808165.1 protein_id gnl|my_center|LOCUS_12190 5988 5467 gene locus_tag LOCUS_12200 5988 5467 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722429.1 protein_id gnl|my_center|LOCUS_12200 6824 5985 gene locus_tag LOCUS_12210 6824 5985 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_12210 8549 7209 gene locus_tag LOCUS_12220 8549 7209 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_12220 9448 8561 gene locus_tag LOCUS_12230 9448 8561 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_12230 9673 10647 gene locus_tag LOCUS_12240 gene wtpA 9673 10647 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_12240 10644 12668 gene locus_tag LOCUS_12250 10644 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 13100 12645 gene locus_tag LOCUS_12260 13100 12645 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775840.1 protein_id gnl|my_center|LOCUS_12260 13414 13175 gene locus_tag LOCUS_12270 13414 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 13541 14050 gene locus_tag LOCUS_12280 13541 14050 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878425.1 protein_id gnl|my_center|LOCUS_12280 14302 14060 gene locus_tag LOCUS_12290 14302 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 15387 14299 gene locus_tag LOCUS_12300 gene moaA 15387 14299 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014195.1 protein_id gnl|my_center|LOCUS_12300 16667 15375 gene locus_tag LOCUS_12310 16667 15375 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_12310 17176 16664 gene locus_tag LOCUS_12320 17176 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 17854 17234 gene locus_tag LOCUS_12330 17854 17234 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084901.1 protein_id gnl|my_center|LOCUS_12330 17911 18444 gene locus_tag LOCUS_12340 gene moaC 17911 18444 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_12340 19422 20414 gene locus_tag LOCUS_12350 19422 20414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 20676 21509 gene locus_tag LOCUS_12360 gene sapM 20676 21509 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417249.1 protein_id gnl|my_center|LOCUS_12360 21887 23032 gene locus_tag LOCUS_12370 21887 23032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 <23733 23179 gene locus_tag LOCUS_12380 <23733 23179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189284555.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence040 417 70 gene locus_tag LOCUS_tm00010 417 70 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1135 608 gene locus_tag LOCUS_12390 1135 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1707 2114 gene locus_tag LOCUS_12400 gene mec 1707 2114 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_12400 2218 2523 gene locus_tag LOCUS_12410 2218 2523 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730181.1 protein_id gnl|my_center|LOCUS_12410 2555 3502 gene locus_tag LOCUS_12420 2555 3502 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_12420 3507 4268 gene locus_tag LOCUS_12430 3507 4268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_12430 4265 5065 gene locus_tag LOCUS_12440 gene rph 4265 5065 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811149.1 protein_id gnl|my_center|LOCUS_12440 5062 5742 gene locus_tag LOCUS_12450 gene rdgB 5062 5742 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_12450 6427 5687 gene locus_tag LOCUS_12460 6427 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6823 7680 gene locus_tag LOCUS_12470 6823 7680 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_12470 8892 7711 gene locus_tag LOCUS_12480 8892 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 11436 9025 gene locus_tag LOCUS_12490 11436 9025 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893793.1 protein_id gnl|my_center|LOCUS_12490 11435 11683 gene locus_tag LOCUS_12500 11435 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 13318 11804 gene locus_tag LOCUS_12510 13318 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 13570 13642 gene locus_tag LOCUS_t00220 13570 13642 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13805 14632 gene locus_tag LOCUS_12520 13805 14632 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_12520 15854 14643 gene locus_tag LOCUS_12530 15854 14643 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_12530 16122 15865 gene locus_tag LOCUS_12540 16122 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 16606 16851 gene locus_tag LOCUS_12550 16606 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 16824 17720 gene locus_tag LOCUS_12560 16824 17720 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_12560 17717 19039 gene locus_tag LOCUS_12570 17717 19039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_12570 19685 19939 gene locus_tag LOCUS_12580 19685 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 20193 19975 gene locus_tag LOCUS_12590 20193 19975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 20074 20313 gene locus_tag LOCUS_12600 20074 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 20789 20523 gene locus_tag LOCUS_12610 20789 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 20919 22427 gene locus_tag LOCUS_12620 20919 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 22518 22949 gene locus_tag LOCUS_12630 22518 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence041 1436 24 gene locus_tag LOCUS_12640 1436 24 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_12640 2187 1462 gene locus_tag LOCUS_12650 gene recO 2187 1462 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412222.1 protein_id gnl|my_center|LOCUS_12650 2429 2184 gene locus_tag LOCUS_12660 2429 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3241 2426 gene locus_tag LOCUS_12670 3241 2426 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_12670 3320 5287 gene locus_tag LOCUS_12680 gene dinG 3320 5287 CDS product ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898827.1 protein_id gnl|my_center|LOCUS_12680 6236 5301 gene locus_tag LOCUS_12690 gene era 6236 5301 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_12690 7555 6233 gene locus_tag LOCUS_12700 7555 6233 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_12700 8055 7552 gene locus_tag LOCUS_12710 gene ybeY 8055 7552 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_12710 9025 8045 gene locus_tag LOCUS_12720 9025 8045 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_12720 9488 9138 gene locus_tag LOCUS_12730 9488 9138 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869381.1 protein_id gnl|my_center|LOCUS_12730 9775 9515 gene locus_tag LOCUS_12740 9775 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 10499 9906 gene locus_tag LOCUS_12750 gene bldD 10499 9906 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_12750 11502 10717 gene locus_tag LOCUS_12760 11502 10717 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_12760 12650 11499 gene locus_tag LOCUS_12770 gene dnaJ 12650 11499 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_12770 13708 12647 gene locus_tag LOCUS_12780 gene hrcA 13708 12647 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_12780 14510 13851 gene locus_tag LOCUS_12790 14510 13851 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_12790 14761 15993 gene locus_tag LOCUS_12800 14761 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 16110 16469 gene locus_tag LOCUS_12810 16110 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 16466 16900 gene locus_tag LOCUS_12820 16466 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 16951 17196 gene locus_tag LOCUS_12830 16951 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 17206 17622 gene locus_tag LOCUS_12840 17206 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17619 17819 gene locus_tag LOCUS_12850 17619 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 17816 18073 gene locus_tag LOCUS_12860 17816 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 18058 18648 gene locus_tag LOCUS_12870 18058 18648 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_12870 20503 18716 gene locus_tag LOCUS_12880 gene lepA 20503 18716 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775765.1 protein_id gnl|my_center|LOCUS_12880 20772 21053 gene locus_tag LOCUS_12890 gene rpsT 20772 21053 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_12890 21850 21113 gene locus_tag LOCUS_12900 21850 21113 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_12900 <22524 21853 gene locus_tag LOCUS_12910 <22524 21853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_031039612.1:LLM class F420-dependent oxidoreductase >Feature sequence042 2468 324 gene locus_tag LOCUS_12920 2468 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3322 2594 gene locus_tag LOCUS_12930 3322 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4107 3541 gene locus_tag LOCUS_12940 gene ispF 4107 3541 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_12940 4774 4142 gene locus_tag LOCUS_12950 gene ispD 4774 4142 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_12950 5277 4801 gene locus_tag LOCUS_12960 5277 4801 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_12960 6519 5428 gene locus_tag LOCUS_12970 gene disA 6519 5428 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_12970 7970 6516 gene locus_tag LOCUS_12980 gene radA 7970 6516 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064995.1 protein_id gnl|my_center|LOCUS_12980 10780 8225 gene locus_tag LOCUS_12990 10780 8225 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_12990 11018 10806 gene locus_tag LOCUS_13000 11018 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 10899 11876 gene locus_tag LOCUS_13010 10899 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 12801 11995 gene locus_tag LOCUS_13020 12801 11995 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_13020 13781 12804 gene locus_tag LOCUS_13030 gene nadC 13781 12804 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804027.1 protein_id gnl|my_center|LOCUS_13030 15595 13778 gene locus_tag LOCUS_13040 15595 13778 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_13040 15984 15592 gene locus_tag LOCUS_13050 15984 15592 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083440.1 protein_id gnl|my_center|LOCUS_13050 16998 15988 gene locus_tag LOCUS_13060 gene panC 16998 15988 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976190.1 protein_id gnl|my_center|LOCUS_13060 17837 16995 gene locus_tag LOCUS_13070 17837 16995 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_13070 18440 17901 gene locus_tag LOCUS_13080 18440 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 18901 18437 gene locus_tag LOCUS_13090 18901 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13090 19307 18906 gene locus_tag LOCUS_13100 19307 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 20245 19436 gene locus_tag LOCUS_13110 gene folP 20245 19436 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839406.1 protein_id gnl|my_center|LOCUS_13110 20926 20357 gene locus_tag LOCUS_13120 gene folE 20926 20357 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_13120 21523 20933 gene locus_tag LOCUS_13130 gene hpt 21523 20933 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence043 1858 3387 gene locus_tag LOCUS_13140 1858 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4693 3467 gene locus_tag LOCUS_13150 4693 3467 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_13150 5858 4791 gene locus_tag LOCUS_13160 5858 4791 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_13160 5938 7161 gene locus_tag LOCUS_13170 5938 7161 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_13170 7158 10160 gene locus_tag LOCUS_13180 7158 10160 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 protein_id gnl|my_center|LOCUS_13180 10643 10212 gene locus_tag LOCUS_13190 10643 10212 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227629.1 protein_id gnl|my_center|LOCUS_13190 11288 10842 gene locus_tag LOCUS_13200 11288 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 12070 11285 gene locus_tag LOCUS_13210 12070 11285 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_13210 13606 12251 gene locus_tag LOCUS_13220 13606 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 15191 13599 gene locus_tag LOCUS_13230 15191 13599 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_13230 16526 15276 gene locus_tag LOCUS_13240 16526 15276 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_13240 16738 17886 gene locus_tag LOCUS_13250 16738 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 18549 17914 gene locus_tag LOCUS_13260 18549 17914 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_13260 18811 18656 gene locus_tag LOCUS_13270 18811 18656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 18804 20222 gene locus_tag LOCUS_13280 18804 20222 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_13280 20319 20591 gene locus_tag LOCUS_13290 20319 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 20702 20550 gene locus_tag LOCUS_13300 20702 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence044 195 482 gene locus_tag LOCUS_13310 gene rpsQ 195 482 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_13310 479 847 gene locus_tag LOCUS_13320 gene rplN 479 847 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_13320 848 1153 gene locus_tag LOCUS_13330 gene rplX 848 1153 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_13330 1150 1722 gene locus_tag LOCUS_13340 gene rplE 1150 1722 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892854.1 protein_id gnl|my_center|LOCUS_13340 1727 1912 gene locus_tag LOCUS_13350 1727 1912 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_13350 1929 2333 gene locus_tag LOCUS_13360 gene rpsH 1929 2333 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_13360 2394 2936 gene locus_tag LOCUS_13370 gene rplF 2394 2936 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_13370 2936 3301 gene locus_tag LOCUS_13380 gene rplR 2936 3301 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_13380 3305 3853 gene locus_tag LOCUS_13390 gene rpsE 3305 3853 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 3855 4070 gene locus_tag LOCUS_13400 gene rpmD 3855 4070 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 protein_id gnl|my_center|LOCUS_13400 4072 4560 gene locus_tag LOCUS_13410 gene rplO 4072 4560 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_13410 4594 5886 gene locus_tag LOCUS_13420 gene secY 4594 5886 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_13420 5887 6561 gene locus_tag LOCUS_13430 5887 6561 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_13430 6558 7301 gene locus_tag LOCUS_13440 gene map 6558 7301 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_13440 7671 7868 gene locus_tag LOCUS_13450 gene infA 7671 7868 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_13450 8174 8551 gene locus_tag LOCUS_13460 gene rpsM 8174 8551 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_13460 8551 8958 gene locus_tag LOCUS_13470 gene rpsK 8551 8958 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_13470 8986 9633 gene locus_tag LOCUS_13480 gene rpsD 8986 9633 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_13480 9728 10666 gene locus_tag LOCUS_13490 9728 10666 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_13490 10676 11029 gene locus_tag LOCUS_13500 10676 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11026 11967 gene locus_tag LOCUS_13510 gene truA 11026 11967 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_13510 12258 12725 gene locus_tag LOCUS_13520 gene rplM 12258 12725 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_13520 12764 13162 gene locus_tag LOCUS_13530 gene rpsI 12764 13162 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_13530 13167 14537 gene locus_tag LOCUS_13540 gene glmM 13167 14537 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_13540 14615 16507 gene locus_tag LOCUS_13550 gene glmS 14615 16507 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_13550 16504 16944 gene locus_tag LOCUS_13560 16504 16944 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_13560 16949 18358 gene locus_tag LOCUS_13570 16949 18358 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_13570 18348 19529 gene locus_tag LOCUS_13580 gene alr 18348 19529 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143807.1 protein_id gnl|my_center|LOCUS_13580 19475 20191 gene locus_tag LOCUS_13590 19475 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence045 410 709 gene locus_tag LOCUS_13600 410 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1649 825 gene locus_tag LOCUS_13610 