>Feature sequence01 556 377 gene locus_tag LOCUS_00010 556 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1850 870 gene locus_tag LOCUS_00020 1850 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2242 3438 gene locus_tag LOCUS_00030 2242 3438 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_00030 4284 3709 gene locus_tag LOCUS_00040 4284 3709 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_00040 4973 4446 gene locus_tag LOCUS_00050 4973 4446 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_00050 5905 4970 gene locus_tag LOCUS_00060 5905 4970 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_00060 6493 6185 gene locus_tag LOCUS_00070 6493 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7043 6756 gene locus_tag LOCUS_00080 7043 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 8533 7703 gene locus_tag LOCUS_00090 8533 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8949 8680 gene locus_tag LOCUS_00100 8949 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9218 8946 gene locus_tag LOCUS_00110 9218 8946 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_00110 10627 9419 gene locus_tag LOCUS_00120 10627 9419 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815840.1 protein_id gnl|my_center|LOCUS_00120 11292 10657 gene locus_tag LOCUS_00130 gene gstA 11292 10657 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 protein_id gnl|my_center|LOCUS_00130 11432 12202 gene locus_tag LOCUS_00140 11432 12202 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007538352.1 protein_id gnl|my_center|LOCUS_00140 12221 12964 gene locus_tag LOCUS_00150 12221 12964 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085391.1 protein_id gnl|my_center|LOCUS_00150 12969 13574 gene locus_tag LOCUS_00160 12969 13574 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174966.1 protein_id gnl|my_center|LOCUS_00160 14395 14718 gene locus_tag LOCUS_00170 14395 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15432 14797 gene locus_tag LOCUS_00180 15432 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15697 17061 gene locus_tag LOCUS_00190 15697 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17084 18343 gene locus_tag LOCUS_00200 17084 18343 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_00200 19139 18423 gene locus_tag LOCUS_00210 19139 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20860 19136 gene locus_tag LOCUS_00220 20860 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21667 21059 gene locus_tag LOCUS_00230 21667 21059 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275226.1 protein_id gnl|my_center|LOCUS_00230 22892 22539 gene locus_tag LOCUS_00240 22892 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23033 23728 gene locus_tag LOCUS_00250 23033 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24737 23850 gene locus_tag LOCUS_00260 24737 23850 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_00260 26110 24983 gene locus_tag LOCUS_00270 gene nagA 26110 24983 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704755.1 protein_id gnl|my_center|LOCUS_00270 26386 26135 gene locus_tag LOCUS_00280 26386 26135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26677 27585 gene locus_tag LOCUS_00290 26677 27585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27949 28440 gene locus_tag LOCUS_00300 27949 28440 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_00300 28630 29346 gene locus_tag LOCUS_00310 gene ispD 28630 29346 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_00310 30173 29349 gene locus_tag LOCUS_00320 gene larE 30173 29349 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_00320 31376 30441 gene locus_tag LOCUS_00330 gene cysK 31376 30441 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_00330 32999 31467 gene locus_tag LOCUS_00340 32999 31467 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 protein_id gnl|my_center|LOCUS_00340 34478 33093 gene locus_tag LOCUS_00350 34478 33093 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022072.1 protein_id gnl|my_center|LOCUS_00350 35050 34676 gene locus_tag LOCUS_00360 35050 34676 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259041.1 protein_id gnl|my_center|LOCUS_00360 35660 35112 gene locus_tag LOCUS_00370 35660 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36673 35924 gene locus_tag LOCUS_00380 gene fabG 36673 35924 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_00380 37315 36896 gene locus_tag LOCUS_00390 37315 36896 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083271.1 protein_id gnl|my_center|LOCUS_00390 38776 37328 gene locus_tag LOCUS_00400 gene atpD 38776 37328 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_00400 39813 38929 gene locus_tag LOCUS_00410 39813 38929 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530300.1 protein_id gnl|my_center|LOCUS_00410 41382 39838 gene locus_tag LOCUS_00420 gene atpA 41382 39838 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_00420 41941 41408 gene locus_tag LOCUS_00430 41941 41408 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_00430 42528 41941 gene locus_tag LOCUS_00440 42528 41941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42992 42525 gene locus_tag LOCUS_00450 42992 42525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43645 43091 gene locus_tag LOCUS_00460 43645 43091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 45894 44197 gene locus_tag LOCUS_00470 45894 44197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46180 46578 gene locus_tag LOCUS_00480 46180 46578 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_00480 47009 47998 gene locus_tag LOCUS_00490 47009 47998 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_00490 47995 48897 gene locus_tag LOCUS_00500 47995 48897 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_00500 49243 50463 gene locus_tag LOCUS_00510 49243 50463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_00510 52774 50696 gene locus_tag LOCUS_00520 52774 50696 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_00520 54204 53353 gene locus_tag LOCUS_00530 54204 53353 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_00530 54851 56341 gene locus_tag LOCUS_00540 54851 56341 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 protein_id gnl|my_center|LOCUS_00540 56650 57252 gene locus_tag LOCUS_00550 56650 57252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57327 58538 gene locus_tag LOCUS_00560 57327 58538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58617 58814 gene locus_tag LOCUS_00570 58617 58814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58890 59153 gene locus_tag LOCUS_00580 58890 59153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59092 59409 gene locus_tag LOCUS_00590 59092 59409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 59669 59448 gene locus_tag LOCUS_00600 59669 59448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60063 59713 gene locus_tag LOCUS_00610 60063 59713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 60314 60045 gene locus_tag LOCUS_00620 60314 60045 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108222469.1 protein_id gnl|my_center|LOCUS_00620 60627 60388 gene locus_tag LOCUS_00630 60627 60388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 61197 60628 gene locus_tag LOCUS_00640 61197 60628 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087829.1 protein_id gnl|my_center|LOCUS_00640 62372 61227 gene locus_tag LOCUS_00650 gene ispG 62372 61227 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_00650 62743 62408 gene locus_tag LOCUS_00660 62743 62408 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015477.1 protein_id gnl|my_center|LOCUS_00660 63461 63228 gene locus_tag LOCUS_00670 63461 63228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 63858 63436 gene locus_tag LOCUS_00680 63858 63436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 64559 64065 gene locus_tag LOCUS_00690 gene purE 64559 64065 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_00690 65465 64590 gene locus_tag LOCUS_00700 65465 64590 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_00700 66325 65465 gene locus_tag LOCUS_00710 66325 65465 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_00710 67387 66530 gene locus_tag LOCUS_00720 67387 66530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 69342 67450 gene locus_tag LOCUS_00730 gene mnmG 69342 67450 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_00730 70954 69575 gene locus_tag LOCUS_00740 gene mnmE 70954 69575 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_00740 71491 71754 gene locus_tag LOCUS_00750 71491 71754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 71744 72064 gene locus_tag LOCUS_00760 71744 72064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 72069 73754 gene locus_tag LOCUS_00770 gene yidC 72069 73754 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938376.1 protein_id gnl|my_center|LOCUS_00770 74246 74725 gene locus_tag LOCUS_00780 74246 74725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 74895 75629 gene locus_tag LOCUS_00790 74895 75629 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_00790 75710 76282 gene locus_tag LOCUS_00800 gene def 75710 76282 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268642.1 protein_id gnl|my_center|LOCUS_00800 76515 78131 gene locus_tag LOCUS_00810 76515 78131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79780 80421 gene locus_tag LOCUS_00820 79780 80421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 81042 80575 gene locus_tag LOCUS_00830 gene tadA 81042 80575 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_00830 81332 82090 gene locus_tag LOCUS_00840 gene truA 81332 82090 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_00840 82269 82550 gene locus_tag LOCUS_00850 gene hupB 82269 82550 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 protein_id gnl|my_center|LOCUS_00850 84070 82697 gene locus_tag LOCUS_00860 84070 82697 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_00860 84209 85468 gene locus_tag LOCUS_00870 84209 85468 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_00870 86324 85509 gene locus_tag LOCUS_00880 86324 85509 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_00880 87139 86423 gene locus_tag LOCUS_00890 87139 86423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 87410 87162 gene locus_tag LOCUS_00900 87410 87162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 88117 87539 gene locus_tag LOCUS_00910 88117 87539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88193 89161 gene locus_tag LOCUS_00920 88193 89161 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634869.1 protein_id gnl|my_center|LOCUS_00920 89351 89563 gene locus_tag LOCUS_00930 89351 89563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 89583 90041 gene locus_tag LOCUS_00940 89583 90041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 90409 90049 gene locus_tag LOCUS_tm00010 90409 90049 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 90522 91013 gene locus_tag LOCUS_00950 gene smpB 90522 91013 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_00950 91121 91209 gene locus_tag LOCUS_t00010 91121 91209 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 91743 91381 gene locus_tag LOCUS_00960 91743 91381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 92112 92252 gene locus_tag LOCUS_00970 92112 92252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 93861 92641 gene locus_tag LOCUS_00980 93861 92641 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_00980 95167 93947 gene locus_tag LOCUS_00990 95167 93947 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 protein_id gnl|my_center|LOCUS_00990 96995 95343 gene locus_tag LOCUS_01000 96995 95343 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965432.1 protein_id gnl|my_center|LOCUS_01000 97690 96992 gene locus_tag LOCUS_01010 97690 96992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 98528 97806 gene locus_tag LOCUS_01020 98528 97806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 99120 98536 gene locus_tag LOCUS_01030 99120 98536 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892139.1 protein_id gnl|my_center|LOCUS_01030 100004 99225 gene locus_tag LOCUS_01040 100004 99225 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 protein_id gnl|my_center|LOCUS_01040 101229 100021 gene locus_tag LOCUS_01050 101229 100021 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_01050 102063 101260 gene locus_tag LOCUS_01060 102063 101260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_01060 102833 102057 gene locus_tag LOCUS_01070 102833 102057 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_01070 104172 102826 gene locus_tag LOCUS_01080 104172 102826 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_01080 105244 104177 gene locus_tag LOCUS_01090 105244 104177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 106390 105272 gene locus_tag LOCUS_01100 106390 105272 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808803.1 protein_id gnl|my_center|LOCUS_01100 107663 106473 gene locus_tag LOCUS_01110 107663 106473 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_01110 108870 107722 gene locus_tag LOCUS_01120 108870 107722 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727137.1 protein_id gnl|my_center|LOCUS_01120 110438 108888 gene locus_tag LOCUS_01130 110438 108888 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090595.1 protein_id gnl|my_center|LOCUS_01130 111552 110425 gene locus_tag LOCUS_01140 111552 110425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530840.1 protein_id gnl|my_center|LOCUS_01140 113759 111555 gene locus_tag LOCUS_01150 113759 111555 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090593.1 protein_id gnl|my_center|LOCUS_01150 114902 113772 gene locus_tag LOCUS_01160 114902 113772 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090592.1 protein_id gnl|my_center|LOCUS_01160 116117 114906 gene locus_tag LOCUS_01170 116117 114906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090591.1 protein_id gnl|my_center|LOCUS_01170 116722 116264 gene locus_tag LOCUS_01180 116722 116264 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_01180 117029 117910 gene locus_tag LOCUS_01190 117029 117910 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_01190 119652 118123 gene locus_tag LOCUS_01200 119652 118123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 120578 120111 gene locus_tag LOCUS_01210 120578 120111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 121729 120743 gene locus_tag LOCUS_01220 121729 120743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 124201 122555 gene locus_tag LOCUS_01230 124201 122555 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969590.1 protein_id gnl|my_center|LOCUS_01230 125013 124198 gene locus_tag LOCUS_01240 125013 124198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311615.1 protein_id gnl|my_center|LOCUS_01240 125940 125020 gene locus_tag LOCUS_01250 125940 125020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528534.1 protein_id gnl|my_center|LOCUS_01250 126952 126038 gene locus_tag LOCUS_01260 126952 126038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 127588 127034 gene locus_tag LOCUS_01270 gene thpR 127588 127034 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392592.1 protein_id gnl|my_center|LOCUS_01270 128658 127714 gene locus_tag LOCUS_01280 128658 127714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 128840 129673 gene locus_tag LOCUS_01290 128840 129673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 130326 129883 gene locus_tag LOCUS_01300 130326 129883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 130840 131148 gene locus_tag LOCUS_01310 130840 131148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 131642 131232 gene locus_tag LOCUS_01320 131642 131232 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633600.1 protein_id gnl|my_center|LOCUS_01320 131980 131675 gene locus_tag LOCUS_01330 131980 131675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 133362 132304 gene locus_tag LOCUS_01340 133362 132304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_01340 134107 133877 gene locus_tag LOCUS_01350 134107 133877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 135226 134411 gene locus_tag LOCUS_01360 135226 134411 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_01360 135516 135280 gene locus_tag LOCUS_01370 135516 135280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 137445 135865 gene locus_tag LOCUS_01380 137445 135865 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_01380 138859 137816 gene locus_tag LOCUS_01390 138859 137816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_01390 140334 139210 gene locus_tag LOCUS_01400 gene ugpC 140334 139210 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975885.1 protein_id gnl|my_center|LOCUS_01400 140719 140432 gene locus_tag LOCUS_01410 140719 140432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 141569 140727 gene locus_tag LOCUS_01420 141569 140727 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_01420 142457 141573 gene locus_tag LOCUS_01430 142457 141573 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243183.1 protein_id gnl|my_center|LOCUS_01430 144037 142577 gene locus_tag LOCUS_01440 144037 142577 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_01440 145317 144394 gene locus_tag LOCUS_01450 145317 144394 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_01450 146155 145385 gene locus_tag LOCUS_01460 146155 145385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 147152 146166 gene locus_tag LOCUS_01470 147152 146166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 149621 147252 gene locus_tag LOCUS_01480 149621 147252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 151714 149627 gene locus_tag LOCUS_01490 151714 149627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 153333 151720 gene locus_tag LOCUS_01500 153333 151720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 154041 153433 gene locus_tag LOCUS_01510 154041 153433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 155434 154130 gene locus_tag LOCUS_01520 155434 154130 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258510.1 protein_id gnl|my_center|LOCUS_01520 155966 156433 gene locus_tag LOCUS_01530 155966 156433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 156434 158113 gene locus_tag LOCUS_01540 156434 158113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 158130 158549 gene locus_tag LOCUS_01550 158130 158549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 158810 159220 gene locus_tag LOCUS_01560 158810 159220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 159111 159854 gene locus_tag LOCUS_01570 159111 159854 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_01570 161080 160136 gene locus_tag LOCUS_01580 gene selD 161080 160136 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_01580 163268 161337 gene locus_tag LOCUS_01590 gene selB 163268 161337 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_01590 163416 164954 gene locus_tag LOCUS_01600 gene cysS 163416 164954 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_01600 165047 165919 gene locus_tag LOCUS_01610 165047 165919 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_01610 166018 167073 gene locus_tag LOCUS_01620 gene ltaE 166018 167073 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_01620 168272 167337 gene locus_tag LOCUS_01630 168272 167337 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_01630 168780 169139 gene locus_tag LOCUS_01640 168780 169139 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_01640 169163 169981 gene locus_tag LOCUS_01650 169163 169981 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_01650 170022 170903 gene locus_tag LOCUS_01660 170022 170903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 170944 172110 gene locus_tag LOCUS_01670 gene arsB 170944 172110 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 protein_id gnl|my_center|LOCUS_01670 172276 172857 gene locus_tag LOCUS_01680 gene pgsA 172276 172857 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_01680 172906 172982 gene locus_tag LOCUS_t00020 172906 172982 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 173790 173551 gene locus_tag LOCUS_01690 173790 173551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 174916 173864 gene locus_tag LOCUS_01700 174916 173864 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776854.1 protein_id gnl|my_center|LOCUS_01700 176179 175154 gene locus_tag LOCUS_01710 176179 175154 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_01710 176456 176767 gene locus_tag LOCUS_01720 176456 176767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 178557 179873 gene locus_tag LOCUS_01730 178557 179873 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031662.1 protein_id gnl|my_center|LOCUS_01730 180709 179969 gene locus_tag LOCUS_01740 180709 179969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 181026 182759 gene locus_tag LOCUS_01750 181026 182759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01750 182768 184225 gene locus_tag LOCUS_01760 182768 184225 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_01760 184308 184913 gene locus_tag LOCUS_01770 184308 184913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 185084 185368 gene locus_tag LOCUS_01780 185084 185368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 186118 186324 gene locus_tag LOCUS_01790 186118 186324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 187892 186630 gene locus_tag LOCUS_01800 187892 186630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 188051 190012 gene locus_tag LOCUS_01810 188051 190012 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_01810 190193 191683 gene locus_tag LOCUS_01820 190193 191683 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_01820 193482 192046 gene locus_tag LOCUS_01830 gene rtcB 193482 192046 CDS product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 protein_id gnl|my_center|LOCUS_01830 194068 193643 gene locus_tag LOCUS_01840 194068 193643 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545771.1 protein_id gnl|my_center|LOCUS_01840 194402 196375 gene locus_tag LOCUS_01850 gene hemE 194402 196375 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121588.1 protein_id gnl|my_center|LOCUS_01850 196372 197313 gene locus_tag LOCUS_01860 196372 197313 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_01860 197401 197886 gene locus_tag LOCUS_01870 197401 197886 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_01870 198143 198553 gene locus_tag LOCUS_01880 198143 198553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 198989 200560 gene locus_tag LOCUS_01890 gene hemG 198989 200560 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_01890 200612 202075 gene locus_tag LOCUS_01900 gene leuC 200612 202075 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_01900 202099 202704 gene locus_tag LOCUS_01910 gene leuD 202099 202704 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267363.1 protein_id gnl|my_center|LOCUS_01910 202869 203789 gene locus_tag LOCUS_01920 202869 203789 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 204320 205735 gene locus_tag LOCUS_01930 gene rho 204320 205735 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_01930 205831 206595 gene locus_tag LOCUS_01940 gene rpsB 205831 206595 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_01940 206861 207481 gene locus_tag LOCUS_01950 gene tsf 206861 207481 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_01950 207735 208484 gene locus_tag LOCUS_01960 gene pyrH 207735 208484 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_01960 208489 209061 gene locus_tag LOCUS_01970 gene frr 208489 209061 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_01970 209105 209866 gene locus_tag LOCUS_01980 209105 209866 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_01980 209874 210653 gene locus_tag LOCUS_01990 209874 210653 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_01990 210695 212080 gene locus_tag LOCUS_02000 210695 212080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 212052 212810 gene locus_tag LOCUS_02010 gene tsaB 212052 212810 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_02010 212843 213070 gene locus_tag LOCUS_02020 212843 213070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 213151 213672 gene locus_tag LOCUS_02030 gene ilvN 213151 213672 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_02030 213673 214689 gene locus_tag LOCUS_02040 gene ilvC 213673 214689 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_02040 214695 215390 gene locus_tag LOCUS_02050 214695 215390 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_02050 215387 216289 gene locus_tag LOCUS_02060 gene pssA 215387 216289 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_02060 216366 216605 gene locus_tag LOCUS_02070 216366 216605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 218076 216736 gene locus_tag LOCUS_02080 218076 216736 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838492.1 protein_id gnl|my_center|LOCUS_02080 218849 218076 gene locus_tag LOCUS_02090 gene larB 218849 218076 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_02090 220129 218846 gene locus_tag LOCUS_02100 220129 218846 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_02100 221334 220126 gene locus_tag LOCUS_02110 221334 220126 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_02110 222338 221346 gene locus_tag LOCUS_02120 gene thiL 222338 221346 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_02120 223220 222795 gene locus_tag LOCUS_02130 223220 222795 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_02130 223459 223211 gene locus_tag LOCUS_02140 223459 223211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 224171 227119 gene locus_tag LOCUS_02150 224171 227119 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_02150 228805 227537 gene locus_tag LOCUS_02160 228805 227537 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_02160 229261 229608 gene locus_tag LOCUS_02170 229261 229608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 229715 230500 gene locus_tag LOCUS_02180 gene uppP 229715 230500 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_02180 230757 230972 gene locus_tag LOCUS_02190 230757 230972 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_02190 231452 231012 gene locus_tag LOCUS_02200 231452 231012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 231523 231723 gene locus_tag LOCUS_02210 231523 231723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 232519 231761 gene locus_tag LOCUS_02220 232519 231761 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_02220 233388 232615 gene locus_tag LOCUS_02230 233388 232615 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_02230 235281 233569 gene locus_tag LOCUS_02240 235281 233569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 236834 235278 gene locus_tag LOCUS_02250 gene guaA 236834 235278 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_02250 238407 236941 gene locus_tag LOCUS_02260 gene der 238407 236941 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_02260 239530 238628 gene locus_tag LOCUS_02270 gene era 239530 238628 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392137.1 protein_id gnl|my_center|LOCUS_02270 240275 239511 gene locus_tag LOCUS_02280 gene rnc 240275 239511 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_02280 241548 240169 gene locus_tag LOCUS_02290 gene mtaB 241548 240169 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_02290 242651 241554 gene locus_tag LOCUS_02300 gene mnmA 242651 241554 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_02300 243996 242719 gene locus_tag LOCUS_02310 gene nifS 243996 242719 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_02310 245032 244313 gene locus_tag LOCUS_02320 gene cysE 245032 244313 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_02320 246961 245318 gene locus_tag LOCUS_02330 gene cimA 246961 245318 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_02330 248091 246961 gene locus_tag LOCUS_02340 248091 246961 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_02340 248773 248258 gene locus_tag LOCUS_02350 gene tsaE 248773 248258 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_02350 250511 248916 gene locus_tag LOCUS_02360 250511 248916 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_02360 251547 250750 gene locus_tag LOCUS_02370 251547 250750 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546437.1 protein_id gnl|my_center|LOCUS_02370 253035 251569 gene locus_tag LOCUS_02380 gene glmM 253035 251569 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_02380 253982 253032 gene locus_tag LOCUS_02390 253982 253032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 254778 253969 gene locus_tag LOCUS_02400 gene cdaA 254778 253969 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938576.1 protein_id gnl|my_center|LOCUS_02400 255570 254779 gene locus_tag LOCUS_02410 gene folP 255570 254779 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_02410 256164 256078 gene locus_tag LOCUS_t00030 256164 256078 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 256635 256270 gene locus_tag LOCUS_02420 gene secG 256635 256270 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495557.1 protein_id gnl|my_center|LOCUS_02420 257420 256647 gene locus_tag LOCUS_02430 gene tpiA 257420 256647 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_02430 258642 257638 gene locus_tag LOCUS_02440 gene gap 258642 257638 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_02440 259024 259731 gene locus_tag LOCUS_02450 gene tolQ 259024 259731 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_02450 259750 260202 gene locus_tag LOCUS_02460 gene tolR 259750 260202 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_02460 260871 260527 gene locus_tag LOCUS_02470 260871 260527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 260864 261526 gene locus_tag LOCUS_02480 260864 261526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 261914 263272 gene locus_tag LOCUS_02490 gene tolB 261914 263272 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_02490 263232 263804 gene locus_tag LOCUS_02500 263232 263804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 263821 264705 gene locus_tag LOCUS_02510 263821 264705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 264748 265689 gene locus_tag LOCUS_02520 264748 265689 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_02520 265860 266402 gene locus_tag LOCUS_02530 265860 266402 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_02530 266651 267982 gene locus_tag LOCUS_02540 266651 267982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 268229 269122 gene locus_tag LOCUS_02550 gene fabD 268229 269122 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_02550 269228 269467 gene locus_tag LOCUS_02560 gene acpP 269228 269467 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_02560 269870 270346 gene locus_tag LOCUS_02570 gene nrdR 269870 270346 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_02570 270358 271518 gene locus_tag LOCUS_02580 gene ribD 270358 271518 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_02580 271783 272952 gene locus_tag LOCUS_02590 271783 272952 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_02590 273031 273501 gene locus_tag LOCUS_02600 gene nusB 273031 273501 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_02600 273482 274084 gene locus_tag LOCUS_02610 273482 274084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 276199 274394 gene locus_tag LOCUS_02620 276199 274394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940591.1 protein_id gnl|my_center|LOCUS_02620 277350 276196 gene locus_tag LOCUS_02630 277350 276196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 278195 277599 gene locus_tag LOCUS_02640 278195 277599 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_02640 280459 278417 gene locus_tag LOCUS_02650 gene kdpB 280459 278417 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965691.1 protein_id gnl|my_center|LOCUS_02650 282207 280480 gene locus_tag LOCUS_02660 gene kdpA 282207 280480 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391515.1 protein_id gnl|my_center|LOCUS_02660 283130 285688 gene locus_tag LOCUS_02670 283130 285688 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_02670 286799 285825 gene locus_tag LOCUS_02680 286799 285825 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_02680 287640 286891 gene locus_tag LOCUS_02690 287640 286891 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064854.1 protein_id gnl|my_center|LOCUS_02690 288493 287711 gene locus_tag LOCUS_02700 288493 287711 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_02700 288930 290000 gene locus_tag LOCUS_02710 288930 290000 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_02710 290367 290152 gene locus_tag LOCUS_02720 290367 290152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 290679 292187 gene locus_tag LOCUS_02730 290679 292187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 292250 292789 gene locus_tag LOCUS_02740 292250 292789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 292967 292743 gene locus_tag LOCUS_02750 292967 292743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 293260 293463 gene locus_tag LOCUS_02760 293260 293463 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816068.1 protein_id gnl|my_center|LOCUS_02760 293557 294057 gene locus_tag LOCUS_02770 293557 294057 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_02770 294057 294773 gene locus_tag LOCUS_02780 294057 294773 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_02780 294876 295910 gene locus_tag LOCUS_02790 gene ispH 294876 295910 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_02790 296216 296842 gene locus_tag LOCUS_02800 296216 296842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 297946 297035 gene locus_tag LOCUS_02810 297946 297035 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_02810 299229 297943 gene locus_tag LOCUS_02820 299229 297943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 300964 299285 gene locus_tag LOCUS_02830 300964 299285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 301283 301192 gene locus_tag LOCUS_t00040 301283 301192 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 302022 301477 gene locus_tag LOCUS_02840 302022 301477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 303093 302113 gene locus_tag LOCUS_02850 303093 302113 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815923.1 protein_id gnl|my_center|LOCUS_02850 304351 303242 gene locus_tag LOCUS_02860 gene leuB 304351 303242 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393735.1 protein_id gnl|my_center|LOCUS_02860 306387 304816 gene locus_tag LOCUS_02870 306387 304816 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_02870 307145 307687 gene locus_tag LOCUS_02880 307145 307687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 308659 307907 gene locus_tag LOCUS_02890 308659 307907 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_02890 309586 308720 gene locus_tag LOCUS_02900 gene rlmB 309586 308720 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_02900 309703 310851 gene locus_tag LOCUS_02910 gene lptF 309703 310851 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_02910 310848 311960 gene locus_tag LOCUS_02920 310848 311960 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_02920 312093 313802 gene locus_tag LOCUS_02930 312093 313802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 314036 315988 gene locus_tag LOCUS_02940 gene asnB 314036 315988 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_02940 316342 316055 gene locus_tag LOCUS_02950 316342 316055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 317180 316374 gene locus_tag LOCUS_02960 317180 316374 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_02960 318415 317177 gene locus_tag LOCUS_02970 gene speY 318415 317177 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_02970 318838 319662 gene locus_tag LOCUS_02980 318838 319662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 319766 321049 gene locus_tag LOCUS_02990 319766 321049 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_02990 321350 322114 gene locus_tag LOCUS_03000 gene pyrF 321350 322114 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_03000 322833 322621 gene locus_tag LOCUS_03010 322833 322621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 323361 323092 gene locus_tag LOCUS_03020 323361 323092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 323348 323650 gene locus_tag LOCUS_03030 323348 323650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 324174 324815 gene locus_tag LOCUS_03040 324174 324815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 325000 325620 gene locus_tag LOCUS_03050 325000 325620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 325745 326887 gene locus_tag LOCUS_03060 325745 326887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 326894 327544 gene locus_tag LOCUS_03070 326894 327544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 327534 328625 gene locus_tag LOCUS_03080 327534 328625 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_03080 328743 329531 gene locus_tag LOCUS_03090 gene murI 328743 329531 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_03090 329893 332586 gene locus_tag LOCUS_03100 gene secA 329893 332586 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_03100 332615 333811 gene locus_tag LOCUS_03110 gene argJ 332615 333811 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_03110 334130 335686 gene locus_tag LOCUS_03120 gene trpE 334130 335686 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_03120 335699 336277 gene locus_tag LOCUS_03130 335699 336277 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_03130 336274 337326 gene locus_tag LOCUS_03140 gene trpD 336274 337326 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028831.1 protein_id gnl|my_center|LOCUS_03140 337310 338101 gene locus_tag LOCUS_03150 gene trpC 337310 338101 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969378.1 protein_id gnl|my_center|LOCUS_03150 338112 338723 gene locus_tag LOCUS_03160 338112 338723 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_03160 338707 339900 gene locus_tag LOCUS_03170 gene trpB 338707 339900 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_03170 339904 340737 gene locus_tag LOCUS_03180 gene trpA 339904 340737 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_03180 340769 341620 gene locus_tag LOCUS_03190 gene accD 340769 341620 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125011.1 protein_id gnl|my_center|LOCUS_03190 342172 343485 gene locus_tag LOCUS_03200 342172 343485 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_03200 343502 345985 gene locus_tag LOCUS_03210 343502 345985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 347190 346402 gene locus_tag LOCUS_03220 347190 346402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_03220 348206 347187 gene locus_tag LOCUS_03230 348206 347187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_03230 348458 349663 gene locus_tag LOCUS_03240 348458 349663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965428.1 protein_id gnl|my_center|LOCUS_03240 350711 351775 gene locus_tag LOCUS_03250 350711 351775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258460.1 protein_id gnl|my_center|LOCUS_03250 353201 351822 gene locus_tag LOCUS_03260 353201 351822 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_03260 353494 353198 gene locus_tag LOCUS_03270 353494 353198 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_03270 354695 353511 gene locus_tag LOCUS_03280 354695 353511 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_03280 354886 354707 gene locus_tag LOCUS_03290 354886 354707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 355603 356103 gene locus_tag LOCUS_03300 355603 356103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 356694 356185 gene locus_tag LOCUS_03310 356694 356185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 357382 357882 gene locus_tag LOCUS_03320 357382 357882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 357906 358454 gene locus_tag LOCUS_03330 357906 358454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 359076 358576 gene locus_tag LOCUS_03340 359076 358576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 359533 359318 gene locus_tag LOCUS_03350 gene iscX 359533 359318 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_03350 361498 359642 gene locus_tag LOCUS_03360 gene hscA 361498 359642 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196658.1 protein_id gnl|my_center|LOCUS_03360 362130 361567 gene locus_tag LOCUS_03370 gene hscB 362130 361567 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540869.1 protein_id gnl|my_center|LOCUS_03370 362562 362245 gene locus_tag LOCUS_03380 gene iscA 362562 362245 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693788.1 protein_id gnl|my_center|LOCUS_03380 363021 362608 gene locus_tag LOCUS_03390 gene iscU 363021 362608 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_03390 364388 363168 gene locus_tag LOCUS_03400 364388 363168 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_03400 365514 364582 gene locus_tag LOCUS_03410 365514 364582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 365618 365935 gene locus_tag LOCUS_03420 365618 365935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 366940 366599 gene locus_tag LOCUS_03430 366940 366599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 367892 366963 gene locus_tag LOCUS_03440 gene secF 367892 366963 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_03440 369225 368128 gene locus_tag LOCUS_03450 369225 368128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 370218 369346 gene locus_tag LOCUS_03460 gene dapA 370218 369346 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_03460 371307 370414 gene locus_tag LOCUS_03470 gene dapF 371307 370414 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_03470 372615 371347 gene locus_tag LOCUS_03480 gene lysA 372615 371347 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_03480 373311 372787 gene locus_tag LOCUS_03490 373311 372787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 374717 373308 gene locus_tag LOCUS_03500 gene argH 374717 373308 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_03500 375558 374797 gene locus_tag LOCUS_03510 375558 374797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 377794 376577 gene locus_tag LOCUS_03520 377794 376577 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_03520 378843 377809 gene locus_tag LOCUS_03530 gene argF 378843 377809 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_03530 380059 378872 gene locus_tag LOCUS_03540 380059 378872 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03540 381074 380052 gene locus_tag LOCUS_03550 gene argB 381074 380052 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_03550 382566 381217 gene locus_tag LOCUS_03560 gene hslU 382566 381217 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_03560 383164 382604 gene locus_tag LOCUS_03570 gene hslV 383164 382604 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_03570 384077 383145 gene locus_tag LOCUS_03580 gene xerC 384077 383145 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_03580 384298 384588 gene locus_tag LOCUS_03590 384298 384588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 384927 386348 gene locus_tag LOCUS_03600 384927 386348 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_03600 386474 388309 gene locus_tag LOCUS_03610 gene glmS 386474 388309 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_03610 389854 388403 gene locus_tag LOCUS_03620 389854 388403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 390592 389969 gene locus_tag LOCUS_03630 390592 389969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 391770 390589 gene locus_tag LOCUS_03640 391770 390589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_03640 393685 391937 gene locus_tag LOCUS_03650 gene rpoD 393685 391937 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_03650 394615 396876 gene locus_tag LOCUS_03660 394615 396876 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_03660 398871 397027 gene locus_tag LOCUS_03670 398871 397027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 399520 398984 gene locus_tag LOCUS_03680 399520 398984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 400949 400299 gene locus_tag LOCUS_03690 400949 400299 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562559.1 protein_id gnl|my_center|LOCUS_03690 401117 401800 gene locus_tag LOCUS_03700 401117 401800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 402030 403409 gene locus_tag LOCUS_03710 402030 403409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 403858 404376 gene locus_tag LOCUS_03720 403858 404376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 404953 404570 gene locus_tag LOCUS_03730 404953 404570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 405465 404986 gene locus_tag LOCUS_03740 405465 404986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 406538 405534 gene locus_tag LOCUS_03750 406538 405534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 407269 406574 gene locus_tag LOCUS_03760 407269 406574 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_03760 408109 407288 gene locus_tag LOCUS_03770 408109 407288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 410428 408281 gene locus_tag LOCUS_03780 gene hyfB 410428 408281 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_03780 411162 410425 gene locus_tag LOCUS_03790 411162 410425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 412865 411276 gene locus_tag LOCUS_03800 412865 411276 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_03800 414314 412869 gene locus_tag LOCUS_03810 414314 412869 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_03810 414991 414314 gene locus_tag LOCUS_03820 414991 414314 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_03820 415952 415002 gene locus_tag