1649 825 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227838.1 protein_id gnl|my_center|LOCUS_13610 3040 2048 gene locus_tag LOCUS_13620 gene galE 3040 2048 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_13620 3480 4001 gene locus_tag LOCUS_13630 3480 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13630 3998 4144 gene locus_tag LOCUS_13640 3998 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5212 4166 gene locus_tag LOCUS_13650 5212 4166 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_13650 5852 5352 gene locus_tag LOCUS_13660 5852 5352 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071356.1 protein_id gnl|my_center|LOCUS_13660 7152 5896 gene locus_tag LOCUS_13670 7152 5896 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_13670 7243 7734 gene locus_tag LOCUS_13680 7243 7734 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_13680 9967 7781 gene locus_tag LOCUS_13690 9967 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 10240 11250 gene locus_tag LOCUS_13700 10240 11250 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_13700 12145 11198 gene locus_tag LOCUS_13710 12145 11198 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 protein_id gnl|my_center|LOCUS_13710 12934 12155 gene locus_tag LOCUS_13720 12934 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 13511 13047 gene locus_tag LOCUS_13730 13511 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13909 15093 gene locus_tag LOCUS_13740 13909 15093 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_13740 15646 15281 gene locus_tag LOCUS_13750 15646 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 15762 16349 gene locus_tag LOCUS_13760 gene pabA 15762 16349 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_13760 18411 16387 gene locus_tag LOCUS_13770 gene pknB 18411 16387 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_13770 19966 18485 gene locus_tag LOCUS_13780 gene pbpA 19966 18485 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence046 <1 571 gene locus_tag LOCUS_13790 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522101.1:oxygenase MpaB family protein 866 3562 gene locus_tag LOCUS_13800 866 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3683 4681 gene locus_tag LOCUS_13810 3683 4681 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 protein_id gnl|my_center|LOCUS_13810 5305 4745 gene locus_tag LOCUS_13820 5305 4745 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093354.1 protein_id gnl|my_center|LOCUS_13820 5342 6724 gene locus_tag LOCUS_13830 5342 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6011 5923 gene locus_tag LOCUS_t00230 6011 5923 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7266 6856 gene locus_tag LOCUS_13840 7266 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7760 7266 gene locus_tag LOCUS_13850 7760 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 8863 7766 gene locus_tag LOCUS_13860 8863 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 9423 9091 gene locus_tag LOCUS_13870 9423 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9817 9590 gene locus_tag LOCUS_13880 9817 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 10874 10302 gene locus_tag LOCUS_13890 10874 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 10801 11334 gene locus_tag LOCUS_13900 10801 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 11569 12054 gene locus_tag LOCUS_13910 11569 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 12048 12911 gene locus_tag LOCUS_13920 12048 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 13562 13299 gene locus_tag LOCUS_13930 13562 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 13619 14380 gene locus_tag LOCUS_13940 13619 14380 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_13940 14789 17578 gene locus_tag LOCUS_13950 14789 17578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 18151 19089 gene locus_tag LOCUS_13960 18151 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 19086 19304 gene locus_tag LOCUS_13970 19086 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 19301 19711 gene locus_tag LOCUS_13980 gene vapC4 19301 19711 CDS product type II toxin-antitoxin system toxin ribonuclease C4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403122.1 protein_id gnl|my_center|LOCUS_13980 19758 20141 gene locus_tag LOCUS_13990 19758 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 20179 20104 gene locus_tag LOCUS_t00240 20179 20104 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 959 2446 gene locus_tag LOCUS_14000 959 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3111 2389 gene locus_tag LOCUS_14010 3111 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3243 3608 gene locus_tag LOCUS_14020 3243 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3766 5094 gene locus_tag LOCUS_14030 3766 5094 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_14030 5219 5848 gene locus_tag LOCUS_14040 5219 5848 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876687.1 protein_id gnl|my_center|LOCUS_14040 6527 5826 gene locus_tag LOCUS_14050 6527 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8815 6524 gene locus_tag LOCUS_14060 8815 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 9748 9281 gene locus_tag LOCUS_14070 9748 9281 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_14070 10968 9934 gene locus_tag LOCUS_14080 10968 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 11491 10961 gene locus_tag LOCUS_14090 11491 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 11424 13151 gene locus_tag LOCUS_14100 11424 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13292 14449 gene locus_tag LOCUS_14110 gene ald 13292 14449 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_14110 15586 14591 gene locus_tag LOCUS_14120 15586 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 16577 15654 gene locus_tag LOCUS_14130 16577 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965847.1 protein_id gnl|my_center|LOCUS_14130 17886 16594 gene locus_tag LOCUS_14140 17886 16594 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_14140 18724 18341 gene locus_tag LOCUS_14150 18724 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 18963 18805 gene locus_tag LOCUS_14160 18963 18805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 19224 19466 gene locus_tag LOCUS_14170 19224 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence048 2167 932 gene locus_tag LOCUS_14180 2167 932 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_14180 2315 2716 gene locus_tag LOCUS_14190 2315 2716 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_14190 2813 3547 gene locus_tag LOCUS_14200 2813 3547 CDS product evbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135362122.1 protein_id gnl|my_center|LOCUS_14200 3762 4058 gene locus_tag LOCUS_14210 gene acpP 3762 4058 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 protein_id gnl|my_center|LOCUS_14210 4082 4852 gene locus_tag LOCUS_14220 gene rnc 4082 4852 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_14220 4845 5687 gene locus_tag LOCUS_14230 gene mutM 4845 5687 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_14230 5736 9326 gene locus_tag LOCUS_14240 gene smc 5736 9326 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899542.1 protein_id gnl|my_center|LOCUS_14240 9323 10510 gene locus_tag LOCUS_14250 9323 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 10626 12161 gene locus_tag LOCUS_14260 gene ffh 10626 12161 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_14260 12265 12567 gene locus_tag LOCUS_14270 gene rpsP 12265 12567 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268754.1 protein_id gnl|my_center|LOCUS_14270 12651 12872 gene locus_tag LOCUS_14280 12651 12872 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_14280 12895 13386 gene locus_tag LOCUS_14290 gene rimM 12895 13386 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414726.1 protein_id gnl|my_center|LOCUS_14290 13383 14189 gene locus_tag LOCUS_14300 gene trmD 13383 14189 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_14300 14320 14673 gene locus_tag LOCUS_14310 gene rplS 14320 14673 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_14310 14755 15048 gene locus_tag LOCUS_14320 14755 15048 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_14320 15296 15445 gene locus_tag LOCUS_14330 15296 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15572 16366 gene locus_tag LOCUS_14340 15572 16366 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_14340 16528 18063 gene locus_tag LOCUS_14350 16528 18063 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_14350 18060 19277 gene locus_tag LOCUS_14360 gene dprA 18060 19277 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085786324.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence049 1870 275 gene locus_tag LOCUS_14370 gene glpK 1870 275 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 protein_id gnl|my_center|LOCUS_14370 2218 5115 gene locus_tag LOCUS_14380 2218 5115 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_14380 5759 6130 gene locus_tag LOCUS_14390 5759 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6347 6784 gene locus_tag LOCUS_14400 6347 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 8543 6936 gene locus_tag LOCUS_14410 8543 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 8796 9254 gene locus_tag LOCUS_14420 8796 9254 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963690.1 protein_id gnl|my_center|LOCUS_14420 11367 9265 gene locus_tag LOCUS_14430 11367 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 11554 12216 gene locus_tag LOCUS_14440 11554 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 12699 12256 gene locus_tag LOCUS_14450 12699 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 13373 12696 gene locus_tag LOCUS_14460 13373 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 13817 14551 gene locus_tag LOCUS_14470 gene ygiD 13817 14551 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 protein_id gnl|my_center|LOCUS_14470 14663 14893 gene locus_tag LOCUS_14480 14663 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 16643 15003 gene locus_tag LOCUS_14490 16643 15003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_14490 16867 17409 gene locus_tag LOCUS_14500 16867 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 17474 18496 gene locus_tag LOCUS_14510 17474 18496 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence050 881 1537 gene locus_tag LOCUS_14520 gene paaG 881 1537 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969781.1 protein_id gnl|my_center|LOCUS_14520 2035 1628 gene locus_tag LOCUS_14530 2035 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2284 2036 gene locus_tag LOCUS_14540 2284 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2949 2419 gene locus_tag LOCUS_14550 2949 2419 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969916.1 protein_id gnl|my_center|LOCUS_14550 3281 3781 gene locus_tag LOCUS_14560 3281 3781 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155369284.1 protein_id gnl|my_center|LOCUS_14560 3784 4587 gene locus_tag LOCUS_14570 3784 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5142 4747 gene locus_tag LOCUS_14580 5142 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5159 6025 gene locus_tag LOCUS_14590 5159 6025 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_14590 6037 6309 gene locus_tag LOCUS_14600 6037 6309 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_14600 7387 6332 gene locus_tag LOCUS_14610 7387 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8864 7425 gene locus_tag LOCUS_14620 gene zwf 8864 7425 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402864.1 protein_id gnl|my_center|LOCUS_14620 9060 10586 gene locus_tag LOCUS_14630 gene lysS 9060 10586 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_14630 10749 10952 gene locus_tag LOCUS_14640 10749 10952 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_14640 11749 11120 gene locus_tag LOCUS_14650 11749 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14650 13781 12243 gene locus_tag LOCUS_14660 gene mftF 13781 12243 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 protein_id gnl|my_center|LOCUS_14660 14667 13846 gene locus_tag LOCUS_14670 14667 13846 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_14670 15479 14664 gene locus_tag LOCUS_14680 15479 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 16471 15476 gene locus_tag LOCUS_14690 16471 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 16835 16482 gene locus_tag LOCUS_14700 16835 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 18172 16832 gene locus_tag LOCUS_14710 18172 16832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_14710 <19095 18165 gene locus_tag LOCUS_14720 <19095 18165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390826.1:FAD-binding protein >Feature sequence051 311 48 gene locus_tag LOCUS_14730 311 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1123 308 gene locus_tag LOCUS_14740 1123 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1776 1120 gene locus_tag LOCUS_14750 1776 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3089 1839 gene locus_tag LOCUS_14760 3089 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4988 3216 gene locus_tag LOCUS_14770 4988 3216 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 protein_id gnl|my_center|LOCUS_14770 5916 4978 gene locus_tag LOCUS_14780 5916 4978 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 protein_id gnl|my_center|LOCUS_14780 6840 6349 gene locus_tag LOCUS_14790 6840 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8114 6945 gene locus_tag LOCUS_14800 8114 6945 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_14800 8166 9020 gene locus_tag LOCUS_14810 8166 9020 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_14810 10395 9121 gene locus_tag LOCUS_14820 10395 9121 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_14820 11464 10556 gene locus_tag LOCUS_14830 11464 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 13381 12170 gene locus_tag LOCUS_14840 13381 12170 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_14840 14808 13558 gene locus_tag LOCUS_14850 14808 13558 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_14850 16314 14998 gene locus_tag LOCUS_14860 16314 14998 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_14860 18470 16311 gene locus_tag LOCUS_14870 18470 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 18528 19043 gene locus_tag LOCUS_14880 18528 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence052 232 17 gene locus_tag LOCUS_14890 232 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 134 754 gene locus_tag LOCUS_14900 134 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 842 771 gene locus_tag LOCUS_t00250 842 771 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2498 801 gene locus_tag LOCUS_14910 2498 801 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_14910 2682 3248 gene locus_tag LOCUS_14920 gene dcd 2682 3248 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_14920 3387 5438 gene locus_tag LOCUS_14930 3387 5438 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_14930 5912 5487 gene locus_tag LOCUS_14940 5912 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6207 7607 gene locus_tag LOCUS_14950 6207 7607 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_14950 7699 8037 gene locus_tag LOCUS_14960 gene glnB 7699 8037 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_14960 8920 8165 gene locus_tag LOCUS_14970 8920 8165 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_14970 9279 11111 gene locus_tag LOCUS_14980 gene dnaK 9279 11111 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_14980 11118 11936 gene locus_tag LOCUS_14990 11118 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 11953 13071 gene locus_tag LOCUS_15000 gene dnaJ 11953 13071 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_15000 13073 13510 gene locus_tag LOCUS_15010 13073 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 13507 15999 gene locus_tag LOCUS_15020 gene clpB 13507 15999 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_15020 16129 17418 gene locus_tag LOCUS_15030 16129 17418 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804520.