LOCUS_03830 415952 415002 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence02 342 118 gene locus_tag LOCUS_03840 342 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 946 767 gene locus_tag LOCUS_03850 946 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 984 1523 gene locus_tag LOCUS_03860 984 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1520 1888 gene locus_tag LOCUS_03870 1520 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 2027 2278 gene locus_tag LOCUS_03880 2027 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2281 2466 gene locus_tag LOCUS_03890 2281 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2463 2816 gene locus_tag LOCUS_03900 2463 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3459 5084 gene locus_tag LOCUS_03910 3459 5084 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 protein_id gnl|my_center|LOCUS_03910 5249 5734 gene locus_tag LOCUS_03920 5249 5734 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_03920 5901 5674 gene locus_tag LOCUS_03930 5901 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6858 5986 gene locus_tag LOCUS_03940 6858 5986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707183.1 protein_id gnl|my_center|LOCUS_03940 9338 6963 gene locus_tag LOCUS_03950 9338 6963 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 protein_id gnl|my_center|LOCUS_03950 10614 9736 gene locus_tag LOCUS_03960 10614 9736 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_03960 11691 10846 gene locus_tag LOCUS_03970 11691 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12301 12041 gene locus_tag LOCUS_03980 12301 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 13663 12320 gene locus_tag LOCUS_03990 13663 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_03990 13996 13703 gene locus_tag LOCUS_04000 13996 13703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 15251 15024 gene locus_tag LOCUS_04010 15251 15024 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_04010 16558 16316 gene locus_tag LOCUS_04020 16558 16316 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_04020 17321 16956 gene locus_tag LOCUS_04030 17321 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 17726 17325 gene locus_tag LOCUS_04040 17726 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 18147 17890 gene locus_tag LOCUS_04050 18147 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 19347 18400 gene locus_tag LOCUS_04060 19347 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19673 19365 gene locus_tag LOCUS_04070 19673 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 19934 20263 gene locus_tag LOCUS_04080 19934 20263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 20238 20624 gene locus_tag LOCUS_04090 20238 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 20633 21685 gene locus_tag LOCUS_04100 20633 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 22330 22710 gene locus_tag LOCUS_04110 22330 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 23435 22920 gene locus_tag LOCUS_04120 23435 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 24322 24245 gene locus_tag LOCUS_t00050 24322 24245 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24815 25300 gene locus_tag LOCUS_04130 24815 25300 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385360.1 protein_id gnl|my_center|LOCUS_04130 25367 27052 gene locus_tag LOCUS_04140 25367 27052 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_04140 27337 28200 gene locus_tag LOCUS_04150 gene fghA 27337 28200 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064806.1 protein_id gnl|my_center|LOCUS_04150 28593 29075 gene locus_tag LOCUS_04160 28593 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 29072 33565 gene locus_tag LOCUS_04170 29072 33565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 33587 33826 gene locus_tag LOCUS_04180 33587 33826 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563132.1 protein_id gnl|my_center|LOCUS_04180 34209 35318 gene locus_tag LOCUS_04190 34209 35318 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_04190 37852 35834 gene locus_tag LOCUS_04200 37852 35834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 38583 38149 gene locus_tag LOCUS_04210 38583 38149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 39766 39341 gene locus_tag LOCUS_04220 39766 39341 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102545.1 protein_id gnl|my_center|LOCUS_04220 40286 41617 gene locus_tag LOCUS_04230 40286 41617 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986859.1 protein_id gnl|my_center|LOCUS_04230 41684 42490 gene locus_tag LOCUS_04240 41684 42490 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932478.1 protein_id gnl|my_center|LOCUS_04240 43747 43286 gene locus_tag LOCUS_04250 43747 43286 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_04250 44303 45631 gene locus_tag LOCUS_04260 44303 45631 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_04260 46286 48376 gene locus_tag LOCUS_04270 46286 48376 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_04270 48923 49993 gene locus_tag LOCUS_04280 48923 49993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 51345 50869 gene locus_tag LOCUS_04290 51345 50869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 51589 51383 gene locus_tag LOCUS_04300 51589 51383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 51524 52027 gene locus_tag LOCUS_04310 51524 52027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04310 52347 53318 gene locus_tag LOCUS_04320 52347 53318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 53743 55041 gene locus_tag LOCUS_04330 53743 55041 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_04330 55278 55129 gene locus_tag LOCUS_04340 55278 55129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 56785 55361 gene locus_tag LOCUS_04350 gene merA 56785 55361 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 protein_id gnl|my_center|LOCUS_04350 57441 56833 gene locus_tag LOCUS_04360 57441 56833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 57775 58335 gene locus_tag LOCUS_04370 57775 58335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 58316 59227 gene locus_tag LOCUS_04380 58316 59227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 59279 59524 gene locus_tag LOCUS_04390 59279 59524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 59644 61068 gene locus_tag LOCUS_04400 gene merA 59644 61068 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_04400 62778 61471 gene locus_tag LOCUS_04410 gene cbpB 62778 61471 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_04410 64363 64028 gene locus_tag LOCUS_04420 64363 64028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 65664 64414 gene locus_tag LOCUS_04430 gene terL 65664 64414 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_04430 66046 65633 gene locus_tag LOCUS_04440 66046 65633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 66412 66690 gene locus_tag LOCUS_04450 66412 66690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 67191 66928 gene locus_tag LOCUS_04460 67191 66928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 67563 67201 gene locus_tag LOCUS_04470 67563 67201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 69684 67810 gene locus_tag LOCUS_04480 69684 67810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 69911 69690 gene locus_tag LOCUS_04490 69911 69690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 69953 70846 gene locus_tag LOCUS_04500 69953 70846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 70848 71993 gene locus_tag LOCUS_04510 70848 71993 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087297.1 protein_id gnl|my_center|LOCUS_04510 72206 72112 gene locus_tag LOCUS_t00060 72206 72112 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 73410 72238 gene locus_tag LOCUS_04520 73410 72238 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_04520 74601 74305 gene locus_tag LOCUS_04530 74601 74305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 75395 74934 gene locus_tag LOCUS_04540 75395 74934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 75961 75482 gene locus_tag LOCUS_04550 75961 75482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 78973 75998 gene locus_tag LOCUS_04560 78973 75998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 81335 79311 gene locus_tag LOCUS_04570 81335 79311 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_04570 81576 81875 gene locus_tag LOCUS_04580 81576 81875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 81909 82289 gene locus_tag LOCUS_04590 81909 82289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 82366 83256 gene locus_tag LOCUS_04600 82366 83256 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150388385.1 protein_id gnl|my_center|LOCUS_04600 85117 83360 gene locus_tag LOCUS_04610 85117 83360 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_04610 85562 85275 gene locus_tag LOCUS_04620 85562 85275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 85812 86786 gene locus_tag LOCUS_04630 85812 86786 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_04630 86870 88039 gene locus_tag LOCUS_04640 86870 88039 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_04640 88073 88501 gene locus_tag LOCUS_04650 88073 88501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 88665 89138 gene locus_tag LOCUS_04660 88665 89138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 89830 90846 gene locus_tag LOCUS_04670 89830 90846 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_04670 92406 91903 gene locus_tag LOCUS_04680 92406 91903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 92628 93380 gene locus_tag LOCUS_04690 92628 93380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 93393 93716 gene locus_tag LOCUS_04700 93393 93716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 93987 93649 gene locus_tag LOCUS_04710 93987 93649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 94559 94074 gene locus_tag LOCUS_04720 94559 94074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 95008 94556 gene locus_tag LOCUS_04730 95008 94556 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_04730 96044 95106 gene locus_tag LOCUS_04740 96044 95106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 96357 96067 gene locus_tag LOCUS_04750 96357 96067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 97161 98342 gene locus_tag LOCUS_04760 97161 98342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 98474 98830 gene locus_tag LOCUS_04770 98474 98830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 99194 99412 gene locus_tag LOCUS_04780 99194 99412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 99867 100211 gene locus_tag LOCUS_04790 99867 100211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 101336 100140 gene locus_tag LOCUS_04800 101336 100140 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_04800 102190 101732 gene locus_tag LOCUS_04810 102190 101732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 103085 102615 gene locus_tag LOCUS_04820 103085 102615 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_04820 105497 103149 gene locus_tag LOCUS_04830 105497 103149 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_04830 106637 105726 gene locus_tag LOCUS_04840 106637 105726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 107486 106773 gene locus_tag LOCUS_04850 107486 106773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 108359 107490 gene locus_tag LOCUS_04860 108359 107490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 109718 108360 gene locus_tag LOCUS_04870 109718 108360 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_04870 110374 110015 gene locus_tag LOCUS_04880 110374 110015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 110762 111220 gene locus_tag LOCUS_04890 110762 111220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 111954 111691 gene locus_tag LOCUS_04900 gene grxC 111954 111691 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_04900 112695 112015 gene locus_tag LOCUS_04910 112695 112015 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_04910 113424 112747 gene locus_tag LOCUS_04920 gene purN 113424 112747 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_04920 114611 113538 gene locus_tag LOCUS_04930 gene purM 114611 113538 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_04930 115204 114614 gene locus_tag LOCUS_04940 115204 114614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 115824 115195 gene locus_tag LOCUS_04950 115824 115195 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_04950 116024 117238 gene locus_tag LOCUS_04960 116024 117238 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_04960 117377 117766 gene locus_tag LOCUS_04970 117377 117766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 118537 117869 gene locus_tag LOCUS_04980 118537 117869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912340.1 protein_id gnl|my_center|LOCUS_04980 119958 118534 gene locus_tag LOCUS_04990 119958 118534 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256631.1 protein_id gnl|my_center|LOCUS_04990 120376 120155 gene locus_tag LOCUS_05000 120376 120155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 121269 120418 gene locus_tag LOCUS_05010 121269 120418 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_05010 122067 121468 gene locus_tag LOCUS_05020 122067 121468 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017206458.1 protein_id gnl|my_center|LOCUS_05020 123557 122589 gene locus_tag LOCUS_05030 123557 122589 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_05030 124140 123565 gene locus_tag LOCUS_05040 124140 123565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 127220 124323 gene locus_tag LOCUS_05050 gene uvrA 127220 124323 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_05050 127451 127230 gene locus_tag LOCUS_05060 127451 127230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 127537 128352 gene locus_tag LOCUS_05070 gene pgeF 127537 128352 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_05070 128509 129636 gene locus_tag LOCUS_05080 128509 129636 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907860.1 protein_id gnl|my_center|LOCUS_05080 129683 130894 gene locus_tag LOCUS_05090 129683 130894 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_05090 130994 133159 gene locus_tag LOCUS_05100 gene uvrB 130994 133159 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_05100 133246 135360 gene locus_tag LOCUS_05110 gene uvrC 133246 135360 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_05110 136024 135614 gene locus_tag LOCUS_05120 136024 135614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 136023 136283 gene locus_tag LOCUS_05130 136023 136283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 137360 136497 gene locus_tag LOCUS_05140 gene panC 137360 136497 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_05140 138245 137427 gene locus_tag LOCUS_05150 gene panB 138245 137427 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_05150 139374 138520 gene locus_tag LOCUS_05160 139374 138520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 140218 139322 gene locus_tag LOCUS_05170 140218 139322 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_05170 141014 140229 gene locus_tag LOCUS_05180 141014 140229 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_05180 141601 142347 gene locus_tag LOCUS_05190 141601 142347 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203813331.1 protein_id gnl|my_center|LOCUS_05190 142922 142998 gene locus_tag LOCUS_t00070 142922 142998 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 143432 142977 gene locus_tag LOCUS_05200 143432 142977 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391728.1 protein_id gnl|my_center|LOCUS_05200 143761 143438 gene locus_tag LOCUS_05210 143761 143438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 144991 144590 gene locus_tag LOCUS_05220 144991 144590 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 protein_id gnl|my_center|LOCUS_05220 145530 144988 gene locus_tag LOCUS_05230 145530 144988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 145780 145520 gene locus_tag LOCUS_05240 145780 145520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 146063 146141 gene locus_tag LOCUS_t00080 146063 146141 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 147053 146232 gene locus_tag LOCUS_05250 147053 146232 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279403.1 protein_id gnl|my_center|LOCUS_05250 147358 147119 gene locus_tag LOCUS_05260 147358 147119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 147916 147467 gene locus_tag LOCUS_05270 147916 147467 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_05270 149139 148108 gene locus_tag LOCUS_05280 149139 148108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 149277 149984 gene locus_tag LOCUS_05290 149277 149984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 150032 150787 gene locus_tag LOCUS_05300 150032 150787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 151224 150958 gene locus_tag LOCUS_05310 151224 150958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 151650 151306 gene locus_tag LOCUS_05320 151650 151306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 151733 152023 gene locus_tag LOCUS_05330 151733 152023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 154789 152039 gene locus_tag LOCUS_05340 gene ppdK 154789 152039 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_05340 156425 155073 gene locus_tag LOCUS_05350 156425 155073 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_05350 156701 156970 gene locus_tag LOCUS_05360 156701 156970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 157716 157378 gene locus_tag LOCUS_05370 157716 157378 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_05370 158736 158122 gene locus_tag LOCUS_05380 gene plsY 158736 158122 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_05380 158837 158763 gene locus_tag LOCUS_t00090 158837 158763 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 159708 159025 gene locus_tag LOCUS_05390 gene rpe 159708 159025 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_05390 161103 159715 gene locus_tag LOCUS_05400 gene rsmB 161103 159715 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_05400 162250 161180 gene locus_tag LOCUS_05410 gene fmt 162250 161180 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704265.1 protein_id gnl|my_center|LOCUS_05410 162249 162494 gene locus_tag LOCUS_05420 162249 162494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 163435 162884 gene locus_tag LOCUS_05430 gene def 163435 162884 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_05430 166228 163754 gene locus_tag LOCUS_05440 gene priA 166228 163754 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_05440 166590 167756 gene locus_tag LOCUS_05450 gene aroC 166590 167756 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_05450 167865 168401 gene locus_tag LOCUS_05460 167865 168401 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_05460 168377 169456 gene locus_tag LOCUS_05470 gene aroB 168377 169456 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_05470 169837 169604 gene locus_tag LOCUS_05480 169837 169604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 171426 170881 gene locus_tag LOCUS_05490 gene lspA 171426 170881 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_05490 174239 171423 gene locus_tag LOCUS_05500 gene ileS 174239 171423 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_05500 174798 175046 gene locus_tag LOCUS_05510 174798 175046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 175066 176262 gene locus_tag LOCUS_05520 175066 176262 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_05520 176262 177473 gene locus_tag LOCUS_05530 176262 177473 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_05530 177638 179167 gene locus_tag LOCUS_05540 177638 179167 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_05540 179452 179907 gene locus_tag LOCUS_05550 179452 179907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 180054 181394 gene locus_tag LOCUS_05560 gene ffh 180054 181394 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_05560 181421 181750 gene locus_tag LOCUS_05570 181421 181750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 181701 181937 gene locus_tag LOCUS_05580 181701 181937 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_05580 181946 182503 gene locus_tag LOCUS_05590 gene rimM 181946 182503 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369214.1 protein_id gnl|my_center|LOCUS_05590 182542 183228 gene locus_tag LOCUS_05600 gene trmD 182542 183228 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_05600 183501 184055 gene locus_tag LOCUS_05610 183501 184055 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 protein_id gnl|my_center|LOCUS_05610 185287 184238 gene locus_tag LOCUS_05620 185287 184238 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_05620 185927 186409 gene locus_tag LOCUS_05630 185927 186409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 186887 186438 gene locus_tag LOCUS_05640 186887 186438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 188156 187476 gene locus_tag LOCUS_05650 188156 187476 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_05650 188746 190332 gene locus_tag LOCUS_05660 188746 190332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 191616 190426 gene locus_tag LOCUS_05670 191616 190426 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_05670 192927 191767 gene locus_tag LOCUS_05680 192927 191767 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_05680 194222 193011 gene locus_tag LOCUS_05690 gene coaBC 194222 193011 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_05690 195760 194546 gene locus_tag LOCUS_05700 195760 194546 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_05700 197104 195908 gene locus_tag LOCUS_05710 gene hpnI 197104 195908 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_05710 198394 198059 gene locus_tag LOCUS_05720 198394 198059 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_05720 199582 198518 gene locus_tag LOCUS_05730 199582 198518 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390053.1 protein_id gnl|my_center|LOCUS_05730 199831 200214 gene locus_tag LOCUS_05740 199831 200214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 202643 200364 gene locus_tag LOCUS_05750 202643 200364 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257190.1 protein_id gnl|my_center|LOCUS_05750 203064 204359 gene locus_tag LOCUS_05760 gene tig 203064 204359 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_05760 204466 205056 gene locus_tag LOCUS_05770 gene clpP 204466 205056 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_05770 205077 206327 gene locus_tag LOCUS_05780 gene clpX 205077 206327 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_05780 206362 208839 gene locus_tag LOCUS_05790 gene lon 206362 208839 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_05790 208948 209259 gene locus_tag LOCUS_05800 208948 209259 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_05800 209310 209383 gene locus_tag LOCUS_t00100 209310 209383 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 209658 210722 gene locus_tag LOCUS_05810 209658 210722 CDS product proton-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144181.1 protein_id gnl|my_center|LOCUS_05810 211609 210965 gene locus_tag LOCUS_05820 gene maiA 211609 210965 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_05820 212530 211883 gene locus_tag LOCUS_05830 gene pdxH 212530 211883 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_05830 213248 212538 gene locus_tag LOCUS_05840 213248 212538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262679.1 protein_id gnl|my_center|LOCUS_05840 213982 213245 gene locus_tag LOCUS_05850 213982 213245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_05850 214884 213982 gene locus_tag LOCUS_05860 214884 213982 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109472687.1 protein_id gnl|my_center|LOCUS_05860 215750 214881 gene locus_tag LOCUS_05870 215750 214881 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_05870 216116 215775 gene locus_tag LOCUS_05880 216116 215775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 217236 216100 gene locus_tag LOCUS_05890 217236 216100 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086395.1 protein_id gnl|my_center|LOCUS_05890 217888 219105 gene locus_tag LOCUS_05900 217888 219105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 219197 222577 gene locus_tag LOCUS_05910 219197 222577 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_05910 225851 223212 gene locus_tag LOCUS_05920 225851 223212 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_05920 228184 226052 gene locus_tag LOCUS_05930 gene glgX 228184 226052 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_05930 229655 228450 gene locus_tag LOCUS_05940 229655 228450 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_05940 232395 229669 gene locus_tag LOCUS_05950 232395 229669 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_05950 233778 232603 gene locus_tag LOCUS_05960 233778 232603 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429565.1 protein_id gnl|my_center|LOCUS_05960 234589 234107 gene locus_tag LOCUS_05970 234589 234107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 235650 237191 gene locus_tag LOCUS_05980 gene glgA 235650 237191 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_05980 237248 238711 gene locus_tag LOCUS_05990 237248 238711 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_05990 239264 238887 gene locus_tag LOCUS_06000 239264 238887 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 protein_id gnl|my_center|LOCUS_06000 239878 239357 gene locus_tag LOCUS_06010 239878 239357 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398767.1 protein_id gnl|my_center|LOCUS_06010 240840 240613 gene locus_tag LOCUS_06020 240840 240613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 243499 241220 gene locus_tag LOCUS_06030 gene glgB 243499 241220 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_06030 243749 245383 gene locus_tag LOCUS_06040 243749 245383 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_06040 247096 245801 gene locus_tag LOCUS_06050 247096 245801 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_06050 247918 248526 gene locus_tag LOCUS_06060 247918 248526 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_06060 249102 250760 gene locus_tag LOCUS_06070 249102 250760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 252813 251602 gene locus_tag LOCUS_06080 252813 251602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 253213 253288 gene locus_tag LOCUS_t00110 253213 253288 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 253311 253385 gene locus_tag LOCUS_t00120 253311 253385 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 253585 253842 gene locus_tag LOCUS_06090 253585 253842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 253873 254172 gene locus_tag LOCUS_06100 253873 254172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 255025 254282 gene locus_tag LOCUS_06110 255025 254282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 255722 254991 gene locus_tag LOCUS_06120 255722 254991 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083064.1 protein_id gnl|my_center|LOCUS_06120 255987 256484 gene locus_tag LOCUS_06130 255987 256484 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_06130 258127 257441 gene locus_tag LOCUS_06140 258127 257441 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_06140 258904 258212 gene locus_tag LOCUS_06150 258904 258212 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_06150 260228 259098 gene locus_tag LOCUS_06160 gene pqqE 260228 259098 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206724.1 protein_id gnl|my_center|LOCUS_06160 260472 260191 gene locus_tag LOCUS_06170 gene pqqD 260472 260191 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_06170 261214 260462 gene locus_tag LOCUS_06180 gene pqqC 261214 260462 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_06180 262187 261240 gene locus_tag LOCUS_06190 gene pqqB 262187 261240 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113495.1 protein_id gnl|my_center|LOCUS_06190 263259 263990 gene locus_tag LOCUS_06200 263259 263990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 263987 264469 gene locus_tag LOCUS_06210 263987 264469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06210 264393 265715 gene locus_tag LOCUS_06220 264393 265715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 265784 266386 gene locus_tag LOCUS_06230 265784 266386 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_06230 266408 266701 gene locus_tag LOCUS_06240 266408 266701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 266773 267345 gene locus_tag LOCUS_06250 266773 267345 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_06250 268702 267614 gene locus_tag LOCUS_06260 268702 267614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 269574 269185 gene locus_tag LOCUS_06270 269574 269185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 270839 269571 gene locus_tag LOCUS_06280 270839 269571 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_06280 271960 271007 gene locus_tag LOCUS_06290 271960 271007 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_06290 274493 272190 gene locus_tag LOCUS_06300 gene clpA 274493 272190 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447476.1 protein_id gnl|my_center|LOCUS_06300 275046 274678 gene locus_tag LOCUS_06310 gene clpS 275046 274678 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_06310 275108 276325 gene locus_tag LOCUS_06320 275108 276325 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144026.1 protein_id gnl|my_center|LOCUS_06320 276452 277624 gene locus_tag LOCUS_06330 276452 277624 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_06330 278968 278264 gene locus_tag LOCUS_06340 278968 278264 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_06340 279147 279072 gene locus_tag LOCUS_t00130 279147 279072 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 281016 279244 gene locus_tag LOCUS_06350 gene dnaG 281016 279244 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_06350 281546 282430 gene locus_tag LOCUS_06360 gene prmA 281546 282430 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_06360 282511 283170 gene locus_tag LOCUS_06370 282511 283170 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_06370 283167 284129 gene locus_tag LOCUS_06380 gene gshB 283167 284129 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143671.1 protein_id gnl|my_center|LOCUS_06380 284530 285837 gene locus_tag LOCUS_06390 284530 285837 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_06390 285877 286377 gene locus_tag LOCUS_06400 285877 286377 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337074.1 protein_id gnl|my_center|LOCUS_06400 286577 287164 gene locus_tag LOCUS_06410 286577 287164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 288182 287451 gene locus_tag LOCUS_06420 288182 287451 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_06420 289078 288170 gene locus_tag LOCUS_06430 289078 288170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 289298 289116 gene locus_tag LOCUS_06440 289298 289116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 289354 290118 gene locus_tag LOCUS_06450 289354 290118 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527266.1 protein_id gnl|my_center|LOCUS_06450 291197 290178 gene locus_tag LOCUS_06460 291197 290178 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_06460 292082 291291 gene locus_tag LOCUS_06470 292082 291291 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_06470 293694 292447 gene locus_tag LOCUS_06480 293694 292447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 294841 294119 gene locus_tag LOCUS_06490 294841 294119 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_06490 295647 294946 gene locus_tag LOCUS_06500 295647 294946 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942266.1 protein_id gnl|my_center|LOCUS_06500 <297040 295644 gene locus_tag LOCUS_06510 <297040 295644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939070.1:LutB/LldF family L-lactate oxidation iron-sulfur protein >Feature sequence03 231 785 gene locus_tag LOCUS_06520 231 785 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957925.1 protein_id gnl|my_center|LOCUS_06520 2818 977 gene locus_tag LOCUS_06530 2818 977 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_06530 3557 2943 gene locus_tag LOCUS_06540 3557 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3807 4073 gene locus_tag LOCUS_06550 3807 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4325 4035 gene locus_tag LOCUS_06560 4325 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5383 4868 gene locus_tag LOCUS_06570 5383 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5619 6950 gene locus_tag LOCUS_06580 5619 6950 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_06580 6953 7756 gene locus_tag LOCUS_06590 6953 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8105 8716 gene locus_tag LOCUS_06600 8105 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9354 10757 gene locus_tag LOCUS_06610 9354 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 11940 10735 gene locus_tag LOCUS_06620 11940 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 13402 12185 gene locus_tag LOCUS_06630 13402 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 14213 13773 gene locus_tag LOCUS_06640 14213 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 14508 14269 gene locus_tag LOCUS_06650 14508 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 15555 15259 gene locus_tag LOCUS_06660 15555 15259 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_06660 15939 15628 gene locus_tag LOCUS_06670 15939 15628 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_06670 18428 17199 gene locus_tag LOCUS_06680 gene ilvA 18428 17199 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_06680 18799 18425 gene locus_tag LOCUS_06690 18799 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 19131 18796 gene locus_tag LOCUS_06700 19131 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 20111 19344 gene locus_tag LOCUS_06710 20111 19344 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_06710 21263 20310 gene locus_tag LOCUS_06720 21263 20310 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876826.1 protein_id gnl|my_center|LOCUS_06720 22058 21417 gene locus_tag LOCUS_06730 gene pncA 22058 21417 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083504.1 protein_id gnl|my_center|LOCUS_06730 22779 22150 gene locus_tag LOCUS_06740 22779 22150 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729980.1 protein_id gnl|my_center|LOCUS_06740 23209 24015 gene locus_tag LOCUS_06750 23209 24015 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_06750 24322 25932 gene locus_tag LOCUS_06760 24322 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 26052 27044 gene locus_tag LOCUS_06770 gene ilvC 26052 27044 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_06770 27707 29053 gene locus_tag LOCUS_06780 27707 29053 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_06780 29050 30246 gene locus_tag LOCUS_06790 29050 30246 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_06790 30265 33387 gene locus_tag LOCUS_06800 30265 33387 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_06800 34190 33411 gene locus_tag LOCUS_06810 34190 33411 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896425.1 protein_id gnl|my_center|LOCUS_06810 34811 34296 gene locus_tag LOCUS_06820 34811 34296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 35621 35112 gene locus_tag LOCUS_06830 35621 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 36142 35618 gene locus_tag LOCUS_06840 36142 35618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 36336 37175 gene locus_tag LOCUS_06850 36336 37175 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_06850 37903 38811 gene locus_tag LOCUS_06860 37903 38811 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057750223.1 protein_id gnl|my_center|LOCUS_06860 39143 39460 gene locus_tag LOCUS_06870 39143 39460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06870 39553 40350 gene locus_tag LOCUS_06880 gene thiD 39553 40350 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_06880 40358 41050 gene locus_tag LOCUS_06890 gene tenA 40358 41050 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_06890 41241 41780 gene locus_tag LOCUS_06900 gene sufT 41241 41780 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_06900 42487 41969 gene locus_tag LOCUS_06910 42487 41969 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630908.1 protein_id gnl|my_center|LOCUS_06910 42656 44164 gene locus_tag LOCUS_06920 42656 44164 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_06920 44165 45085 gene locus_tag LOCUS_06930 44165 45085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_06930 45082 45894 gene locus_tag LOCUS_06940 45082 45894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_06940 46964 45882 gene locus_tag LOCUS_06950 gene mtnA 46964 45882 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_06950 47615 47238 gene locus_tag LOCUS_06960 47615 47238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 48533 48838 gene locus_tag LOCUS_06970 48533 48838 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257727.1 protein_id gnl|my_center|LOCUS_06970 49487 51457 gene locus_tag LOCUS_06980 49487 51457 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_06980 51712 51527 gene locus_tag LOCUS_06990 51712 51527 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870234.1 protein_id gnl|my_center|LOCUS_06990 52191 52865 gene locus_tag LOCUS_07000 52191 52865 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_07000 53340 54341 gene locus_tag LOCUS_07010 gene pdhA 53340 54341 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_07010 54356 55327 gene locus_tag LOCUS_07020 54356 55327 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_07020 55526 57064 gene locus_tag LOCUS_07030 55526 57064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 57340 58749 gene locus_tag LOCUS_07040 gene lpdA 57340 58749 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830912.1 protein_id gnl|my_center|LOCUS_07040 58874 59632 gene locus_tag LOCUS_07050 gene lipB 58874 59632 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_07050 59629 60492 gene locus_tag LOCUS_07060 gene lipA 59629 60492 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_07060 61303 60521 gene locus_tag LOCUS_07070 61303 60521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 62075 61461 gene locus_tag LOCUS_07080 62075 61461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_07080 62899 62432 gene locus_tag LOCUS_07090 gene mlaD 62899 62432 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_07090 63712 62906 gene locus_tag LOCUS_07100 63712 62906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_07100 64959 64150 gene locus_tag LOCUS_07110 64959 64150 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_07110 65236 65658 gene locus_tag LOCUS_07120 65236 65658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 66527 67360 gene locus_tag LOCUS_07130 66527 67360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 67764 68081 gene locus_tag LOCUS_07140 gene rplU 67764 68081 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583641.1 protein_id gnl|my_center|LOCUS_07140 68071 68355 gene locus_tag LOCUS_07150 gene rpmA 68071 68355 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940618.1 protein_id gnl|my_center|LOCUS_07150 68537 69553 gene locus_tag LOCUS_07160 gene obgE 68537 69553 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583639.1 protein_id gnl|my_center|LOCUS_07160 69534 70676 gene locus_tag LOCUS_07170 gene proB 69534 70676 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_07170 70696 71949 gene locus_tag LOCUS_07180 70696 71949 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_07180 71984 72622 gene locus_tag LOCUS_07190 gene nadD 71984 72622 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_07190 72649 73035 gene locus_tag LOCUS_07200 gene rsfS 72649 73035 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_07200 74361 73168 gene locus_tag LOCUS_07210 74361 73168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 75006 74443 gene locus_tag LOCUS_07220 gene efp 75006 74443 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 protein_id gnl|my_center|LOCUS_07220 75611 75468 gene locus_tag LOCUS_07230 75611 75468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 75854 76819 gene locus_tag LOCUS_07240 75854 76819 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_07240 76991 77134 gene locus_tag LOCUS_07250 76991 77134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 77366 78970 gene locus_tag LOCUS_07260 77366 78970 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_07260 78986 79795 gene locus_tag LOCUS_07270 78986 79795 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_07270 79859 81415 gene locus_tag LOCUS_07280 79859 81415 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 protein_id gnl|my_center|LOCUS_07280 81551 82360 gene locus_tag LOCUS_07290 81551 82360 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_07290 82275 82529 gene locus_tag LOCUS_07300 82275 82529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 83409 82558 gene locus_tag LOCUS_07310 83409 82558 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582729.1 protein_id gnl|my_center|LOCUS_07310 83893 84765 gene locus_tag LOCUS_07320 83893 84765 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_07320 84768 85259 gene locus_tag LOCUS_07330 gene cutC 84768 85259 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_07330 85403 87814 gene locus_tag LOCUS_07340 85403 87814 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_07340 87873 88466 gene locus_tag LOCUS_07350 87873 88466 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_07350 88470 89381 gene locus_tag LOCUS_07360 88470 89381 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_07360 89461 90615 gene locus_tag LOCUS_07370 89461 90615 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_07370 90703 91710 gene locus_tag LOCUS_07380 90703 91710 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_07380 91707 92330 gene locus_tag LOCUS_07390 91707 92330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 92796 93593 gene locus_tag LOCUS_07400 92796 93593 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_07400 93634 94851 gene locus_tag LOCUS_07410 93634 94851 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_07410 94883 95311 gene locus_tag LOCUS_07420 94883 95311 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192846.1 protein_id gnl|my_center|LOCUS_07420 95569 95862 gene locus_tag LOCUS_07430 95569 95862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 95966 97423 gene locus_tag LOCUS_07440 95966 97423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 97420 98820 gene locus_tag LOCUS_07450 97420 98820 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_07450 99599 99294 gene locus_tag LOCUS_07460 99599 99294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 100010 101098 gene locus_tag LOCUS_07470 100010 101098 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_07470 101283 102191 gene locus_tag LOCUS_07480 101283 102191 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974207.1 protein_id gnl|my_center|LOCUS_07480 102750 103592 gene locus_tag LOCUS_07490 102750 103592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 103567 104313 gene locus_tag LOCUS_07500 gene tmk 103567 104313 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_07500 104557 105054 gene locus_tag LOCUS_07510 gene sixA 104557 105054 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979596.1 protein_id gnl|my_center|LOCUS_07510 106263 105229 gene locus_tag LOCUS_07520 106263 105229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 106663 107220 gene locus_tag LOCUS_07530 gene rfaH 106663 107220 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211542.1 protein_id gnl|my_center|LOCUS_07530 107413 108453 gene locus_tag LOCUS_07540 107413 108453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 108453 109802 gene locus_tag LOCUS_07550 108453 109802 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228096.1 protein_id gnl|my_center|LOCUS_07550 110041 111357 gene locus_tag LOCUS_07560 110041 111357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 111522 111256 gene locus_tag LOCUS_07570 111522 111256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 111515 112702 gene locus_tag LOCUS_07580 111515 112702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 112746 113717 gene locus_tag LOCUS_07590 112746 113717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 113834 114541 gene locus_tag LOCUS_07600 113834 114541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 114616 115854 gene locus_tag LOCUS_07610 114616 115854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 115929 117134 gene locus_tag LOCUS_07620 115929 117134 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259616.1 protein_id gnl|my_center|LOCUS_07620 117476 118855 gene locus_tag LOCUS_07630 117476 118855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 119303 120364 gene locus_tag LOCUS_07640 119303 120364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 120445 120936 gene locus_tag LOCUS_07650 120445 120936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 121015 121911 gene locus_tag LOCUS_07660 121015 121911 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_07660 122157 124091 gene locus_tag LOCUS_07670 122157 124091 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 protein_id gnl|my_center|LOCUS_07670 124172 125374 gene locus_tag LOCUS_07680 gene yhbH 124172 125374 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_07680 125483 126913 gene locus_tag LOCUS_07690 125483 126913 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 protein_id gnl|my_center|LOCUS_07690 126947 128326 gene locus_tag LOCUS_07700 126947 128326 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338764.1 protein_id gnl|my_center|LOCUS_07700 128333 129853 gene locus_tag LOCUS_07710 128333 129853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 131053 129908 gene locus_tag LOCUS_07720 gene astA 131053 129908 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212031.1 protein_id gnl|my_center|LOCUS_07720 131211 131393 gene locus_tag LOCUS_07730 131211 131393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 132668 131982 gene locus_tag LOCUS_07740 132668 131982 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970750.1 protein_id gnl|my_center|LOCUS_07740 133361 134599 gene locus_tag LOCUS_07750 133361 134599 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_07750 136153 134777 gene locus_tag LOCUS_07760 gene accC 136153 134777 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_07760 136385 136158 gene locus_tag LOCUS_07770 136385 136158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 137167 136406 gene locus_tag LOCUS_07780 137167 136406 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_07780 138156 137170 gene locus_tag LOCUS_07790 138156 137170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 139251 138265 gene locus_tag LOCUS_07800 139251 138265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 140289 139282 gene locus_tag LOCUS_07810 140289 139282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612424.1 protein_id gnl|my_center|LOCUS_07810 141808 140282 gene locus_tag LOCUS_07820 141808 140282 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612422.1 protein_id gnl|my_center|LOCUS_07820 143060 141906 gene locus_tag LOCUS_07830 gene torT 143060 141906 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612420.1 protein_id gnl|my_center|LOCUS_07830 144428 143184 gene locus_tag LOCUS_07840 gene gabT 144428 143184 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093019.1 protein_id gnl|my_center|LOCUS_07840 145394 144588 gene locus_tag LOCUS_07850 145394 144588 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814139.1 protein_id gnl|my_center|LOCUS_07850 145594 146595 gene locus_tag LOCUS_07860 gene bioB 145594 146595 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228065.1 protein_id gnl|my_center|LOCUS_07860 147540 146650 gene locus_tag LOCUS_07870 147540 146650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 148337 148422 gene locus_tag LOCUS_t00140 148337 148422 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 149003 148719 gene locus_tag LOCUS_07880 149003 148719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 149582 149145 gene locus_tag LOCUS_07890 149582 149145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 150907 149582 gene locus_tag LOCUS_07900 150907 149582 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_07900 150788 151180 gene locus_tag LOCUS_07910 150788 151180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 151677 153017 gene locus_tag LOCUS_07920 151677 153017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113893.1 protein_id gnl|my_center|LOCUS_07920 154163 153135 gene locus_tag LOCUS_07930 gene arsS 154163 153135 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_07930 154644 155963 gene locus_tag LOCUS_07940 154644 155963 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090419.1 protein_id gnl|my_center|LOCUS_07940 156952 156086 gene locus_tag LOCUS_07950 156952 156086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 157823 156870 gene locus_tag LOCUS_07960 157823 156870 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_07960 158645 158373 gene locus_tag LOCUS_07970 158645 158373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_07970 160060 159200 gene locus_tag LOCUS_07980 gene atpG 160060 159200 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_07980 161633 160068 gene locus_tag LOCUS_07990 161633 160068 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205710.1 protein_id gnl|my_center|LOCUS_07990 162369 161617 gene locus_tag LOCUS_08000 162369 161617 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188739.1 protein_id gnl|my_center|LOCUS_08000 162617 162372 gene locus_tag LOCUS_08010 162617 162372 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187193.1 protein_id gnl|my_center|LOCUS_08010 163299 162631 gene locus_tag LOCUS_08020 163299 162631 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187346.1 protein_id gnl|my_center|LOCUS_08020 163580 163296 gene locus_tag LOCUS_08030 163580 163296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 163882 163577 gene locus_tag LOCUS_08040 163882 163577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 164338 163895 gene locus_tag LOCUS_08050 164338 163895 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836235.1 protein_id gnl|my_center|LOCUS_08050 165864 164341 gene locus_tag LOCUS_08060 gene atpD 165864 164341 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045606127.1 protein_id gnl|my_center|LOCUS_08060 166476 167096 gene locus_tag LOCUS_08070 166476 167096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_08070 167646 169178 gene locus_tag LOCUS_08080 167646 169178 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_08080 169323 169994 gene locus_tag LOCUS_08090 169323 169994 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_08090 170167 169991 gene locus_tag LOCUS_08100 170167 169991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 170283 170891 gene locus_tag LOCUS_08110 170283 170891 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_08110 171036 171731 gene locus_tag LOCUS_08120 171036 171731 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_08120 172430 171732 gene locus_tag LOCUS_08130 172430 171732 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967273.1 protein_id gnl|my_center|LOCUS_08130 172802 173344 gene locus_tag LOCUS_08140 gene cysC 172802 173344 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_08140 173603 173679 gene locus_tag LOCUS_t00150 173603 173679 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 174173 174568 gene locus_tag LOCUS_08150 174173 174568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 175063 176184 gene locus_tag LOCUS_08160 175063 176184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 176475 178010 gene locus_tag LOCUS_08170 176475 178010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 178059 178826 gene locus_tag LOCUS_08180 178059 178826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 179073 179438 gene locus_tag LOCUS_08190 179073 179438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 179594 180568 gene locus_tag LOCUS_08200 179594 180568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 180790 182055 gene locus_tag LOCUS_08210 180790 182055 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259593.1 protein_id gnl|my_center|LOCUS_08210 182113 182382 gene locus_tag LOCUS_08220 182113 182382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 182522 183205 gene locus_tag LOCUS_08230 182522 183205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 183790 184419 gene locus_tag LOCUS_08240 183790 184419 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_08240 187718 184512 gene locus_tag LOCUS_08250 187718 184512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 188605 189591 gene locus_tag LOCUS_08260 gene gnd 188605 189591 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_08260 191087 189765 gene locus_tag LOCUS_08270 191087 189765 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_08270 192665 191331 gene locus_tag LOCUS_08280 192665 191331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_08280 193384 195090 gene locus_tag LOCUS_08290 gene polX 193384 195090 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_08290 195485 196249 gene locus_tag LOCUS_08300 195485 196249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 196731 198221 gene locus_tag LOCUS_08310 196731 198221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 198262 201417 gene locus_tag LOCUS_08320 198262 201417 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_08320 201610 202434 gene locus_tag LOCUS_08330 201610 202434 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_08330 202588 205398 gene locus_tag LOCUS_08340 202588 205398 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_08340 205399 206205 gene locus_tag LOCUS_08350 205399 206205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 206540 208639 gene locus_tag LOCUS_08360 gene fusA 206540 208639 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_08360 208957 208727 gene locus_tag LOCUS_08370 208957 208727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 209178 209387 gene locus_tag LOCUS_08380 209178 209387 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_08380 210933 211145 gene locus_tag LOCUS_08390 210933 211145 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_08390 211149 213371 gene locus_tag LOCUS_08400 211149 213371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_08400 213443 214753 gene locus_tag LOCUS_08410 213443 214753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 214788 215564 gene locus_tag LOCUS_08420 gene queC 214788 215564 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_08420 216541 215783 gene locus_tag LOCUS_08430 216541 215783 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_08430 217060 217134 gene locus_tag LOCUS_t00160 217060 217134 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 217551 218393 gene locus_tag LOCUS_08440 217551 218393 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_08440 218421 219134 gene locus_tag LOCUS_08450 218421 219134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 219349 219792 gene locus_tag LOCUS_08460 219349 219792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08460 219761 219928 gene locus_tag LOCUS_08470 219761 219928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 220906 220445 gene locus_tag LOCUS_08480 220906 220445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 221516 222388 gene locus_tag LOCUS_08490 221516 222388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 222744 223172 gene locus_tag LOCUS_08500 222744 223172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 223199 223606 gene locus_tag LOCUS_08510 223199 223606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 223615 225036 gene locus_tag LOCUS_08520 223615 225036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence04 3042 1915 gene locus_tag LOCUS_08530 3042 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3064 3357 gene locus_tag LOCUS_08540 3064 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4315 4076 gene locus_tag LOCUS_08550 4315 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4469 4263 gene locus_tag LOCUS_08560 4469 4263 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_08560 4665 4471 gene locus_tag LOCUS_08570 4665 4471 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_08570 8063 4662 gene locus_tag LOCUS_08580 8063 4662 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_08580 8413 8180 gene locus_tag LOCUS_08590 8413 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 10096 8630 gene locus_tag LOCUS_08600 10096 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 10647 10093 gene locus_tag LOCUS_08610 10647 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12875 11112 gene locus_tag LOCUS_08620 12875 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13271 12999 gene locus_tag LOCUS_08630 13271 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 13764 13468 gene locus_tag LOCUS_08640 13764 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 14332 13880 gene locus_tag LOCUS_08650 14332 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14784 14329 gene locus_tag LOCUS_08660 14784 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 15928 14963 gene locus_tag LOCUS_08670 15928 14963 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_08670 16119 16034 gene locus_tag LOCUS_t00170 16119 16034 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17719 16307 gene locus_tag LOCUS_08680 17719 16307 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_08680 18454 18104 gene locus_tag LOCUS_08690 18454 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 20409 18991 gene locus_tag LOCUS_08700 20409 18991 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_08700 23066 20655 gene locus_tag LOCUS_08710 23066 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 23559 27530 gene locus_tag LOCUS_08720 23559 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 27595 28137 gene locus_tag LOCUS_08730 27595 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 30603 28258 gene locus_tag LOCUS_08740 gene ppk1 30603 28258 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_08740 30960 31355 gene locus_tag LOCUS_08750 30960 31355 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_08750 31355 32254 gene locus_tag LOCUS_08760 31355 32254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 32548 34038 gene locus_tag LOCUS_08770 gene glpK 32548 34038 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_08770 34095 35729 gene locus_tag LOCUS_08780 34095 35729 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 protein_id gnl|my_center|LOCUS_08780 35814 36224 gene locus_tag LOCUS_08790 35814 36224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 36945 36313 gene locus_tag LOCUS_08800 36945 36313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 37511 37236 gene locus_tag LOCUS_08810 37511 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 38521 37787 gene locus_tag LOCUS_08820 38521 37787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 39686 38784 gene locus_tag LOCUS_08830 gene rapZ 39686 38784 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_08830 40244 39783 gene locus_tag LOCUS_08840 40244 39783 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_08840 40889 40407 gene locus_tag LOCUS_08850 40889 40407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 42471 40924 gene locus_tag LOCUS_08860 gene rpoN 42471 40924 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_08860 43124 42486 gene locus_tag LOCUS_08870 43124 42486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 43788 43186 gene locus_tag LOCUS_08880 43788 43186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 43980 45389 gene locus_tag LOCUS_08890 43980 45389 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_08890 45591 46046 gene locus_tag LOCUS_08900 45591 46046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 46384 46043 gene locus_tag LOCUS_08910 46384 46043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 47576 48862 gene locus_tag LOCUS_08920 gene egtB 47576 48862 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_08920 48868 49923 gene locus_tag LOCUS_08930 gene egtD 48868 49923 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_08930 49913 50149 gene locus_tag LOCUS_08940 49913 50149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 50449 51144 gene locus_tag LOCUS_08950 50449 51144 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626347.1 protein_id gnl|my_center|LOCUS_08950 51162 52070 gene locus_tag LOCUS_08960 51162 52070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 52259 53107 gene locus_tag LOCUS_08970 52259 53107 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_08970 54124 53168 gene locus_tag LOCUS_08980 54124 53168 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_08980 54934 54182 gene locus_tag LOCUS_08990 54934 54182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 55383 54949 gene locus_tag LOCUS_09000 55383 54949 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_09000 55856 55407 gene locus_tag LOCUS_09010 55856 55407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 56227 56532 gene locus_tag LOCUS_09020 56227 56532 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_09020 56670 57629 gene locus_tag LOCUS_09030 56670 57629 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_09030 59384 57879 gene locus_tag LOCUS_09040 59384 57879 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_09040 60928 59381 gene locus_tag LOCUS_09050 60928 59381 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_09050 62865 60925 gene locus_tag LOCUS_09060 gene nuoL 62865 60925 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_09060 63161 62859 gene locus_tag LOCUS_09070 gene nuoK 63161 62859 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_09070 63718 63158 gene locus_tag LOCUS_09080 63718 63158 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 protein_id gnl|my_center|LOCUS_09080 64844 63735 gene locus_tag LOCUS_09090 gene nuoH 64844 63735 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_09090 65334 64834 gene locus_tag LOCUS_09100 65334 64834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 65781 66179 gene locus_tag LOCUS_09110 65781 66179 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_09110 67383 66193 gene locus_tag LOCUS_09120 67383 66193 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_09120 70056 67465 gene locus_tag LOCUS_09130 70056 67465 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_09130 71979 70114 gene locus_tag LOCUS_09140 71979 70114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 72887 71982 gene locus_tag LOCUS_09150 72887 71982 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582648.1 protein_id gnl|my_center|LOCUS_09150 73940 72900 gene locus_tag LOCUS_09160 73940 72900 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_09160 75379 73937 gene locus_tag LOCUS_09170 75379 73937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 75826 75638 gene locus_tag LOCUS_09180 75826 75638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 76328 76128 gene locus_tag LOCUS_09190 76328 76128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 77652 76303 gene locus_tag LOCUS_09200 77652 76303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 78409 77822 gene locus_tag LOCUS_09210 78409 77822 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_09210 78351 78584 gene locus_tag LOCUS_09220 78351 78584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 79161 80570 gene locus_tag LOCUS_09230 79161 80570 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027210.1 protein_id gnl|my_center|LOCUS_09230 80582 81766 gene locus_tag LOCUS_09240 80582 81766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 81874 83016 gene locus_tag LOCUS_09250 81874 83016 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_09250 83832 83134 gene locus_tag LOCUS_09260 83832 83134 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_09260 84266 84907 gene locus_tag LOCUS_09270 84266 84907 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_09270 85251 85835 gene locus_tag LOCUS_09280 85251 85835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 86464 86991 gene locus_tag LOCUS_09290 86464 86991 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_09290 87067 87951 gene locus_tag LOCUS_09300 87067 87951 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510049.1 protein_id gnl|my_center|LOCUS_09300 88760 88101 gene locus_tag LOCUS_09310 gene thiE 88760 88101 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_09310 89756 88902 gene locus_tag LOCUS_09320 89756 88902 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_09320 89955 89740 gene locus_tag LOCUS_09330 gene thiS 89955 89740 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_09330 89869 90114 gene locus_tag LOCUS_09340 89869 90114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 90491 91708 gene locus_tag LOCUS_09350 90491 91708 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967450.1 protein_id gnl|my_center|LOCUS_09350 92816 91788 gene locus_tag LOCUS_09360 92816 91788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 93653 92823 gene locus_tag LOCUS_09370 93653 92823 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_09370 94082 94762 gene locus_tag LOCUS_09380 94082 94762 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241077.1 protein_id gnl|my_center|LOCUS_09380 94904 96388 gene locus_tag LOCUS_09390 94904 96388 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_09390 96385 97680 gene locus_tag LOCUS_09400 96385 97680 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_09400 97677 98966 gene locus_tag LOCUS_09410 gene glcF 97677 98966 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_09410 99112 100686 gene locus_tag LOCUS_09420 gene aceB 99112 100686 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_09420 102537 100933 gene locus_tag LOCUS_09430 102537 100933 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763085.1 protein_id gnl|my_center|LOCUS_09430 103177 104409 gene locus_tag LOCUS_09440 103177 104409 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633142.1 protein_id gnl|my_center|LOCUS_09440 104857 105810 gene locus_tag LOCUS_09450 104857 105810 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_09450 105835 107259 gene locus_tag LOCUS_09460 105835 107259 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_09460 107510 108013 gene locus_tag LOCUS_09470 107510 108013 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_09470 108083 108805 gene locus_tag LOCUS_09480 108083 108805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 109132 109569 gene locus_tag LOCUS_09490 109132 109569 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_09490 110651 109728 gene locus_tag LOCUS_09500 110651 109728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 111378 110893 gene locus_tag LOCUS_09510 111378 110893 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142043.1 protein_id gnl|my_center|LOCUS_09510 111749 111375 gene locus_tag LOCUS_09520 111749 111375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 111655 112989 gene locus_tag LOCUS_09530 111655 112989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030428446.1 protein_id gnl|my_center|LOCUS_09530 113642 113187 gene locus_tag LOCUS_09540 113642 113187 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_09540 113909 114574 gene locus_tag LOCUS_09550 113909 114574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 114538 116142 gene locus_tag LOCUS_09560 114538 116142 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_09560 116155 117105 gene locus_tag LOCUS_09570 116155 117105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_09570 117092 117970 gene locus_tag LOCUS_09580 117092 117970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_09580 118273 119238 gene locus_tag LOCUS_09590 118273 119238 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_09590 119249 120253 gene locus_tag LOCUS_09600 119249 120253 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380904.1 protein_id gnl|my_center|LOCUS_09600 120259 121380 gene locus_tag LOCUS_09610 120259 121380 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 protein_id gnl|my_center|LOCUS_09610 121758 122006 gene locus_tag LOCUS_09620 121758 122006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 122073 122327 gene locus_tag LOCUS_09630 122073 122327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 122355 123107 gene locus_tag LOCUS_09640 122355 123107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 124322 123486 gene locus_tag LOCUS_09650 124322 123486 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817676.1 protein_id gnl|my_center|LOCUS_09650 127708 124460 gene locus_tag LOCUS_09660 127708 124460 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_09660 128790 127705 gene locus_tag LOCUS_09670 128790 127705 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_09670 130002 128794 gene locus_tag LOCUS_09680 130002 128794 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_09680 130015 130278 gene locus_tag LOCUS_09690 130015 130278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 130668 130234 gene locus_tag LOCUS_09700 130668 130234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 130917 130681 gene locus_tag LOCUS_09710 130917 130681 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 protein_id gnl|my_center|LOCUS_09710 130982 131716 gene locus_tag LOCUS_09720 130982 131716 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_09720 131837 132088 gene locus_tag LOCUS_09730 131837 132088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 132227 132526 gene locus_tag LOCUS_09740 132227 132526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 132492 133196 gene locus_tag LOCUS_09750 132492 133196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 133700 134341 gene locus_tag LOCUS_09760 133700 134341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 135186 134314 gene locus_tag LOCUS_09770 135186 134314 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084901.1 protein_id gnl|my_center|LOCUS_09770 135408 135707 gene locus_tag LOCUS_09780 135408 135707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 135714 135956 gene locus_tag LOCUS_09790 135714 135956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 137617 136478 gene locus_tag LOCUS_09800 gene nirJ2 137617 136478 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966080.1 protein_id gnl|my_center|LOCUS_09800 138216 137857 gene locus_tag LOCUS_09810 138216 137857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 140206 139118 gene locus_tag LOCUS_09820 gene asd 140206 139118 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_09820 141524 140349 gene locus_tag LOCUS_09830 141524 140349 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965168.1 protein_id gnl|my_center|LOCUS_09830 141891 142445 gene locus_tag LOCUS_09840 gene pyrE 141891 142445 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_09840 142454 143344 gene locus_tag LOCUS_09850 gene aroE 142454 143344 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544907.1 protein_id gnl|my_center|LOCUS_09850 144748 143612 gene locus_tag LOCUS_09860 gene dnaJ 144748 143612 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_09860 147144 145189 gene locus_tag LOCUS_09870 gene dnaK 147144 145189 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_09870 148130 147453 gene locus_tag LOCUS_09880 148130 147453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 149544 148468 gene locus_tag LOCUS_09890 gene hrcA 149544 148468 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_09890 149840 151426 gene locus_tag LOCUS_09900 149840 151426 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048176.1 protein_id gnl|my_center|LOCUS_09900 151802 154639 gene locus_tag LOCUS_09910 151802 154639 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_09910 155783 155010 gene locus_tag LOCUS_09920 155783 155010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 157517 156504 gene locus_tag LOCUS_09930 157517 156504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 157671 157910 gene locus_tag LOCUS_09940 157671 157910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 158237 159142 gene locus_tag LOCUS_09950 158237 159142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_09950 159117 159980 gene locus_tag LOCUS_09960 159117 159980 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_09960 159977 161026 gene locus_tag LOCUS_09970 159977 161026 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_09970 161118 161588 gene locus_tag LOCUS_09980 161118 161588 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_09980 161706 163400 gene locus_tag LOCUS_09990 161706 163400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 164019 164300 gene locus_tag LOCUS_10000 164019 164300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 164618 165766 gene locus_tag LOCUS_10010 gene hemW 164618 165766 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_10010 166631 165876 gene locus_tag LOCUS_10020 166631 165876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 167165 166965 gene locus_tag LOCUS_10030 167165 166965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 167620 168216 gene locus_tag LOCUS_10040 167620 168216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 168246 168443 gene locus_tag LOCUS_10050 168246 168443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 168440 169678 gene locus_tag LOCUS_10060 168440 169678 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_10060 169666 169950 gene locus_tag LOCUS_10070 169666 169950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 170169 170828 gene locus_tag LOCUS_10080 170169 170828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 170910 172058 gene locus_tag LOCUS_10090 gene hemW 170910 172058 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_10090 173766 172177 gene locus_tag LOCUS_10100 173766 172177 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_10100 173987 173784 gene locus_tag LOCUS_10110 173987 173784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 174363 175403 gene locus_tag LOCUS_10120 174363 175403 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_10120 176355 175576 gene locus_tag LOCUS_10130 gene recO 176355 175576 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_10130 177493 176369 gene locus_tag LOCUS_10140 177493 176369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 177783 178670 gene locus_tag LOCUS_10150 177783 178670 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_10150 180166 178835 gene locus_tag LOCUS_10160 180166 178835 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_10160 180524 181936 gene locus_tag LOCUS_10170 gene hydA 180524 181936 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_10170 182199 183326 gene locus_tag LOCUS_10180 182199 183326 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870412.1 protein_id gnl|my_center|LOCUS_10180 183323 186043 gene locus_tag LOCUS_10190 183323 186043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870411.1 protein_id gnl|my_center|LOCUS_10190 186241 187515 gene locus_tag LOCUS_10200 186241 187515 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_10200 187893 189098 gene locus_tag LOCUS_10210 187893 189098 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087237.1 protein_id gnl|my_center|LOCUS_10210 189841 192582 gene locus_tag LOCUS_10220 189841 192582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 192774 193103 gene locus_tag LOCUS_10230 192774 193103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 193088 193327 gene locus_tag LOCUS_10240 193088 193327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 193348 193488 gene locus_tag LOCUS_10250 193348 193488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 193638 194978 gene locus_tag LOCUS_10260 193638 194978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_10260 194990 198118 gene locus_tag LOCUS_10270 194990 198118 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_10270 198376 198161 gene locus_tag LOCUS_10280 198376 198161 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173482.1 protein_id gnl|my_center|LOCUS_10280 198949 199563 gene locus_tag LOCUS_10290 198949 199563 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_10290 199630 200667 gene locus_tag LOCUS_10300 199630 200667 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 protein_id gnl|my_center|LOCUS_10300 201587 202999 gene locus_tag LOCUS_10310 gene glnA 201587 202999 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_10310 203638 203174 gene locus_tag LOCUS_10320 203638 203174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 206235 203638 gene locus_tag LOCUS_10330 206235 203638 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_10330 206391 206675 gene locus_tag LOCUS_10340 206391 206675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 207191 206700 gene locus_tag LOCUS_10350 207191 206700 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947818.1 protein_id gnl|my_center|LOCUS_10350 207604 207320 gene locus_tag LOCUS_10360 207604 207320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_10360 207835 208008 gene locus_tag LOCUS_10370 207835 208008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 208023 209018 gene locus_tag LOCUS_10380 208023 209018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 209473 210228 gene locus_tag LOCUS_10390 209473 210228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 211695 210388 gene locus_tag LOCUS_10400 gene aceA 211695 210388 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237144.1 protein_id gnl|my_center|LOCUS_10400 212559 212353 gene locus_tag LOCUS_10410 212559 212353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 212813 213832 gene locus_tag LOCUS_10420 212813 213832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 214166 214855 gene locus_tag LOCUS_10430 214166 214855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 215962 215030 gene locus_tag LOCUS_10440 215962 215030 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_10440 217214 216165 gene locus_tag LOCUS_10450 217214 216165 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_10450 218004 217549 gene locus_tag LOCUS_10460 218004 217549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 218383 218009 gene locus_tag LOCUS_10470 218383 218009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 219830 218907 gene locus_tag LOCUS_10480 219830 218907 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_10480 220841 220233 gene locus_tag LOCUS_10490 gene coaE 220841 220233 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_10490 221452 222303 gene locus_tag LOCUS_10500 221452 222303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257914.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence05 990 388 gene locus_tag LOCUS_10510 gene lexA 990 388 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_10510 2413 1289 gene locus_tag LOCUS_10520 2413 1289 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973048.1 protein_id gnl|my_center|LOCUS_10520 3702 2527 gene locus_tag LOCUS_10530 3702 2527 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815298.1 protein_id gnl|my_center|LOCUS_10530 4456 3875 gene locus_tag LOCUS_10540 gene msuE 4456 3875 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 protein_id gnl|my_center|LOCUS_10540 5259 5026 gene locus_tag LOCUS_10550 5259 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 6728 5664 gene locus_tag LOCUS_10560 6728 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8545 7346 gene locus_tag LOCUS_10570 gene frc 8545 7346 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_10570 9595 8837 gene locus_tag LOCUS_10580 9595 8837 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_10580 10034 11521 gene locus_tag LOCUS_10590 10034 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 12548 11691 gene locus_tag LOCUS_10600 12548 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 13143 13943 gene locus_tag LOCUS_10610 gene cobB 13143 13943 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 protein_id gnl|my_center|LOCUS_10610 15914 14184 gene locus_tag LOCUS_10620 gene dsbD 15914 14184 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958394.1 protein_id gnl|my_center|LOCUS_10620 16582 17664 gene locus_tag LOCUS_10630 16582 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 17686 18423 gene locus_tag LOCUS_10640 17686 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 19851 18691 gene locus_tag LOCUS_10650 19851 18691 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_10650 20039 21451 gene locus_tag LOCUS_10660 gene selA 20039 21451 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967004.1 protein_id gnl|my_center|LOCUS_10660 21777 22544 gene locus_tag LOCUS_10670 21777 22544 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_10670 22984 24747 gene locus_tag LOCUS_10680 22984 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 25561 25304 gene locus_tag LOCUS_10690 25561 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 25602 26105 gene locus_tag LOCUS_10700 25602 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 27017 26160 gene locus_tag LOCUS_10710 27017 26160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 27552 26947 gene locus_tag LOCUS_10720 27552 26947 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_10720 29551 28085 gene locus_tag LOCUS_10730 29551 28085 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_10730 30249 29551 gene locus_tag LOCUS_10740 gene rpiA 30249 29551 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_10740 30947 30378 gene locus_tag LOCUS_10750 30947 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 32026 31085 gene locus_tag LOCUS_10760 32026 31085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 33459 32383 gene locus_tag LOCUS_10770 33459 32383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 33845 34366 gene locus_tag LOCUS_10780 gene bcp 33845 34366 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_10780 35388 34531 gene locus_tag LOCUS_10790 35388 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 36453 35392 gene locus_tag LOCUS_10800 gene lpxD 36453 35392 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_10800 36541 36960 gene locus_tag LOCUS_10810 gene hisI 36541 36960 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_10810 37196 38098 gene locus_tag LOCUS_10820 gene hisG 37196 38098 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_10820 38771 39319 gene locus_tag LOCUS_10830 38771 39319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 39647 39408 gene locus_tag LOCUS_10840 39647 39408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 40351 39995 gene locus_tag LOCUS_10850 40351 39995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 40799 42517 gene locus_tag LOCUS_10860 gene gspE 40799 42517 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_10860 42795 44015 gene locus_tag LOCUS_10870 gene gspF 42795 44015 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_10870 44033 44467 gene locus_tag LOCUS_10880 gene gspG 44033 44467 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 protein_id gnl|my_center|LOCUS_10880 44517 45125 gene locus_tag LOCUS_10890 44517 45125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 45643 46002 gene locus_tag LOCUS_10900 45643 46002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 45999 46673 gene locus_tag LOCUS_10910 45999 46673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 46676 47677 gene locus_tag LOCUS_10920 gene gspK 46676 47677 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_10920 47696 49150 gene locus_tag LOCUS_10930 47696 49150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 49154 49792 gene locus_tag LOCUS_10940 49154 49792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 49978 50829 gene locus_tag LOCUS_10950 49978 50829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 50870 51880 gene locus_tag LOCUS_10960 50870 51880 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_10960 52581 52069 gene locus_tag LOCUS_10970 52581 52069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 53427 52702 gene locus_tag LOCUS_10980 53427 52702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 54783 57197 gene locus_tag LOCUS_10990 gene gyrB 54783 57197 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_10990 57781 60327 gene locus_tag LOCUS_11000 gene gyrA 57781 60327 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_11000 61859 60465 gene locus_tag LOCUS_11010 61859 60465 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_11010 62837 63898 gene locus_tag LOCUS_11020 62837 63898 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 protein_id gnl|my_center|LOCUS_11020 65406 63982 gene locus_tag LOCUS_11030 65406 63982 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726801.1 protein_id gnl|my_center|LOCUS_11030 66902 65394 gene locus_tag LOCUS_11040 66902 65394 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726802.1 protein_id gnl|my_center|LOCUS_11040 67781 67008 gene locus_tag LOCUS_11050 gene fabG 67781 67008 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_11050 68955 67924 gene locus_tag LOCUS_11060 68955 67924 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530209.1 protein_id gnl|my_center|LOCUS_11060 69850 68972 gene locus_tag LOCUS_11070 69850 68972 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104449.1 protein_id gnl|my_center|LOCUS_11070 70585 69860 gene locus_tag LOCUS_11080 70585 69860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086141.1 protein_id gnl|my_center|LOCUS_11080 71373 70582 gene locus_tag LOCUS_11090 71373 70582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878326.1 protein_id gnl|my_center|LOCUS_11090 72751 71375 gene locus_tag LOCUS_11100 72751 71375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 75069 72820 gene locus_tag LOCUS_11110 75069 72820 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_11110 75420 75121 gene locus_tag LOCUS_11120 75420 75121 CDS product small subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811614.1 protein_id gnl|my_center|LOCUS_11120 76586 75588 gene locus_tag LOCUS_11130 76586 75588 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390764.1 protein_id gnl|my_center|LOCUS_11130 77360 76785 gene locus_tag LOCUS_11140 77360 76785 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_11140 80047 77468 gene locus_tag LOCUS_11150 80047 77468 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_11150 81846 80044 gene locus_tag LOCUS_11160 81846 80044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 83104 82205 gene locus_tag LOCUS_11170 83104 82205 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_11170 84105 83107 gene locus_tag LOCUS_11180 84105 83107 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_11180 85684 84170 gene locus_tag LOCUS_11190 85684 84170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 86776 85688 gene locus_tag LOCUS_11200 gene mltG 86776 85688 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_11200 87227 86820 gene locus_tag LOCUS_11210 gene ruvX 87227 86820 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_11210 87940 88239 gene locus_tag LOCUS_11220 87940 88239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 88256 88759 gene locus_tag LOCUS_11230 88256 88759 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_11230 88838 89926 gene locus_tag LOCUS_11240 88838 89926 CDS product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367212.1 protein_id gnl|my_center|LOCUS_11240 90831 89914 gene locus_tag LOCUS_11250 90831 89914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 91574 90843 gene locus_tag LOCUS_11260 91574 90843 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_11260 91780 93135 gene locus_tag LOCUS_11270 91780 93135 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_11270 93138 94214 gene locus_tag LOCUS_11280 93138 94214 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_11280 95058 94321 gene locus_tag LOCUS_11290 95058 94321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 95736 97205 gene locus_tag LOCUS_11300 95736 97205 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267790.1 protein_id gnl|my_center|LOCUS_11300 97430 99619 gene locus_tag LOCUS_11310 97430 99619 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_11310 100849 101307 gene locus_tag LOCUS_11320 100849 101307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 101392 102621 gene locus_tag LOCUS_11330 101392 102621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114846.1 protein_id gnl|my_center|LOCUS_11330 103131 103475 gene locus_tag LOCUS_11340 103131 103475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 103472 103768 gene locus_tag LOCUS_11350 103472 103768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 103790 104794 gene locus_tag LOCUS_11360 103790 104794 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_11360 104791 105732 gene locus_tag LOCUS_11370 104791 105732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_11370 105735 106688 gene locus_tag LOCUS_11380 105735 106688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_11380 106685 107821 gene locus_tag LOCUS_11390 106685 107821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_11390 107834 108967 gene locus_tag LOCUS_11400 107834 108967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_11400 110315 109038 gene locus_tag LOCUS_11410 110315 109038 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_11410 111022 110312 gene locus_tag LOCUS_11420 111022 110312 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_11420 113475 111235 gene locus_tag LOCUS_11430 113475 111235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 116180 113634 gene locus_tag LOCUS_11440 116180 113634 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393352.1 protein_id gnl|my_center|LOCUS_11440 117672 116275 gene locus_tag LOCUS_11450 117672 116275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 119266 118301 gene locus_tag LOCUS_11460 119266 118301 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_11460 119497 121230 gene locus_tag LOCUS_11470 119497 121230 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_11470 121361 121543 gene locus_tag LOCUS_11480 121361 121543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 122370 121783 gene locus_tag LOCUS_11490 122370 121783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 123031 122561 gene locus_tag LOCUS_11500 123031 122561 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_11500 123630 123112 gene locus_tag LOCUS_11510 123630 123112 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_11510 124984 123650 gene locus_tag LOCUS_11520 124984 123650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 125638 125865 gene locus_tag LOCUS_11530 125638 125865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 127237 126224 gene locus_tag LOCUS_11540 127237 126224 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_11540 129233 128463 gene locus_tag LOCUS_11550 129233 128463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 129725 132517 gene locus_tag LOCUS_11560 129725 132517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 132693 133355 gene locus_tag LOCUS_11570 132693 133355 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_11570 133352 134227 gene locus_tag LOCUS_11580 133352 134227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 134246 136414 gene locus_tag LOCUS_11590 134246 136414 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_11590 136411 137856 gene locus_tag LOCUS_11600 136411 