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence053 2064 676 gene locus_tag LOCUS_15040 gene argH 2064 676 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_15040 3275 2061 gene locus_tag LOCUS_15050 3275 2061 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_15050 3772 3272 gene locus_tag LOCUS_15060 3772 3272 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_15060 4704 3769 gene locus_tag LOCUS_15070 gene argF 4704 3769 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_15070 5945 4701 gene locus_tag LOCUS_15080 5945 4701 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928539.1 protein_id gnl|my_center|LOCUS_15080 6883 5942 gene locus_tag LOCUS_15090 gene argB 6883 5942 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_15090 8049 6880 gene locus_tag LOCUS_15100 gene argJ 8049 6880 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_15100 9169 8096 gene locus_tag LOCUS_15110 gene argC 9169 8096 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_15110 9399 9815 gene locus_tag LOCUS_15120 9399 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 12351 9859 gene locus_tag LOCUS_15130 gene pheT 12351 9859 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_15130 13453 12389 gene locus_tag LOCUS_15140 gene pheS 13453 12389 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_15140 14303 13533 gene locus_tag LOCUS_15150 14303 13533 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_15150 14806 14417 gene locus_tag LOCUS_15160 gene rplT 14806 14417 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_15160 15125 14931 gene locus_tag LOCUS_15170 gene rpmI 15125 14931 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_15170 15814 15131 gene locus_tag LOCUS_15180 gene infC 15814 15131 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_15180 15984 16535 gene locus_tag LOCUS_15190 15984 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence054 <1 618 gene locus_tag LOCUS_15200 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412664.1:Rv2466c family mycothiol-dependent reductase 819 1676 gene locus_tag LOCUS_15210 819 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1696 2376 gene locus_tag LOCUS_15220 1696 2376 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_15220 2558 4591 gene locus_tag LOCUS_15230 2558 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4665 5129 gene locus_tag LOCUS_15240 4665 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6316 5141 gene locus_tag LOCUS_15250 6316 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 6337 6948 gene locus_tag LOCUS_15260 6337 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7582 6938 gene locus_tag LOCUS_15270 7582 6938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_15270 8900 7908 gene locus_tag LOCUS_15280 8900 7908 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 protein_id gnl|my_center|LOCUS_15280 9161 10345 gene locus_tag LOCUS_15290 9161 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 11585 10395 gene locus_tag LOCUS_15300 11585 10395 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040046.1 protein_id gnl|my_center|LOCUS_15300 13054 11591 gene locus_tag LOCUS_15310 13054 11591 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_15310 13275 14456 gene locus_tag LOCUS_15320 13275 14456 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_15320 14566 15708 gene locus_tag LOCUS_15330 14566 15708 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525804.1 protein_id gnl|my_center|LOCUS_15330 15705 16247 gene locus_tag LOCUS_15340 15705 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 16244 16723 gene locus_tag LOCUS_15350 16244 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence055 1776 130 gene locus_tag LOCUS_15360 1776 130 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_15360 1915 2979 gene locus_tag LOCUS_15370 1915 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3504 3028 gene locus_tag LOCUS_15380 gene ribC 3504 3028 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_15380 5131 3533 gene locus_tag LOCUS_15390 5131 3533 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805070.1 protein_id gnl|my_center|LOCUS_15390 6377 5169 gene locus_tag LOCUS_15400 gene dusB 6377 5169 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_15400 7041 6370 gene locus_tag LOCUS_15410 7041 6370 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_15410 7156 7437 gene locus_tag LOCUS_15420 7156 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 9088 7457 gene locus_tag LOCUS_15430 9088 7457 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_15430 9833 9351 gene locus_tag LOCUS_15440 9833 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10270 9842 gene locus_tag LOCUS_15450 10270 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10566 12263 gene locus_tag LOCUS_15460 10566 12263 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_15460 12274 13200 gene locus_tag LOCUS_15470 12274 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 14875 13427 gene locus_tag LOCUS_15480 gene ahcY 14875 13427 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_15480 15589 15038 gene locus_tag LOCUS_15490 15589 15038 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971468.1 protein_id gnl|my_center|LOCUS_15490 17059 15644 gene locus_tag LOCUS_15500 17059 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence056 2581 1370 gene locus_tag LOCUS_15510 2581 1370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_15510 3470 2655 gene locus_tag LOCUS_15520 3470 2655 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_15520 3541 4449 gene locus_tag LOCUS_15530 3541 4449 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_15530 5347 4754 gene locus_tag LOCUS_15540 5347 4754 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_15540 5472 6527 gene locus_tag LOCUS_15550 5472 6527 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 protein_id gnl|my_center|LOCUS_15550 6646 7686 gene locus_tag LOCUS_15560 6646 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 7807 8760 gene locus_tag LOCUS_15570 7807 8760 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142835.1 protein_id gnl|my_center|LOCUS_15570 9195 8797 gene locus_tag LOCUS_15580 9195 8797 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_15580 10234 9377 gene locus_tag LOCUS_15590 10234 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 10822 10415 gene locus_tag LOCUS_15600 10822 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11958 11143 gene locus_tag LOCUS_15610 11958 11143 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893578.1 protein_id gnl|my_center|LOCUS_15610 12177 13031 gene locus_tag LOCUS_15620 12177 13031 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035563.1 protein_id gnl|my_center|LOCUS_15620 13245 13538 gene locus_tag LOCUS_15630 13245 13538 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_15630 13910 13428 gene locus_tag LOCUS_15640 13910 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 13940 14131 gene locus_tag LOCUS_15650 13940 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 14237 15268 gene locus_tag LOCUS_15660 gene mgrA 14237 15268 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_15660 15279 16412 gene locus_tag LOCUS_15670 15279 16412 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence057 895 668 gene locus_tag LOCUS_15680 895 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1001 928 gene locus_tag LOCUS_t00260 1001 928 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1716 1069 gene locus_tag LOCUS_15690 1716 1069 CDS product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 protein_id gnl|my_center|LOCUS_15690 3209 1734 gene locus_tag LOCUS_15700 3209 1734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_15700 4068 3421 gene locus_tag LOCUS_15710 4068 3421 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_15710 4364 4813 gene locus_tag LOCUS_15720 4364 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5460 5161 gene locus_tag LOCUS_15730 5460 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5378 6001 gene locus_tag LOCUS_15740 5378 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15740 6461 7795 gene locus_tag LOCUS_15750 6461 7795 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_15750 7801 8355 gene locus_tag LOCUS_15760 7801 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8553 8849 gene locus_tag LOCUS_15770 8553 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9783 9067 gene locus_tag LOCUS_15780 9783 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 11569 10172 gene locus_tag LOCUS_15790 11569 10172 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_15790 13237 11678 gene locus_tag LOCUS_15800 13237 11678 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_15800 14679 13234 gene locus_tag LOCUS_15810 14679 13234 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411690.1 protein_id gnl|my_center|LOCUS_15810 15069 15380 gene locus_tag LOCUS_15820 15069 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 15867 16589 gene locus_tag LOCUS_15830 15867 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence058 <1 670 gene locus_tag LOCUS_15840 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933138.1:aquaporin 660 1037 gene locus_tag LOCUS_15850 660 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_15850 1413 1159 gene locus_tag LOCUS_15860 1413 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1376 1846 gene locus_tag LOCUS_15870 1376 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 1856 3322 gene locus_tag LOCUS_15880 1856 3322 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_15880 3912 3409 gene locus_tag LOCUS_15890 3912 3409 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_15890 4054 6099 gene locus_tag LOCUS_15900 4054 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 7377 6154 gene locus_tag LOCUS_15910 7377 6154 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_15910 9661 7406 gene locus_tag LOCUS_15920 9661 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 11251 9671 gene locus_tag LOCUS_15930 11251 9671 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214612.1 protein_id gnl|my_center|LOCUS_15930 11367 12443 gene locus_tag LOCUS_15940 11367 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12511 13065 gene locus_tag LOCUS_15950 12511 13065 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730621.1 protein_id gnl|my_center|LOCUS_15950 13154 13996 gene locus_tag LOCUS_15960 13154 13996 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_15960 14376 14729 gene locus_tag LOCUS_15970 14376 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 14805 15434 gene locus_tag LOCUS_15980 14805 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence059 66 140 gene locus_tag LOCUS_t00270 66 140 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 151 708 gene locus_tag LOCUS_15990 151 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 904 3855 gene locus_tag LOCUS_16000 904 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 4835 3885 gene locus_tag LOCUS_16010 4835 3885 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_16010 5083 5922 gene locus_tag LOCUS_16020 5083 5922 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_16020 6464 7093 gene locus_tag LOCUS_16030 6464 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7148 8086 gene locus_tag LOCUS_16040 7148 8086 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_16040 8530 8102 gene locus_tag LOCUS_16050 gene arfB 8530 8102 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_16050 8687 9481 gene locus_tag LOCUS_16060 8687 9481 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_16060 9511 10287 gene locus_tag LOCUS_16070 9511 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 10630 10340 gene locus_tag LOCUS_16080 10630 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11096 10647 gene locus_tag LOCUS_16090 11096 10647 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_16090 12349 11213 gene locus_tag LOCUS_16100 12349 11213 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 protein_id gnl|my_center|LOCUS_16100 13635 12460 gene locus_tag LOCUS_16110 13635 12460 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_16110 14728 13688 gene locus_tag LOCUS_16120 14728 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <16113 14725 gene locus_tag LOCUS_16130 <16113 14725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179943936.1:PKD domain-containing protein >Feature sequence060 1312 227 gene locus_tag LOCUS_16140 gene plsX 1312 227 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990052.1 protein_id gnl|my_center|LOCUS_16140 1530 1312 gene locus_tag LOCUS_16150 1530 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2001 1570 gene locus_tag LOCUS_16160 2001 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 2753 2118 gene locus_tag LOCUS_16170 2753 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3228 2746 gene locus_tag LOCUS_16180 gene coaD 3228 2746 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_16180 3788 3225 gene locus_tag LOCUS_16190 gene rsmD 3788 3225 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_16190 6040 3875 gene locus_tag LOCUS_16200 gene recG 6040 3875 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_16200 7812 6127 gene locus_tag LOCUS_16210 7812 6127 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028485.1 protein_id gnl|my_center|LOCUS_16210 7872 8081 gene locus_tag LOCUS_16220 gene rpmB 7872 8081 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_16220 8364 9542 gene locus_tag LOCUS_16230 8364 9542 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_16230 9539 10327 gene locus_tag LOCUS_16240 9539 10327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_16240 10324 11556 gene locus_tag LOCUS_16250 10324 11556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_16250 11642 12550 gene locus_tag LOCUS_16260 11642 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 12565 14244 gene locus_tag LOCUS_16270 12565 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 15864 14296 gene locus_tag LOCUS_16280 15864 14296 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730237.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence061 471 274 gene locus_tag LOCUS_16290 471 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2036 804 gene locus_tag LOCUS_16300 2036 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5558 2046 gene locus_tag LOCUS_16310 gene metH 5558 2046 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_16310 5712 6344 gene locus_tag LOCUS_16320 5712 6344 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_16320 6338 7924 gene locus_tag LOCUS_16330 6338 7924 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_16330 8384 7899 gene locus_tag LOCUS_16340 8384 7899 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 protein_id gnl|my_center|LOCUS_16340 11014 8381 gene locus_tag LOCUS_16350 11014 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11480 12001 gene locus_tag LOCUS_16360 11480 12001 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_16360 11994 12782 gene locus_tag LOCUS_16370 11994 12782 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_16370 12779 13621 gene locus_tag LOCUS_16380 12779 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 13618 14544 gene locus_tag LOCUS_16390 13618 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 14626 15519 gene locus_tag LOCUS_16400 gene yfeX 14626 15519 CDS product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350538.