137856 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_11600 138121 138891 gene locus_tag LOCUS_11610 138121 138891 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_11610 139244 139855 gene locus_tag LOCUS_11620 139244 139855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 139836 140987 gene locus_tag LOCUS_11630 gene hadC 139836 140987 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_11630 141016 142341 gene locus_tag LOCUS_11640 gene fldB 141016 142341 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_11640 142384 143202 gene locus_tag LOCUS_11650 142384 143202 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_11650 143199 144020 gene locus_tag LOCUS_11660 143199 144020 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_11660 144105 144401 gene locus_tag LOCUS_11670 144105 144401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 144398 144850 gene locus_tag LOCUS_11680 144398 144850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 145241 146860 gene locus_tag LOCUS_11690 145241 146860 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_11690 146878 147357 gene locus_tag LOCUS_11700 146878 147357 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_11700 147528 150032 gene locus_tag LOCUS_11710 gene xdhA 147528 150032 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_11710 150201 151226 gene locus_tag LOCUS_11720 150201 151226 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975841.1 protein_id gnl|my_center|LOCUS_11720 151443 151838 gene locus_tag LOCUS_11730 151443 151838 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388492.1 protein_id gnl|my_center|LOCUS_11730 153304 152045 gene locus_tag LOCUS_11740 153304 152045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 154026 153301 gene locus_tag LOCUS_11750 gene hypB 154026 153301 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388055.1 protein_id gnl|my_center|LOCUS_11750 154367 154026 gene locus_tag LOCUS_11760 gene hypA 154367 154026 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_11760 155214 154378 gene locus_tag LOCUS_11770 155214 154378 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812449.1 protein_id gnl|my_center|LOCUS_11770 156283 155243 gene locus_tag LOCUS_11780 gene hypE 156283 155243 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_11780 157419 156280 gene locus_tag LOCUS_11790 gene hypD 157419 156280 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_11790 157702 157412 gene locus_tag LOCUS_11800 157702 157412 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_11800 160026 157708 gene locus_tag LOCUS_11810 gene hypF 160026 157708 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_11810 160224 160030 gene locus_tag LOCUS_11820 160224 160030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 160927 160358 gene locus_tag LOCUS_11830 160927 160358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 161805 161086 gene locus_tag LOCUS_11840 gene cybH 161805 161086 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_11840 163508 161802 gene locus_tag LOCUS_11850 163508 161802 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_11850 164610 163510 gene locus_tag LOCUS_11860 164610 163510 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_11860 165341 166486 gene locus_tag LOCUS_11870 165341 166486 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_11870 166488 166949 gene locus_tag LOCUS_11880 166488 166949 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 protein_id gnl|my_center|LOCUS_11880 166968 167828 gene locus_tag LOCUS_11890 166968 167828 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_11890 167834 168622 gene locus_tag LOCUS_11900 167834 168622 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_11900 168603 169886 gene locus_tag LOCUS_11910 168603 169886 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_11910 169886 170356 gene locus_tag LOCUS_11920 169886 170356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 170888 171814 gene locus_tag LOCUS_11930 170888 171814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 171811 172992 gene locus_tag LOCUS_11940 171811 172992 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_11940 173014 173973 gene locus_tag LOCUS_11950 173014 173973 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_11950 174455 174141 gene locus_tag LOCUS_11960 174455 174141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 174819 174562 gene locus_tag LOCUS_11970 174819 174562 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_11970 175108 174824 gene locus_tag LOCUS_11980 175108 174824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 176204 175437 gene locus_tag LOCUS_11990 176204 175437 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_11990 176697 176374 gene locus_tag LOCUS_12000 gene grxD 176697 176374 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771068.1 protein_id gnl|my_center|LOCUS_12000 176960 176712 gene locus_tag LOCUS_12010 176960 176712 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144400.1 protein_id gnl|my_center|LOCUS_12010 178418 177174 gene locus_tag LOCUS_12020 178418 177174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 179728 178721 gene locus_tag LOCUS_12030 179728 178721 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_12030 180135 183710 gene locus_tag LOCUS_12040 gene mfd 180135 183710 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_12040 183872 184837 gene locus_tag LOCUS_12050 183872 184837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 184902 185906 gene locus_tag LOCUS_12060 gene pdxA 184902 185906 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_12060 185917 188745 gene locus_tag LOCUS_12070 gene uvrA 185917 188745 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_12070 189471 188827 gene locus_tag LOCUS_12080 189471 188827 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_12080 190771 189416 gene locus_tag LOCUS_12090 190771 189416 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_12090 192212 190827 gene locus_tag LOCUS_12100 192212 190827 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_12100 192266 194431 gene locus_tag LOCUS_12110 192266 194431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 195162 194917 gene locus_tag LOCUS_12120 195162 194917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 195413 195162 gene locus_tag LOCUS_12130 195413 195162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 195512 195706 gene locus_tag LOCUS_12140 195512 195706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 197550 196024 gene locus_tag LOCUS_12150 gene gpmI 197550 196024 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_12150 198857 197547 gene locus_tag LOCUS_12160 gene eno 198857 197547 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_12160 199724 199098 gene locus_tag LOCUS_12170 199724 199098 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706202.1 protein_id gnl|my_center|LOCUS_12170 201252 199957 gene locus_tag LOCUS_12180 201252 199957 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_12180 201930 201262 gene locus_tag LOCUS_12190 201930 201262 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938551.1 protein_id gnl|my_center|LOCUS_12190 203240 201912 gene locus_tag LOCUS_12200 gene purD 203240 201912 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_12200 204831 203263 gene locus_tag LOCUS_12210 gene purH 204831 203263 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_12210 205937 204837 gene locus_tag LOCUS_12220 gene alr 205937 204837 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12220 206631 206341 gene locus_tag LOCUS_12230 206631 206341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 207718 206684 gene locus_tag LOCUS_12240 gene htpX 207718 206684 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985953.1 protein_id gnl|my_center|LOCUS_12240 208319 207747 gene locus_tag LOCUS_12250 208319 207747 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 protein_id gnl|my_center|LOCUS_12250 208824 208537 gene locus_tag LOCUS_12260 208824 208537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 208787 209527 gene locus_tag LOCUS_12270 208787 209527 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence06 <1 577 gene locus_tag LOCUS_12280 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000163274.1:zincin-like metallopeptidase domain-containing protein 1115 738 gene locus_tag LOCUS_12290 1115 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2032 1412 gene locus_tag LOCUS_12300 2032 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2306 2614 gene locus_tag LOCUS_12310 2306 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2684 2863 gene locus_tag LOCUS_12320 2684 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4416 3031 gene locus_tag LOCUS_12330 4416 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4570 4319 gene locus_tag LOCUS_12340 4570 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5343 4732 gene locus_tag LOCUS_12350 5343 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5482 6099 gene locus_tag LOCUS_12360 5482 6099 CDS product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530137.1 protein_id gnl|my_center|LOCUS_12360 6330 6121 gene locus_tag LOCUS_12370 6330 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7399 6617 gene locus_tag LOCUS_12380 7399 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 7890 7624 gene locus_tag LOCUS_12390 7890 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 8318 8019 gene locus_tag LOCUS_12400 8318 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8607 8329 gene locus_tag LOCUS_12410 8607 8329 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086466044.1 protein_id gnl|my_center|LOCUS_12410 9710 9635 gene locus_tag LOCUS_t00180 9710 9635 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10167 9805 gene locus_tag LOCUS_12420 10167 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 10325 10804 gene locus_tag LOCUS_12430 10325 10804 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_12430 12245 10992 gene locus_tag LOCUS_12440 12245 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 13541 12324 gene locus_tag LOCUS_12450 gene ftsA 13541 12324 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_12450 14275 13538 gene locus_tag LOCUS_12460 14275 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 15193 14291 gene locus_tag LOCUS_12470 gene murB 15193 14291 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 protein_id gnl|my_center|LOCUS_12470 16605 15199 gene locus_tag LOCUS_12480 gene murC 16605 15199 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_12480 17768 16638 gene locus_tag LOCUS_12490 gene murG 17768 16638 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_12490 18913 17765 gene locus_tag LOCUS_12500 gene spoVE 18913 17765 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_12500 20195 18867 gene locus_tag LOCUS_12510 gene murD 20195 18867 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_12510 21268 20192 gene locus_tag LOCUS_12520 gene mraY 21268 20192 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_12520 22722 21268 gene locus_tag LOCUS_12530 22722 21268 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_12530 24248 22728 gene locus_tag LOCUS_12540 24248 22728 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_12540 26311 24245 gene locus_tag LOCUS_12550 26311 24245 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_12550 26538 26308 gene locus_tag LOCUS_12560 26538 26308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 27530 26589 gene locus_tag LOCUS_12570 gene rsmH 27530 26589 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_12570 28019 27546 gene locus_tag LOCUS_12580 gene mraZ 28019 27546 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632499.1 protein_id gnl|my_center|LOCUS_12580 28503 29291 gene locus_tag LOCUS_12590 28503 29291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 29527 29739 gene locus_tag LOCUS_12600 29527 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 32245 29831 gene locus_tag LOCUS_12610 32245 29831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 33020 34597 gene locus_tag LOCUS_12620 33020 34597 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_12620 35334 35259 gene locus_tag LOCUS_t00190 35334 35259 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35839 37095 gene locus_tag LOCUS_12630 35839 37095 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_12630 37282 37584 gene locus_tag LOCUS_12640 37282 37584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 38854 37778 gene locus_tag LOCUS_12650 38854 37778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 40570 39416 gene locus_tag LOCUS_12660 40570 39416 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_12660 40685 40999 gene locus_tag LOCUS_12670 40685 40999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 41273 41632 gene locus_tag LOCUS_12680 41273 41632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 42003 41782 gene locus_tag LOCUS_12690 42003 41782 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_12690 42182 42000 gene locus_tag LOCUS_12700 42182 42000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 43188 42643 gene locus_tag LOCUS_12710 43188 42643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 44661 43963 gene locus_tag LOCUS_12720 44661 43963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 46327 44831 gene locus_tag LOCUS_12730 46327 44831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 47889 46408 gene locus_tag LOCUS_12740 47889 46408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 49690 48887 gene locus_tag LOCUS_12750 49690 48887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 50243 49833 gene locus_tag LOCUS_12760 50243 49833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 50826 52211 gene locus_tag LOCUS_12770 50826 52211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 53656 52244 gene locus_tag LOCUS_12780 53656 52244 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_12780 55143 53653 gene locus_tag LOCUS_12790 55143 53653 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941041.1 protein_id gnl|my_center|LOCUS_12790 55805 55191 gene locus_tag LOCUS_12800 55805 55191 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776561.1 protein_id gnl|my_center|LOCUS_12800 56263 55823 gene locus_tag LOCUS_12810 56263 55823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 57325 56792 gene locus_tag LOCUS_12820 57325 56792 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_12820 57645 57878 gene locus_tag LOCUS_12830 57645 57878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 58100 59671 gene locus_tag LOCUS_12840 58100 59671 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_12840 59936 61294 gene locus_tag LOCUS_12850 59936 61294 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_12850 61500 62339 gene locus_tag LOCUS_12860 61500 62339 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_12860 62470 63654 gene locus_tag LOCUS_12870 62470 63654 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_12870 63829 64707 gene locus_tag LOCUS_12880 63829 64707 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_12880 64704 66743 gene locus_tag LOCUS_12890 64704 66743 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_12890 68422 66896 gene locus_tag LOCUS_12900 68422 66896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 70020 68731 gene locus_tag LOCUS_12910 70020 68731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 70302 71546 gene locus_tag LOCUS_12920 70302 71546 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461385.1 protein_id gnl|my_center|LOCUS_12920 71769 71969 gene locus_tag LOCUS_12930 gene rpmE 71769 71969 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_12930 72058 73119 gene locus_tag LOCUS_12940 gene prfA 72058 73119 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_12940 73116 74006 gene locus_tag LOCUS_12950 gene prmC 73116 74006 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_12950 74278 75546 gene locus_tag LOCUS_12960 gene murA 74278 75546 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_12960 75543 76853 gene locus_tag LOCUS_12970 gene hisD 75543 76853 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 protein_id gnl|my_center|LOCUS_12970 76881 77570 gene locus_tag LOCUS_12980 gene hisB 76881 77570 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_12980 77590 78372 gene locus_tag LOCUS_12990 gene hisA 77590 78372 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_12990 79741 78365 gene locus_tag LOCUS_13000 79741 78365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 79829 81607 gene locus_tag LOCUS_13010 79829 81607 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_13010 82292 81765 gene locus_tag LOCUS_13020 82292 81765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 83109 82306 gene locus_tag LOCUS_13030 83109 82306 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_13030 83603 84073 gene locus_tag LOCUS_13040 83603 84073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 84079 84417 gene locus_tag LOCUS_13050 84079 84417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 84404 85513 gene locus_tag LOCUS_13060 84404 85513 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_13060 86382 85651 gene locus_tag LOCUS_13070 86382 85651 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 protein_id gnl|my_center|LOCUS_13070 86984 86598 gene locus_tag LOCUS_13080 86984 86598 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729821.1 protein_id gnl|my_center|LOCUS_13080 87752 87252 gene locus_tag LOCUS_13090 87752 87252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 89959 88277 gene locus_tag LOCUS_13100 89959 88277 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_13100 91487 90156 gene locus_tag LOCUS_13110 91487 90156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 91740 92921 gene locus_tag LOCUS_13120 91740 92921 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555330.1 protein_id gnl|my_center|LOCUS_13120 93233 93000 gene locus_tag LOCUS_13130 93233 93000 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066791.1 protein_id gnl|my_center|LOCUS_13130 93381 94007 gene locus_tag LOCUS_13140 93381 94007 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 protein_id gnl|my_center|LOCUS_13140 94053 94658 gene locus_tag LOCUS_13150 94053 94658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 94794 95840 gene locus_tag LOCUS_13160 gene ychF 94794 95840 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_13160 96624 97796 gene locus_tag LOCUS_13170 96624 97796 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_13170 98073 98315 gene locus_tag LOCUS_13180 98073 98315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 98312 98722 gene locus_tag LOCUS_13190 98312 98722 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392211.1 protein_id gnl|my_center|LOCUS_13190 99038 99898 gene locus_tag LOCUS_13200 99038 99898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 100608 101090 gene locus_tag LOCUS_13210 100608 101090 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_13210 102916 101213 gene locus_tag LOCUS_13220 102916 101213 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942489.1 protein_id gnl|my_center|LOCUS_13220 105901 103145 gene locus_tag LOCUS_13230 105901 103145 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_13230 106040 106705 gene locus_tag LOCUS_13240 106040 106705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 107147 111862 gene locus_tag LOCUS_13250 107147 111862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 112446 114107 gene locus_tag LOCUS_13260 gene murJ 112446 114107 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_13260 115105 114386 gene locus_tag LOCUS_13270 gene lepB 115105 114386 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_13270 116914 115112 gene locus_tag LOCUS_13280 gene lepA 116914 115112 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_13280 117953 116922 gene locus_tag LOCUS_13290 117953 116922 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_13290 119274 117967 gene locus_tag LOCUS_13300 119274 117967 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_13300 120251 119313 gene locus_tag LOCUS_13310 120251 119313 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_13310 121159 120236 gene locus_tag LOCUS_13320 121159 120236 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_13320 122157 121294 gene locus_tag LOCUS_13330 gene mtnP 122157 121294 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_13330 123497 122379 gene locus_tag LOCUS_13340 gene rlmN 123497 122379 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_13340 125809 123989 gene locus_tag LOCUS_13350 125809 123989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 126076 127161 gene locus_tag LOCUS_13360 126076 127161 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390053.1 protein_id gnl|my_center|LOCUS_13360 127190 128128 gene locus_tag LOCUS_13370 127190 128128 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_13370 128145 128906 gene locus_tag LOCUS_13380 128145 128906 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_13380 129269 131011 gene locus_tag LOCUS_13390 129269 131011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_13390 131018 132850 gene locus_tag LOCUS_13400 131018 132850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_13400 132863 134017 gene locus_tag LOCUS_13410 132863 134017 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_13410 134587 135087 gene locus_tag LOCUS_13420 134587 135087 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545624.1 protein_id gnl|my_center|LOCUS_13420 135503 135991 gene locus_tag LOCUS_13430 135503 135991 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_13430 136096 138546 gene locus_tag LOCUS_13440 gene leuS 136096 138546 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_13440 138735 139505 gene locus_tag LOCUS_13450 138735 139505 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_13450 139832 140098 gene locus_tag LOCUS_13460 139832 140098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 140086 140487 gene locus_tag LOCUS_13470 140086 140487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 140536 141171 gene locus_tag LOCUS_13480 140536 141171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 141205 141471 gene locus_tag LOCUS_13490 141205 141471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 141560 141835 gene locus_tag LOCUS_13500 141560 141835 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_13500 141871 142179 gene locus_tag LOCUS_13510 141871 142179 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_13510 142378 142809 gene locus_tag LOCUS_13520 142378 142809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 143550 143993 gene locus_tag LOCUS_13530 143550 143993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 144188 144463 gene locus_tag LOCUS_13540 144188 144463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 144451 144870 gene locus_tag LOCUS_13550 144451 144870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 145213 145004 gene locus_tag LOCUS_13560 145213 145004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 146342 145620 gene locus_tag LOCUS_13570 146342 145620 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528117.1 protein_id gnl|my_center|LOCUS_13570 147484 146441 gene locus_tag LOCUS_13580 147484 146441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 147879 149030 gene locus_tag LOCUS_13590 147879 149030 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_13590 149047 150639 gene locus_tag LOCUS_13600 gene serA 149047 150639 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_13600 150715 152010 gene locus_tag LOCUS_13610 150715 152010 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_13610 152086 153900 gene locus_tag LOCUS_13620 152086 153900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 153953 154957 gene locus_tag LOCUS_13630 153953 154957 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869033.1 protein_id gnl|my_center|LOCUS_13630 154971 155942 gene locus_tag LOCUS_13640 154971 155942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13640 155961 156929 gene locus_tag LOCUS_13650 155961 156929 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_13650 156996 157970 gene locus_tag LOCUS_13660 156996 157970 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_13660 158156 159592 gene locus_tag LOCUS_13670 158156 159592 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_13670 160125 160871 gene locus_tag LOCUS_13680 160125 160871 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814875.1 protein_id gnl|my_center|LOCUS_13680 160915 161364 gene locus_tag LOCUS_13690 160915 161364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 162807 161575 gene locus_tag LOCUS_13700 162807 161575 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113399.1 protein_id gnl|my_center|LOCUS_13700 163913 162963 gene locus_tag LOCUS_13710 163913 162963 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_13710 164438 165427 gene locus_tag LOCUS_13720 164438 165427 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_13720 165424 166725 gene locus_tag LOCUS_13730 165424 166725 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528722.1 protein_id gnl|my_center|LOCUS_13730 166722 167357 gene locus_tag LOCUS_13740 166722 167357 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965772.1 protein_id gnl|my_center|LOCUS_13740 167388 168200 gene locus_tag LOCUS_13750 167388 168200 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266418.1 protein_id gnl|my_center|LOCUS_13750 169555 168767 gene locus_tag LOCUS_13760 169555 168767 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027775.1 protein_id gnl|my_center|LOCUS_13760 170762 169818 gene locus_tag LOCUS_13770 170762 169818 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 protein_id gnl|my_center|LOCUS_13770 171571 170849 gene locus_tag LOCUS_13780 gene pxpB 171571 170849 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389260.1 protein_id gnl|my_center|LOCUS_13780 171752 172582 gene locus_tag LOCUS_13790 171752 172582 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_13790 173641 172703 gene locus_tag LOCUS_13800 gene rsmI 173641 172703 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_13800 173806 174669 gene locus_tag LOCUS_13810 gene purU 173806 174669 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887229.1 protein_id gnl|my_center|LOCUS_13810 174666 175499 gene locus_tag LOCUS_13820 174666 175499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 176847 176077 gene locus_tag LOCUS_13830 176847 176077 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532835.1 protein_id gnl|my_center|LOCUS_13830 177509 177030 gene locus_tag LOCUS_13840 177509 177030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 177889 178782 gene locus_tag LOCUS_13850 gene meaB 177889 178782 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_13850 178766 179494 gene locus_tag LOCUS_13860 178766 179494 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_13860 179541 179614 gene locus_tag LOCUS_t00200 179541 179614 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 180209 180364 gene locus_tag LOCUS_13870 180209 180364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 180367 180675 gene locus_tag LOCUS_13880 180367 180675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 180715 181131 gene locus_tag LOCUS_13890 180715 181131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 181133 181318 gene locus_tag LOCUS_13900 181133 181318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 181419 181487 gene locus_tag LOCUS_t00210 181419 181487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 182185 181511 gene locus_tag LOCUS_13910 182185 181511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 182463 182209 gene locus_tag LOCUS_13920 182463 182209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 182734 183033 gene locus_tag LOCUS_13930 182734 183033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 183566 183144 gene locus_tag LOCUS_13940 183566 183144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 184159 185325 gene locus_tag LOCUS_13950 gene fbp 184159 185325 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_13950 185886 185413 gene locus_tag LOCUS_13960 gene trmL 185886 185413 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_13960 186389 185895 gene locus_tag LOCUS_13970 186389 185895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 186887 186441 gene locus_tag LOCUS_13980 gene dtd 186887 186441 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_13980 187182 188027 gene locus_tag LOCUS_13990 gene lgt 187182 188027 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_13990 188024 188584 gene locus_tag LOCUS_14000 188024 188584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 188659 190122 gene locus_tag LOCUS_14010 188659 190122 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_14010 190479 192029 gene locus_tag LOCUS_14020 gene xseA 190479 192029 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_14020 192292 192717 gene locus_tag LOCUS_14030 192292 192717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 193459 192692 gene locus_tag LOCUS_14040 193459 192692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 194417 193482 gene locus_tag LOCUS_14050 194417 193482 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172854.1 protein_id gnl|my_center|LOCUS_14050 194809 195087 gene locus_tag LOCUS_14060 194809 195087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 195553 195320 gene locus_tag LOCUS_14070 195553 195320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 196156 195581 gene locus_tag LOCUS_14080 196156 195581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 197205 196138 gene locus_tag LOCUS_14090 197205 196138 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224004.1 protein_id gnl|my_center|LOCUS_14090 197684 197609 gene locus_tag LOCUS_t00220 197684 197609 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 198564 197698 gene locus_tag LOCUS_14100 gene galU 198564 197698 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817120.1 protein_id gnl|my_center|LOCUS_14100 198716 199888 gene locus_tag LOCUS_14110 gene larC 198716 199888 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_14110 199893 200546 gene locus_tag LOCUS_14120 gene queE 199893 200546 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence07 1638 541 gene locus_tag LOCUS_14130 1638 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2367 2567 gene locus_tag LOCUS_14140 2367 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2857 2564 gene locus_tag LOCUS_14150 2857 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4273 3374 gene locus_tag LOCUS_14160 4273 3374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_14160 4516 5493 gene locus_tag LOCUS_14170 4516 5493 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_14170 7840 5546 gene locus_tag LOCUS_14180 7840 5546 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_14180 9277 8021 gene locus_tag LOCUS_14190 9277 8021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104023.1 protein_id gnl|my_center|LOCUS_14190 9994 11061 gene locus_tag LOCUS_14200 9994 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 11061 12326 gene locus_tag LOCUS_14210 11061 12326 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_14210 12424 13668 gene locus_tag LOCUS_14220 12424 13668 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 protein_id gnl|my_center|LOCUS_14220 14280 15527 gene locus_tag LOCUS_14230 14280 15527 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_14230 15815 17137 gene locus_tag LOCUS_14240 15815 17137 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_14240 17304 18263 gene locus_tag LOCUS_14250 17304 18263 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_14250 19272 18535 gene locus_tag LOCUS_14260 19272 18535 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039081.1 protein_id gnl|my_center|LOCUS_14260 19713 20297 gene locus_tag LOCUS_14270 19713 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 20436 20987 gene locus_tag LOCUS_14280 20436 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21531 21187 gene locus_tag LOCUS_14290 21531 21187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 22931 21732 gene locus_tag LOCUS_14300 22931 21732 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_14300 23311 24147 gene locus_tag LOCUS_14310 23311 24147 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392933.1 protein_id gnl|my_center|LOCUS_14310 24427 24882 gene locus_tag LOCUS_14320 24427 24882 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689406.1 protein_id gnl|my_center|LOCUS_14320 25249 26757 gene locus_tag LOCUS_14330 25249 26757 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 protein_id gnl|my_center|LOCUS_14330 26929 26771 gene locus_tag LOCUS_14340 26929 26771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 29038 27089 gene locus_tag LOCUS_14350 gene ftsH 29038 27089 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_14350 30621 29050 gene locus_tag LOCUS_14360 gene tilS 30621 29050 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_14360 32178 31417 gene locus_tag LOCUS_14370 32178 31417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 32486 32178 gene locus_tag LOCUS_14380 32486 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 32862 32560 gene locus_tag LOCUS_14390 32862 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 33938 32865 gene locus_tag LOCUS_14400 gene dnaJ 33938 32865 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_14400 34207 34022 gene locus_tag LOCUS_14410 34207 34022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 34914 34204 gene locus_tag LOCUS_14420 gene ccsA 34914 34204 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_14420 35660 34992 gene locus_tag LOCUS_14430 35660 34992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 36527 35835 gene locus_tag LOCUS_14440 gene ccmA 36527 35835 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_14440 37305 36700 gene locus_tag LOCUS_14450 37305 36700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 37886 37383 gene locus_tag LOCUS_14460 37886 37383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 39907 37883 gene locus_tag LOCUS_14470 39907 37883 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_14470 40796 40158 gene locus_tag LOCUS_14480 40796 40158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 42224 41160 gene locus_tag LOCUS_14490 42224 41160 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217007.1 protein_id gnl|my_center|LOCUS_14490 43284 42256 gene locus_tag LOCUS_14500 43284 42256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_14500 44292 43858 gene locus_tag LOCUS_14510 44292 43858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 45561 44296 gene locus_tag LOCUS_14520 45561 44296 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229155.1 protein_id gnl|my_center|LOCUS_14520 46970 45597 gene locus_tag LOCUS_14530 46970 45597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 48315 47281 gene locus_tag LOCUS_14540 48315 47281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 48625 49836 gene locus_tag LOCUS_14550 48625 49836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391589.1 protein_id gnl|my_center|LOCUS_14550 50408 51706 gene locus_tag LOCUS_14560 50408 51706 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972746.1 protein_id gnl|my_center|LOCUS_14560 51780 52640 gene locus_tag LOCUS_14570 51780 52640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391586.1 protein_id gnl|my_center|LOCUS_14570 52700 53524 gene locus_tag LOCUS_14580 52700 53524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972744.1 protein_id gnl|my_center|LOCUS_14580 54138 53770 gene locus_tag LOCUS_14590 54138 53770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 55002 54178 gene locus_tag LOCUS_14600 55002 54178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 55698 55081 gene locus_tag LOCUS_14610 55698 55081 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119120.1 protein_id gnl|my_center|LOCUS_14610 55986 55786 gene locus_tag LOCUS_14620 55986 55786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 57997 56339 gene locus_tag LOCUS_14630 gene secD 57997 56339 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_14630 58426 58043 gene locus_tag LOCUS_14640 58426 58043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 59574 58441 gene locus_tag LOCUS_14650 gene tgt 59574 58441 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_14650 60649 59588 gene locus_tag LOCUS_14660 gene queA 60649 59588 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_14660 61744 60764 gene locus_tag LOCUS_14670 61744 60764 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_14670 63534 64811 gene locus_tag LOCUS_14680 63534 64811 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_14680 65703 64846 gene locus_tag LOCUS_14690 65703 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 66692 65694 gene locus_tag LOCUS_14700 66692 65694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 67141 67494 gene locus_tag LOCUS_14710 67141 67494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 67545 68045 gene locus_tag LOCUS_14720 67545 68045 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_14720 68386 69600 gene locus_tag LOCUS_14730 gene nuoD 68386 69600 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_14730 69857 70957 gene locus_tag LOCUS_14740 gene waaC 69857 70957 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_14740 70986 71852 gene locus_tag LOCUS_14750 70986 71852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 72333 72142 gene locus_tag LOCUS_14760 72333 72142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 72241 73335 gene locus_tag LOCUS_14770 72241 73335 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_14770 73332 74207 gene locus_tag LOCUS_14780 73332 74207 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_14780 74576 74941 gene locus_tag LOCUS_14790 74576 74941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 75269 75814 gene locus_tag LOCUS_14800 gene gmk 75269 75814 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 protein_id gnl|my_center|LOCUS_14800 75805 78036 gene locus_tag LOCUS_14810 75805 78036 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_14810 78180 78599 gene locus_tag LOCUS_14820 78180 78599 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889137.1 protein_id gnl|my_center|LOCUS_14820 79392 78643 gene locus_tag LOCUS_14830 79392 78643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 80678 79368 gene locus_tag LOCUS_14840 80678 79368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 81724 80603 gene locus_tag LOCUS_14850 81724 80603 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_14850 82052 81882 gene locus_tag LOCUS_14860 82052 81882 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_14860 83403 82258 gene locus_tag LOCUS_14870 gene lpxK 83403 82258 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_14870 84857 83406 gene locus_tag LOCUS_14880 84857 83406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 86968 85193 gene locus_tag LOCUS_14890 gene msbA 86968 85193 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_14890 88134 86965 gene locus_tag LOCUS_14900 gene lpxB 88134 86965 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_14900 89120 88158 gene locus_tag LOCUS_14910 89120 88158 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_14910 90211 89408 gene locus_tag LOCUS_14920 gene lpxI 90211 89408 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967850.1 protein_id gnl|my_center|LOCUS_14920 91034 90204 gene locus_tag LOCUS_14930 gene lpxA 91034 90204 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_14930 91784 91164 gene locus_tag LOCUS_14940 91784 91164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 94341 91969 gene locus_tag LOCUS_14950 gene bamA 94341 91969 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_14950 95748 94993 gene locus_tag LOCUS_14960 95748 94993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939647.1 protein_id gnl|my_center|LOCUS_14960 97024 95741 gene locus_tag LOCUS_14970 97024 95741 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_14970 97183 99948 gene locus_tag LOCUS_14980 97183 99948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 100195 101115 gene locus_tag LOCUS_14990 100195 101115 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_14990 101865 102200 gene locus_tag LOCUS_15000 101865 102200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 102385 103371 gene locus_tag LOCUS_15010 gene moaA 102385 103371 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_15010 104301 103633 gene locus_tag LOCUS_15020 104301 103633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 104751 104563 gene locus_tag LOCUS_15030 gene rpmB 104751 104563 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_15030 105218 107110 gene locus_tag LOCUS_15040 gene mutL 105218 107110 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_15040 107107 108069 gene locus_tag LOCUS_15050 gene miaA 107107 108069 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_15050 108066 108965 gene locus_tag LOCUS_15060 108066 108965 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810007.1 protein_id gnl|my_center|LOCUS_15060 108978 110138 gene locus_tag LOCUS_15070 gene pheA 108978 110138 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_15070 110107 111207 gene locus_tag LOCUS_15080 gene hisC 110107 111207 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_15080 111378 112235 gene locus_tag LOCUS_15090 111378 112235 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383714.1 protein_id gnl|my_center|LOCUS_15090 112232 112921 gene locus_tag LOCUS_15100 gene cmk 112232 112921 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081716.1 protein_id gnl|my_center|LOCUS_15100 112984 114729 gene locus_tag LOCUS_15110 112984 114729 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_15110 114766 115071 gene locus_tag LOCUS_15120 114766 115071 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200394.1 protein_id gnl|my_center|LOCUS_15120 115205 115600 gene locus_tag LOCUS_15130 115205 115600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 115625 117034 gene locus_tag LOCUS_15140 115625 117034 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_15140 117136 118728 gene locus_tag LOCUS_15150 117136 118728 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_15150 120633 118852 gene locus_tag LOCUS_15160 120633 118852 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_15160 120806 121717 gene locus_tag LOCUS_15170 120806 121717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 122071 121856 gene locus_tag LOCUS_15180 122071 121856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 121961 123211 gene locus_tag LOCUS_15190 gene gatA 121961 123211 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_15190 124487 123564 gene locus_tag LOCUS_15200 124487 123564 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_15200 125800 126537 gene locus_tag LOCUS_15210 125800 126537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 128532 127018 gene locus_tag LOCUS_15220 128532 127018 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_15220 128776 130062 gene locus_tag LOCUS_15230 gene larA 128776 130062 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_15230 131128 130106 gene locus_tag LOCUS_15240 131128 130106 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_15240 131838 131221 gene locus_tag LOCUS_15250 131838 131221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 133062 131989 gene locus_tag LOCUS_15260 133062 131989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 134551 133163 gene locus_tag LOCUS_15270 gene accC 134551 133163 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_15270 135044 134577 gene locus_tag LOCUS_15280 gene accB 135044 134577 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_15280 135572 135060 gene locus_tag LOCUS_15290 gene aroQ 135572 135060 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_15290 135937 136770 gene locus_tag LOCUS_15300 135937 136770 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038652.1 protein_id gnl|my_center|LOCUS_15300 136973 137722 gene locus_tag LOCUS_15310 136973 137722 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_15310 137725 138552 gene locus_tag LOCUS_15320 gene ccsB 137725 138552 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_15320 138556 139902 gene locus_tag LOCUS_15330 gene hemA 138556 139902 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_15330 139930 140880 gene locus_tag LOCUS_15340 gene hemC 139930 140880 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350351.1 protein_id gnl|my_center|LOCUS_15340 140873 142414 gene locus_tag LOCUS_15350 gene cobA 140873 142414 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_15350 142509 143483 gene locus_tag LOCUS_15360 gene hemB 142509 143483 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_15360 144060 145208 gene locus_tag LOCUS_15370 144060 145208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 146639 145515 gene locus_tag LOCUS_15380 146639 145515 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_15380 146899 148110 gene locus_tag LOCUS_15390 146899 148110 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_15390 148426 149772 gene locus_tag LOCUS_15400 148426 149772 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_15400 149774 150877 gene locus_tag LOCUS_15410 gene thrC 149774 150877 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_15410 151044 152258 gene locus_tag LOCUS_15420 151044 152258 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_15420 152291 153244 gene locus_tag LOCUS_15430 gene glpX 152291 153244 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545655.1 protein_id gnl|my_center|LOCUS_15430 153274 154053 gene locus_tag LOCUS_15440 153274 154053 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_15440 154692 154312 gene locus_tag LOCUS_15450 154692 154312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 154935 154726 gene locus_tag LOCUS_15460 154935 154726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 156670 155378 gene locus_tag LOCUS_15470 156670 155378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 157131 156670 gene locus_tag LOCUS_15480 157131 156670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 157305 158426 gene locus_tag LOCUS_15490 gene dndB 157305 158426 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_15490 158442 158765 gene locus_tag LOCUS_15500 158442 158765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 159252 159085 gene locus_tag LOCUS_15510 159252 159085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 159756 159298 gene locus_tag LOCUS_15520 159756 159298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 159808 161091 gene locus_tag LOCUS_15530 159808 161091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 161306 161644 gene locus_tag LOCUS_15540 161306 161644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 162074 163219 gene locus_tag LOCUS_15550 162074 163219 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_15550 163222 164874 gene locus_tag LOCUS_15560 163222 164874 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_15560 164949 165326 gene locus_tag LOCUS_15570 164949 165326 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_15570 165434 166696 gene locus_tag LOCUS_15580 165434 166696 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_15580 168530 166821 gene locus_tag LOCUS_15590 168530 166821 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_15590 168933 168595 gene locus_tag LOCUS_15600 168933 168595 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_15600 170227 169097 gene locus_tag LOCUS_15610 170227 169097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 172434 171376 gene locus_tag LOCUS_15620 172434 171376 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_15620 173392 174108 gene locus_tag LOCUS_15630 173392 174108 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_15630 174420 174716 gene locus_tag LOCUS_15640 174420 174716 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969011.1 protein_id gnl|my_center|LOCUS_15640 174731 175033 gene locus_tag LOCUS_15650 174731 175033 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_15650 176040 176279 gene locus_tag LOCUS_15660 176040 176279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 176251 176997 gene locus_tag LOCUS_15670 176251 176997 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 protein_id gnl|my_center|LOCUS_15670 178459 176966 gene locus_tag LOCUS_15680 178459 176966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 177194 177103 gene locus_tag LOCUS_t00230 177194 177103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 178697 178446 gene locus_tag LOCUS_15690 178697 178446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 179144 179473 gene locus_tag LOCUS_15700 179144 179473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 179767 180714 gene locus_tag LOCUS_15710 179767 180714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 181046 181357 gene locus_tag LOCUS_15720 181046 181357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 181381 181785 gene locus_tag LOCUS_15730 181381 181785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence08 694 1203 gene locus_tag LOCUS_15740 694 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769876.1 protein_id gnl|my_center|LOCUS_15740 1391 2869 gene locus_tag LOCUS_15750 gene gnfM 1391 2869 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_15750 2866 3504 gene locus_tag LOCUS_15760 gene thiE 2866 3504 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_15760 4233 3517 gene locus_tag LOCUS_15770 4233 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6232 4508 gene locus_tag LOCUS_15780 6232 4508 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_15780 7159 6515 gene locus_tag LOCUS_15790 7159 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7796 7182 gene locus_tag LOCUS_15800 gene rlmE 7796 7182 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 protein_id gnl|my_center|LOCUS_15800 7890 10103 gene locus_tag LOCUS_15810 7890 10103 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_15810 11632 10193 gene locus_tag LOCUS_15820 gene gatB 11632 10193 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_15820 13105 11645 gene locus_tag LOCUS_15830 gene gatA 13105 11645 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_15830 13510 13202 gene locus_tag LOCUS_15840 gene gatC 13510 13202 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_15840 14213 15028 gene locus_tag LOCUS_15850 gene lpxA 14213 15028 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_15850 15152 15751 gene locus_tag LOCUS_15860 15152 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 17986 16247 gene locus_tag LOCUS_15870 gene treZ 17986 16247 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_15870 20644 17990 gene locus_tag LOCUS_15880 20644 17990 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257050.1 protein_id gnl|my_center|LOCUS_15880 22715 20634 gene locus_tag LOCUS_15890 gene glgX 22715 20634 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_15890 22788 23105 gene locus_tag LOCUS_15900 22788 23105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 23125 24777 gene locus_tag LOCUS_15910 23125 24777 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965432.1 protein_id gnl|my_center|LOCUS_15910 28240 24836 gene locus_tag LOCUS_15920 28240 24836 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117787.1 protein_id gnl|my_center|LOCUS_15920 29083 29592 gene locus_tag LOCUS_15930 29083 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 29964 30986 gene locus_tag LOCUS_15940 29964 30986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_15940 31055 31828 gene locus_tag LOCUS_15950 31055 31828 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_15950 32646 31825 gene locus_tag LOCUS_15960 32646 31825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 33269 32853 gene locus_tag LOCUS_15970 33269 32853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 33570 35060 gene locus_tag LOCUS_15980 33570 35060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 35335 36858 gene locus_tag LOCUS_15990 35335 36858 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965939.1 protein_id gnl|my_center|LOCUS_15990 36903 37694 gene locus_tag LOCUS_16000 36903 37694 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086319.1 protein_id gnl|my_center|LOCUS_16000 37747 40170 gene locus_tag LOCUS_16010 37747 40170 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_16010 40196 41071 gene locus_tag LOCUS_16020 40196 41071 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807629.1 protein_id gnl|my_center|LOCUS_16020 41068 41556 gene locus_tag LOCUS_16030 gene cutC 41068 41556 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_16030 41971 42270 gene locus_tag LOCUS_16040 41971 42270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 42251 42511 gene locus_tag LOCUS_16050 42251 42511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 43030 42560 gene locus_tag LOCUS_16060 43030 42560 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_16060 43877 43101 gene locus_tag LOCUS_16070 43877 43101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 44343 43870 gene locus_tag LOCUS_16080 44343 43870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 44753 44397 gene locus_tag LOCUS_16090 44753 44397 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_16090 45000 47432 gene locus_tag LOCUS_16100 gene lon 45000 47432 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_16100 47623 48336 gene locus_tag LOCUS_16110 47623 48336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 48657 49229 gene locus_tag LOCUS_16120 48657 49229 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_16120 49240 53772 gene locus_tag LOCUS_16130 gene gltB 49240 53772 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_16130 53929 55377 gene locus_tag LOCUS_16140 53929 55377 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_16140 55883 55476 gene locus_tag LOCUS_16150 55883 55476 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_16150 57037 55880 gene locus_tag LOCUS_16160 57037 55880 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731361.1 protein_id gnl|my_center|LOCUS_16160 57227 57303 gene locus_tag LOCUS_t00240 57227 57303 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 58025 57333 gene locus_tag LOCUS_16170 58025 57333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 59156 58047 gene locus_tag LOCUS_16180 59156 58047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_16180 60290 59166 gene locus_tag LOCUS_16190 60290 59166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 62092 60287 gene locus_tag LOCUS_16200 62092 60287 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_16200 63134 62043 gene locus_tag LOCUS_16210 63134 62043 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_16210 65283 63400 gene locus_tag LOCUS_16220 65283 63400 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_16220 67295 65364 gene locus_tag LOCUS_16230 67295 65364 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_16230 67572 68168 gene locus_tag LOCUS_16240 67572 68168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 70390 68315 gene locus_tag LOCUS_16250 70390 68315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 71385 71134 gene locus_tag LOCUS_16260 71385 71134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 71281 72639 gene locus_tag LOCUS_16270 71281 72639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 72952 76317 gene locus_tag LOCUS_16280 72952 76317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 76447 79626 gene locus_tag LOCUS_16290 76447 79626 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_16290 79771 80541 gene locus_tag LOCUS_16300 79771 80541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 80819 81217 gene locus_tag LOCUS_16310 80819 81217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 81721 82875 gene locus_tag LOCUS_16320 gene hpnI 81721 82875 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_16320 83863 82898 gene locus_tag LOCUS_16330 83863 82898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 86306 85002 gene locus_tag LOCUS_16340 86306 85002 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_16340 87747 86443 gene locus_tag LOCUS_16350 87747 86443 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980484.1 protein_id gnl|my_center|LOCUS_16350 89350 88124 gene locus_tag LOCUS_16360 89350 88124 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084993.1 protein_id gnl|my_center|LOCUS_16360 89756 89466 gene locus_tag LOCUS_16370 89756 89466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 90261 89770 gene locus_tag LOCUS_16380 90261 89770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 90785 90597 gene locus_tag LOCUS_16390 90785 90597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 90750 91091 gene locus_tag LOCUS_16400 90750 91091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16400 91257 91772 gene locus_tag LOCUS_16410 91257 91772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 91946 92194 gene locus_tag LOCUS_16420 91946 92194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 92599 95985 gene locus_tag LOCUS_16430 92599 95985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 96656 96246 gene locus_tag LOCUS_16440 96656 96246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 97240 98109 gene locus_tag LOCUS_16450 gene dapB 97240 98109 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_16450 98384 99292 gene locus_tag LOCUS_16460 98384 99292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 99282 99788 gene locus_tag LOCUS_16470 99282 99788 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_16470 99912 100946 gene locus_tag LOCUS_16480 99912 100946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 101003 101476 gene locus_tag LOCUS_16490 101003 101476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 101777 101496 gene locus_tag LOCUS_16500 101777 101496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 102110 101895 gene locus_tag LOCUS_16510 102110 101895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 102702 102520 gene locus_tag LOCUS_16520 102702 102520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 104805 102877 gene locus_tag LOCUS_16530 104805 102877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 106062 105040 gene locus_tag LOCUS_16540 106062 105040 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_16540 106545 106207 gene locus_tag LOCUS_16550 106545 106207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 108266 106656 gene locus_tag LOCUS_16560 108266 106656 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_16560 108689 109705 gene locus_tag LOCUS_16570 108689 109705 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_16570 111488 110232 gene locus_tag LOCUS_16580 111488 110232 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192528.1 protein_id gnl|my_center|LOCUS_16580 111982 111485 gene locus_tag LOCUS_16590 111982 111485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 112744 112819 gene locus_tag LOCUS_t00250 112744 112819 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 114838 113162 gene locus_tag LOCUS_16600 114838 113162 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_16600 115841 116179 gene locus_tag LOCUS_16610 115841 116179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 118673 116385 gene locus_tag LOCUS_16620 118673 116385 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114258.1 protein_id gnl|my_center|LOCUS_16620 119134 118670 gene locus_tag LOCUS_16630 119134 118670 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_16630 119765 121066 gene locus_tag LOCUS_16640 119765 121066 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_16640 121063 121845 gene locus_tag LOCUS_16650 121063 121845 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228947.1 protein_id gnl|my_center|LOCUS_16650 122018 122245 gene locus_tag LOCUS_16660 122018 122245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 122255 122956 gene locus_tag LOCUS_16670 122255 122956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 123298 124557 gene locus_tag LOCUS_16680 gene guaD 123298 124557 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_16680 125910 124942 gene locus_tag LOCUS_16690 125910 124942 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_16690 126698 127087 gene locus_tag LOCUS_16700 126698 127087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 127134 127541 gene locus_tag LOCUS_16710 127134 127541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 127822 129483 gene locus_tag LOCUS_16720 127822 129483 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230264.1 protein_id gnl|my_center|LOCUS_16720 129990 131462 gene locus_tag LOCUS_16730 129990 131462 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_16730 131482 132393 gene locus_tag LOCUS_16740 131482 132393 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_16740 132390 133277 gene locus_tag LOCUS_16750 gene dapA 132390 133277 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_16750 133277 134719 gene locus_tag LOCUS_16760 gene hpaB 133277 134719 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_16760 135011 134745 gene locus_tag LOCUS_16770 135011 134745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 134899 136089 gene locus_tag LOCUS_16780 134899 136089 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_16780 137289 136123 gene locus_tag LOCUS_16790 137289 136123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_16790 137482 137691 gene locus_tag LOCUS_16800 137482 137691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 138730 138224 gene locus_tag LOCUS_16810 138730 138224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 139745 140161 gene locus_tag LOCUS_16820 139745 140161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 141181 140477 gene locus_tag LOCUS_16830 141181 140477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_16830 141934 141182 gene locus_tag LOCUS_16840 141934 141182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_16840 142951 141971 gene locus_tag LOCUS_16850 142951 141971 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_16850 143843 142962 gene locus_tag LOCUS_16860 143843 142962 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_16860 145086 143884 gene locus_tag LOCUS_16870 145086 143884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_16870 145724 146173 gene locus_tag LOCUS_16880 145724 146173 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_16880 146202 146429 gene locus_tag LOCUS_16890 146202 146429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 147736 146495 gene locus_tag LOCUS_16900 147736 146495 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546421.1 protein_id gnl|my_center|LOCUS_16900 148069 148803 gene locus_tag LOCUS_16910 148069 148803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 150561 148975 gene locus_tag LOCUS_16920 150561 148975 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256483.1 protein_id gnl|my_center|LOCUS_16920 151223 153934 gene locus_tag LOCUS_16930 gene cas3u 151223 153934 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_16930 153949 154764 gene locus_tag LOCUS_16940 gene cas8c 153949 154764 CDS product type I-U CRISPR-associated protein Cas8c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940730.1 protein_id gnl|my_center|LOCUS_16940 154761 155849 gene locus_tag LOCUS_16950 gene cas7u 154761 155849 CDS product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 protein_id gnl|my_center|LOCUS_16950 156228 157463 gene locus_tag LOCUS_16960 156228 157463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 157578 157874 gene locus_tag LOCUS_16970 157578 157874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 157831 158187 gene locus_tag LOCUS_16980 157831 158187 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_16980 158193 158522 gene locus_tag LOCUS_16990 158193 158522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 158543 160375 gene locus_tag LOCUS_17000 gene cas1 158543 160375 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_17000 160556 164667 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgcgctcgaatgagcgcggccccattgaagc >Feature sequence09 9 977 gene locus_tag LOCUS_17010 gene cofD 9 977 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_17010 993 1754 gene locus_tag LOCUS_17020 gene cofE 993 1754 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_17020 1789 2775 gene locus_tag LOCUS_17030 1789 2775 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_17030 2813 3001 gene locus_tag LOCUS_17040 2813 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3729 3187 gene locus_tag LOCUS_17050 3729 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6476 3903 gene locus_tag LOCUS_17060 gene mutS 6476 3903 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_17060 8870 6705 gene locus_tag LOCUS_17070 8870 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 8758 9225 gene locus_tag LOCUS_17080 8758 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 10331 9699 gene locus_tag LOCUS_17090 10331 9699 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_17090 12532 10652 gene locus_tag LOCUS_17100 12532 10652 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_17100 13515 12565 gene locus_tag LOCUS_17110 13515 12565 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_17110 13932 15116 gene locus_tag LOCUS_17120 gene thiI 13932 15116 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_17120 15179 15574 gene locus_tag LOCUS_17130 15179 15574 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_17130 15710 16867 gene locus_tag LOCUS_17140 15710 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 17187 17738 gene locus_tag LOCUS_17150 17187 17738 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_17150 17751 19097 gene locus_tag LOCUS_17160 gene nuoF 17751 19097 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_17160 19459 21051 gene locus_tag LOCUS_17170 19459 21051 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_17170 21320 22441 gene locus_tag LOCUS_17180 gene thiO 21320 22441 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_17180 22627 22989 gene locus_tag LOCUS_17190 22627 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 23075 27826 gene locus_tag LOCUS_17200 23075 27826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 27997 30759 gene locus_tag LOCUS_17210 gene acnA 27997 30759 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_17210 31869 30787 gene locus_tag LOCUS_17220 31869 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 32206 31862 gene locus_tag LOCUS_17230 32206 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 32551 32913 gene locus_tag LOCUS_17240 32551 32913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 34114 33119 gene locus_tag LOCUS_17250 34114 33119 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_17250 35217 34531 gene locus_tag LOCUS_17260 35217 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 37357 35366 gene locus_tag LOCUS_17270 37357 35366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 37541 39181 gene locus_tag LOCUS_17280 37541 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 40160 39465 gene locus_tag LOCUS_17290 40160 39465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 41007 41462 gene locus_tag LOCUS_17300 41007 41462 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088958.1 protein_id gnl|my_center|LOCUS_17300 41531 43732 gene locus_tag LOCUS_17310 41531 43732 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064553.1 protein_id gnl|my_center|LOCUS_17310 43840 45603 gene locus_tag LOCUS_17320 gene ilvB 43840 45603 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_17320 46890 45763 gene locus_tag LOCUS_17330 46890 45763 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094900.1 protein_id gnl|my_center|LOCUS_17330 47842 48594 gene locus_tag LOCUS_17340 47842 48594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 48988 48599 gene locus_tag LOCUS_17350 gene gcvH 48988 48599 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_17350 49283 50389 gene locus_tag LOCUS_17360 gene ald 49283 50389 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_17360 51270 50509 gene locus_tag LOCUS_17370 51270 50509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 53114 51267 gene locus_tag LOCUS_17380 gene aspS 53114 51267 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_17380 54498 53164 gene locus_tag LOCUS_17390 gene hisS 54498 53164 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_17390 56051 54888 gene locus_tag LOCUS_17400 56051 54888 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_17400 56886 56446 gene locus_tag LOCUS_17410 56886 56446 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_17410 59465 57072 gene locus_tag LOCUS_17420 59465 57072 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_17420 60146 60619 gene locus_tag LOCUS_17430 60146 60619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 60937 61248 gene locus_tag LOCUS_17440 60937 61248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085813.1 protein_id gnl|my_center|LOCUS_17440 62647 61334 gene locus_tag LOCUS_17450 62647 61334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 63185 62640 gene locus_tag LOCUS_17460 63185 62640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 65924 63759 gene locus_tag LOCUS_17470 65924 63759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 67087 65957 gene locus_tag LOCUS_17480 67087 65957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 67633 67199 gene locus_tag LOCUS_17490 67633 67199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 69466 67778 gene locus_tag LOCUS_17500 gene fliD 69466 67778 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392286.1 protein_id gnl|my_center|LOCUS_17500 70893 69646 gene locus_tag LOCUS_17510 70893 69646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 71065 71937 gene locus_tag LOCUS_17520 71065 71937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 71943 72338 gene locus_tag LOCUS_17530 71943 72338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 72344 73228 gene locus_tag LOCUS_17540 72344 73228 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_17540 73247 74053 gene locus_tag LOCUS_17550 73247 74053 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_17550 74050 74934 gene locus_tag LOCUS_17560 74050 74934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 74939 75217 gene locus_tag LOCUS_17570 74939 75217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 75241 76209 gene locus_tag LOCUS_17580 gene fliG 75241 76209 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883356.1 protein_id gnl|my_center|LOCUS_17580 76374 76859 gene locus_tag LOCUS_17590 76374 76859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 76936 77280 gene locus_tag LOCUS_17600 76936 77280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 77349 77762 gene locus_tag LOCUS_17610 gene flgC 77349 77762 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211111.1 protein_id gnl|my_center|LOCUS_17610 77777 78061 gene locus_tag LOCUS_17620 77777 78061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 78087 79763 gene locus_tag LOCUS_17630 gene fliF 78087 79763 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_17630 79760 80473 gene locus_tag LOCUS_17640 79760 80473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 80470 81768 gene locus_tag LOCUS_17650 gene fliI 80470 81768 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_17650 81755 82144 gene locus_tag LOCUS_17660 81755 82144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 83332 83826 gene locus_tag LOCUS_17670 83332 83826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 83826 84461 gene locus_tag LOCUS_17680 83826 84461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 84506 85747 gene locus_tag LOCUS_17690 gene flgE 84506 85747 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885873.1 protein_id gnl|my_center|LOCUS_17690 85744 86160 gene locus_tag LOCUS_17700 85744 86160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 86157 86891 gene locus_tag LOCUS_17710 86157 86891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 87054 87329 gene locus_tag LOCUS_17720 gene fliQ 87054 87329 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 protein_id gnl|my_center|LOCUS_17720 87326 88087 gene locus_tag LOCUS_17730 87326 88087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 88080 89129 gene locus_tag LOCUS_17740 gene flhB 88080 89129 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881318.1 protein_id gnl|my_center|LOCUS_17740 89136 91181 gene locus_tag LOCUS_17750 gene flhA 89136 91181 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206768427.1 protein_id gnl|my_center|LOCUS_17750 91178 91765 gene locus_tag LOCUS_17760 91178 91765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 91762 92493 gene locus_tag LOCUS_17770 gene flgF 91762 92493 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_17770 92523 93317 gene locus_tag LOCUS_17780 gene flgG 92523 93317 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_17780 93348 94145 gene locus_tag LOCUS_17790 93348 94145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 94156 94860 gene locus_tag LOCUS_17800 gene flgH 94156 94860 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390472.1 protein_id gnl|my_center|LOCUS_17800 94893 96089 gene locus_tag LOCUS_17810 94893 96089 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869891.1 protein_id gnl|my_center|LOCUS_17810 96094 96588 gene locus_tag LOCUS_17820 96094 96588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 96703 97017 gene locus_tag LOCUS_17830 96703 97017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 97010 97249 gene locus_tag LOCUS_17840 97010 97249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 97268 98632 gene locus_tag LOCUS_17850 gene flgK 97268 98632 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_17850 98650 99531 gene locus_tag LOCUS_17860 98650 99531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 100874 100053 gene locus_tag LOCUS_17870 100874 100053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 101231 101617 gene locus_tag LOCUS_17880 101231 101617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 102008 102895 gene locus_tag LOCUS_17890 102008 102895 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_17890 103052 103285 gene locus_tag LOCUS_17900 103052 103285 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_17900 103529 104059 gene locus_tag LOCUS_17910 gene greA 103529 104059 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869984.1 protein_id gnl|my_center|LOCUS_17910 106096 104282 gene locus_tag LOCUS_17920 106096 104282 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_17920 106546 107541 gene locus_tag LOCUS_17930 106546 107541 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_17930 107538 108440 gene locus_tag LOCUS_17940 gene cyoE 107538 108440 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880042.1 protein_id gnl|my_center|LOCUS_17940 108459 108692 gene locus_tag LOCUS_17950 108459 108692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 108696 109127 gene locus_tag LOCUS_17960 108696 109127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 109331 109762 gene locus_tag LOCUS_17970 109331 109762 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928467.1 protein_id gnl|my_center|LOCUS_17970 109779 110936 gene locus_tag LOCUS_17980 109779 110936 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_17980 111077 111433 gene locus_tag LOCUS_17990 111077 111433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 111597 111977 gene locus_tag LOCUS_18000 111597 111977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 112161 112403 gene locus_tag LOCUS_18010 112161 112403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 112400 112774 gene locus_tag LOCUS_18020 112400 112774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 112815 113057 gene locus_tag LOCUS_18030 112815 113057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 113054 113488 gene locus_tag LOCUS_18040 113054 113488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 113713 114084 gene locus_tag LOCUS_18050 113713 114084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 114309 115097 gene locus_tag LOCUS_18060 114309 115097 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_18060 115172 115630 gene locus_tag LOCUS_18070 115172 115630 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_18070 115721 116143 gene locus_tag LOCUS_18080 115721 116143 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_18080 116730 117038 gene locus_tag LOCUS_18090 116730 117038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 117678 118166 gene locus_tag LOCUS_18100 gene rimP 117678 118166 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958225.1 protein_id gnl|my_center|LOCUS_18100 118300 119706 gene locus_tag LOCUS_18110 118300 119706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 119759 119983 gene locus_tag LOCUS_18120 119759 119983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 119994 122909 gene locus_tag LOCUS_18130 gene infB 119994 122909 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_18130 123018 123305 gene locus_tag LOCUS_18140 123018 123305 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 protein_id gnl|my_center|LOCUS_18140 123726 124085 gene locus_tag LOCUS_18150 gene rbfA 123726 124085 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_18150 124329 125288 gene locus_tag LOCUS_18160 gene truB 124329 125288 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_18160 125349 125618 gene locus_tag LOCUS_18170 gene rpsO 125349 125618 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_18170 125665 127848 gene locus_tag LOCUS_18180 gene pnp 125665 127848 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_18180 127845 129116 gene locus_tag LOCUS_18190 127845 129116 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_18190 129458 129901 gene locus_tag LOCUS_18200 gene dut 129458 129901 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_18200 130039 131481 gene locus_tag LOCUS_18210 gene purB 130039 131481 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_18210 131838 132560 gene locus_tag LOCUS_18220 131838 132560 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_18220 132650 132895 gene locus_tag LOCUS_18230 gene purS 132650 132895 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383889.1 protein_id gnl|my_center|LOCUS_18230 132892 133578 gene locus_tag LOCUS_18240 gene purQ 132892 133578 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_18240 133578 135977 gene locus_tag LOCUS_18250 gene purL 133578 135977 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_18250 135970 137421 gene locus_tag LOCUS_18260 gene purF 135970 137421 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_18260 138417 137458 gene locus_tag LOCUS_18270 138417 137458 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_18270 140642 139224 gene locus_tag LOCUS_18280 gene boxB 140642 139224 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_18280 142291 140639 gene locus_tag LOCUS_18290 gene boxC 142291 140639 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_18290 142604 144277 gene locus_tag LOCUS_18300 142604 144277 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_18300 144312 145112 gene locus_tag LOCUS_18310 144312 145112 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_18310 146303 145239 gene locus_tag LOCUS_18320 146303 145239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 146916 146518 gene locus_tag LOCUS_18330 146916 146518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 147812 146931 gene locus_tag LOCUS_18340 147812 146931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 149039 148167 gene locus_tag LOCUS_18350 149039 148167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 150981 149065 gene locus_tag LOCUS_18360 150981 149065 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_18360 151258 152292 gene locus_tag LOCUS_18370 151258 152292 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_18370 152357 153187 gene locus_tag LOCUS_18380 gene mreC 152357 153187 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_18380 153203 153712 gene locus_tag LOCUS_18390 153203 153712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 153878 155779 gene locus_tag LOCUS_18400 gene mrdA 153878 155779 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_18400 155803 156909 gene locus_tag LOCUS_18410 gene rodA 155803 156909 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_18410 157587 156946 gene locus_tag LOCUS_18420 157587 156946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 157815 157618 gene locus_tag LOCUS_18430 157815 157618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 158467 158036 gene locus_tag LOCUS_18440 158467 158036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 159213 160802 gene locus_tag LOCUS_18450 159213 160802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 160874 161401 gene locus_tag LOCUS_18460 160874 161401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 161536 161946 gene locus_tag LOCUS_18470 161536 161946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 163157 161979 gene locus_tag LOCUS_18480 163157 161979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 163502 163654 gene locus_tag LOCUS_18490 163502 163654 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence10 <1 781 gene locus_tag LOCUS_18500 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085967.1:ABC transporter substrate-binding protein 866 1744 gene locus_tag LOCUS_18510 866 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1755 2930 gene locus_tag LOCUS_18520 1755 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2977 3741 gene locus_tag LOCUS_18530 2977 3741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_18530 3746 4462 gene locus_tag LOCUS_18540 3746 4462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_18540 4941 4492 gene locus_tag LOCUS_18550 4941 4492 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_18550 5364 5642 gene locus_tag LOCUS_18560 5364 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 5629 6093 gene locus_tag LOCUS_18570 5629 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6430 7629 gene locus_tag LOCUS_18580 6430 7629 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788709.1 protein_id gnl|my_center|LOCUS_18580 8023 9333 gene locus_tag LOCUS_18590 gene anmK 8023 9333 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_18590 9544 10179 gene locus_tag LOCUS_18600 9544 10179 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_18600 10234 10704 gene locus_tag LOCUS_18610 10234 10704 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_18610 12435 10888 gene locus_tag LOCUS_18620 12435 10888 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_18620 12912 13670 gene locus_tag LOCUS_18630 12912 13670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391947.1 protein_id gnl|my_center|LOCUS_18630 13670 14158 gene locus_tag LOCUS_18640 13670 14158 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773822.1 protein_id gnl|my_center|LOCUS_18640 15193 14198 gene locus_tag LOCUS_18650 gene glk 15193 14198 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_18650 16171 15398 gene locus_tag LOCUS_18660 gene pgl 16171 15398 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_18660 17286 16168 gene locus_tag LOCUS_18670 17286 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 18830 17283 gene locus_tag LOCUS_18680 gene zwf 18830 17283 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_18680 20543 19110 gene locus_tag LOCUS_18690 20543 19110 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_18690 20871 21254 gene locus_tag LOCUS_18700 20871 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 21434 21817 gene locus_tag LOCUS_18710 21434 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 22142 23083 gene locus_tag LOCUS_18720 22142 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 23384 24424 gene locus_tag LOCUS_18730 gene pstS 23384 24424 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_18730 24933 25217 gene locus_tag LOCUS_18740 24933 25217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 25430 27130 gene locus_tag LOCUS_18750 25430 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 27258 27647 gene locus_tag LOCUS_18760 27258 27647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 27696 28073 gene locus_tag LOCUS_18770 27696 28073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 29664 28246 gene locus_tag LOCUS_18780 29664 28246 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829417.1 protein_id gnl|my_center|LOCUS_18780 30052 30834 gene locus_tag LOCUS_18790 30052 30834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 31223 33223 gene locus_tag LOCUS_18800 31223 33223 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_18800 33223 34101 gene locus_tag LOCUS_18810 33223 34101 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_18810 34762 35535 gene locus_tag LOCUS_18820 gene fabI 34762 35535 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_18820 35694 36470 gene locus_tag LOCUS_18830 gene gloB 35694 36470 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143329.1 protein_id gnl|my_center|LOCUS_18830 36937 36515 gene locus_tag LOCUS_18840 36937 36515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 38173 36956 gene locus_tag LOCUS_18850 38173 36956 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_18850 38675 38334 gene locus_tag LOCUS_18860 38675 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 40035 39274 gene locus_tag LOCUS_18870 40035 39274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 40233 41687 gene locus_tag LOCUS_18880 gene guaB 40233 41687 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546759.1 protein_id gnl|my_center|LOCUS_18880 41727 42068 gene locus_tag LOCUS_18890 41727 42068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 42055 43209 gene locus_tag LOCUS_18900 gene ddlA 42055 43209 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053170.1 protein_id gnl|my_center|LOCUS_18900 43265 43894 gene locus_tag LOCUS_18910 gene rdgB 43265 43894 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_18910 44349 44146 gene locus_tag LOCUS_18920 44349 44146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 45388 46095 gene locus_tag LOCUS_18930 45388 46095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 46170 46697 gene locus_tag LOCUS_18940 46170 46697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 46702 48420 gene locus_tag LOCUS_18950 46702 48420 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_18950 48453 48875 gene locus_tag LOCUS_18960 48453 48875 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_18960 49623 50048 gene locus_tag LOCUS_18970 49623 50048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 50133 52133 gene locus_tag LOCUS_18980 gene nosZ 50133 52133 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_18980 52608 53249 gene locus_tag LOCUS_18990 52608 53249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_18990 53494 53943 gene locus_tag LOCUS_19000 53494 53943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 53987 55327 gene locus_tag LOCUS_19010 53987 55327 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_19010 55285 56004 gene locus_tag LOCUS_19020 55285 56004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 55992 56783 gene locus_tag LOCUS_19030 55992 56783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 57183 59237 gene locus_tag LOCUS_19040 gene cstA 57183 59237 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_19040 59234 59506 gene locus_tag LOCUS_19050 59234 59506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 59620 60135 gene locus_tag LOCUS_19060 59620 60135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 60190 61671 gene locus_tag LOCUS_19070 gene ctaD 60190 61671 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040672.1 protein_id gnl|my_center|LOCUS_19070 62314 64413 gene locus_tag LOCUS_19080 62314 64413 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_19080 64616 64930 gene locus_tag LOCUS_19090 64616 64930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 65398 65712 gene locus_tag LOCUS_19100 65398 65712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431302.1 protein_id gnl|my_center|LOCUS_19100 65702 66727 gene locus_tag LOCUS_19110 65702 66727 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764786.1 protein_id gnl|my_center|LOCUS_19110 68035 66830 gene locus_tag LOCUS_19120 68035 66830 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_19120 69465 68032 gene locus_tag LOCUS_19130 69465 68032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 70559 69465 gene locus_tag LOCUS_19140 70559 69465 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_19140 70915 71286 gene locus_tag LOCUS_19150 70915 71286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 71462 72367 gene locus_tag LOCUS_19160 71462 72367 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639891.1 protein_id gnl|my_center|LOCUS_19160 75353 72471 gene locus_tag LOCUS_19170 75353 72471 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_19170 75630 76667 gene locus_tag LOCUS_19180 75630 76667 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_19180 77734 76679 gene locus_tag LOCUS_19190 gene argC 77734 76679 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_19190 78345 77941 gene locus_tag LOCUS_19200 gene rpsI 78345 77941 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 protein_id gnl|my_center|LOCUS_19200 78762 78349 gene locus_tag LOCUS_19210 gene rplM 78762 78349 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_19210 78960 78883 gene locus_tag LOCUS_t00260 78960 78883 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 79175 82366 gene locus_tag LOCUS_19220 79175 82366 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_19220 82404 83591 gene locus_tag LOCUS_19230 82404 83591 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_19230 84976 83936 gene locus_tag LOCUS_19240 84976 83936 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_19240 85532 85131 gene locus_tag LOCUS_19250 85532 85131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 86363 85536 gene locus_tag LOCUS_19260 86363 85536 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530055.1 protein_id gnl|my_center|LOCUS_19260 86863 88068 gene locus_tag LOCUS_19270 86863 88068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 88478 88176 gene locus_tag LOCUS_19280 88478 88176 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_19280 89369 88491 gene locus_tag LOCUS_19290 gene proC 89369 88491 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_19290 90082 89366 gene locus_tag LOCUS_19300 90082 89366 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_19300 90691 90119 gene locus_tag LOCUS_19310 90691 90119 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_19310 91036 93204 gene locus_tag LOCUS_19320 91036 93204 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_19320 93322 93966 gene locus_tag LOCUS_19330 93322 93966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 94435 94217 gene locus_tag LOCUS_19340 94435 94217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 94732 94457 gene locus_tag LOCUS_19350 94732 94457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 96407 94740 gene locus_tag LOCUS_19360 96407 94740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 96833 97621 gene locus_tag LOCUS_19370 96833 97621 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_19370 97686 98057 gene locus_tag LOCUS_19380 97686 98057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 98724 99695 gene locus_tag LOCUS_19390 98724 99695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 99692 100528 gene locus_tag LOCUS_19400 99692 100528 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246196.1 protein_id gnl|my_center|LOCUS_19400 100789 102168 gene locus_tag LOCUS_19410 100789 102168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092207.1 protein_id gnl|my_center|LOCUS_19410 102184 102705 gene locus_tag