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence062 447 1583 gene locus_tag LOCUS_16410 447 1583 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_16410 5741 2454 gene locus_tag LOCUS_16420 5741 2454 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_16420 7084 5825 gene locus_tag LOCUS_16430 7084 5825 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 protein_id gnl|my_center|LOCUS_16430 8824 7412 gene locus_tag LOCUS_16440 8824 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10057 9038 gene locus_tag LOCUS_16450 10057 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 10040 10369 gene locus_tag LOCUS_16460 10040 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 10483 11187 gene locus_tag LOCUS_16470 10483 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 11184 11738 gene locus_tag LOCUS_16480 11184 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 13557 11848 gene locus_tag LOCUS_16490 13557 11848 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_16490 14766 13630 gene locus_tag LOCUS_16500 14766 13630 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_16500 15056 14718 gene locus_tag LOCUS_16510 15056 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence063 849 70 gene locus_tag LOCUS_16520 849 70 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_16520 1641 907 gene locus_tag LOCUS_16530 1641 907 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_16530 1808 2113 gene locus_tag LOCUS_16540 1808 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3768 2191 gene locus_tag LOCUS_16550 3768 2191 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_16550 4655 3771 gene locus_tag LOCUS_16560 4655 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 5475 4657 gene locus_tag LOCUS_16570 5475 4657 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_16570 5395 6015 gene locus_tag LOCUS_16580 5395 6015 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_16580 6012 6959 gene locus_tag LOCUS_16590 6012 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 8310 7093 gene locus_tag LOCUS_16600 8310 7093 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_16600 9254 8307 gene locus_tag LOCUS_16610 9254 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 9603 9367 gene locus_tag LOCUS_16620 9603 9367 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_16620 9708 10967 gene locus_tag LOCUS_16630 9708 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 12226 11063 gene locus_tag LOCUS_16640 12226 11063 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104279.1 protein_id gnl|my_center|LOCUS_16640 12272 12982 gene locus_tag LOCUS_16650 12272 12982 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434132.1 protein_id gnl|my_center|LOCUS_16650 12979 14184 gene locus_tag LOCUS_16660 gene nifS 12979 14184 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence064 1185 13 gene locus_tag LOCUS_16670 1185 13 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_16670 1937 1182 gene locus_tag LOCUS_16680 1937 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2893 1934 gene locus_tag LOCUS_16690 2893 1934 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258420.1 protein_id gnl|my_center|LOCUS_16690 3867 2890 gene locus_tag LOCUS_16700 3867 2890 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_16700 4610 3864 gene locus_tag LOCUS_16710 gene cobS 4610 3864 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140155.1 protein_id gnl|my_center|LOCUS_16710 5119 4610 gene locus_tag LOCUS_16720 5119 4610 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085328.1 protein_id gnl|my_center|LOCUS_16720 7194 5119 gene locus_tag LOCUS_16730 7194 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 10748 7191 gene locus_tag LOCUS_16740 gene cobN 10748 7191 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_16740 11464 10745 gene locus_tag LOCUS_16750 11464 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 12990 11461 gene locus_tag LOCUS_16760 12990 11461 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_16760 13209 14018 gene locus_tag LOCUS_16770 13209 14018 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence065 196 62 gene locus_tag LOCUS_16780 196 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1781 264 gene locus_tag LOCUS_16790 1781 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1856 3091 gene locus_tag LOCUS_16800 1856 3091 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_16800 3680 3099 gene locus_tag LOCUS_16810 3680 3099 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731344.1 protein_id gnl|my_center|LOCUS_16810 3896 6055 gene locus_tag LOCUS_16820 3896 6055 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 protein_id gnl|my_center|LOCUS_16820 6544 6287 gene locus_tag LOCUS_16830 6544 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6795 7490 gene locus_tag LOCUS_16840 6795 7490 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_16840 7487 8932 gene locus_tag LOCUS_16850 7487 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 9245 9868 gene locus_tag LOCUS_16860 9245 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 9933 10646 gene locus_tag LOCUS_16870 9933 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 10723 11745 gene locus_tag LOCUS_16880 10723 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 11868 13967 gene locus_tag LOCUS_16890 11868 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence066 177 914 gene locus_tag LOCUS_16900 177 914 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731408.1 protein_id gnl|my_center|LOCUS_16900 1034 1255 gene locus_tag LOCUS_16910 1034 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2504 1242 gene locus_tag LOCUS_16920 2504 1242 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_16920 3367 2801 gene locus_tag LOCUS_16930 gene pyrE 3367 2801 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_16930 4446 3364 gene locus_tag LOCUS_16940 gene purM 4446 3364 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_16940 5996 4443 gene locus_tag LOCUS_16950 gene purF 5996 4443 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085623.1 protein_id gnl|my_center|LOCUS_16950 6125 7144 gene locus_tag LOCUS_16960 6125 7144 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_16960 9505 7199 gene locus_tag LOCUS_16970 gene purL 9505 7199 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_16970 10139 10528 gene locus_tag LOCUS_16980 10139 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 11326 10655 gene locus_tag LOCUS_16990 gene purQ 11326 10655 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383890.1 protein_id gnl|my_center|LOCUS_16990 11637 11326 gene locus_tag LOCUS_17000 gene purS 11637 11326 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125005.1 protein_id gnl|my_center|LOCUS_17000 12530 11634 gene locus_tag LOCUS_17010 12530 11634 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_17010 13897 12530 gene locus_tag LOCUS_17020 gene purB 13897 12530 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence067 2080 932 gene locus_tag LOCUS_17030 2080 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2424 3797 gene locus_tag LOCUS_17040 2424 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3871 4581 gene locus_tag LOCUS_17050 3871 4581 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_17050 4647 5981 gene locus_tag LOCUS_17060 4647 5981 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_17060 7638 5974 gene locus_tag LOCUS_17070 7638 5974 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_17070 8920 7718 gene locus_tag LOCUS_17080 8920 7718 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_17080 10323 9265 gene locus_tag LOCUS_17090 10323 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 10730 10653 gene locus_tag LOCUS_t00280 10730 10653 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12109 11348 gene locus_tag LOCUS_17100 gene fabG 12109 11348 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_17100 12342 13763 gene locus_tag LOCUS_17110 12342 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence068 2903 171 gene locus_tag LOCUS_17120 2903 171 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 protein_id gnl|my_center|LOCUS_17120 3044 4609 gene locus_tag LOCUS_17130 3044 4609 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_17130 4626 5270 gene locus_tag LOCUS_17140 4626 5270 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_17140 6526 5285 gene locus_tag LOCUS_17150 6526 5285 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_17150 6804 8147 gene locus_tag LOCUS_17160 6804 8147 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_17160 8231 9208 gene locus_tag LOCUS_17170 8231 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 10160 9234 gene locus_tag LOCUS_17180 10160 9234 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411454.1 protein_id gnl|my_center|LOCUS_17180 11037 10162 gene locus_tag LOCUS_17190 11037 10162 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087477.1 protein_id gnl|my_center|LOCUS_17190 11231 11545 gene locus_tag LOCUS_17200 11231 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17200 12433 11642 gene locus_tag LOCUS_17210 12433 11642 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797963.1 protein_id gnl|my_center|LOCUS_17210 13098 12430 gene locus_tag LOCUS_17220 gene queC 13098 12430 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_17220 13462 13100 gene locus_tag LOCUS_17230 gene queD 13462 13100 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082502.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence069 <1 1233 gene locus_tag LOCUS_17240 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008193633.1:site-specific DNA-methyltransferase 1358 2161 gene locus_tag LOCUS_17250 1358 2161 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_17250 2149 2664 gene locus_tag LOCUS_17260 2149 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2860 3471 gene locus_tag LOCUS_17270 2860 3471 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_17270 5167 3581 gene locus_tag LOCUS_17280 gene guaA 5167 3581 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_17280 5332 6735 gene locus_tag LOCUS_17290 5332 6735 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_17290 8691 6934 gene locus_tag LOCUS_17300 8691 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8873 9448 gene locus_tag LOCUS_17310 8873 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9554 10021 gene locus_tag LOCUS_17320 9554 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 11097 9961 gene locus_tag LOCUS_17330 11097 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 13763 11295 gene locus_tag LOCUS_17340 13763 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence070 1 435 gene locus_tag LOCUS_17350 1 435 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_17350 1215 466 gene locus_tag LOCUS_17360 gene cobF 1215 466 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 protein_id gnl|my_center|LOCUS_17360 2500 1244 gene locus_tag LOCUS_17370 2500 1244 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_17370 3890 2505 gene locus_tag LOCUS_17380 3890 2505 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_17380 4414 3887 gene locus_tag LOCUS_17390 gene cobO 4414 3887 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_17390 4734 6197 gene locus_tag LOCUS_17400 4734 6197 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_17400 7165 6254 gene locus_tag LOCUS_17410 7165 6254 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_17410 7825 7202 gene locus_tag LOCUS_17420 7825 7202 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392611.1 protein_id gnl|my_center|LOCUS_17420 9585 7828 gene locus_tag LOCUS_17430 gene cobJ 9585 7828 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_17430 10370 9582 gene locus_tag LOCUS_17440 gene cobM 10370 9582 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_17440 11173 10367 gene locus_tag LOCUS_17450 gene cobI 11173 10367 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence071 170 760 gene locus_tag LOCUS_17460 170 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 760 1398 gene locus_tag LOCUS_17470 gene recR 760 1398 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_17470 1395 2111 gene locus_tag LOCUS_17480 1395 2111 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_17480 3539 2187 gene locus_tag LOCUS_17490 3539 2187 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_17490 3538 4878 gene locus_tag LOCUS_17500 gene ccrA 3538 4878 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_17500 4875 5285 gene locus_tag LOCUS_17510 gene mce 4875 5285 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_17510 7219 5309 gene locus_tag LOCUS_17520 7219 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 7466 9010 gene locus_tag LOCUS_17530 7466 9010 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_17530 9007 9309 gene locus_tag LOCUS_17540 9007 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10160 9324 gene locus_tag LOCUS_17550 10160 9324 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_17550 12321 10285 gene locus_tag LOCUS_17560 12321 10285 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_17560 13318 12476 gene locus_tag LOCUS_17570 13318 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence072 305 99 gene locus_tag LOCUS_17580 305 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1206 730 gene locus_tag LOCUS_17590 1206 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1441 2601 gene locus_tag LOCUS_17600 1441 2601 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730961.1 protein_id gnl|my_center|LOCUS_17600 2669 3463 gene locus_tag LOCUS_17610 2669 3463 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_17610 3460 4266 gene locus_tag LOCUS_17620 3460 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5868 4318 gene locus_tag LOCUS_17630 gene fadD4 5868 4318 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_17630 6087 7004 gene locus_tag LOCUS_17640 6087 7004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_17640 8031 7027 gene locus_tag LOCUS_17650 8031 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 9172 8084 gene locus_tag LOCUS_17660 9172 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 9369 10061 gene locus_tag LOCUS_17670 9369 10061 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_17670 11284 9992 gene locus_tag LOCUS_17680 11284 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 13172 11304 gene locus_tag LOCUS_17690 13172 11304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence073 1798 518 gene locus_tag LOCUS_17700 1798 518 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_17700 2043 4184 gene locus_tag LOCUS_17710 2043 4184 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 protein_id gnl|my_center|LOCUS_17710 5255 4230 gene locus_tag LOCUS_17720 5255 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 6628 5444 gene locus_tag LOCUS_17730 6628 5444 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_17730 6828 7181 gene locus_tag LOCUS_17740 6828 7181 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_17740 7178 7450 gene locus_tag LOCUS_17750 7178 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7750 8901 gene locus_tag LOCUS_17760 7750 8901 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_17760 8974 9843 gene locus_tag LOCUS_17770 8974 9843 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_17770 9962 10738 gene locus_tag LOCUS_17780 9962 10738 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024520.1 protein_id gnl|my_center|LOCUS_17780 10803 11843 gene locus_tag LOCUS_17790 10803 11843 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_17790 12468 11890 gene locus_tag LOCUS_17800 12468 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence074 <1 2868 gene locus_tag LOCUS_17810 <1 2868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392105.1:leucine--tRNA ligase 108 33 gene locus_tag LOCUS_t00290 108 33 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3088 2852 gene locus_tag LOCUS_17820 3088 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3087 5321 gene locus_tag LOCUS_17830 3087 5321 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_17830 6419 5412 gene locus_tag LOCUS_17840 6419 5412 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_17840 6727 7215 gene locus_tag LOCUS_17850 6727 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 8101 7196 gene locus_tag LOCUS_17860 8101 7196 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 protein_id gnl|my_center|LOCUS_17860 9192 8098 gene locus_tag LOCUS_17870 9192 8098 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_17870 9570 9737 gene locus_tag LOCUS_17880 9570 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 9902 10300 gene locus_tag LOCUS_17890 9902 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 10484 10621 gene locus_tag LOCUS_17900 10484 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10718 11566 gene locus_tag LOCUS_17910 gene folP 10718 11566 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223256.1 protein_id gnl|my_center|LOCUS_17910 11563 12615 gene locus_tag LOCUS_17920 11563 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence075 <1 1368 gene locus_tag LOCUS_17930 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417912.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1368 2372 gene locus_tag LOCUS_17940 gene hpnH 1368 2372 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_17940 2616 4034 gene locus_tag LOCUS_17950 2616 4034 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_17950 4031 5434 gene locus_tag LOCUS_17960 4031 5434 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_17960 6685 5540 gene locus_tag LOCUS_17970 6685 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 7596 6682 gene locus_tag LOCUS_17980 7596 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7576 8718 gene locus_tag LOCUS_17990 7576 8718 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_17990 8723 9814 gene locus_tag LOCUS_18000 gene mnmA 8723 9814 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 protein_id gnl|my_center|LOCUS_18000 9811 12141 gene locus_tag LOCUS_18010 gene ligA 9811 12141 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence076 618 1262 gene locus_tag LOCUS_18020 618 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1259 2086 gene locus_tag LOCUS_18030 1259 2086 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_18030 2978 2283 gene locus_tag LOCUS_18040 2978 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3282 4820 gene locus_tag LOCUS_18050 3282 4820 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230432.1 protein_id gnl|my_center|LOCUS_18050 6246 4888 gene locus_tag LOCUS_18060 6246 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7299 6313 gene locus_tag LOCUS_18070 7299 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 8240 7296 gene locus_tag LOCUS_18080 8240 7296 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_18080 8631 9989 gene locus_tag LOCUS_18090 8631 9989 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_18090 11621 9942 gene locus_tag LOCUS_18100 11621 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 12546 11902 gene locus_tag LOCUS_18110 12546 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence077 3769 1628 gene locus_tag LOCUS_18120 3769 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3978 5375 gene locus_tag LOCUS_18130 3978 5375 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_18130 6760 5663 gene locus_tag LOCUS_18140 6760 5663 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_18140 7424 6774 gene locus_tag LOCUS_18150 7424 6774 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_18150 7708 8073 gene locus_tag LOCUS_18160 7708 8073 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_18160 8210 9094 gene locus_tag LOCUS_18170 gene panB 8210 9094 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080134253.1 protein_id gnl|my_center|LOCUS_18170 9276 9605 gene locus_tag LOCUS_18180 gene rpsF 9276 9605 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_18180 9609 10082 gene locus_tag LOCUS_18190 9609 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 10169 10549 gene locus_tag LOCUS_18200 10169 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 10551 11003 gene locus_tag LOCUS_18210 gene rplI 10551 11003 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079044.1 protein_id gnl|my_center|LOCUS_18210 11332 12720 gene locus_tag LOCUS_18220 gene dnaB 11332 12720 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence078 311 2329 gene locus_tag LOCUS_18230 311 2329 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_18230 2326 3312 gene locus_tag LOCUS_18240 2326 3312 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_18240 3309 3968 gene locus_tag LOCUS_18250 3309 3968 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_18250 3968 5431 gene locus_tag LOCUS_18260 3968 5431 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_18260 5428 6933 gene locus_tag LOCUS_18270 5428 6933 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_18270 7547 7843 gene locus_tag LOCUS_18280 7547 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 8013 8774 gene locus_tag LOCUS_18290 8013 8774 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_18290 8771 9967 gene locus_tag LOCUS_18300 8771 9967 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_18300 9964 10314 gene locus_tag LOCUS_18310 9964 10314 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_18310 10314 11531 gene locus_tag LOCUS_18320 10314 11531 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_18320 12017 11601 gene locus_tag LOCUS_18330 12017 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 12086 12376 gene locus_tag LOCUS_18340 12086 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 12880 12491 gene locus_tag LOCUS_18350 12880 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence079 1626 385 gene locus_tag LOCUS_18360 1626 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2136 1627 gene locus_tag LOCUS_18370 2136 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2666 2133 gene locus_tag LOCUS_18380 2666 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4219 2663 gene locus_tag LOCUS_18390 4219 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7098 4216 gene locus_tag LOCUS_18400 7098 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7750 7091 gene locus_tag LOCUS_18410 7750 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 8906 7812 gene locus_tag LOCUS_18420 8906 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 9526 8903 gene locus_tag LOCUS_18430 9526 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 12368 9531 gene locus_tag LOCUS_18440 12368 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 12527 12688 gene locus_tag LOCUS_18450 12527 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence080 310 618 gene locus_tag LOCUS_18460 310 618 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229671.1 protein_id gnl|my_center|LOCUS_18460 609 1382 gene locus_tag LOCUS_18470 609 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1398 1658 gene locus_tag LOCUS_18480 1398 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1900 1993 gene locus_tag LOCUS_t00300 1900 1993 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2030 2257 gene locus_tag LOCUS_18490 2030 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3348 2212 gene locus_tag LOCUS_18500 gene arsB 3348 2212 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029172.1 protein_id gnl|my_center|LOCUS_18500 3804 3403 gene locus_tag LOCUS_18510 gene cadI 3804 3403 CDS product cadmium-induced metalloenzyme CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413675.1 protein_id gnl|my_center|LOCUS_18510 3887 4237 gene locus_tag LOCUS_18520 3887 4237 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_18520 5537 4344 gene locus_tag LOCUS_18530 5537 4344 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225002.1 protein_id gnl|my_center|LOCUS_18530 5843 6511 gene locus_tag LOCUS_18540 5843 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6582 7688 gene locus_tag LOCUS_18550 6582 7688 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_18550 7685 8848 gene locus_tag LOCUS_18560 7685 8848 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_18560 8845 9279 gene locus_tag LOCUS_18570 8845 9279 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_18570 9276 10886 gene locus_tag LOCUS_18580 9276 10886 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence081 1136 165 gene locus_tag LOCUS_18590 1136 165 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227084.1 protein_id gnl|my_center|LOCUS_18590 2137 1133 gene locus_tag LOCUS_18600 2137 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3702 2239 gene locus_tag LOCUS_18610 gene gatB 3702 2239 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_18610 5177 3699 gene locus_tag LOCUS_18620 gene gatA 5177 3699 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_18620 5497 5174 gene locus_tag LOCUS_18630 gene gatC 5497 5174 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_18630 6264 5494 gene locus_tag LOCUS_18640 6264 5494 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_18640 6405 6812 gene locus_tag LOCUS_18650 6405 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 8683 6842 gene locus_tag LOCUS_18660 8683 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 9566 8688 gene locus_tag LOCUS_18670 9566 8688 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_18670 10816 9674 gene locus_tag LOCUS_18680 10816 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 11055 10813 gene locus_tag LOCUS_18690 11055 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 12101 11202 gene locus_tag LOCUS_18700 12101 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence082 245 814 gene locus_tag LOCUS_18710 gene scpB 245 814 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_18710 837 1646 gene locus_tag LOCUS_18720 837 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1680 2054 gene locus_tag LOCUS_18730 gene aroH 1680 2054 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_18730 2035 3183 gene locus_tag LOCUS_18740 2035 3183 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_18740 3180 4541 gene locus_tag LOCUS_18750 gene aroA 3180 4541 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141040.1 protein_id gnl|my_center|LOCUS_18750 4538 5182 gene locus_tag LOCUS_18760 gene cmk 4538 5182 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_18760 5161 5856 gene locus_tag LOCUS_18770 5161 5856 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_18770 6758 5913 gene locus_tag LOCUS_18780 6758 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7303 6758 gene locus_tag LOCUS_18790 7303 6758 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_18790 8522 7479 gene locus_tag LOCUS_18800 8522 7479 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405853.1 protein_id gnl|my_center|LOCUS_18800 8630 10075 gene locus_tag LOCUS_18810 8630 10075 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_18810 10150 11544 gene locus_tag LOCUS_18820 gene der 10150 11544 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729299.1 protein_id gnl|my_center|LOCUS_18820 11583 11792 gene locus_tag LOCUS_18830 11583 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence083 1961 1392 gene locus_tag LOCUS_18840 gene frr 1961 1392 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 protein_id gnl|my_center|LOCUS_18840 2787 2038 gene locus_tag LOCUS_18850 gene pyrH 2787 2038 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 protein_id gnl|my_center|LOCUS_18850 3582 2788 gene locus_tag LOCUS_18860 gene tsf 3582 2788 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_18860 4499 3585 gene locus_tag LOCUS_18870 gene rpsB 4499 3585 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893880.1 protein_id gnl|my_center|LOCUS_18870 5541 4690 gene locus_tag LOCUS_18880 gene whiG 5541 4690 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_18880 6489 5551 gene locus_tag LOCUS_18890 6489 5551 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804632.1 protein_id gnl|my_center|LOCUS_18890 6585 8390 gene locus_tag LOCUS_18900 6585 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 8441 9118 gene locus_tag LOCUS_18910 8441 9118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_18910 9146 10687 gene locus_tag LOCUS_18920 9146 10687 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_18920 10684 11325 gene locus_tag LOCUS_18930 10684 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 11861 11409 gene locus_tag LOCUS_18940 11861 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence084 2065 968 gene locus_tag LOCUS_18950 2065 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2457 3794 gene locus_tag LOCUS_18960 2457 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5689 3833 gene locus_tag LOCUS_18970 5689 3833 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_18970 6391 5786 gene locus_tag LOCUS_18980 gene orn 6391 5786 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_18980 6625 7062 gene locus_tag LOCUS_18990 gene dut 6625 7062 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_18990 7181 8767 gene locus_tag LOCUS_19000 7181 8767 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_19000 8907 11456 gene locus_tag LOCUS_19010 8907 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 11535 11608 gene locus_tag LOCUS_t00310 11535 11608 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 930 490 gene locus_tag LOCUS_19020 930 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 961 1122 gene locus_tag LOCUS_19030 961 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1598 1341 gene locus_tag LOCUS_19040 1598 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1651 2145 gene locus_tag LOCUS_19050 1651 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3139 2588 gene locus_tag LOCUS_19060 3139 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3441 3211 gene locus_tag LOCUS_19070 3441 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3337 3624 gene locus_tag LOCUS_19080 3337 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3949 4908 gene locus_tag LOCUS_19090 3949 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4892 5650 gene locus_tag LOCUS_19100 4892 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 7321 6452 gene locus_tag LOCUS_19110 7321 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 7823 7581 gene locus_tag LOCUS_19120 7823 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 7735 8028 gene locus_tag LOCUS_19130 7735 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 8648 8010 gene locus_tag LOCUS_19140 8648 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_19140 8949 9395 gene locus_tag LOCUS_19150 8949 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 9430 9819 gene locus_tag LOCUS_19160 9430 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 9828 11042 gene locus_tag LOCUS_19170 9828 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 11036 11755 gene locus_tag LOCUS_19180 11036 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence086 1895 678 gene locus_tag LOCUS_19190 1895 678 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_19190 2689 1892 gene locus_tag LOCUS_19200 2689 1892 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228704.1 protein_id gnl|my_center|LOCUS_19200 2856 4316 gene locus_tag LOCUS_19210 2856 4316 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_19210 4390 5373 gene locus_tag LOCUS_19220 4390 5373 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_19220 5370 7151 gene locus_tag LOCUS_19230 gene ilvB 5370 7151 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_19230 7180 7554 gene locus_tag LOCUS_19240 7180 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 7740 7570 gene locus_tag LOCUS_19250 7740 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7667 8620 gene locus_tag LOCUS_19260 7667 8620 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_19260 8922 9761 gene locus_tag LOCUS_19270 8922 9761 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223492.1 protein_id gnl|my_center|LOCUS_19270 9761 10819 gene locus_tag LOCUS_19280 9761 10819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727629.1 protein_id gnl|my_center|LOCUS_19280 10961 11518 gene locus_tag LOCUS_19290 10961 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence087 101 1999 gene locus_tag LOCUS_19300 101 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5038 2024 gene locus_tag LOCUS_19310 5038 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 7722 5245 gene locus_tag LOCUS_19320 7722 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8094 8008 gene locus_tag LOCUS_t00320 8094 8008 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8557 8105 gene locus_tag LOCUS_19330 gene tadA 8557 8105 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_19330 8706 8620 gene locus_tag LOCUS_t00330 8706 8620 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9042 10952 gene locus_tag LOCUS_19340 9042 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence088 1812 751 gene locus_tag LOCUS_19350 1812 751 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_19350 1945 3738 gene locus_tag LOCUS_19360 1945 3738 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_19360 5257 3701 gene locus_tag LOCUS_19370 5257 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5458 5694 gene locus_tag LOCUS_19380 5458 5694 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_19380 6922 5777 gene locus_tag LOCUS_19390 6922 5777 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_19390 7089 8132 gene locus_tag LOCUS_19400 gene galK 7089 8132 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_19400 8624 8187 gene locus_tag LOCUS_19410 8624 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 9820 8675 gene locus_tag LOCUS_19420 9820 8675 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_19420 <11345 9933 gene locus_tag LOCUS_19430 <11345 9933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405061.