LOCUS_19420 102184 102705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 102719 103576 gene locus_tag LOCUS_19430 102719 103576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 103570 104886 gene locus_tag LOCUS_19440 103570 104886 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064536.1 protein_id gnl|my_center|LOCUS_19440 104883 106055 gene locus_tag LOCUS_19450 104883 106055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 107143 106064 gene locus_tag LOCUS_19460 107143 106064 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 protein_id gnl|my_center|LOCUS_19460 108606 107299 gene locus_tag LOCUS_19470 108606 107299 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_19470 108716 109639 gene locus_tag LOCUS_19480 gene ribF 108716 109639 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_19480 110116 109673 gene locus_tag LOCUS_19490 110116 109673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 110668 110120 gene locus_tag LOCUS_19500 110668 110120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 111187 110717 gene locus_tag LOCUS_19510 111187 110717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 111421 111636 gene locus_tag LOCUS_19520 111421 111636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 112110 111823 gene locus_tag LOCUS_19530 112110 111823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 112030 112209 gene locus_tag LOCUS_19540 112030 112209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 113213 112233 gene locus_tag LOCUS_19550 113213 112233 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990661.1 protein_id gnl|my_center|LOCUS_19550 113553 113477 gene locus_tag LOCUS_t00270 113553 113477 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 113825 115354 gene locus_tag LOCUS_19560 113825 115354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 116610 116323 gene locus_tag LOCUS_19570 116610 116323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 117610 116591 gene locus_tag LOCUS_19580 117610 116591 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_19580 117835 118461 gene locus_tag LOCUS_19590 117835 118461 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_19590 118634 119386 gene locus_tag LOCUS_19600 118634 119386 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110992.1 protein_id gnl|my_center|LOCUS_19600 119742 121382 gene locus_tag LOCUS_19610 119742 121382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 121387 125817 gene locus_tag LOCUS_19620 121387 125817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 126555 127088 gene locus_tag LOCUS_19630 126555 127088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 127082 127870 gene locus_tag LOCUS_19640 127082 127870 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947313.1 protein_id gnl|my_center|LOCUS_19640 127870 129666 gene locus_tag LOCUS_19650 127870 129666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 130867 129899 gene locus_tag LOCUS_19660 130867 129899 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_19660 131556 131104 gene locus_tag LOCUS_19670 131556 131104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 132918 131575 gene locus_tag LOCUS_19680 gene rimO 132918 131575 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19680 133761 133036 gene locus_tag LOCUS_19690 133761 133036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 136560 134314 gene locus_tag LOCUS_19700 136560 134314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 138200 136542 gene locus_tag LOCUS_19710 138200 136542 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence11 622 1035 gene locus_tag LOCUS_19720 622 1035 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_19720 1995 1096 gene locus_tag LOCUS_19730 1995 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2389 2141 gene locus_tag LOCUS_19740 2389 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3405 2356 gene locus_tag LOCUS_19750 gene cysM 3405 2356 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930733.1 protein_id gnl|my_center|LOCUS_19750 3637 3359 gene locus_tag LOCUS_19760 3637 3359 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_19760 5116 3854 gene locus_tag LOCUS_19770 gene thrC 5116 3854 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_19770 5844 5122 gene locus_tag LOCUS_19780 gene thiF 5844 5122 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_19780 6498 6205 gene locus_tag LOCUS_19790 6498 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 7727 6963 gene locus_tag LOCUS_19800 7727 6963 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_19800 8512 7853 gene locus_tag LOCUS_19810 8512 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 8600 9064 gene locus_tag LOCUS_19820 8600 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 9253 9909 gene locus_tag LOCUS_19830 9253 9909 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_19830 10279 11010 gene locus_tag LOCUS_19840 10279 11010 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_19840 11213 12208 gene locus_tag LOCUS_19850 11213 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 12373 13227 gene locus_tag LOCUS_19860 gene htpX 12373 13227 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_19860 13250 13675 gene locus_tag LOCUS_19870 13250 13675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 13958 16348 gene locus_tag LOCUS_19880 gene mrcB 13958 16348 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_19880 16706 17902 gene locus_tag LOCUS_19890 16706 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 17955 18914 gene locus_tag LOCUS_19900 gene tsaD 17955 18914 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_19900 19135 19860 gene locus_tag LOCUS_19910 gene rsmA 19135 19860 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_19910 19853 20725 gene locus_tag LOCUS_19920 gene mutM 19853 20725 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175950.1 protein_id gnl|my_center|LOCUS_19920 20956 21900 gene locus_tag LOCUS_19930 20956 21900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 21900 22538 gene locus_tag LOCUS_19940 gene tmk 21900 22538 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546833.1 protein_id gnl|my_center|LOCUS_19940 22538 23584 gene locus_tag LOCUS_19950 gene holB 22538 23584 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_19950 23793 25379 gene locus_tag LOCUS_19960 gene metG 23793 25379 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_19960 25414 26235 gene locus_tag LOCUS_19970 25414 26235 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_19970 26974 26573 gene locus_tag LOCUS_19980 gene mce 26974 26573 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_19980 27526 27161 gene locus_tag LOCUS_19990 27526 27161 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_19990 27812 27531 gene locus_tag LOCUS_20000 27812 27531 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 protein_id gnl|my_center|LOCUS_20000 28734 28042 gene locus_tag LOCUS_20010 28734 28042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 29645 28995 gene locus_tag LOCUS_20020 gene fsa 29645 28995 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_20020 30234 29680 gene locus_tag LOCUS_20030 gene folK 30234 29680 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_20030 31410 30244 gene locus_tag LOCUS_20040 31410 30244 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_20040 32340 32855 gene locus_tag LOCUS_20050 32340 32855 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_20050 32884 35802 gene locus_tag LOCUS_20060 32884 35802 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_20060 35803 37191 gene locus_tag LOCUS_20070 gene nrfD 35803 37191 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_20070 37188 37700 gene locus_tag LOCUS_20080 37188 37700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 37687 38256 gene locus_tag LOCUS_20090 37687 38256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 38253 39422 gene locus_tag LOCUS_20100 38253 39422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 39419 40453 gene locus_tag LOCUS_20110 39419 40453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 40465 42912 gene locus_tag LOCUS_20120 40465 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 42909 43247 gene locus_tag LOCUS_20130 42909 43247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 43257 44090 gene locus_tag LOCUS_20140 43257 44090 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971120.1 protein_id gnl|my_center|LOCUS_20140 44613 44200 gene locus_tag LOCUS_20150 44613 44200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 44951 45424 gene locus_tag LOCUS_20160 44951 45424 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_20160 45426 45722 gene locus_tag LOCUS_20170 45426 45722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 45738 46070 gene locus_tag LOCUS_20180 45738 46070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 46467 46542 gene locus_tag LOCUS_t00280 46467 46542 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 46797 46872 gene locus_tag LOCUS_t00290 46797 46872 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 47780 47998 gene locus_tag LOCUS_20190 47780 47998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 48071 48301 gene locus_tag LOCUS_20200 48071 48301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 48578 49865 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcagtcccctcctcatcggggatcggtttgaagc 50570 49968 gene locus_tag LOCUS_20210 gene cas4 50570 49968 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258805.1 protein_id gnl|my_center|LOCUS_20210 50839 50567 gene locus_tag LOCUS_20220 50839 50567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 52021 50843 gene locus_tag LOCUS_20230 gene cas1 52021 50843 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_20230 52866 52060 gene locus_tag LOCUS_20240 52866 52060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255976.1 protein_id gnl|my_center|LOCUS_20240 53839 52871 gene locus_tag LOCUS_20250 53839 52871 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255977.1 protein_id gnl|my_center|LOCUS_20250 55367 53844 gene locus_tag LOCUS_20260 55367 53844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 58062 55588 gene locus_tag LOCUS_20270 58062 55588 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255980.1 protein_id gnl|my_center|LOCUS_20270 58297 58203 gene locus_tag LOCUS_t00300 58297 58203 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59370 58405 gene locus_tag LOCUS_20280 gene cas6 59370 58405 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_20280 59739 59383 gene locus_tag LOCUS_20290 59739 59383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 60293 59910 gene locus_tag LOCUS_20300 60293 59910 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_20300 60657 60283 gene locus_tag LOCUS_20310 60657 60283 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_20310 61067 61744 gene locus_tag LOCUS_20320 61067 61744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 62268 64124 gene locus_tag LOCUS_20330 62268 64124 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_20330 64899 65831 gene locus_tag LOCUS_20340 64899 65831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 65841 66449 gene locus_tag LOCUS_20350 65841 66449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 66446 67987 gene locus_tag LOCUS_20360 gene ctaD 66446 67987 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224924.1 protein_id gnl|my_center|LOCUS_20360 68976 68632 gene locus_tag LOCUS_20370 68976 68632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 69511 69011 gene locus_tag LOCUS_20380 69511 69011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20380 70350 69634 gene locus_tag LOCUS_20390 70350 69634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 71679 70411 gene locus_tag LOCUS_20400 71679 70411 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880096.1 protein_id gnl|my_center|LOCUS_20400 73011 72412 gene locus_tag LOCUS_20410 73011 72412 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_20410 74882 73230 gene locus_tag LOCUS_20420 74882 73230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 76020 74968 gene locus_tag LOCUS_20430 gene cbbX 76020 74968 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532058.1 protein_id gnl|my_center|LOCUS_20430 76846 76367 gene locus_tag LOCUS_20440 76846 76367 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_20440 77133 76888 gene locus_tag LOCUS_20450 77133 76888 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_20450 77637 77158 gene locus_tag LOCUS_20460 77637 77158 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_20460 78727 77603 gene locus_tag LOCUS_20470 78727 77603 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391983.1 protein_id gnl|my_center|LOCUS_20470 79725 78769 gene locus_tag LOCUS_20480 79725 78769 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_20480 80827 79733 gene locus_tag LOCUS_20490 80827 79733 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979957.1 protein_id gnl|my_center|LOCUS_20490 81114 80827 gene locus_tag LOCUS_20500 81114 80827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 83285 81111 gene locus_tag LOCUS_20510 83285 81111 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_20510 84270 83293 gene locus_tag LOCUS_20520 84270 83293 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_20520 85052 84282 gene locus_tag LOCUS_20530 85052 84282 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_20530 86344 85052 gene locus_tag LOCUS_20540 86344 85052 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_20540 87085 86351 gene locus_tag LOCUS_20550 87085 86351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846994.1 protein_id gnl|my_center|LOCUS_20550 88155 87091 gene locus_tag LOCUS_20560 88155 87091 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_20560 89338 88148 gene locus_tag LOCUS_20570 89338 88148 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_20570 89700 89344 gene locus_tag LOCUS_20580 89700 89344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 90413 89706 gene locus_tag LOCUS_20590 90413 89706 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_20590 90904 90434 gene locus_tag LOCUS_20600 90904 90434 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_20600 91379 90996 gene locus_tag LOCUS_20610 91379 90996 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979946.1 protein_id gnl|my_center|LOCUS_20610 92107 91376 gene locus_tag LOCUS_20620 92107 91376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 92216 92449 gene locus_tag LOCUS_20630 92216 92449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 92580 93011 gene locus_tag LOCUS_20640 92580 93011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 93198 93482 gene locus_tag LOCUS_20650 93198 93482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20650 94441 94232 gene locus_tag LOCUS_20660 94441 94232 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_20660 94915 94634 gene locus_tag LOCUS_20670 94915 94634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 94964 94888 gene locus_tag LOCUS_t00310 94964 94888 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 95955 95095 gene locus_tag LOCUS_20680 95955 95095 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_20680 96298 97767 gene locus_tag LOCUS_20690 96298 97767 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966731.1 protein_id gnl|my_center|LOCUS_20690 97764 98408 gene locus_tag LOCUS_20700 97764 98408 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083999.1 protein_id gnl|my_center|LOCUS_20700 98653 101064 gene locus_tag LOCUS_20710 98653 101064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 101776 102867 gene locus_tag LOCUS_20720 101776 102867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 103073 103966 gene locus_tag LOCUS_20730 103073 103966 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_20730 104567 104163 gene locus_tag LOCUS_20740 104567 104163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 105071 104586 gene locus_tag LOCUS_20750 105071 104586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20750 105616 105248 gene locus_tag LOCUS_20760 105616 105248 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_20760 105818 106612 gene locus_tag LOCUS_20770 105818 106612 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392230.1 protein_id gnl|my_center|LOCUS_20770 106609 108414 gene locus_tag LOCUS_20780 106609 108414 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990758.1 protein_id gnl|my_center|LOCUS_20780 108414 109202 gene locus_tag LOCUS_20790 108414 109202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 109959 109519 gene locus_tag LOCUS_20800 109959 109519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 110806 109949 gene locus_tag LOCUS_20810 110806 109949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20810 112166 111150 gene locus_tag LOCUS_20820 112166 111150 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_20820 112619 112891 gene locus_tag LOCUS_20830 112619 112891 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 protein_id gnl|my_center|LOCUS_20830 112904 114121 gene locus_tag LOCUS_20840 112904 114121 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_20840 114121 115362 gene locus_tag LOCUS_20850 114121 115362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 115388 116725 gene locus_tag LOCUS_20860 gene pepP 115388 116725 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_20860 117394 118509 gene locus_tag LOCUS_20870 117394 118509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 118484 119350 gene locus_tag LOCUS_20880 118484 119350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 119347 120165 gene locus_tag LOCUS_20890 119347 120165 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865285.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence12 919 1464 gene locus_tag LOCUS_20900 gene moaC 919 1464 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_20900 1760 2944 gene locus_tag LOCUS_20910 1760 2944 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_20910 3895 4278 gene locus_tag LOCUS_20920 gene fosA 3895 4278 CDS product FosA5 family fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704268.1 protein_id gnl|my_center|LOCUS_20920 6075 4441 gene locus_tag LOCUS_20930 gene rng 6075 4441 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_20930 6355 6999 gene locus_tag LOCUS_20940 6355 6999 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_20940 7157 10687 gene locus_tag LOCUS_20950 gene smc 7157 10687 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_20950 11675 10728 gene locus_tag LOCUS_20960 11675 10728 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_20960 12002 13531 gene locus_tag LOCUS_20970 12002 13531 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_20970 13557 14330 gene locus_tag LOCUS_20980 13557 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 14789 14409 gene locus_tag LOCUS_20990 14789 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 15079 14864 gene locus_tag LOCUS_21000 15079 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 17647 15200 gene locus_tag LOCUS_21010 gene pheT 17647 15200 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_21010 18716 17667 gene locus_tag LOCUS_21020 gene pheS 18716 17667 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_21020 19205 18846 gene locus_tag LOCUS_21030 gene rplT 19205 18846 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_21030 19639 19442 gene locus_tag LOCUS_21040 gene rpmI 19639 19442 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_21040 20170 19676 gene locus_tag LOCUS_21050 gene infC 20170 19676 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_21050 22235 20319 gene locus_tag LOCUS_21060 gene thrS 22235 20319 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_21060 22445 22371 gene locus_tag LOCUS_t00320 22445 22371 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22603 23685 gene locus_tag LOCUS_21070 22603 23685 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_21070 23831 25165 gene locus_tag LOCUS_21080 23831 25165 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_21080 25372 25575 gene locus_tag LOCUS_21090 25372 25575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 25957 26907 gene locus_tag LOCUS_21100 25957 26907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 27309 27070 gene locus_tag LOCUS_21110 27309 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 27199 27450 gene locus_tag LOCUS_21120 27199 27450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 27969 28532 gene locus_tag LOCUS_21130 gene pncA 27969 28532 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_21130 29527 28568 gene locus_tag LOCUS_21140 29527 28568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 30319 30732 gene locus_tag LOCUS_21150 30319 30732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21150 30739 31209 gene locus_tag LOCUS_21160 30739 31209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21160 31234 31731 gene locus_tag LOCUS_21170 31234 31731 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_21170 32141 34858 gene locus_tag LOCUS_21180 32141 34858 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058460933.1 protein_id gnl|my_center|LOCUS_21180 35447 35626 gene locus_tag LOCUS_21190 35447 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 35724 36914 gene locus_tag LOCUS_21200 35724 36914 CDS product IS256-like element ISRm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969783.1 protein_id gnl|my_center|LOCUS_21200 38189 37236 gene locus_tag LOCUS_21210 38189 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 38963 39652 gene locus_tag LOCUS_21220 38963 39652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 40219 41181 gene locus_tag LOCUS_21230 40219 41181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 41441 42622 gene locus_tag LOCUS_21240 gene pseC 41441 42622 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_21240 42812 43753 gene locus_tag LOCUS_21250 42812 43753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_21250 44425 44628 gene locus_tag LOCUS_21260 44425 44628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 44897 45670 gene locus_tag LOCUS_21270 44897 45670 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_21270 46954 45803 gene locus_tag LOCUS_21280 46954 45803 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_21280 47185 48180 gene locus_tag LOCUS_21290 47185 48180 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411960.1 protein_id gnl|my_center|LOCUS_21290 49641 48283 gene locus_tag LOCUS_21300 49641 48283 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_21300 51748 49634 gene locus_tag LOCUS_21310 51748 49634 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_21310 52130 52813 gene locus_tag LOCUS_21320 gene nthB 52130 52813 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_21320 52884 53516 gene locus_tag LOCUS_21330 gene nthA 52884 53516 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 protein_id gnl|my_center|LOCUS_21330 53519 53854 gene locus_tag LOCUS_21340 53519 53854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 54127 53894 gene locus_tag LOCUS_21350 54127 53894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 54405 54806 gene locus_tag LOCUS_21360 54405 54806 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817437.1 protein_id gnl|my_center|LOCUS_21360 56347 54923 gene locus_tag LOCUS_21370 56347 54923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 57950 56379 gene locus_tag LOCUS_21380 57950 56379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 58742 57969 gene locus_tag LOCUS_21390 gene gldF 58742 57969 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_21390 59518 58739 gene locus_tag LOCUS_21400 59518 58739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_21400 61018 59786 gene locus_tag LOCUS_21410 61018 59786 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_21410 61775 61512 gene locus_tag LOCUS_21420 61775 61512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 62178 62477 gene locus_tag LOCUS_21430 62178 62477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 63530 62886 gene locus_tag LOCUS_21440 63530 62886 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429495.1 protein_id gnl|my_center|LOCUS_21440 65898 63607 gene locus_tag LOCUS_21450 65898 63607 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_21450 66415 65900 gene locus_tag LOCUS_21460 66415 65900 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_21460 67446 66574 gene locus_tag LOCUS_21470 67446 66574 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_21470 68627 67536 gene locus_tag LOCUS_21480 68627 67536 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_21480 69022 68624 gene locus_tag LOCUS_21490 69022 68624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 69383 69015 gene locus_tag LOCUS_21500 69383 69015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 69567 69866 gene locus_tag LOCUS_21510 69567 69866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 70494 69958 gene locus_tag LOCUS_21520 70494 69958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 70724 70491 gene locus_tag LOCUS_21530 70724 70491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 72699 71503 gene locus_tag LOCUS_21540 72699 71503 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_21540 75015 72967 gene locus_tag LOCUS_21550 75015 72967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 76082 75213 gene locus_tag LOCUS_21560 76082 75213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 76455 76108 gene locus_tag LOCUS_21570 76455 76108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 77155 76496 gene locus_tag LOCUS_21580 77155 76496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 80257 77687 gene locus_tag LOCUS_21590 80257 77687 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036254.1 protein_id gnl|my_center|LOCUS_21590 81435 80557 gene locus_tag LOCUS_21600 gene hpnK 81435 80557 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_21600 81512 82264 gene locus_tag LOCUS_21610 81512 82264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 83331 82387 gene locus_tag LOCUS_21620 83331 82387 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_21620 84448 83456 gene locus_tag LOCUS_21630 84448 83456 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_21630 85828 84455 gene locus_tag LOCUS_21640 gene hpnE 85828 84455 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_21640 86880 85825 gene locus_tag LOCUS_21650 gene hpnD 86880 85825 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_21650 87862 86969 gene locus_tag LOCUS_21660 gene hpnC 87862 86969 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_21660 89026 87872 gene locus_tag LOCUS_21670 gene dxr 89026 87872 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_21670 91037 89040 gene locus_tag LOCUS_21680 gene shc 91037 89040 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_21680 92203 91112 gene locus_tag LOCUS_21690 92203 91112 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545565.1 protein_id gnl|my_center|LOCUS_21690 93126 92212 gene locus_tag LOCUS_21700 93126 92212 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_21700 94764 93766 gene locus_tag LOCUS_21710 gene hpnH 94764 93766 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_21710 95459 94806 gene locus_tag LOCUS_21720 95459 94806 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706713.1 protein_id gnl|my_center|LOCUS_21720 96348 95833 gene locus_tag LOCUS_21730 96348 95833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 97408 96563 gene locus_tag LOCUS_21740 97408 96563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 97739 97419 gene locus_tag LOCUS_21750 97739 97419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 98142 99092 gene locus_tag LOCUS_21760 98142 99092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 99082 100410 gene locus_tag LOCUS_21770 99082 100410 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_21770 100719 100507 gene locus_tag LOCUS_21780 100719 100507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 100925 100716 gene locus_tag LOCUS_21790 100925 100716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 101162 100980 gene locus_tag LOCUS_21800 101162 100980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 101915 101340 gene locus_tag LOCUS_21810 101915 101340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 103193 102333 gene locus_tag LOCUS_21820 103193 102333 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_21820 103156 104157 gene locus_tag LOCUS_21830 103156 104157 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_21830 104328 105902 gene locus_tag LOCUS_21840 104328 105902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 106822 106256 gene locus_tag LOCUS_21850 106822 106256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 108111 106822 gene locus_tag LOCUS_21860 108111 106822 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 protein_id gnl|my_center|LOCUS_21860 108950 108291 gene locus_tag LOCUS_21870 108950 108291 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_21870 110794 109127 gene locus_tag LOCUS_21880 110794 109127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 111068 111688 gene locus_tag LOCUS_21890 gene rsmD 111068 111688 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_21890 111663 112175 gene locus_tag LOCUS_21900 gene coaD 111663 112175 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_21900 112261 113466 gene locus_tag LOCUS_21910 112261 113466 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_21910 114073 113630 gene locus_tag LOCUS_21920 114073 113630 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_21920 114384 114689 gene locus_tag LOCUS_21930 114384 114689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 115520 116770 gene locus_tag LOCUS_21940 gene icd 115520 116770 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_21940 116917 117849 gene locus_tag LOCUS_21950 gene mdh 116917 117849 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_21950 118092 119255 gene locus_tag LOCUS_21960 gene sucC 118092 119255 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918226.1 protein_id gnl|my_center|LOCUS_21960 119266 120144 gene locus_tag LOCUS_21970 gene sucD 119266 120144 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_21970 120314 120730 gene locus_tag LOCUS_21980 gene ndk 120314 120730 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence13 800 2800 gene locus_tag LOCUS_21990 800 2800 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087045357.1 protein_id gnl|my_center|LOCUS_21990 3536 4021 gene locus_tag LOCUS_22000 3536 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4439 3966 gene locus_tag LOCUS_22010 4439 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5314 6822 gene locus_tag LOCUS_22020 5314 6822 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087237.1 protein_id gnl|my_center|LOCUS_22020 7413 8426 gene locus_tag LOCUS_22030 7413 8426 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_22030 8974 8501 gene locus_tag LOCUS_22040 8974 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 9479 9096 gene locus_tag LOCUS_22050 9479 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10344 9469 gene locus_tag LOCUS_22060 10344 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 11325 10612 gene locus_tag LOCUS_22070 11325 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 11843 12796 gene locus_tag LOCUS_22080 11843 12796 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931057.1 protein_id gnl|my_center|LOCUS_22080 13010 13201 gene locus_tag LOCUS_22090 13010 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 13337 13543 gene locus_tag LOCUS_22100 13337 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 14125 13841 gene locus_tag LOCUS_22110 14125 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 14645 14106 gene locus_tag LOCUS_22120 14645 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 14962 14654 gene locus_tag LOCUS_22130 14962 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 15464 16903 gene locus_tag LOCUS_22140 15464 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 16900 18753 gene locus_tag LOCUS_22150 gene menD 16900 18753 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_22150 19300 20208 gene locus_tag LOCUS_22160 gene menH 19300 20208 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_22160 20679 21497 gene locus_tag LOCUS_22170 gene menB 20679 21497 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_22170 21494 22507 gene locus_tag LOCUS_22180 21494 22507 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_22180 22790 23977 gene locus_tag LOCUS_22190 22790 23977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 24579 25514 gene locus_tag LOCUS_22200 24579 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 25870 27069 gene locus_tag LOCUS_22210 25870 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 27537 28145 gene locus_tag LOCUS_22220 27537 28145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 28682 29641 gene locus_tag LOCUS_22230 28682 29641 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_22230 29804 30082 gene locus_tag LOCUS_22240 29804 30082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 30278 30454 gene locus_tag LOCUS_22250 30278 30454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 30492 30737 gene locus_tag LOCUS_22260 30492 30737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 31887 31084 gene locus_tag LOCUS_22270 31887 31084 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_22270 33077 32055 gene locus_tag LOCUS_22280 gene nadA 33077 32055 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228349.1 protein_id gnl|my_center|LOCUS_22280 34077 33100 gene locus_tag LOCUS_22290 gene nadC 34077 33100 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249173.1 protein_id gnl|my_center|LOCUS_22290 34680 34297 gene locus_tag LOCUS_22300 34680 34297 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391655.1 protein_id gnl|my_center|LOCUS_22300 35398 35940 gene locus_tag LOCUS_22310 35398 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 36963 36361 gene locus_tag LOCUS_22320 36963 36361 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950645.1 protein_id gnl|my_center|LOCUS_22320 37292 37765 gene locus_tag LOCUS_22330 37292 37765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 38010 39260 gene locus_tag LOCUS_22340 38010 39260 CDS product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747527.1 protein_id gnl|my_center|LOCUS_22340 40278 41561 gene locus_tag LOCUS_22350 40278 41561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 41986 42288 gene locus_tag LOCUS_22360 41986 42288 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_22360 42547 43710 gene locus_tag LOCUS_22370 42547 43710 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_22370 44147 43722 gene locus_tag LOCUS_22380 44147 43722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 44799 44206 gene locus_tag LOCUS_22390 44799 44206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 45212 44781 gene locus_tag LOCUS_22400 45212 44781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 45751 45341 gene locus_tag LOCUS_22410 45751 45341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 46080 45748 gene locus_tag LOCUS_22420 46080 45748 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_22420 46741 46235 gene locus_tag LOCUS_22430 46741 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 48112 49104 gene locus_tag LOCUS_22440 48112 49104 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_22440 49260 50144 gene locus_tag LOCUS_22450 49260 50144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 51285 50434 gene locus_tag LOCUS_22460 51285 50434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 51842 51321 gene locus_tag LOCUS_22470 51842 51321 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_22470 52350 53678 gene locus_tag LOCUS_22480 52350 53678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210058.1 protein_id gnl|my_center|LOCUS_22480 53724 54170 gene locus_tag LOCUS_22490 53724 54170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 54949 54305 gene locus_tag LOCUS_22500 54949 54305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 56802 55639 gene locus_tag LOCUS_22510 56802 55639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 57026 58300 gene locus_tag LOCUS_22520 57026 58300 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_22520 58728 58462 gene locus_tag LOCUS_22530 58728 58462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 58761 59879 gene locus_tag LOCUS_22540 58761 59879 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_22540 60162 60512 gene locus_tag LOCUS_22550 60162 60512 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_22550 60595 62040 gene locus_tag LOCUS_22560 60595 62040 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407630.1 protein_id gnl|my_center|LOCUS_22560 62325 63389 gene locus_tag LOCUS_22570 62325 63389 CDS product phenylacetaldoxime dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266125.1 protein_id gnl|my_center|LOCUS_22570 64382 65392 gene locus_tag LOCUS_22580 64382 65392 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_22580 65565 65858 gene locus_tag LOCUS_22590 65565 65858 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530150.1 protein_id gnl|my_center|LOCUS_22590 66128 67192 gene locus_tag LOCUS_22600 66128 67192 CDS product proton-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144181.1 protein_id gnl|my_center|LOCUS_22600 67935 67189 gene locus_tag LOCUS_22610 67935 67189 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891556.1 protein_id gnl|my_center|LOCUS_22610 68687 68238 gene locus_tag LOCUS_22620 68687 68238 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_22620 69214 68684 gene locus_tag LOCUS_22630 69214 68684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 69472 69230 gene locus_tag LOCUS_22640 69472 69230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 69930 69487 gene locus_tag LOCUS_22650 gene cynS 69930 69487 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_22650 70406 71644 gene locus_tag LOCUS_22660 70406 71644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_22660 71670 72116 gene locus_tag LOCUS_22670 71670 72116 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_22670 72469 73251 gene locus_tag LOCUS_22680 72469 73251 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564075.1 protein_id gnl|my_center|LOCUS_22680 73886 73389 gene locus_tag LOCUS_22690 73886 73389 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_22690 74096 75055 gene locus_tag LOCUS_22700 74096 75055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 75428 75745 gene locus_tag LOCUS_22710 75428 75745 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105450.1 protein_id gnl|my_center|LOCUS_22710 75757 76077 gene locus_tag LOCUS_22720 75757 76077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 76491 77465 gene locus_tag LOCUS_22730 76491 77465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 77584 78324 gene locus_tag LOCUS_22740 77584 78324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 78317 79075 gene locus_tag LOCUS_22750 78317 79075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 79627 80049 gene locus_tag LOCUS_22760 79627 80049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 80419 81183 gene locus_tag LOCUS_22770 80419 81183 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_22770 81377 81532 gene locus_tag LOCUS_22780 81377 81532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 81653 82996 gene locus_tag LOCUS_22790 81653 82996 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210058.1 protein_id gnl|my_center|LOCUS_22790 83682 84566 gene locus_tag LOCUS_22800 83682 84566 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894369.1 protein_id gnl|my_center|LOCUS_22800 84642 85910 gene locus_tag LOCUS_22810 gene urtA 84642 85910 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_22810 86042 86887 gene locus_tag LOCUS_22820 gene urtB 86042 86887 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 protein_id gnl|my_center|LOCUS_22820 86884 87897 gene locus_tag LOCUS_22830 86884 87897 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_22830 87903 88622 gene locus_tag LOCUS_22840 gene urtD 87903 88622 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_22840 88619 89323 gene locus_tag LOCUS_22850 88619 89323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 protein_id gnl|my_center|LOCUS_22850 89734 91077 gene locus_tag LOCUS_22860 89734 91077 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 protein_id gnl|my_center|LOCUS_22860 91225 92265 gene locus_tag LOCUS_22870 gene cydB 91225 92265 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_22870 92530 93111 gene locus_tag LOCUS_22880 92530 93111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 93533 94855 gene locus_tag LOCUS_22890 93533 94855 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_22890 95145 97244 gene locus_tag LOCUS_22900 95145 97244 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086466.1 protein_id gnl|my_center|LOCUS_22900 97619 98662 gene locus_tag LOCUS_22910 97619 98662 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966229.1 protein_id gnl|my_center|LOCUS_22910 98664 99341 gene locus_tag LOCUS_22920 98664 99341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 99563 100414 gene locus_tag LOCUS_22930 99563 100414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 100494 101288 gene locus_tag LOCUS_22940 100494 101288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 101614 101922 gene locus_tag LOCUS_22950 101614 101922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 101990 103270 gene locus_tag LOCUS_22960 101990 103270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 103568 104593 gene locus_tag LOCUS_22970 103568 104593 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086462.1 protein_id gnl|my_center|LOCUS_22970 104607 105320 gene locus_tag LOCUS_22980 104607 105320 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337801.1 protein_id gnl|my_center|LOCUS_22980 105776 105558 gene locus_tag LOCUS_22990 105776 105558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_22990 106036 105818 gene locus_tag LOCUS_23000 106036 105818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 106339 106806 gene locus_tag LOCUS_23010 106339 106806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 106941 107609 gene locus_tag LOCUS_23020 106941 107609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 108054 108473 gene locus_tag LOCUS_23030 108054 108473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 109471 108707 gene locus_tag LOCUS_23040 109471 108707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 110157 109468 gene locus_tag LOCUS_23050 110157 109468 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083950.1 protein_id gnl|my_center|LOCUS_23050 111225 110179 gene locus_tag LOCUS_23060 111225 110179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 111557 111222 gene locus_tag LOCUS_23070 gene copC 111557 111222 CDS product copper homeostasis periplasmic binding protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185895.1 protein_id gnl|my_center|LOCUS_23070 112573 111611 gene locus_tag LOCUS_23080 112573 111611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 113136 112822 gene locus_tag LOCUS_23090 113136 112822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 113576 113124 gene locus_tag LOCUS_23100 113576 113124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 115139 113844 gene locus_tag LOCUS_23110 115139 113844 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 protein_id gnl|my_center|LOCUS_23110 115662 115459 gene locus_tag LOCUS_23120 115662 115459 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228937.1 protein_id gnl|my_center|LOCUS_23120 116756 115938 gene locus_tag LOCUS_23130 116756 115938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence14 894 43 gene locus_tag LOCUS_23140 894 43 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 protein_id gnl|my_center|LOCUS_23140 3076 1274 gene locus_tag LOCUS_23150 3076 1274 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088953.1 protein_id gnl|my_center|LOCUS_23150 4527 3547 gene locus_tag LOCUS_23160 4527 3547 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_23160 5790 4687 gene locus_tag LOCUS_23170 5790 4687 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_23170 5750 6115 gene locus_tag LOCUS_23180 5750 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 9167 7092 gene locus_tag LOCUS_23190 gene tkt 9167 7092 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_23190 12187 9320 gene locus_tag LOCUS_23200 12187 9320 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_23200 13018 14040 gene locus_tag LOCUS_23210 13018 14040 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063785.