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence089 2 982 gene locus_tag LOCUS_19440 2 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 984 2147 gene locus_tag LOCUS_19450 gene prfB 984 2147 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728139.1 protein_id gnl|my_center|LOCUS_19450 2295 3137 gene locus_tag LOCUS_19460 gene ftsE 2295 3137 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_19460 3137 4027 gene locus_tag LOCUS_19470 gene ftsX 3137 4027 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776048.1 protein_id gnl|my_center|LOCUS_19470 5345 4104 gene locus_tag LOCUS_19480 5345 4104 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531653.1 protein_id gnl|my_center|LOCUS_19480 6372 5836 gene locus_tag LOCUS_19490 6372 5836 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_19490 7409 6369 gene locus_tag LOCUS_19500 7409 6369 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169507384.1 protein_id gnl|my_center|LOCUS_19500 8936 7554 gene locus_tag LOCUS_19510 8936 7554 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_19510 9067 9810 gene locus_tag LOCUS_19520 9067 9810 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_19520 <11187 9870 gene locus_tag LOCUS_19530 <11187 9870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030108.1:AarF/ABC1/UbiB kinase family protein >Feature sequence090 1469 402 gene locus_tag LOCUS_19540 1469 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2477 1497 gene locus_tag LOCUS_19550 2477 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3523 2474 gene locus_tag LOCUS_19560 3523 2474 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_19560 5604 3580 gene locus_tag LOCUS_19570 5604 3580 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_19570 6820 5648 gene locus_tag LOCUS_19580 gene marP 6820 5648 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_19580 7001 7729 gene locus_tag LOCUS_19590 7001 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 8981 7644 gene locus_tag LOCUS_19600 8981 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 9493 9110 gene locus_tag LOCUS_19610 9493 9110 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228875.1 protein_id gnl|my_center|LOCUS_19610 <11125 9557 gene locus_tag LOCUS_19620 <11125 9557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030282.1:MMPL family transporter >Feature sequence091 497 421 gene locus_tag LOCUS_t00340 497 421 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 706 2259 gene locus_tag LOCUS_19630 706 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2956 2300 gene locus_tag LOCUS_19640 2956 2300 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207732.1 protein_id gnl|my_center|LOCUS_19640 3311 3946 gene locus_tag LOCUS_19650 3311 3946 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_19650 4179 3964 gene locus_tag LOCUS_19660 4179 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4085 4342 gene locus_tag LOCUS_19670 gene rpsO 4085 4342 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_19670 4618 6999 gene locus_tag LOCUS_19680 4618 6999 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907967.1 protein_id gnl|my_center|LOCUS_19680 7100 8356 gene locus_tag LOCUS_19690 7100 8356 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_19690 8471 9259 gene locus_tag LOCUS_19700 gene dapB 8471 9259 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_19700 9256 9870 gene locus_tag LOCUS_19710 9256 9870 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_19710 10023 10892 gene locus_tag LOCUS_19720 10023 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence092 479 138 gene locus_tag LOCUS_19730 479 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 687 3284 gene locus_tag LOCUS_19740 687 3284 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089205.1 protein_id gnl|my_center|LOCUS_19740 4815 3340 gene locus_tag LOCUS_19750 4815 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5324 6058 gene locus_tag LOCUS_19760 5324 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 6723 6103 gene locus_tag LOCUS_19770 6723 6103 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_19770 7456 6740 gene locus_tag LOCUS_19780 7456 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 8142 7456 gene locus_tag LOCUS_19790 8142 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 8384 8154 gene locus_tag LOCUS_19800 8384 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 8597 9643 gene locus_tag LOCUS_19810 8597 9643 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_19810 9927 9667 gene locus_tag LOCUS_19820 9927 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence093 1711 1304 gene locus_tag LOCUS_19830 1711 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1858 3096 gene locus_tag LOCUS_19840 1858 3096 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_19840 3093 3629 gene locus_tag LOCUS_19850 3093 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19850 3675 3872 gene locus_tag LOCUS_19860 3675 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19860 5177 3888 gene locus_tag LOCUS_19870 gene serS 5177 3888 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_19870 5205 6278 gene locus_tag LOCUS_19880 5205 6278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_19880 6278 7024 gene locus_tag LOCUS_19890 6278 7024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_19890 7757 7083 gene locus_tag LOCUS_19900 7757 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 8659 7757 gene locus_tag LOCUS_19910 8659 7757 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_19910 8801 9760 gene locus_tag LOCUS_19920 8801 9760 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_19920 9757 10116 gene locus_tag LOCUS_19930 9757 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 10113 10622 gene locus_tag LOCUS_19940 10113 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 10659 10732 gene locus_tag LOCUS_t00350 10659 10732 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10759 10836 gene locus_tag LOCUS_t00360 10759 10836 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10892 10966 gene locus_tag LOCUS_t00370 10892 10966 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence094 <1 904 gene locus_tag LOCUS_19950 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392466.1:beta-ketoacyl-ACP synthase II 999 3935 gene locus_tag LOCUS_19960 999 3935 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222319.1 protein_id gnl|my_center|LOCUS_19960 5242 4037 gene locus_tag LOCUS_19970 5242 4037 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896601.1 protein_id gnl|my_center|LOCUS_19970 5308 6486 gene locus_tag LOCUS_19980 5308 6486 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_19980 6499 7623 gene locus_tag LOCUS_19990 6499 7623 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 protein_id gnl|my_center|LOCUS_19990 8911 7664 gene locus_tag LOCUS_20000 8911 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 9225 9007 gene locus_tag LOCUS_20010 9225 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 9244 10311 gene locus_tag LOCUS_20020 9244 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence095 1139 3112 gene locus_tag LOCUS_20030 1139 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3109 4248 gene locus_tag LOCUS_20040 3109 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 6075 4270 gene locus_tag LOCUS_20050 6075 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 7915 6194 gene locus_tag LOCUS_20060 7915 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8165 8983 gene locus_tag LOCUS_20070 gene cmrA 8165 8983 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730038.1 protein_id gnl|my_center|LOCUS_20070 10417 9179 gene locus_tag LOCUS_20080 10417 9179 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_20080 10276 10368 gene locus_tag LOCUS_t00380 10276 10368 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence096 <1 1430 gene locus_tag LOCUS_20090 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775856.1:Rne/Rng family ribonuclease 1443 1757 gene locus_tag LOCUS_20100 gene rplU 1443 1757 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005989959.1 protein_id gnl|my_center|LOCUS_20100 1826 2095 gene locus_tag LOCUS_20110 gene rpmA 1826 2095 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 protein_id gnl|my_center|LOCUS_20110 2184 3485 gene locus_tag LOCUS_20120 gene obgE 2184 3485 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_20120 3482 4618 gene locus_tag LOCUS_20130 gene proB 3482 4618 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908350.1 protein_id gnl|my_center|LOCUS_20130 4648 5904 gene locus_tag LOCUS_20140 4648 5904 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_20140 5901 6812 gene locus_tag LOCUS_20150 5901 6812 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_20150 6823 8310 gene locus_tag LOCUS_20160 6823 8310 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_20160 8307 9146 gene locus_tag LOCUS_20170 8307 9146 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_20170 10383 9205 gene locus_tag LOCUS_20180 10383 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence097 <1 573 gene locus_tag LOCUS_20190 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338201.1:DNA primase 651 905 gene locus_tag LOCUS_20200 651 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2219 918 gene locus_tag LOCUS_20210 2219 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2429 2355 gene locus_tag LOCUS_t00390 2429 2355 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5020 2546 gene locus_tag LOCUS_20220 5020 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5292 6392 gene locus_tag LOCUS_20230 5292 6392 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228012.1 protein_id gnl|my_center|LOCUS_20230 8411 7011 gene locus_tag LOCUS_20240 8411 7011 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_20240 8770 8408 gene locus_tag LOCUS_20250 8770 8408 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_20250 9999 8767 gene locus_tag LOCUS_20260 9999 8767 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence098 611 1555 gene locus_tag LOCUS_20270 611 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_20270 1794 1501 gene locus_tag LOCUS_20280 1794 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1714 3054 gene locus_tag LOCUS_20290 1714 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3045 3896 gene locus_tag LOCUS_20300 3045 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 3893 4816 gene locus_tag LOCUS_20310 3893 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5030 5233 gene locus_tag LOCUS_20320 5030 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 5230 5658 gene locus_tag LOCUS_20330 5230 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5774 6184 gene locus_tag LOCUS_20340 5774 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 6181 6657 gene locus_tag LOCUS_20350 6181 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6664 9867 gene locus_tag LOCUS_20360 6664 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence099 1403 486 gene locus_tag LOCUS_20370 gene rfbD 1403 486 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_20370 3021 1525 gene locus_tag LOCUS_20380 3021 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3406 4416 gene locus_tag LOCUS_20390 3406 4416 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_20390 4428 4979 gene locus_tag LOCUS_20400 gene rfbC 4428 4979 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_20400 5146 5457 gene locus_tag LOCUS_20410 5146 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 5783 5343 gene locus_tag LOCUS_20420 5783 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 6333 5776 gene locus_tag LOCUS_20430 6333 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 6435 7226 gene locus_tag LOCUS_20440 6435 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9247 7223 gene locus_tag LOCUS_20450 9247 7223 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_20450 9228 9533 gene locus_tag LOCUS_20460 9228 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 9632 9706 gene locus_tag LOCUS_t00400 9632 9706 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 <1 3315 gene locus_tag LOCUS_20470 <1 3315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113008.1:exodeoxyribonuclease V subunit gamma 3312 7040 gene locus_tag LOCUS_20480 3312 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 7064 9061 gene locus_tag LOCUS_20490 gene recD 7064 9061 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 protein_id gnl|my_center|LOCUS_20490 9994 9140 gene locus_tag LOCUS_20500 9994 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence101 423 1187 gene locus_tag LOCUS_20510 423 1187 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_20510 1304 2032 gene locus_tag LOCUS_20520 1304 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3638 2058 gene locus_tag LOCUS_20530 gene gcvPB 3638 2058 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_20530 4981 3635 gene locus_tag LOCUS_20540 gene gcvPA 4981 3635 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_20540 6226 5081 gene locus_tag LOCUS_20550 gene gcvT 6226 5081 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_20550 6674 6285 gene locus_tag LOCUS_20560 6674 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7234 6680 gene locus_tag LOCUS_20570 7234 6680 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_20570 8082 7558 gene locus_tag LOCUS_20580 8082 7558 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence102 2403 130 gene locus_tag LOCUS_20590 2403 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3011 5506 gene locus_tag LOCUS_20600 3011 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 6476 5514 gene locus_tag LOCUS_20610 6476 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 6616 7443 gene locus_tag LOCUS_20620 6616 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence103 184 1608 gene locus_tag LOCUS_20630 gene rodA 184 1608 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_20630 2250 1645 gene locus_tag LOCUS_20640 2250 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20640 3383 2247 gene locus_tag LOCUS_20650 gene rodA 3383 2247 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_20650 4317 3448 gene locus_tag LOCUS_20660 4317 3448 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_20660 5366 4314 gene locus_tag LOCUS_20670 5366 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5841 5368 gene locus_tag LOCUS_20680 gene ruvX 5841 5368 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_20680 8438 5838 gene locus_tag LOCUS_20690 gene alaS 8438 5838 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869780.1 protein_id gnl|my_center|LOCUS_20690 8914 8450 gene locus_tag LOCUS_20700 8914 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 9330 8932 gene locus_tag LOCUS_20710 9330 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence104 351 1034 gene locus_tag LOCUS_20720 351 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1168 2223 gene locus_tag LOCUS_20730 1168 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3973 2294 gene locus_tag LOCUS_20740 3973 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4677 3970 gene locus_tag LOCUS_20750 4677 3970 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_20750 6342 4822 gene locus_tag LOCUS_20760 6342 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6606 6845 gene locus_tag LOCUS_20770 6606 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 8582 7587 gene locus_tag LOCUS_20780 8582 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence105 889 584 gene locus_tag LOCUS_20790 889 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2178 922 gene locus_tag LOCUS_20800 gene nusA 2178 922 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_20800 2768 2175 gene locus_tag LOCUS_20810 2768 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4422 2971 gene locus_tag LOCUS_20820 gene proS 4422 2971 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_20820 5768 4518 gene locus_tag LOCUS_20830 gene ispG 5768 4518 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_20830 7181 5841 gene locus_tag LOCUS_20840 7181 5841 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893934.1 protein_id gnl|my_center|LOCUS_20840 8350 7178 gene locus_tag LOCUS_20850 8350 7178 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_20850 <9418 8369 gene locus_tag LOCUS_20860 <9418 8369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804638.1:phosphatidate cytidylyltransferase >Feature sequence106 2450 162 gene locus_tag LOCUS_20870 2450 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3369 2458 gene locus_tag LOCUS_20880 3369 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4097 3366 gene locus_tag LOCUS_20890 4097 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 5349 4363 gene locus_tag LOCUS_20900 5349 4363 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_20900 6277 5384 gene locus_tag LOCUS_20910 gene truB 6277 5384 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_20910 6744 6274 gene locus_tag LOCUS_20920 6744 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8430 6748 gene locus_tag LOCUS_20930 gene infB 8430 6748 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 protein_id gnl|my_center|LOCUS_20930 8834 8568 gene locus_tag LOCUS_20940 8834 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence107 <1 3511 gene locus_tag LOCUS_20950 <1 3511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030150.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit 3562 4926 gene locus_tag LOCUS_20960 3562 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4984 5403 gene locus_tag LOCUS_20970 gene fabZ 4984 5403 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_20970 5411 6184 gene locus_tag LOCUS_20980 5411 6184 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_20980 7830 6160 gene locus_tag LOCUS_20990 7830 6160 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 protein_id gnl|my_center|LOCUS_20990 7861 8643 gene locus_tag LOCUS_21000 7861 8643 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence108 676 1731 gene locus_tag LOCUS_21010 gene recA 676 1731 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057169.1 protein_id gnl|my_center|LOCUS_21010 3989 1905 gene locus_tag LOCUS_21020 3989 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 5986 3986 gene locus_tag LOCUS_21030 5986 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7697 5976 gene locus_tag LOCUS_21040 gene aftB 7697 5976 CDS product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence109 1631 606 gene locus_tag LOCUS_21050 1631 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2482 1811 gene locus_tag LOCUS_21060 2482 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3342 2434 gene locus_tag LOCUS_21070 3342 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3731 4966 gene locus_tag LOCUS_21080 gene fabF 3731 4966 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_21080 6352 5066 gene locus_tag LOCUS_21090 6352 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 6471 6992 gene locus_tag LOCUS_21100 6471 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 7040 8209 gene locus_tag LOCUS_21110 7040 8209 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence110 3572 603 gene locus_tag LOCUS_21120 3572 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3779 4774 gene locus_tag LOCUS_21130 3779 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 4790 5455 gene locus_tag LOCUS_21140 4790 5455 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_21140 5452 6996 gene locus_tag LOCUS_21150 5452 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 7167 7415 gene locus_tag LOCUS_21160 7167 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence111 450 1787 gene locus_tag LOCUS_21170 450 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2034 1831 gene locus_tag LOCUS_21180 2034 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2184 2429 gene locus_tag LOCUS_21190 2184 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3005 2448 gene locus_tag LOCUS_21200 3005 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3550 3002 gene locus_tag LOCUS_21210 3550 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4151 3543 gene locus_tag LOCUS_21220 4151 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 5489 4164 gene locus_tag LOCUS_21230 gene tyrS 5489 4164 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_21230 5540 6868 gene locus_tag LOCUS_21240 5540 6868 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224852.1 protein_id gnl|my_center|LOCUS_21240 <8200 6896 gene locus_tag LOCUS_21250 <8200 6896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259491.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence112 2131 677 gene locus_tag LOCUS_21260 2131 677 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 protein_id gnl|my_center|LOCUS_21260 4018 2198 gene locus_tag LOCUS_21270 gene aspS 4018 2198 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_21270 5370 4015 gene locus_tag LOCUS_21280 gene hisS 5370 4015 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_21280 7853 5379 gene locus_tag LOCUS_21290 7853 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence113 398 1399 gene locus_tag LOCUS_21300 398 1399 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918150.1 protein_id gnl|my_center|LOCUS_21300 2854 1463 gene locus_tag LOCUS_21310 2854 1463 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_21310 4356 2851 gene locus_tag LOCUS_21320 4356 2851 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_21320 5217 6428 gene locus_tag LOCUS_21330 5217 6428 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_21330 6590 7228 gene locus_tag LOCUS_21340 6590 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence114 129 581 gene locus_tag LOCUS_21350 129 581 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403137.1 protein_id gnl|my_center|LOCUS_21350 1242 802 gene locus_tag LOCUS_21360 1242 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1585 1235 gene locus_tag LOCUS_21370 1585 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1844 1632 gene locus_tag LOCUS_21380 1844 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1902 2363 gene locus_tag LOCUS_21390 1902 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_21390 4324 2462 gene locus_tag LOCUS_21400 4324 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 5389 4511 gene locus_tag LOCUS_21410 5389 4511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_21410 6174 5386 gene locus_tag LOCUS_21420 6174 5386 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_21420 7119 6184 gene locus_tag LOCUS_21430 7119 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence115 1568 1032 gene locus_tag LOCUS_21440 1568 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2221 1565 gene locus_tag LOCUS_21450 2221 1565 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_21450 2521 4704 gene locus_tag LOCUS_21460 2521 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence116 2985 1042 gene locus_tag LOCUS_21470 gene gyrB 2985 1042 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_21470 3486 3157 gene locus_tag LOCUS_21480 3486 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4556 3483 gene locus_tag LOCUS_21490 gene recF 4556 3483 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_21490 5655 4567 gene locus_tag LOCUS_21500 gene dnaN 5655 4567 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400271.1 protein_id gnl|my_center|LOCUS_21500 <7131 6067 gene locus_tag LOCUS_21510 <7131 6067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400253.1:chromosomal replication initiator protein DnaA >Feature sequence117 1235 375 gene locus_tag LOCUS_21520 1235 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2478 1312 gene locus_tag LOCUS_21530 2478 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2569 3888 gene locus_tag LOCUS_21540 gene egtB 2569 3888 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_21540 3962 4882 gene locus_tag LOCUS_21550 gene egtD 3962 4882 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419799.1 protein_id gnl|my_center|LOCUS_21550 6589 5096 gene locus_tag LOCUS_21560 6589 5096 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_21560 6564 7028 gene locus_tag LOCUS_21570 6564 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence118 336 914 gene locus_tag LOCUS_21580 336 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1071 1325 gene locus_tag LOCUS_21590 1071 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1322 1540 gene locus_tag LOCUS_21600 1322 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1669 2568 gene locus_tag LOCUS_21610 1669 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2625 3860 gene locus_tag LOCUS_21620 2625 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4743 3895 gene locus_tag LOCUS_21630 4743 3895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846403.1 protein_id gnl|my_center|LOCUS_21630 5522 4776 gene locus_tag LOCUS_21640 5522 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 6739 5519 gene locus_tag LOCUS_21650 6739 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence119 341 853 gene locus_tag LOCUS_21660 341 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 920 1711 gene locus_tag LOCUS_21670 gene proC 920 1711 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_21670 1728 2666 gene locus_tag LOCUS_21680 1728 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2718 3473 gene locus_tag LOCUS_21690 2718 3473 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_21690 3579 4877 gene locus_tag LOCUS_21700 3579 4877 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727309.1 protein_id gnl|my_center|LOCUS_21700 4924 5886 gene locus_tag LOCUS_21710 gene hemC 4924 5886 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_21710 5838 6611 gene locus_tag LOCUS_21720 5838 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21720 >Feature sequence120 1106 1516 gene locus_tag LOCUS_21730 1106 1516 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_21730 1885 2028 gene locus_tag LOCUS_21740 1885 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2025 2612 gene locus_tag LOCUS_21750 2025 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21750 2768 3412 gene locus_tag LOCUS_21760 2768 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 4358 3468 gene locus_tag LOCUS_21770 4358 3468 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_21770 <6901 4412 gene locus_tag LOCUS_21780 <6901 4412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037563.1:hybrid sensor histidine kinase/response regulator >Feature sequence121 2223 1669 gene locus_tag LOCUS_21790 2223 1669 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_21790 3241 2366 gene locus_tag LOCUS_21800 3241 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21800 3369 4580 gene locus_tag LOCUS_21810 3369 4580 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_21810 4654 5691 gene locus_tag LOCUS_21820 4654 5691 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_21820 6358 5738 gene locus_tag LOCUS_21830 gene phoU 6358 5738 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence122 1874 696 gene locus_tag LOCUS_21840 1874 696 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_21840 2647 1871 gene locus_tag LOCUS_21850 2647 1871 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_21850 3537 2644 gene locus_tag LOCUS_21860 3537 2644 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_21860 4393 3635 gene locus_tag LOCUS_21870 4393 3635 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_21870 4575 5444 gene locus_tag LOCUS_21880 4575 5444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence123 <1 1827 gene locus_tag LOCUS_21890 <1 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224737.1:LCP family protein 2868 1903 gene locus_tag LOCUS_21900 2868 1903 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_21900 3042 4202 gene locus_tag LOCUS_21910 3042 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4409 4801 gene locus_tag LOCUS_21920 4409 4801 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_21920 5640 4924 gene locus_tag LOCUS_21930 5640 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 6284 5859 gene locus_tag LOCUS_21940 6284 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence124 <1 1275 gene locus_tag LOCUS_21950 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393993.1:AAA family ATPase 1259 2227 gene locus_tag LOCUS_21960 1259 2227 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082835.1 protein_id gnl|my_center|LOCUS_21960 3411 2419 gene locus_tag LOCUS_21970 3411 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 3787 3461 gene locus_tag LOCUS_21980 gene trxA 3787 3461 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_21980 4871 3906 gene locus_tag LOCUS_21990 gene trxB 4871 3906 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_21990 5128 4868 gene locus_tag LOCUS_22000 5128 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 5786 5316 gene locus_tag LOCUS_22010 5786 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22010 6149 5793 gene locus_tag LOCUS_22020 6149 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22020 >Feature sequence125 1394 267 gene locus_tag LOCUS_22030 1394 267 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_22030 2356 1394 gene locus_tag LOCUS_22040 2356 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3068 2370 gene locus_tag LOCUS_22050 3068 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3262 4194 gene locus_tag LOCUS_22060 gene cysD 3262 4194 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_22060 4194 5483 gene locus_tag LOCUS_22070 4194 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22070 5534 6124 gene locus_tag LOCUS_22080 5534 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22080 >Feature sequence126 1211 996 gene locus_tag LOCUS_22090 1211 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1428 2372 gene locus_tag LOCUS_22100 1428 2372 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191243275.1 protein_id gnl|my_center|LOCUS_22100 3645 2446 gene locus_tag LOCUS_22110 3645 2446 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057979.1 protein_id gnl|my_center|LOCUS_22110 4114 3638 gene locus_tag LOCUS_22120 4114 3638 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408058.1 protein_id gnl|my_center|LOCUS_22120 5522 4218 gene locus_tag LOCUS_22130 5522 4218 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_22130 5726 5802 gene locus_tag LOCUS_t00410 5726 5802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 1269 928 gene locus_tag LOCUS_22140 1269 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2222 1266 gene locus_tag LOCUS_22150 2222 1266 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_22150 2710 2219 gene locus_tag LOCUS_22160 2710 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4415 2727 gene locus_tag LOCUS_22170 4415 2727 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805674.1 protein_id gnl|my_center|LOCUS_22170 5638 4412 gene locus_tag LOCUS_22180 5638 4412 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence128 2069 1344 gene locus_tag LOCUS_22190 2069 1344 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337557.1 protein_id gnl|my_center|LOCUS_22190 3303 2155 gene locus_tag LOCUS_22200 3303 2155 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_22200 4967 3300 gene locus_tag LOCUS_22210 4967 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 <5900 5026 gene locus_tag LOCUS_22220 <5900 5026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421581.1:2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase >Feature sequence129 475 1515 gene locus_tag LOCUS_22230 gene hemB 475 1515 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080287.1 protein_id gnl|my_center|LOCUS_22230 1508 2818 gene locus_tag LOCUS_22240 gene hemL 1508 2818 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_22240 3886 2843 gene locus_tag LOCUS_22250 3886 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4121 4858 gene locus_tag LOCUS_22260 4121 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4946 5149 gene locus_tag LOCUS_22270 4946 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence130 862 1065 gene locus_tag LOCUS_22280 862 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1062 3263 gene locus_tag LOCUS_22290 1062 3263 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_22290 3260 3640 gene locus_tag LOCUS_22300 3260 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3734 5323 gene locus_tag LOCUS_22310 3734 5323 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363407.