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23210 14345 15712 gene locus_tag LOCUS_23220 14345 15712 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_23220 15771 16271 gene locus_tag LOCUS_23230 15771 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 16666 17415 gene locus_tag LOCUS_23240 gene kdsB 16666 17415 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_23240 17369 19057 gene locus_tag LOCUS_23250 17369 19057 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_23250 19140 19964 gene locus_tag LOCUS_23260 gene kdsA 19140 19964 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_23260 20337 20660 gene locus_tag LOCUS_23270 20337 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 20814 23261 gene locus_tag LOCUS_23280 20814 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 23757 24968 gene locus_tag LOCUS_23290 gene urtA 23757 24968 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889579.1 protein_id gnl|my_center|LOCUS_23290 25048 25959 gene locus_tag LOCUS_23300 gene urtB 25048 25959 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889580.1 protein_id gnl|my_center|LOCUS_23300 25965 27104 gene locus_tag LOCUS_23310 gene urtC 25965 27104 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889581.1 protein_id gnl|my_center|LOCUS_23310 27097 27861 gene locus_tag LOCUS_23320 gene urtD 27097 27861 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 protein_id gnl|my_center|LOCUS_23320 27848 28555 gene locus_tag LOCUS_23330 gene urtE 27848 28555 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889583.1 protein_id gnl|my_center|LOCUS_23330 30285 28567 gene locus_tag LOCUS_23340 30285 28567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 30992 31189 gene locus_tag LOCUS_23350 30992 31189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 31743 31423 gene locus_tag LOCUS_23360 31743 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 32163 33023 gene locus_tag LOCUS_23370 32163 33023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 34162 33479 gene locus_tag LOCUS_23380 34162 33479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 34386 35243 gene locus_tag LOCUS_23390 34386 35243 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_23390 36737 35451 gene locus_tag LOCUS_23400 gene ahcY 36737 35451 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_23400 38121 36943 gene locus_tag LOCUS_23410 gene metK 38121 36943 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_23410 38320 38111 gene locus_tag LOCUS_23420 38320 38111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 38675 38409 gene locus_tag LOCUS_23430 38675 38409 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_23430 38763 39044 gene locus_tag LOCUS_23440 38763 39044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 39436 40611 gene locus_tag LOCUS_23450 39436 40611 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192961.1 protein_id gnl|my_center|LOCUS_23450 42004 40754 gene locus_tag LOCUS_23460 42004 40754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086785.1 protein_id gnl|my_center|LOCUS_23460 42336 43379 gene locus_tag LOCUS_23470 42336 43379 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808659.1 protein_id gnl|my_center|LOCUS_23470 45632 43395 gene locus_tag LOCUS_23480 45632 43395 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392879.1 protein_id gnl|my_center|LOCUS_23480 46669 46205 gene locus_tag LOCUS_23490 46669 46205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 46866 48212 gene locus_tag LOCUS_23500 46866 48212 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_23500 49648 49118 gene locus_tag LOCUS_23510 49648 49118 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 protein_id gnl|my_center|LOCUS_23510 49635 49823 gene locus_tag LOCUS_23520 49635 49823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 50196 50672 gene locus_tag LOCUS_23530 50196 50672 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_23530 50894 51586 gene locus_tag LOCUS_23540 50894 51586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 52011 52673 gene locus_tag LOCUS_23550 52011 52673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 52720 54009 gene locus_tag LOCUS_23560 52720 54009 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393008.1 protein_id gnl|my_center|LOCUS_23560 54187 55251 gene locus_tag LOCUS_23570 54187 55251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 55566 57014 gene locus_tag LOCUS_23580 gene tldD 55566 57014 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268865.1 protein_id gnl|my_center|LOCUS_23580 57011 58381 gene locus_tag LOCUS_23590 57011 58381 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_23590 58452 58685 gene locus_tag LOCUS_23600 58452 58685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 59726 61471 gene locus_tag LOCUS_23610 59726 61471 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900757.1 protein_id gnl|my_center|LOCUS_23610 61817 61524 gene locus_tag LOCUS_23620 gene rpsT 61817 61524 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_23620 62734 61919 gene locus_tag LOCUS_23630 62734 61919 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_23630 63672 62845 gene locus_tag LOCUS_23640 gene mazG 63672 62845 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_23640 64062 67142 gene locus_tag LOCUS_23650 64062 67142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 67147 68061 gene locus_tag LOCUS_23660 67147 68061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 68128 68673 gene locus_tag LOCUS_23670 68128 68673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 68670 68897 gene locus_tag LOCUS_23680 68670 68897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 68890 69648 gene locus_tag LOCUS_23690 68890 69648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 70379 70879 gene locus_tag LOCUS_23700 gene rfaH 70379 70879 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703997.1 protein_id gnl|my_center|LOCUS_23700 71163 71702 gene locus_tag LOCUS_23710 71163 71702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 72045 73334 gene locus_tag LOCUS_23720 72045 73334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 73343 75649 gene locus_tag LOCUS_23730 73343 75649 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_23730 75818 78475 gene locus_tag LOCUS_23740 75818 78475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 78526 79821 gene locus_tag LOCUS_23750 gene wcaI 78526 79821 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 protein_id gnl|my_center|LOCUS_23750 79824 80816 gene locus_tag LOCUS_23760 79824 80816 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_23760 81018 82397 gene locus_tag LOCUS_23770 81018 82397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 82405 83781 gene locus_tag LOCUS_23780 82405 83781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 83697 83963 gene locus_tag LOCUS_23790 83697 83963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 83927 84211 gene locus_tag LOCUS_23800 83927 84211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 84264 84923 gene locus_tag LOCUS_23810 84264 84923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 85248 86168 gene locus_tag LOCUS_23820 85248 86168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 86330 87658 gene locus_tag LOCUS_23830 86330 87658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 87679 88950 gene locus_tag LOCUS_23840 87679 88950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 89042 89896 gene locus_tag LOCUS_23850 89042 89896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 89884 91053 gene locus_tag LOCUS_23860 89884 91053 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_23860 91050 92483 gene locus_tag LOCUS_23870 91050 92483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 92524 93204 gene locus_tag LOCUS_23880 92524 93204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 93191 94429 gene locus_tag LOCUS_23890 93191 94429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 94517 95671 gene locus_tag LOCUS_23900 94517 95671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 95690 96598 gene locus_tag LOCUS_23910 95690 96598 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 protein_id gnl|my_center|LOCUS_23910 96841 97569 gene locus_tag LOCUS_23920 96841 97569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 97566 98426 gene locus_tag LOCUS_23930 97566 98426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 98432 99253 gene locus_tag LOCUS_23940 98432 99253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 99868 100998 gene locus_tag LOCUS_23950 99868 100998 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_23950 100995 101177 gene locus_tag LOCUS_23960 100995 101177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 101195 101419 gene locus_tag LOCUS_23970 101195 101419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23970 101489 101989 gene locus_tag LOCUS_23980 101489 101989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 103104 102439 gene locus_tag LOCUS_23990 103104 102439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 104045 103575 gene locus_tag LOCUS_24000 104045 103575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 105414 104881 gene locus_tag LOCUS_24010 105414 104881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 105606 106355 gene locus_tag LOCUS_24020 105606 106355 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_24020 106693 107247 gene locus_tag LOCUS_24030 gene ruvC 106693 107247 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112575.1 protein_id gnl|my_center|LOCUS_24030 107382 108263 gene locus_tag LOCUS_24040 107382 108263 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_24040 108375 108983 gene locus_tag LOCUS_24050 gene ruvA 108375 108983 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365989.1 protein_id gnl|my_center|LOCUS_24050 108973 110046 gene locus_tag LOCUS_24060 gene ruvB 108973 110046 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_24060 110247 110504 gene locus_tag LOCUS_24070 110247 110504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 110987 110655 gene locus_tag LOCUS_24080 110987 110655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 111237 110977 gene locus_tag LOCUS_24090 111237 110977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence15 1217 552 gene locus_tag LOCUS_24100 1217 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2173 1214 gene locus_tag LOCUS_24110 2173 1214 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_24110 2970 2170 gene locus_tag LOCUS_24120 2970 2170 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_24120 4173 3016 gene locus_tag LOCUS_24130 4173 3016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_24130 6637 5396 gene locus_tag LOCUS_24140 6637 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 8189 6873 gene locus_tag LOCUS_24150 8189 6873 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_24150 10018 8369 gene locus_tag LOCUS_24160 10018 8369 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_24160 11054 10815 gene locus_tag LOCUS_24170 11054 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 10942 11334 gene locus_tag LOCUS_24180 10942 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 12072 11662 gene locus_tag LOCUS_24190 12072 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393169.1 protein_id gnl|my_center|LOCUS_24190 13363 12236 gene locus_tag LOCUS_24200 13363 12236 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_24200 13847 13377 gene locus_tag LOCUS_24210 13847 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 15461 13974 gene locus_tag LOCUS_24220 15461 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_24220 16746 15448 gene locus_tag LOCUS_24230 16746 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 16893 17231 gene locus_tag LOCUS_24240 16893 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24240 17197 17694 gene locus_tag LOCUS_24250 17197 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24250 17920 18450 gene locus_tag LOCUS_24260 17920 18450 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_24260 19925 18498 gene locus_tag LOCUS_24270 19925 18498 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_24270 20105 21883 gene locus_tag LOCUS_24280 20105 21883 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_24280 21890 22720 gene locus_tag LOCUS_24290 21890 22720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 22928 23548 gene locus_tag LOCUS_24300 22928 23548 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615057.1 protein_id gnl|my_center|LOCUS_24300 23941 24690 gene locus_tag LOCUS_24310 23941 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 24781 24704 gene locus_tag LOCUS_t00330 24781 24704 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24857 24784 gene locus_tag LOCUS_t00340 24857 24784 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25127 25681 gene locus_tag LOCUS_24320 25127 25681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 27021 25621 gene locus_tag LOCUS_24330 27021 25621 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_24330 28273 27491 gene locus_tag LOCUS_24340 28273 27491 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_24340 29212 29045 gene locus_tag LOCUS_24350 29212 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 29693 29355 gene locus_tag LOCUS_24360 29693 29355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 30172 30618 gene locus_tag LOCUS_24370 30172 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 30972 32093 gene locus_tag LOCUS_24380 30972 32093 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_24380 32189 33019 gene locus_tag LOCUS_24390 32189 33019 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_24390 33212 34063 gene locus_tag LOCUS_24400 33212 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 34842 35141 gene locus_tag LOCUS_24410 34842 35141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 35975 35403 gene locus_tag LOCUS_24420 35975 35403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 36532 35972 gene locus_tag LOCUS_24430 36532 35972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 37323 38390 gene locus_tag LOCUS_24440 37323 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 38716 40152 gene locus_tag LOCUS_24450 38716 40152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 42128 40533 gene locus_tag LOCUS_24460 42128 40533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 42592 42173 gene locus_tag LOCUS_24470 42592 42173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 42810 42589 gene locus_tag LOCUS_24480 42810 42589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 43394 43807 gene locus_tag LOCUS_24490 43394 43807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 44063 45922 gene locus_tag LOCUS_24500 44063 45922 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_24500 46871 48787 gene locus_tag LOCUS_24510 46871 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 48784 49425 gene locus_tag LOCUS_24520 48784 49425 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_24520 50167 51093 gene locus_tag LOCUS_24530 50167 51093 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966251.1 protein_id gnl|my_center|LOCUS_24530 51478 51918 gene locus_tag LOCUS_24540 51478 51918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 51935 52210 gene locus_tag LOCUS_24550 51935 52210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 52538 52278 gene locus_tag LOCUS_24560 52538 52278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 52665 53465 gene locus_tag LOCUS_24570 52665 53465 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090560.1 protein_id gnl|my_center|LOCUS_24570 54061 53606 gene locus_tag LOCUS_24580 54061 53606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 54077 54232 gene locus_tag LOCUS_24590 54077 54232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 56046 54385 gene locus_tag LOCUS_24600 56046 54385 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_24600 56760 56059 gene locus_tag LOCUS_24610 gene gldF 56760 56059 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_24610 57749 56757 gene locus_tag LOCUS_24620 57749 56757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_24620 58838 57933 gene locus_tag LOCUS_24630 58838 57933 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_24630 59097 59498 gene locus_tag LOCUS_24640 59097 59498 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_24640 60809 59592 gene locus_tag LOCUS_24650 60809 59592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 62211 60952 gene locus_tag LOCUS_24660 62211 60952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 62584 63543 gene locus_tag LOCUS_24670 62584 63543 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926995.1 protein_id gnl|my_center|LOCUS_24670 63843 64823 gene locus_tag LOCUS_24680 gene cbiB 63843 64823 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 protein_id gnl|my_center|LOCUS_24680 64917 65990 gene locus_tag LOCUS_24690 gene cobT 64917 65990 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_24690 66147 66950 gene locus_tag LOCUS_24700 gene cobS 66147 66950 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086039.1 protein_id gnl|my_center|LOCUS_24700 67620 67087 gene locus_tag LOCUS_24710 gene cobU 67620 67087 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_24710 70696 67661 gene locus_tag LOCUS_24720 gene glnE 70696 67661 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_24720 72028 70934 gene locus_tag LOCUS_24730 72028 70934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 72544 72242 gene locus_tag LOCUS_24740 72544 72242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 72531 72806 gene locus_tag LOCUS_24750 72531 72806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 73166 74452 gene locus_tag LOCUS_24760 gene aroA 73166 74452 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_24760 75010 74624 gene locus_tag LOCUS_24770 gene gloA 75010 74624 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_24770 75762 75544 gene locus_tag LOCUS_24780 75762 75544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 75818 76000 gene locus_tag LOCUS_24790 75818 76000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 76903 76025 gene locus_tag LOCUS_24800 76903 76025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186242.1 protein_id gnl|my_center|LOCUS_24800 77222 77545 gene locus_tag LOCUS_24810 77222 77545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 77863 78138 gene locus_tag LOCUS_24820 77863 78138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 78197 78388 gene locus_tag LOCUS_24830 78197 78388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 78495 78421 gene locus_tag LOCUS_t00350 78495 78421 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 80095 78824 gene locus_tag LOCUS_24840 80095 78824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 80527 80198 gene locus_tag LOCUS_24850 80527 80198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 81382 80906 gene locus_tag LOCUS_24860 81382 80906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 81784 83373 gene locus_tag LOCUS_24870 81784 83373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 83795 83433 gene locus_tag LOCUS_24880 83795 83433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 84714 83986 gene locus_tag LOCUS_24890 gene bluB 84714 83986 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_24890 85277 84750 gene locus_tag LOCUS_24900 gene tpx 85277 84750 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_24900 86682 86032 gene locus_tag LOCUS_24910 86682 86032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 87404 86736 gene locus_tag LOCUS_24920 87404 86736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142256.1 protein_id gnl|my_center|LOCUS_24920 88449 87805 gene locus_tag LOCUS_24930 88449 87805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 89357 88521 gene locus_tag LOCUS_24940 89357 88521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 89886 89659 gene locus_tag LOCUS_24950 89886 89659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 91146 90076 gene locus_tag LOCUS_24960 91146 90076 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_24960 92050 91187 gene locus_tag LOCUS_24970 92050 91187 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_24970 92425 94470 gene locus_tag LOCUS_24980 92425 94470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 94620 94943 gene locus_tag LOCUS_24990 94620 94943 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_24990 94970 95599 gene locus_tag LOCUS_25000 gene recR 94970 95599 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940773.1 protein_id gnl|my_center|LOCUS_25000 95996 95667 gene locus_tag LOCUS_25010 95996 95667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 96607 97437 gene locus_tag LOCUS_25020 96607 97437 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_25020 97666 99216 gene locus_tag LOCUS_25030 97666 99216 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_25030 99371 100885 gene locus_tag LOCUS_25040 99371 100885 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_25040 100901 101398 gene locus_tag LOCUS_25050 100901 101398 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879577.1 protein_id gnl|my_center|LOCUS_25050 101411 103099 gene locus_tag LOCUS_25060 101411 103099 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_25060 103594 104157 gene locus_tag LOCUS_25070 103594 104157 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_25070 108200 104856 gene locus_tag LOCUS_25080 108200 104856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 109354 108608 gene locus_tag LOCUS_25090 109354 108608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 109878 110840 gene locus_tag LOCUS_25100 109878 110840 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947606.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence16 747 496 gene locus_tag LOCUS_25110 747 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 955 1173 gene locus_tag LOCUS_25120 955 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1170 1358 gene locus_tag LOCUS_25130 1170 1358 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_25130 1370 4768 gene locus_tag LOCUS_25140 1370 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 5282 4932 gene locus_tag LOCUS_25150 5282 4932 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_25150 5778 5314 gene locus_tag LOCUS_25160 5778 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6075 7748 gene locus_tag LOCUS_25170 gene ilvD 6075 7748 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_25170 10008 7921 gene locus_tag LOCUS_25180 10008 7921 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_25180 10338 12122 gene locus_tag LOCUS_25190 10338 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 13388 12243 gene locus_tag LOCUS_25200 gene dnaN 13388 12243 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_25200 14993 13623 gene locus_tag LOCUS_25210 gene dnaA 14993 13623 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_25210 15546 16844 gene locus_tag LOCUS_25220 gene hemL 15546 16844 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_25220 16896 17087 gene locus_tag LOCUS_25230 16896 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 17205 17597 gene locus_tag LOCUS_25240 17205 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 17622 18305 gene locus_tag LOCUS_25250 gene atpB 17622 18305 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_25250 18411 18749 gene locus_tag LOCUS_25260 18411 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 19786 19004 gene locus_tag LOCUS_25270 19786 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 20011 22404 gene locus_tag LOCUS_25280 20011 22404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 25180 22847 gene locus_tag LOCUS_25290 25180 22847 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880789.1 protein_id gnl|my_center|LOCUS_25290 25283 26893 gene locus_tag LOCUS_25300 25283 26893 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_25300 27190 27813 gene locus_tag LOCUS_25310 27190 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 29283 27853 gene locus_tag LOCUS_25320 gene fumC 29283 27853 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948622.1 protein_id gnl|my_center|LOCUS_25320 29907 30263 gene locus_tag LOCUS_25330 29907 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 31378 30503 gene locus_tag LOCUS_25340 31378 30503 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_25340 31689 32549 gene locus_tag LOCUS_25350 31689 32549 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_25350 32769 35234 gene locus_tag LOCUS_25360 32769 35234 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_25360 36183 36419 gene locus_tag LOCUS_25370 36183 36419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 36618 37994 gene locus_tag LOCUS_25380 36618 37994 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_25380 38703 38008 gene locus_tag LOCUS_25390 gene scnC 38703 38008 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_25390 39045 38734 gene locus_tag LOCUS_25400 39045 38734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 39464 39042 gene locus_tag LOCUS_25410 39464 39042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 40010 39816 gene locus_tag LOCUS_25420 40010 39816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 40331 41356 gene locus_tag LOCUS_25430 gene recA 40331 41356 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_25430 41518 44175 gene locus_tag LOCUS_25440 gene alaS 41518 44175 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_25440 44402 45307 gene locus_tag LOCUS_25450 44402 45307 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_25450 45504 46022 gene locus_tag LOCUS_25460 45504 46022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 46019 46573 gene locus_tag LOCUS_25470 46019 46573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 46577 48190 gene locus_tag LOCUS_25480 gene lnt 46577 48190 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_25480 48544 49572 gene locus_tag LOCUS_25490 gene prfB 48544 49572 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_25490 50104 49727 gene locus_tag LOCUS_25500 50104 49727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 50879 50298 gene locus_tag LOCUS_25510 50879 50298 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_25510 51784 51233 gene locus_tag LOCUS_25520 51784 51233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 52352 51774 gene locus_tag LOCUS_25530 52352 51774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 52949 52371 gene locus_tag LOCUS_25540 52949 52371 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_25540 55618 52985 gene locus_tag LOCUS_25550 gene polA 55618 52985 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_25550 56313 55987 gene locus_tag LOCUS_25560 56313 55987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 56936 56589 gene locus_tag LOCUS_25570 56936 56589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 57618 57058 gene locus_tag LOCUS_25580 57618 57058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 57984 59129 gene locus_tag LOCUS_25590 gene dprA 57984 59129 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_25590 59204 61564 gene locus_tag LOCUS_25600 gene topA 59204 61564 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_25600 61707 62453 gene locus_tag LOCUS_25610 61707 62453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 62461 62646 gene locus_tag LOCUS_25620 62461 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 63318 63172 gene locus_tag LOCUS_25630 63318 63172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 63304 64530 gene locus_tag LOCUS_25640 gene trmFO 63304 64530 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_25640 64701 65627 gene locus_tag LOCUS_25650 64701 65627 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926799.1 protein_id gnl|my_center|LOCUS_25650 65958 67448 gene locus_tag LOCUS_25660 65958 67448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 68023 67583 gene locus_tag LOCUS_25670 68023 67583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 69054 68245 gene locus_tag LOCUS_25680 gene thyX 69054 68245 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939529.1 protein_id gnl|my_center|LOCUS_25680 69412 70605 gene locus_tag LOCUS_25690 69412 70605 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_25690 70790 71692 gene locus_tag LOCUS_25700 70790 71692 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_25700 71806 71878 gene locus_tag LOCUS_t00360 71806 71878 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 72142 72438 gene locus_tag LOCUS_25710 72142 72438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25710 73315 74634 gene locus_tag LOCUS_25720 73315 74634 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195503.1 protein_id gnl|my_center|LOCUS_25720 74723 75823 gene locus_tag LOCUS_25730 74723 75823 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_25730 76298 77596 gene locus_tag LOCUS_25740 76298 77596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 77619 78401 gene locus_tag LOCUS_25750 77619 78401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_25750 78398 79114 gene locus_tag LOCUS_25760 78398 79114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_25760 79123 80001 gene locus_tag LOCUS_25770 79123 80001 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970223.1 protein_id gnl|my_center|LOCUS_25770 80022 81119 gene locus_tag LOCUS_25780 80022 81119 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_25780 81116 82222 gene locus_tag LOCUS_25790 gene ald 81116 82222 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_25790 82800 83321 gene locus_tag LOCUS_25800 82800 83321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 84589 84125 gene locus_tag LOCUS_25810 84589 84125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 85620 84667 gene locus_tag LOCUS_25820 85620 84667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 86186 85623 gene locus_tag LOCUS_25830 86186 85623 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_25830 86872 89307 gene locus_tag LOCUS_25840 86872 89307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 89696 90103 gene locus_tag LOCUS_25850 89696 90103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 90527 90453 gene locus_tag LOCUS_t00370 90527 90453 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 177 701 gene locus_tag LOCUS_25860 177 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1177 1344 gene locus_tag LOCUS_25870 1177 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3425 2256 gene locus_tag LOCUS_25880 3425 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 8989 3428 gene locus_tag LOCUS_25890 8989 3428 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970454.1 protein_id gnl|my_center|LOCUS_25890 9945 8986 gene locus_tag LOCUS_25900 9945 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 11264 9942 gene locus_tag LOCUS_25910 11264 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 11716 11507 gene locus_tag LOCUS_25920 11716 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 11637 12032 gene locus_tag LOCUS_25930 11637 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 12828 12055 gene locus_tag LOCUS_25940 12828 12055 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867788.1 protein_id gnl|my_center|LOCUS_25940 13729 13992 gene locus_tag LOCUS_25950 13729 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 14204 14446 gene locus_tag LOCUS_25960 14204 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 15464 14487 gene locus_tag LOCUS_25970 15464 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 16264 15461 gene locus_tag LOCUS_25980 16264 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 17226 16531 gene locus_tag LOCUS_25990 17226 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 17368 17676 gene locus_tag LOCUS_26000 17368 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 17701 19023 gene locus_tag LOCUS_26010 17701 19023 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_26010 19020 19412 gene locus_tag LOCUS_26020 19020 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 19496 19822 gene locus_tag LOCUS_26030 19496 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384762.1 protein_id gnl|my_center|LOCUS_26030 19848 20186 gene locus_tag LOCUS_26040 19848 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 21586 20288 gene locus_tag LOCUS_26050 21586 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 21808 21611 gene locus_tag LOCUS_26060 21808 21611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 22570 21827 gene locus_tag LOCUS_26070 22570 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 25094 22590 gene locus_tag LOCUS_26080 25094 22590 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_26080 25452 25111 gene locus_tag LOCUS_26090 25452 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 25819 25472 gene locus_tag LOCUS_26100 25819 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 26064 25816 gene locus_tag LOCUS_26110 26064 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 27030 26068 gene locus_tag LOCUS_26120 gene trbB 27030 26068 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633597.1 protein_id gnl|my_center|LOCUS_26120 27404 27027 gene locus_tag LOCUS_26130 27404 27027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 29499 27670 gene locus_tag LOCUS_26140 29499 27670 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645922.1 protein_id gnl|my_center|LOCUS_26140 30524 29505 gene locus_tag LOCUS_26150 30524 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 30897 30496 gene locus_tag LOCUS_26160 30897 30496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 31421 30903 gene locus_tag LOCUS_26170 gene traF 31421 30903 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002726.1 protein_id gnl|my_center|LOCUS_26170 31963 31694 gene locus_tag LOCUS_26180 31963 31694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 33178 32027 gene locus_tag LOCUS_26190 33178 32027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 34152 33184 gene locus_tag LOCUS_26200 gene trbG 34152 33184 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_26200 34829 34149 gene locus_tag LOCUS_26210 gene trbF 34829 34149 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 protein_id gnl|my_center|LOCUS_26210 35102 35455 gene locus_tag LOCUS_26220 35102 35455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 35502 35828 gene locus_tag LOCUS_26230 35502 35828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 36077 36002 gene locus_tag LOCUS_t00380 36077 36002 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36658 38307 gene locus_tag LOCUS_26240 36658 38307 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_26240 39229 38750 gene locus_tag LOCUS_26250 39229 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 39611 39261 gene locus_tag LOCUS_26260 39611 39261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 40272 39613 gene locus_tag LOCUS_26270 40272 39613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 40511 40435 gene locus_tag LOCUS_t00390 40511 40435 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 42290 40593 gene locus_tag LOCUS_26280 gene recN 42290 40593 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_26280 43118 42306 gene locus_tag LOCUS_26290 43118 42306 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_26290 43405 44286 gene locus_tag LOCUS_26300 43405 44286 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_26300 44374 45378 gene locus_tag LOCUS_26310 gene trpS 44374 45378 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887736.1 protein_id gnl|my_center|LOCUS_26310 46676 45444 gene locus_tag LOCUS_26320 46676 45444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268578.1 protein_id gnl|my_center|LOCUS_26320 47685 46921 gene locus_tag LOCUS_26330 47685 46921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 49266 47794 gene locus_tag LOCUS_26340 gene proS 49266 47794 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_26340 52878 49783 gene locus_tag LOCUS_26350 52878 49783 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_26350 54016 52889 gene locus_tag LOCUS_26360 54016 52889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 55266 54013 gene locus_tag LOCUS_26370 55266 54013 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_26370 56311 55877 gene locus_tag LOCUS_26380 56311 55877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 59148 56542 gene locus_tag LOCUS_26390 gene clpB 59148 56542 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_26390 59486 59947 gene locus_tag LOCUS_26400 59486 59947 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_26400 60066 62414 gene locus_tag LOCUS_26410 60066 62414 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_26410 62420 63289 gene locus_tag LOCUS_26420 62420 63289 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_26420 63321 63851 gene locus_tag LOCUS_26430 63321 63851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 64342 64788 gene locus_tag LOCUS_26440 64342 64788 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_26440 65219 64896 gene locus_tag LOCUS_26450 65219 64896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 65109 66095 gene locus_tag LOCUS_26460 gene serS 65109 66095 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_26460 66324 67352 gene locus_tag LOCUS_26470 gene pstC 66324 67352 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371940.1 protein_id gnl|my_center|LOCUS_26470 67349 68221 gene locus_tag LOCUS_26480 gene pstA 67349 68221 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_26480 68229 68987 gene locus_tag LOCUS_26490 gene pstB 68229 68987 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_26490 69019 69708 gene locus_tag LOCUS_26500 gene phoU 69019 69708 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_26500 69705 70442 gene locus_tag LOCUS_26510 69705 70442 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_26510 70435 71850 gene locus_tag LOCUS_26520 70435 71850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 72010 72714 gene locus_tag LOCUS_26530 gene ubiE 72010 72714 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_26530 74020 72764 gene locus_tag LOCUS_26540 74020 72764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 75458 75213 gene locus_tag LOCUS_26550 75458 75213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 76197 75526 gene locus_tag LOCUS_26560 76197 75526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 77058 76983 gene locus_tag LOCUS_t00400 77058 76983 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 77590 78282 gene locus_tag LOCUS_26570 77590 78282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 78430 79737 gene locus_tag LOCUS_26580 gene thiC 78430 79737 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_26580 79727 80212 gene locus_tag LOCUS_26590 gene bcp 79727 80212 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_26590 80285 81511 gene locus_tag LOCUS_26600 80285 81511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 81637 82326 gene locus_tag LOCUS_26610 gene cobC 81637 82326 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_26610 82714 84240 gene locus_tag LOCUS_26620 82714 84240 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071251.1 protein_id gnl|my_center|LOCUS_26620 84351 85487 gene locus_tag LOCUS_26630 84351 85487 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence18 766 131 gene locus_tag LOCUS_26640 766 131 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_26640 2508 1183 gene locus_tag LOCUS_26650 2508 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2653 2489 gene locus_tag LOCUS_26660 2653 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3508 2993 gene locus_tag LOCUS_26670 3508 2993 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389623.1 protein_id gnl|my_center|LOCUS_26670 4873 3620 gene locus_tag LOCUS_26680 4873 3620 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_26680 6615 5158 gene locus_tag LOCUS_26690 6615 5158 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_26690 7405 6662 gene locus_tag LOCUS_26700 7405 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 8230 7421 gene locus_tag LOCUS_26710 8230 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 9147 8254 gene locus_tag LOCUS_26720 gene nadC 9147 8254 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942603.1 protein_id gnl|my_center|LOCUS_26720 9502 9882 gene locus_tag LOCUS_26730 9502 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 10063 10815 gene locus_tag LOCUS_26740 10063 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085649.1 protein_id gnl|my_center|LOCUS_26740 11492 12856 gene locus_tag LOCUS_26750 11492 12856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087600.1 protein_id gnl|my_center|LOCUS_26750 13056 13697 gene locus_tag LOCUS_26760 13056 13697 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_26760 14437 14613 gene locus_tag LOCUS_26770 14437 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 15222 16355 gene locus_tag LOCUS_26780 15222 16355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_26780 16795 16370 gene locus_tag LOCUS_26790 16795 16370 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772547.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26790 16956 16726 gene locus_tag LOCUS_26800 16956 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 17175 17029 gene locus_tag LOCUS_26810 17175 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 17690 18112 gene locus_tag LOCUS_26820 17690 18112 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_26820 18913 18296 gene locus_tag LOCUS_26830 18913 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 19960 19157 gene locus_tag LOCUS_26840 gene lptB 19960 19157 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_26840 21676 20069 gene locus_tag LOCUS_26850 gene hpxW 21676 20069 CDS product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 protein_id gnl|my_center|LOCUS_26850 22027 23139 gene locus_tag LOCUS_26860 22027 23139 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_26860 23133 23762 gene locus_tag LOCUS_26870 23133 23762 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_26870 23911 24270 gene locus_tag LOCUS_26880 23911 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 24267 24572 gene locus_tag LOCUS_26890 24267 24572 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_26890 25049 24771 gene locus_tag LOCUS_26900 25049 24771 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114441661.1 protein_id gnl|my_center|LOCUS_26900 25309 25046 gene locus_tag LOCUS_26910 25309 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 25915 26070 gene locus_tag LOCUS_26920 25915 26070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 26273 28720 gene locus_tag LOCUS_26930 26273 28720 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258659.1 protein_id gnl|my_center|LOCUS_26930 31011 28741 gene locus_tag LOCUS_26940 31011 28741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 32001 32591 gene locus_tag LOCUS_26950 32001 32591 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_26950 33595 32651 gene locus_tag LOCUS_26960 33595 32651 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519563.1 protein_id gnl|my_center|LOCUS_26960 34500 34802 gene locus_tag LOCUS_26970 gene ureA 34500 34802 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_26970 34847 35224 gene locus_tag LOCUS_26980 34847 35224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26980 35214 36932 gene locus_tag LOCUS_26990 gene ureC 35214 36932 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_26990 36949 37398 gene locus_tag LOCUS_27000 36949 37398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 37382 38077 gene locus_tag LOCUS_27010 37382 38077 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013380.1 protein_id gnl|my_center|LOCUS_27010 38074 38685 gene locus_tag LOCUS_27020 gene ureG 38074 38685 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_27020 38711 39511 gene locus_tag LOCUS_27030 38711 39511 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013381.1 protein_id gnl|my_center|LOCUS_27030 39682 39449 gene locus_tag LOCUS_27040 39682 39449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 40369 40791 gene locus_tag LOCUS_27050 40369 40791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 41728 42231 gene locus_tag LOCUS_27060 41728 42231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 42466 43485 gene locus_tag LOCUS_27070 42466 43485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 43831 45363 gene locus_tag LOCUS_27080 gene rfaE1 43831 45363 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_27080 45502 46515 gene locus_tag LOCUS_27090 gene gmd 45502 46515 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_27090 46784 47146 gene locus_tag LOCUS_27100 46784 47146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 47944 47609 gene locus_tag LOCUS_27110 gene mazF9 47944 47609 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_27110 48152 47931 gene locus_tag LOCUS_27120 48152 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 48894 50039 gene locus_tag LOCUS_27130 48894 50039 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267506.1 protein_id gnl|my_center|LOCUS_27130 50083 50673 gene locus_tag LOCUS_27140 50083 50673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 51027 52055 gene locus_tag LOCUS_27150 51027 52055 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_27150 52203 53708 gene locus_tag LOCUS_27160 52203 53708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 53757 54083 gene locus_tag LOCUS_27170 53757 54083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 54144 55796 gene locus_tag LOCUS_27180 54144 55796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 55910 56905 gene locus_tag LOCUS_27190 55910 56905 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_27190 57391 57708 gene locus_tag LOCUS_27200 57391 57708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 57856 58878 gene locus_tag LOCUS_27210 57856 58878 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_27210 59472 59137 gene locus_tag LOCUS_27220 59472 59137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 59574 59879 gene locus_tag LOCUS_27230 59574 59879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 59986 61380 gene locus_tag LOCUS_27240 59986 61380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 61998 62600 gene locus_tag LOCUS_27250 61998 62600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 62919 64145 gene locus_tag LOCUS_27260 gene fabF 62919 64145 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_27260 64159 65136 gene locus_tag LOCUS_27270 64159 65136 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_27270 65371 66384 gene locus_tag LOCUS_27280 65371 66384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 66718 67110 gene locus_tag LOCUS_27290 66718 67110 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_27290 68103 67267 gene locus_tag LOCUS_27300 68103 67267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 68344 68856 gene locus_tag LOCUS_27310 68344 68856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 69659 69021 gene locus_tag LOCUS_27320 69659 69021 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_27320 70885 69716 gene locus_tag LOCUS_27330 70885 69716 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_27330 71900 71094 gene locus_tag LOCUS_27340 71900 71094 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_27340 <72778 72251 gene locus_tag LOCUS_27350 <72778 72251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004553906.