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence131 219 944 gene locus_tag LOCUS_22320 219 944 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057268.1 protein_id gnl|my_center|LOCUS_22320 941 2323 gene locus_tag LOCUS_22330 941 2323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_22330 <5518 2565 gene locus_tag LOCUS_22340 <5518 2565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225077.1:cation-translocating P-type ATPase >Feature sequence132 1580 966 gene locus_tag LOCUS_22350 1580 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2187 1648 gene locus_tag LOCUS_22360 2187 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2401 2168 gene locus_tag LOCUS_22370 2401 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2370 2570 gene locus_tag LOCUS_22380 2370 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2654 4063 gene locus_tag LOCUS_22390 2654 4063 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296326.1 protein_id gnl|my_center|LOCUS_22390 4048 5103 gene locus_tag LOCUS_22400 4048 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence133 <1 1681 gene locus_tag LOCUS_22410 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030999.1:xyloglucanase 1829 1662 gene locus_tag LOCUS_22420 1829 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2196 2705 gene locus_tag LOCUS_22430 2196 2705 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111791.1 protein_id gnl|my_center|LOCUS_22430 3527 2757 gene locus_tag LOCUS_22440 3527 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4402 3527 gene locus_tag LOCUS_22450 4402 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4637 5335 gene locus_tag LOCUS_22460 4637 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence134 1019 159 gene locus_tag LOCUS_22470 1019 159 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_22470 1698 1051 gene locus_tag LOCUS_22480 gene bluB 1698 1051 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_22480 1791 3203 gene locus_tag LOCUS_22490 1791 3203 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_22490 4535 3291 gene locus_tag LOCUS_22500 4535 3291 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 protein_id gnl|my_center|LOCUS_22500 <5398 4535 gene locus_tag LOCUS_22510 <5398 4535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094791896.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence135 892 395 gene locus_tag LOCUS_22520 892 395 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975229.1 protein_id gnl|my_center|LOCUS_22520 2235 1603 gene locus_tag LOCUS_22530 2235 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2582 2232 gene locus_tag LOCUS_22540 2582 2232 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387990.1 protein_id gnl|my_center|LOCUS_22540 2762 3133 gene locus_tag LOCUS_22550 2762 3133 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941172.1 protein_id gnl|my_center|LOCUS_22550 3975 3181 gene locus_tag LOCUS_22560 3975 3181 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538278.1 protein_id gnl|my_center|LOCUS_22560 4412 3972 gene locus_tag LOCUS_22570 4412 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence136 1369 587 gene locus_tag LOCUS_22580 1369 587 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_22580 1899 1366 gene locus_tag LOCUS_22590 1899 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3369 1963 gene locus_tag LOCUS_22600 3369 1963 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence137 466 1407 gene locus_tag LOCUS_22610 466 1407 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_22610 1431 2972 gene locus_tag LOCUS_22620 1431 2972 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111097.1 protein_id gnl|my_center|LOCUS_22620 5020 3368 gene locus_tag LOCUS_22630 5020 3368 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence138 322 1356 gene locus_tag LOCUS_22640 322 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1564 1346 gene locus_tag LOCUS_22650 1564 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2819 1899 gene locus_tag LOCUS_22660 2819 1899 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_22660 2953 3879 gene locus_tag LOCUS_22670 2953 3879 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_22670 4399 4133 gene locus_tag LOCUS_22680 gene mhuD 4399 4133 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731028.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence139 792 1637 gene locus_tag LOCUS_22690 792 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2378 1734 gene locus_tag LOCUS_22700 2378 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2432 3688 gene locus_tag LOCUS_22710 2432 3688 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence140 3524 2814 gene locus_tag LOCUS_22720 3524 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4948 3521 gene locus_tag LOCUS_22730 4948 3521 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence141 258 1766 gene locus_tag LOCUS_22740 258 1766 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_22740 1824 2738 gene locus_tag LOCUS_22750 1824 2738 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_22750 2844 3299 gene locus_tag LOCUS_22760 2844 3299 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726705.1 protein_id gnl|my_center|LOCUS_22760 3378 3869 gene locus_tag LOCUS_22770 3378 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 <4908 3956 gene locus_tag LOCUS_22780 <4908 3956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941161.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence142 <1 1040 gene locus_tag LOCUS_22790 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021981.1:IS1182-like element ISMac2 family transposase 1397 1322 gene locus_tag LOCUS_t00420 1397 1322 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2622 1468 gene locus_tag LOCUS_22800 2622 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3079 2813 gene locus_tag LOCUS_22810 3079 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 4396 3518 gene locus_tag LOCUS_22820 4396 3518 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706367.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence143 811 359 gene locus_tag LOCUS_22830 811 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1458 808 gene locus_tag LOCUS_22840 1458 808 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_22840 1972 1469 gene locus_tag LOCUS_22850 1972 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2102 3445 gene locus_tag LOCUS_22860 2102 3445 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence144 973 2568 gene locus_tag LOCUS_22870 973 2568 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_22870 2642 2717 gene locus_tag LOCUS_t00430 2642 2717 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2769 3167 gene locus_tag LOCUS_22880 2769 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22880 >Feature sequence145 473 1258 gene locus_tag LOCUS_22890 473 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1432 2307 gene locus_tag LOCUS_22900 gene hpnC 1432 2307 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_22900 2304 3146 gene locus_tag LOCUS_22910 gene hpnD 2304 3146 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence146 84 374 gene locus_tag LOCUS_22920 84 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 391 1227 gene locus_tag LOCUS_22930 gene rplB 391 1227 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 protein_id gnl|my_center|LOCUS_22930 1249 1527 gene locus_tag LOCUS_22940 gene rpsS 1249 1527 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_22940 1527 2222 gene locus_tag LOCUS_22950 1527 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2223 3242 gene locus_tag LOCUS_22960 gene rpsC 2223 3242 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_22960 3244 3681 gene locus_tag LOCUS_22970 gene rplP 3244 3681 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_22970 3681 4151 gene locus_tag LOCUS_22980 3681 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence147 616 2676 gene locus_tag LOCUS_22990 616 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence148 2055 973 gene locus_tag LOCUS_23000 2055 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3891 2203 gene locus_tag LOCUS_23010 3891 2203 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence149 1360 1037 gene locus_tag LOCUS_23020 1360 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1516 2037 gene locus_tag LOCUS_23030 1516 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1964 2329 gene locus_tag LOCUS_23040 1964 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2326 2709 gene locus_tag LOCUS_23050 2326 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2719 3657 gene locus_tag LOCUS_23060 2719 3657 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226732.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence150 113 1453 gene locus_tag LOCUS_23070 113 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1506 2216 gene locus_tag LOCUS_23080 1506 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3381 2236 gene locus_tag LOCUS_23090 3381 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence151 655 1149 gene locus_tag LOCUS_23100 655 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1314 1709 gene locus_tag LOCUS_23110 1314 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1780 3081 gene locus_tag LOCUS_23120 gene flgE 1780 3081 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence152 1993 1088 gene locus_tag LOCUS_23130 1993 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2993 1983 gene locus_tag LOCUS_23140 gene fliG 2993 1983 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460758.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence153 <1 919 gene locus_tag LOCUS_23150 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938190.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1403 945 gene locus_tag LOCUS_23160 1403 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2302 1649 gene locus_tag LOCUS_23170 2302 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2364 3050 gene locus_tag LOCUS_23180 2364 3050 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence154 265 1863 gene locus_tag LOCUS_23190 265 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2787 1897 gene locus_tag LOCUS_23200 2787 1897 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_23200 3337 2825 gene locus_tag LOCUS_23210 3337 2825 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence155 1756 1055 gene locus_tag LOCUS_23220 gene pgsA 1756 1055 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_23220 3147 1753 gene locus_tag LOCUS_23230 gene rimO 3147 1753 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392588.1 protein_id gnl|my_center|LOCUS_23230 3289 3198 gene locus_tag LOCUS_t00440 3289 3198 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 3370 1118 gene locus_tag LOCUS_23240 3370 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence157 89 553 gene locus_tag LOCUS_23250 gene bcp 89 553 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_23250 1353 571 gene locus_tag LOCUS_23260 1353 571 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_23260 1945 1361 gene locus_tag LOCUS_23270 1945 1361 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 protein_id gnl|my_center|LOCUS_23270 2076 3200 gene locus_tag LOCUS_23280 2076 3200 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence158 <1 758 gene locus_tag LOCUS_23290 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976309.1:pyruvate, phosphate dikinase 832 2757 gene locus_tag LOCUS_23300 832 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence159 121 1173 gene locus_tag LOCUS_23310 121 1173 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_23310 1175 3100 gene locus_tag LOCUS_23320 gene shc 1175 3100 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence160 822 226 gene locus_tag LOCUS_23330 gene nadD 822 226 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_23330 1761 829 gene locus_tag LOCUS_23340 1761 829 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414686.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence161 222 1601 gene locus_tag LOCUS_23350 222 1601 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_23350 1847 1620 gene locus_tag LOCUS_23360 1847 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence162 88 606 gene locus_tag LOCUS_23370 gene rnhA 88 606 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228761.1 protein_id gnl|my_center|LOCUS_23370 691 1068 gene locus_tag LOCUS_23380 691 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1234 2760 gene locus_tag LOCUS_23390 gene lpdA 1234 2760 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence163 2533 1334 gene locus_tag LOCUS_23400 2533 1334 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence164 <1 987 gene locus_tag LOCUS_23410 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027564.1:electron transfer flavoprotein subunit alpha/FixB family protein 1916 1134 gene locus_tag LOCUS_23420 1916 1134 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_23420 2374 1877 gene locus_tag LOCUS_23430 2374 1877 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_23430 <2931 2371 gene locus_tag LOCUS_23440 <2931 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014086.1:histidine phosphatase family protein >Feature sequence165 1247 483 gene locus_tag LOCUS_23450 gene cobM 1247 483 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_23450 2146 1244 gene locus_tag LOCUS_23460 gene cobI 2146 1244 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_23460 <2780 2190 gene locus_tag LOCUS_23470 <2780 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028009.1:cobyrinate a,c-diamide synthase >Feature sequence166 928 239 gene locus_tag LOCUS_23480 928 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23480 1121 2056 gene locus_tag LOCUS_23490 1121 2056 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226614.1 protein_id gnl|my_center|LOCUS_23490 2504 2163 gene locus_tag LOCUS_23500 2504 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence167 <1 909 gene locus_tag LOCUS_23510 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416640.1:ATP-binding protein 1164 2450 gene locus_tag LOCUS_23520 1164 2450 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence168 155 757 gene locus_tag LOCUS_23530 155 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1437 772 gene locus_tag LOCUS_23540 1437 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2003 1434 gene locus_tag LOCUS_23550 2003 1434 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975339.1 protein_id gnl|my_center|LOCUS_23550 2111 2479 gene locus_tag LOCUS_23560 2111 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence169 270 1157 gene locus_tag LOCUS_23570 270 1157 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_23570 <2278 1214 gene locus_tag LOCUS_23580 <2278 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972254.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence170 <1 918 gene locus_tag LOCUS_23590 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114813.1:alpha/beta hydrolase >Feature sequence171 1616 642 gene locus_tag LOCUS_23600 1616 642 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence172 1851 691 gene locus_tag LOCUS_23610 1851 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence173 935 1156 gene locus_tag LOCUS_23620 935 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1177 1539 gene locus_tag LOCUS_23630 1177 1539 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_23630 1536 1940 gene locus_tag LOCUS_23640 1536 1940 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence174 1160 891 gene locus_tag LOCUS_23650 1160 891 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_23650 1315 1935 gene locus_tag LOCUS_23660 1315 1935 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence175 <1950 1312 gene locus_tag LOCUS_23670 <1950 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228791.1:ABC transporter ATP-binding protein >Feature sequence176 1332 616 gene locus_tag LOCUS_23680 1332 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 1736 1332 gene locus_tag LOCUS_23690 1736 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence177 >Feature sequence178 144 605 gene locus_tag LOCUS_23700 144 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 602 1696 gene locus_tag LOCUS_23710 602 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence179 515 1597 gene locus_tag LOCUS_23720 gene trpS 515 1597 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence180 >Feature sequence181 597 166 gene locus_tag LOCUS_23730 597 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1003 758 gene locus_tag LOCUS_23740 1003 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1682 1005 gene locus_tag LOCUS_23750 1682 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence182 <1781 1272 gene locus_tag LOCUS_23760 <1781 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940684.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence183 <1 1251 gene locus_tag LOCUS_23770 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226548.1:acyl-CoA dehydrogenase family protein >Feature sequence184 207 941 gene locus_tag LOCUS_23780 gene frnE 207 941 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_23780 946 1497 gene locus_tag LOCUS_23790 946 1497 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence185 211 1398 gene locus_tag LOCUS_23800 211 1398 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence186 >Feature sequence187 283 669 gene locus_tag LOCUS_23810 283 669 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_23810 708 1070 gene locus_tag LOCUS_23820 708 1070 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_23820