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence19 377 1702 gene locus_tag LOCUS_27360 377 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1925 2593 gene locus_tag LOCUS_27370 1925 2593 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_27370 2872 3897 gene locus_tag LOCUS_27380 2872 3897 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_27380 4105 4536 gene locus_tag LOCUS_27390 4105 4536 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086163.1 protein_id gnl|my_center|LOCUS_27390 5074 4655 gene locus_tag LOCUS_27400 gene cadR 5074 4655 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_27400 5984 5418 gene locus_tag LOCUS_27410 5984 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 6262 6050 gene locus_tag LOCUS_27420 6262 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 6784 7248 gene locus_tag LOCUS_27430 6784 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 7426 7836 gene locus_tag LOCUS_27440 7426 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 10028 7983 gene locus_tag LOCUS_27450 10028 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 13807 10133 gene locus_tag LOCUS_27460 13807 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 17551 13820 gene locus_tag LOCUS_27470 17551 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 18927 17743 gene locus_tag LOCUS_27480 gene waaF 18927 17743 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088670.1 protein_id gnl|my_center|LOCUS_27480 19937 18996 gene locus_tag LOCUS_27490 gene fdhD 19937 18996 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084892.1 protein_id gnl|my_center|LOCUS_27490 21173 20172 gene locus_tag LOCUS_27500 21173 20172 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_27500 21507 22745 gene locus_tag LOCUS_27510 21507 22745 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_27510 23952 23029 gene locus_tag LOCUS_27520 gene fdhE 23952 23029 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551971.1 protein_id gnl|my_center|LOCUS_27520 24590 23958 gene locus_tag LOCUS_27530 24590 23958 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 protein_id gnl|my_center|LOCUS_27530 25625 24744 gene locus_tag LOCUS_27540 gene fdxH 25625 24744 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_27540 28709 25644 gene locus_tag LOCUS_27550 gene fdnG 28709 25644 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528945.1 transl_except (pos:complement(28122..28124),aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_27550 29403 30440 gene locus_tag LOCUS_27560 29403 30440 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897599.1 protein_id gnl|my_center|LOCUS_27560 30437 31474 gene locus_tag LOCUS_27570 30437 31474 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_27570 31458 32477 gene locus_tag LOCUS_27580 31458 32477 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_27580 32946 32596 gene locus_tag LOCUS_27590 32946 32596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 33011 33766 gene locus_tag LOCUS_27600 33011 33766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_27600 33763 34515 gene locus_tag LOCUS_27610 33763 34515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_27610 34581 35714 gene locus_tag LOCUS_27620 34581 35714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 35850 37109 gene locus_tag LOCUS_27630 gene bioF 35850 37109 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_27630 37269 38636 gene locus_tag LOCUS_27640 gene bioA 37269 38636 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_27640 38653 39336 gene locus_tag LOCUS_27650 gene bioD 38653 39336 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035832.1 protein_id gnl|my_center|LOCUS_27650 39749 40030 gene locus_tag LOCUS_27660 39749 40030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 40047 40319 gene locus_tag LOCUS_27670 40047 40319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 41509 40247 gene locus_tag LOCUS_27680 gene tyrS 41509 40247 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_27680 42201 41545 gene locus_tag LOCUS_27690 gene pth 42201 41545 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_27690 43675 42503 gene locus_tag LOCUS_27700 gene hisC 43675 42503 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_27700 44127 43705 gene locus_tag LOCUS_27710 44127 43705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 45181 44423 gene locus_tag LOCUS_27720 45181 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 48390 45202 gene locus_tag LOCUS_27730 48390 45202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 51077 49032 gene locus_tag LOCUS_27740 gene tkt 51077 49032 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_27740 52357 51440 gene locus_tag LOCUS_27750 gene cbbX 52357 51440 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532058.1 protein_id gnl|my_center|LOCUS_27750 52775 52347 gene locus_tag LOCUS_27760 52775 52347 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_27760 54248 52791 gene locus_tag LOCUS_27770 54248 52791 CDS product ribulose-bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532056.1 protein_id gnl|my_center|LOCUS_27770 56451 54286 gene locus_tag LOCUS_27780 56451 54286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 56601 57545 gene locus_tag LOCUS_27790 56601 57545 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_27790 61153 57626 gene locus_tag LOCUS_27800 gene metH 61153 57626 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_27800 61869 62168 gene locus_tag LOCUS_27810 61869 62168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 62161 62649 gene locus_tag LOCUS_27820 62161 62649 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388577.1 protein_id gnl|my_center|LOCUS_27820 62646 64589 gene locus_tag LOCUS_27830 62646 64589 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_27830 64803 65000 gene locus_tag LOCUS_27840 64803 65000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 65102 66124 gene locus_tag LOCUS_27850 65102 66124 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389035.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence20 542 1456 gene locus_tag LOCUS_27860 gene pqqB 542 1456 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269163.1 protein_id gnl|my_center|LOCUS_27860 1485 2213 gene locus_tag LOCUS_27870 gene pqqC 1485 2213 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_27870 2217 2501 gene locus_tag LOCUS_27880 gene pqqD 2217 2501 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_27880 2464 3624 gene locus_tag LOCUS_27890 gene pqqE 2464 3624 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206724.1 protein_id gnl|my_center|LOCUS_27890 3635 4651 gene locus_tag LOCUS_27900 3635 4651 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_27900 4657 5463 gene locus_tag LOCUS_27910 4657 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 5827 5495 gene locus_tag LOCUS_27920 5827 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 5729 8401 gene locus_tag LOCUS_27930 5729 8401 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_27930 8910 8755 gene locus_tag LOCUS_27940 8910 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 9460 8921 gene locus_tag LOCUS_27950 9460 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 9664 9464 gene locus_tag LOCUS_27960 9664 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 9657 10079 gene locus_tag LOCUS_27970 9657 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 10495 10109 gene locus_tag LOCUS_27980 10495 10109 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_27980 11664 10492 gene locus_tag LOCUS_27990 gene qmoC 11664 10492 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_27990 13800 11665 gene locus_tag LOCUS_28000 13800 11665 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_28000 15178 13802 gene locus_tag LOCUS_28010 15178 13802 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_28010 17250 15376 gene locus_tag LOCUS_28020 gene aprA 17250 15376 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_28020 17873 17427 gene locus_tag LOCUS_28030 gene aprB 17873 17427 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_28030 19219 18017 gene locus_tag LOCUS_28040 gene sat 19219 18017 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_28040 20598 19366 gene locus_tag LOCUS_28050 gene frc 20598 19366 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_28050 22447 20735 gene locus_tag LOCUS_28060 22447 20735 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_28060 23230 22484 gene locus_tag LOCUS_28070 23230 22484 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_28070 24075 23362 gene locus_tag LOCUS_28080 24075 23362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227998.1 protein_id gnl|my_center|LOCUS_28080 25337 27154 gene locus_tag LOCUS_28090 gene kdpA 25337 27154 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966943.1 protein_id gnl|my_center|LOCUS_28090 27218 29383 gene locus_tag LOCUS_28100 gene kdpB 27218 29383 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_28100 29412 30428 gene locus_tag LOCUS_28110 29412 30428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 30430 31917 gene locus_tag LOCUS_28120 30430 31917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 32122 33930 gene locus_tag LOCUS_28130 32122 33930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940591.1 protein_id gnl|my_center|LOCUS_28130 33909 35240 gene locus_tag LOCUS_28140 gene algB 33909 35240 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_28140 36752 35616 gene locus_tag LOCUS_28150 36752 35616 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_28150 38137 36749 gene locus_tag LOCUS_28160 38137 36749 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243930.1 protein_id gnl|my_center|LOCUS_28160 38390 39904 gene locus_tag LOCUS_28170 38390 39904 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_28170 40215 39877 gene locus_tag LOCUS_28180 40215 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 40219 41580 gene locus_tag LOCUS_28190 40219 41580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 41788 42672 gene locus_tag LOCUS_28200 41788 42672 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_28200 42669 44693 gene locus_tag LOCUS_28210 42669 44693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 44680 45378 gene locus_tag LOCUS_28220 44680 45378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_28220 45420 46520 gene locus_tag LOCUS_28230 45420 46520 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_28230 47438 46785 gene locus_tag LOCUS_28240 47438 46785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 48860 47670 gene locus_tag LOCUS_28250 48860 47670 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089687.1 protein_id gnl|my_center|LOCUS_28250 49421 48900 gene locus_tag LOCUS_28260 49421 48900 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040338.1 protein_id gnl|my_center|LOCUS_28260 50077 49433 gene locus_tag LOCUS_28270 50077 49433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 50927 50040 gene locus_tag LOCUS_28280 50927 50040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 51141 52277 gene locus_tag LOCUS_28290 51141 52277 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 protein_id gnl|my_center|LOCUS_28290 52533 52970 gene locus_tag LOCUS_28300 52533 52970 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023884.1 protein_id gnl|my_center|LOCUS_28300 53977 52967 gene locus_tag LOCUS_28310 53977 52967 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979108.1 protein_id gnl|my_center|LOCUS_28310 54335 54643 gene locus_tag LOCUS_28320 54335 54643 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918377.1 protein_id gnl|my_center|LOCUS_28320 54609 54866 gene locus_tag LOCUS_28330 54609 54866 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918376.1 protein_id gnl|my_center|LOCUS_28330 56202 57737 gene locus_tag LOCUS_28340 56202 57737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 57734 59104 gene locus_tag LOCUS_28350 57734 59104 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_28350 59437 59691 gene locus_tag LOCUS_28360 59437 59691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 59792 60124 gene locus_tag LOCUS_28370 59792 60124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 60193 60759 gene locus_tag LOCUS_28380 60193 60759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 60834 63158 gene locus_tag LOCUS_28390 60834 63158 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391988.1 protein_id gnl|my_center|LOCUS_28390 63192 63914 gene locus_tag LOCUS_28400 63192 63914 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_28400 63883 65214 gene locus_tag LOCUS_28410 gene nrfD 63883 65214 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence21 1209 283 gene locus_tag LOCUS_28420 gene arcC 1209 283 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_28420 2375 1365 gene locus_tag LOCUS_28430 2375 1365 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_28430 2843 2394 gene locus_tag LOCUS_28440 2843 2394 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_28440 4459 2840 gene locus_tag LOCUS_28450 gene fdrA 4459 2840 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_28450 5804 4464 gene locus_tag LOCUS_28460 5804 4464 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_28460 8218 5858 gene locus_tag LOCUS_28470 8218 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 9801 8203 gene locus_tag LOCUS_28480 gene argH 9801 8203 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331319.1 protein_id gnl|my_center|LOCUS_28480 10568 9798 gene locus_tag LOCUS_28490 10568 9798 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_28490 11625 10645 gene locus_tag LOCUS_28500 11625 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 12076 11768 gene locus_tag LOCUS_28510 12076 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 12117 13745 gene locus_tag LOCUS_28520 12117 13745 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169351683.1 protein_id gnl|my_center|LOCUS_28520 14576 15763 gene locus_tag LOCUS_28530 14576 15763 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_28530 15839 16291 gene locus_tag LOCUS_28540 15839 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 17589 16966 gene locus_tag LOCUS_28550 17589 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28550 18504 17599 gene locus_tag LOCUS_28560 18504 17599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28560 20036 19071 gene locus_tag LOCUS_28570 20036 19071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533021.1 protein_id gnl|my_center|LOCUS_28570 21109 20093 gene locus_tag LOCUS_28580 21109 20093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533020.1 protein_id gnl|my_center|LOCUS_28580 22757 21096 gene locus_tag LOCUS_28590 22757 21096 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969241.1 protein_id gnl|my_center|LOCUS_28590 23896 22754 gene locus_tag LOCUS_28600 23896 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 24738 24217 gene locus_tag LOCUS_28610 24738 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28610 25135 24785 gene locus_tag LOCUS_28620 25135 24785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 26358 25144 gene locus_tag LOCUS_28630 26358 25144 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_28630 27474 26413 gene locus_tag LOCUS_28640 27474 26413 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967142.1 protein_id gnl|my_center|LOCUS_28640 27535 28290 gene locus_tag LOCUS_28650 27535 28290 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 protein_id gnl|my_center|LOCUS_28650 30013 29624 gene locus_tag LOCUS_28660 30013 29624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211291926.1 protein_id gnl|my_center|LOCUS_28660 30590 30075 gene locus_tag LOCUS_28670 30590 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 31429 31064 gene locus_tag LOCUS_28680 31429 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 32224 31874 gene locus_tag LOCUS_28690 32224 31874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 32599 32231 gene locus_tag LOCUS_28700 32599 32231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 33337 32987 gene locus_tag LOCUS_28710 33337 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 34205 33414 gene locus_tag LOCUS_28720 34205 33414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 37133 34683 gene locus_tag LOCUS_28730 gene mrcB 37133 34683 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_28730 37721 38416 gene locus_tag LOCUS_28740 37721 38416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 40095 38686 gene locus_tag LOCUS_28750 40095 38686 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_28750 41969 40494 gene locus_tag LOCUS_28760 41969 40494 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_28760 43098 41959 gene locus_tag LOCUS_28770 43098 41959 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_28770 44050 43100 gene locus_tag LOCUS_28780 44050 43100 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_28780 44229 45089 gene locus_tag LOCUS_28790 44229 45089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 45668 45081 gene locus_tag LOCUS_28800 45668 45081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 46119 45718 gene locus_tag LOCUS_28810 46119 45718 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_28810 48224 46605 gene locus_tag LOCUS_28820 gene groL 48224 46605 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_28820 48617 48324 gene locus_tag LOCUS_28830 gene groES 48617 48324 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_28830 49169 48891 gene locus_tag LOCUS_28840 49169 48891 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943949.1 protein_id gnl|my_center|LOCUS_28840 49485 49177 gene locus_tag LOCUS_28850 49485 49177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 51712 49841 gene locus_tag LOCUS_28860 51712 49841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence22 1532 375 gene locus_tag LOCUS_28870 1532 375 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083663.1 protein_id gnl|my_center|LOCUS_28870 2088 2405 gene locus_tag LOCUS_28880 2088 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3887 2895 gene locus_tag LOCUS_28890 3887 2895 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_28890 4075 4959 gene locus_tag LOCUS_28900 4075 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5339 7375 gene locus_tag LOCUS_28910 5339 7375 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_28910 8694 7639 gene locus_tag LOCUS_28920 8694 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 9057 8854 gene locus_tag LOCUS_28930 9057 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 9874 9392 gene locus_tag LOCUS_28940 9874 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 10234 9878 gene locus_tag LOCUS_28950 10234 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 11007 10651 gene locus_tag LOCUS_28960 11007 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 11399 11064 gene locus_tag LOCUS_28970 11399 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 13436 11790 gene locus_tag LOCUS_28980 gene pgm 13436 11790 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967369.1 protein_id gnl|my_center|LOCUS_28980 15970 14267 gene locus_tag LOCUS_28990 15970 14267 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_28990 16558 16812 gene locus_tag LOCUS_29000 16558 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 16951 18876 gene locus_tag LOCUS_29010 16951 18876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 19088 19444 gene locus_tag LOCUS_29020 19088 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 19727 19473 gene locus_tag LOCUS_29030 19727 19473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 21003 20488 gene locus_tag LOCUS_29040 21003 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 21311 21018 gene locus_tag LOCUS_29050 21311 21018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 21694 24090 gene locus_tag LOCUS_29060 21694 24090 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_29060 25717 27042 gene locus_tag LOCUS_29070 gene pfp 25717 27042 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_29070 27860 27171 gene locus_tag LOCUS_29080 27860 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 28971 27862 gene locus_tag LOCUS_29090 28971 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 30831 29245 gene locus_tag LOCUS_29100 30831 29245 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_29100 31419 30901 gene locus_tag LOCUS_29110 31419 30901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 31843 32214 gene locus_tag LOCUS_29120 31843 32214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 32211 32459 gene locus_tag LOCUS_29130 32211 32459 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_29130 32463 32822 gene locus_tag LOCUS_29140 32463 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 33560 33159 gene locus_tag LOCUS_29150 33560 33159 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_29150 34059 33601 gene locus_tag LOCUS_29160 34059 33601 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_29160 35327 34527 gene locus_tag LOCUS_29170 35327 34527 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222607811.1 protein_id gnl|my_center|LOCUS_29170 35929 35495 gene locus_tag LOCUS_29180 35929 35495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 37154 35922 gene locus_tag LOCUS_29190 37154 35922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 38179 37517 gene locus_tag LOCUS_29200 38179 37517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338846.1 protein_id gnl|my_center|LOCUS_29200 38957 38166 gene locus_tag LOCUS_29210 38957 38166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391538.1 protein_id gnl|my_center|LOCUS_29210 39904 38954 gene locus_tag LOCUS_29220 39904 38954 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_29220 40836 39940 gene locus_tag LOCUS_29230 40836 39940 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_29230 42552 41197 gene locus_tag LOCUS_29240 42552 41197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 43492 43040 gene locus_tag LOCUS_29250 43492 43040 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966793.1 protein_id gnl|my_center|LOCUS_29250 44145 45284 gene locus_tag LOCUS_29260 44145 45284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 48286 46967 gene locus_tag LOCUS_29270 48286 46967 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_29270 48588 49532 gene locus_tag LOCUS_29280 48588 49532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence23 1336 743 gene locus_tag LOCUS_29290 1336 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1752 1246 gene locus_tag LOCUS_29300 1752 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2081 2371 gene locus_tag LOCUS_29310 2081 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2368 2799 gene locus_tag LOCUS_29320 2368 2799 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_29320 4376 3408 gene locus_tag LOCUS_29330 4376 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4846 6153 gene locus_tag LOCUS_29340 4846 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 6432 7352 gene locus_tag LOCUS_29350 6432 7352 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_29350 7653 8210 gene locus_tag LOCUS_29360 gene bcp 7653 8210 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_29360 8219 8419 gene locus_tag LOCUS_29370 8219 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 8448 8532 gene locus_tag LOCUS_t00410 8448 8532 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8555 8630 gene locus_tag LOCUS_t00420 8555 8630 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8686 8761 gene locus_tag LOCUS_t00430 8686 8761 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8875 9027 gene locus_tag LOCUS_29380 gene rpmG 8875 9027 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_29380 9334 9411 gene locus_tag LOCUS_t00440 9334 9411 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 9462 9659 gene locus_tag LOCUS_29390 9462 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 9819 10352 gene locus_tag LOCUS_29400 gene nusG 9819 10352 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_29400 10443 10868 gene locus_tag LOCUS_29410 gene rplK 10443 10868 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_29410 10886 11587 gene locus_tag LOCUS_29420 gene rplA 10886 11587 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_29420 11734 12258 gene locus_tag LOCUS_29430 gene rplJ 11734 12258 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908597.1 protein_id gnl|my_center|LOCUS_29430 12723 13118 gene locus_tag LOCUS_29440 gene rplL 12723 13118 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_29440 13279 17403 gene locus_tag LOCUS_29450 gene rpoB 13279 17403 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_29450 17424 21680 gene locus_tag LOCUS_29460 gene rpoC 17424 21680 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_29460 21724 22200 gene locus_tag LOCUS_29470 gene rpsL 21724 22200 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_29470 22204 22674 gene locus_tag LOCUS_29480 gene rpsG 22204 22674 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 protein_id gnl|my_center|LOCUS_29480 22699 24792 gene locus_tag LOCUS_29490 gene fusA 22699 24792 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_29490 24848 26047 gene locus_tag LOCUS_29500 gene tuf 24848 26047 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_29500 26057 26425 gene locus_tag LOCUS_29510 gene rpsJ 26057 26425 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_29510 26422 27099 gene locus_tag LOCUS_29520 gene rplC 26422 27099 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_29520 27101 27757 gene locus_tag LOCUS_29530 gene rplD 27101 27757 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_29530 27757 28044 gene locus_tag LOCUS_29540 27757 28044 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_29540 28116 28895 gene locus_tag LOCUS_29550 gene rplB 28116 28895 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_29550 28908 29216 gene locus_tag LOCUS_29560 gene rpsS 28908 29216 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_29560 29222 29560 gene locus_tag LOCUS_29570 gene rplV 29222 29560 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887891.1 protein_id gnl|my_center|LOCUS_29570 29569 30237 gene locus_tag LOCUS_29580 gene rpsC 29569 30237 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_29580 30378 30803 gene locus_tag LOCUS_29590 gene rplP 30378 30803 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_29590 30793 30987 gene locus_tag LOCUS_29600 30793 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 31018 31272 gene locus_tag LOCUS_29610 31018 31272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 31289 31657 gene locus_tag LOCUS_29620 gene rplN 31289 31657 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_29620 31657 31989 gene locus_tag LOCUS_29630 gene rplX 31657 31989 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_29630 31989 32714 gene locus_tag LOCUS_29640 31989 32714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 32985 33380 gene locus_tag LOCUS_29650 gene rpsH 32985 33380 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829768.1 protein_id gnl|my_center|LOCUS_29650 33395 33943 gene locus_tag LOCUS_29660 gene rplF 33395 33943 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_29660 34057 34419 gene locus_tag LOCUS_29670 gene rplR 34057 34419 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925411.1 protein_id gnl|my_center|LOCUS_29670 34491 34991 gene locus_tag LOCUS_29680 gene rpsE 34491 34991 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_29680 34991 35179 gene locus_tag LOCUS_29690 gene rpmD 34991 35179 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_29690 35316 35777 gene locus_tag LOCUS_29700 gene rplO 35316 35777 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_29700 35784 37088 gene locus_tag LOCUS_29710 gene secY 35784 37088 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_29710 37091 37750 gene locus_tag LOCUS_29720 37091 37750 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_29720 37747 38520 gene locus_tag LOCUS_29730 gene map 37747 38520 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_29730 38513 38731 gene locus_tag LOCUS_29740 gene infA 38513 38731 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_29740 38898 39278 gene locus_tag LOCUS_29750 gene rpsM 38898 39278 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_29750 39331 39816 gene locus_tag LOCUS_29760 gene rpsK 39331 39816 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_29760 39838 40464 gene locus_tag LOCUS_29770 gene rpsD 39838 40464 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_29770 40539 41564 gene locus_tag LOCUS_29780 40539 41564 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_29780 41607 42059 gene locus_tag LOCUS_29790 41607 42059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 42599 42246 gene locus_tag LOCUS_29800 42599 42246 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144277.1 protein_id gnl|my_center|LOCUS_29800 42883 42680 gene locus_tag LOCUS_29810 42883 42680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29810 43032 42853 gene locus_tag LOCUS_29820 43032 42853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29820 >Feature sequence24 549 319 gene locus_tag LOCUS_29830 549 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 993 679 gene locus_tag LOCUS_29840 993 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29840 1790 2161 gene locus_tag LOCUS_29850 1790 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2381 2626 gene locus_tag LOCUS_29860 2381 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2777 3751 gene locus_tag LOCUS_29870 2777 3751 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_29870 3842 4594 gene locus_tag LOCUS_29880 3842 4594 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383303.1 protein_id gnl|my_center|LOCUS_29880 4660 5259 gene locus_tag LOCUS_29890 4660 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 6022 6894 gene locus_tag LOCUS_29900 6022 6894 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_29900 6968 7243 gene locus_tag LOCUS_29910 6968 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 7372 7890 gene locus_tag LOCUS_29920 7372 7890 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_29920 8299 7928 gene locus_tag LOCUS_29930 8299 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 8183 8614 gene locus_tag LOCUS_29940 8183 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 8670 9317 gene locus_tag LOCUS_29950 8670 9317 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_29950 9352 10047 gene locus_tag LOCUS_29960 9352 10047 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_29960 10522 12036 gene locus_tag LOCUS_29970 10522 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 12071 13105 gene locus_tag LOCUS_29980 12071 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 13205 15232 gene locus_tag LOCUS_29990 gene ligA 13205 15232 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_29990 15288 15584 gene locus_tag LOCUS_30000 15288 15584 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_30000 15712 17610 gene locus_tag LOCUS_30010 15712 17610 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_30010 17617 18615 gene locus_tag LOCUS_30020 17617 18615 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_30020 18914 20179 gene locus_tag LOCUS_30030 18914 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 20973 20236 gene locus_tag LOCUS_30040 20973 20236 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_30040 22382 20988 gene locus_tag LOCUS_30050 22382 20988 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_30050 23710 22520 gene locus_tag LOCUS_30060 23710 22520 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_30060 24381 25007 gene locus_tag LOCUS_30070 24381 25007 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230609.1 protein_id gnl|my_center|LOCUS_30070 26755 25091 gene locus_tag LOCUS_30080 26755 25091 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_30080 26904 27209 gene locus_tag LOCUS_30090 26904 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 27212 29956 gene locus_tag LOCUS_30100 27212 29956 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_30100 30092 29934 gene locus_tag LOCUS_30110 30092 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 30156 31742 gene locus_tag LOCUS_30120 30156 31742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 31730 32398 gene locus_tag LOCUS_30130 31730 32398 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_30130 32619 33344 gene locus_tag LOCUS_30140 32619 33344 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_30140 33591 34970 gene locus_tag LOCUS_30150 gene dnaB 33591 34970 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_30150 35838 34975 gene locus_tag LOCUS_30160 35838 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 36621 35842 gene locus_tag LOCUS_30170 36621 35842 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_30170 37289 36654 gene locus_tag LOCUS_30180 37289 36654 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_30180 38233 37310 gene locus_tag LOCUS_30190 gene xerD 38233 37310 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_30190 41010 38269 gene locus_tag LOCUS_30200 gene glnD 41010 38269 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_30200 42410 41406 gene locus_tag LOCUS_30210 42410 41406 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 protein_id gnl|my_center|LOCUS_30210 42866 42594 gene locus_tag LOCUS_30220 42866 42594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence25 398 2233 gene locus_tag LOCUS_30230 398 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2227 3480 gene locus_tag LOCUS_30240 2227 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3482 4849 gene locus_tag LOCUS_30250 3482 4849 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932125.1 protein_id gnl|my_center|LOCUS_30250 4851 5813 gene locus_tag LOCUS_30260 4851 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 5813 6766 gene locus_tag LOCUS_30270 5813 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 10364 6984 gene locus_tag LOCUS_30280 gene treS 10364 6984 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_30280 12295 10361 gene locus_tag LOCUS_30290 12295 10361 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_30290 13286 14212 gene locus_tag LOCUS_30300 13286 14212 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_30300 15206 14565 gene locus_tag LOCUS_30310 15206 14565 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_30310 15713 17392 gene locus_tag LOCUS_30320 15713 17392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 17866 18963 gene locus_tag LOCUS_30330 17866 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 18953 19426 gene locus_tag LOCUS_30340 18953 19426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 19758 20126 gene locus_tag LOCUS_30350 19758 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 20677 20498 gene locus_tag LOCUS_30360 20677 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 22585 21566 gene locus_tag LOCUS_30370 22585 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 23075 23266 gene locus_tag LOCUS_30380 23075 23266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 23923 23471 gene locus_tag LOCUS_30390 gene mscL 23923 23471 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_30390 24979 24311 gene locus_tag LOCUS_30400 24979 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 25705 25079 gene locus_tag LOCUS_30410 25705 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 26173 26403 gene locus_tag LOCUS_30420 26173 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 26400 27605 gene locus_tag LOCUS_30430 26400 27605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_30430 28108 27728 gene locus_tag LOCUS_30440 28108 27728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 28620 28228 gene locus_tag LOCUS_30450 28620 28228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 29035 30015 gene locus_tag LOCUS_30460 29035 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 30382 31521 gene locus_tag LOCUS_30470 30382 31521 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_30470 31543 32976 gene locus_tag LOCUS_30480 31543 32976 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228361.1 protein_id gnl|my_center|LOCUS_30480 34266 33118 gene locus_tag LOCUS_30490 34266 33118 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321414.1 protein_id gnl|my_center|LOCUS_30490 36573 34492 gene locus_tag LOCUS_30500 36573 34492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_30500 37155 38387 gene locus_tag LOCUS_30510 37155 38387 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349448.1 protein_id gnl|my_center|LOCUS_30510 38608 38348 gene locus_tag LOCUS_30520 38608 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 39147 38671 gene locus_tag LOCUS_30530 39147 38671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 39321 39899 gene locus_tag LOCUS_30540 39321 39899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence26 1403 1071 gene locus_tag LOCUS_30550 gene trxA 1403 1071 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_30550 2901 2035 gene locus_tag LOCUS_30560 gene pyrF 2901 2035 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_30560 3689 2967 gene locus_tag LOCUS_30570 3689 2967 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_30570 6357 3775 gene locus_tag LOCUS_30580 6357 3775 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205538.1 protein_id gnl|my_center|LOCUS_30580 6731 7390 gene locus_tag LOCUS_30590 6731 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 7452 8693 gene locus_tag LOCUS_30600 7452 8693 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_30600 8690 10294 gene locus_tag LOCUS_30610 8690 10294 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_30610 10843 10391 gene locus_tag LOCUS_30620 10843 10391 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_30620 11795 11049 gene locus_tag LOCUS_30630 11795 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 12279 11881 gene locus_tag LOCUS_30640 12279 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 14307 12871 gene locus_tag LOCUS_30650 14307 12871 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_30650 14676 14323 gene locus_tag LOCUS_30660 14676 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 15802 14639 gene locus_tag LOCUS_30670 15802 14639 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_30670 16274 15966 gene locus_tag LOCUS_30680 16274 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 17199 16663 gene locus_tag LOCUS_30690 17199 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 17437 17189 gene locus_tag LOCUS_30700 17437 17189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 18213 17416 gene locus_tag LOCUS_30710 18213 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 18771 18217 gene locus_tag LOCUS_30720 18771 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 20460 18781 gene locus_tag LOCUS_30730 gene ctaD 20460 18781 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533221.1 protein_id gnl|my_center|LOCUS_30730 21389 20457 gene locus_tag LOCUS_30740 21389 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 22613 21801 gene locus_tag LOCUS_30750 22613 21801 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210055.1 protein_id gnl|my_center|LOCUS_30750 23254 22859 gene locus_tag LOCUS_30760 23254 22859 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808835.1 protein_id gnl|my_center|LOCUS_30760 25299 23563 gene locus_tag LOCUS_30770 25299 23563 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_30770 26027 25416 gene locus_tag LOCUS_30780 26027 25416 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088961.1 protein_id gnl|my_center|LOCUS_30780 26463 27677 gene locus_tag LOCUS_30790 26463 27677 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_30790 27776 28114 gene locus_tag LOCUS_30800 27776 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 29565 30722 gene locus_tag LOCUS_30810 29565 30722 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_30810 30768 32117 gene locus_tag LOCUS_30820 30768 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 32131 32757 gene locus_tag LOCUS_30830 32131 32757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30830 32754 33641 gene locus_tag LOCUS_30840 gene cobI 32754 33641 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_30840 33638 34468 gene locus_tag LOCUS_30850 gene cobM 33638 34468 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258425.1 protein_id gnl|my_center|LOCUS_30850 34465 35316 gene locus_tag LOCUS_30860 34465 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 35313 36398 gene locus_tag LOCUS_30870 35313 36398 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229228.1 protein_id gnl|my_center|LOCUS_30870 36392 36772 gene locus_tag LOCUS_30880 36392 36772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 36864 38036 gene locus_tag LOCUS_30890 36864 38036 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_30890 38157 38405 gene locus_tag LOCUS_30900 38157 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence27 484 831 gene locus_tag LOCUS_30910 gene rplS 484 831 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_30910 1349 897 gene locus_tag LOCUS_30920 1349 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2378 1380 gene locus_tag LOCUS_30930 2378 1380 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_30930 3372 2386 gene locus_tag LOCUS_30940 3372 2386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_30940 6001 3575 gene locus_tag LOCUS_30950 6001 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 7235 8071 gene locus_tag LOCUS_30960 7235 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 9496 8561 gene locus_tag LOCUS_30970 9496 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 11255 9522 gene locus_tag LOCUS_30980 11255 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 12186 12109 gene locus_tag LOCUS_t00450 12186 12109 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13669 12431 gene locus_tag LOCUS_30990 gene amrB 13669 12431 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_30990 13812 14579 gene locus_tag LOCUS_31000 13812 14579 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_31000 15107 14859 gene locus_tag LOCUS_31010 15107 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 16434 15178 gene locus_tag LOCUS_31020 gene rlmD 16434 15178 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_31020 16866 21644 gene locus_tag LOCUS_31030 16866 21644 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_31030 22205 21747 gene locus_tag LOCUS_31040 gene rimI 22205 21747 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_31040 22491 22799 gene locus_tag LOCUS_31050 22491 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 23156 22896 gene locus_tag LOCUS_31060 23156 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 23539 25206 gene locus_tag LOCUS_31070 gene groL 23539 25206 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_31070 25378 25746 gene locus_tag LOCUS_31080 25378 25746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 26600 26313 gene locus_tag LOCUS_31090 26600 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 27848 26772 gene locus_tag LOCUS_31100 27848 26772 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_31100 28858 28010 gene locus_tag LOCUS_31110 gene tlyA 28858 28010 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_31110 29397 29014 gene locus_tag LOCUS_31120 29397 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 30844 29366 gene locus_tag LOCUS_31130 30844 29366 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_31130 31757 31341 gene locus_tag LOCUS_31140 31757 31341 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975376.1 protein_id gnl|my_center|LOCUS_31140 32232 33227 gene locus_tag LOCUS_31150 32232 33227 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_31150 33443 34684 gene locus_tag LOCUS_31160 33443 34684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102111.1 protein_id gnl|my_center|LOCUS_31160 34878 36533 gene locus_tag LOCUS_31170 34878 36533 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence28 <1 1609 gene locus_tag LOCUS_31180 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940506.1:multidrug efflux RND transporter permease subunit 2808 1639 gene locus_tag LOCUS_31190 2808 1639 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_31190 3215 4213 gene locus_tag LOCUS_31200 3215 4213 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_31200 5688 4255 gene locus_tag LOCUS_31210 5688 4255 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967450.1 protein_id gnl|my_center|LOCUS_31210 7518 5845 gene locus_tag LOCUS_31220 7518 5845 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_31220 11044 8684 gene locus_tag LOCUS_31230 11044 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 11774 11550 gene locus_tag LOCUS_31240 11774 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 11853 14693 gene locus_tag LOCUS_31250 11853 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 13889 13794 gene locus_tag LOCUS_t00460 13889 13794 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14891 15421 gene locus_tag LOCUS_31260 14891 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 15514 15720 gene locus_tag LOCUS_31270 15514 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 15806 18475 gene locus_tag LOCUS_31280 15806 18475 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_31280 18496 19191 gene locus_tag LOCUS_31290 18496 19191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_31290 19188 20021 gene locus_tag LOCUS_31300 19188 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 20241 21776 gene locus_tag LOCUS_31310 20241 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 23724 21859 gene locus_tag LOCUS_31320 23724 21859 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967085.1 protein_id gnl|my_center|LOCUS_31320 23900 24820 gene locus_tag LOCUS_31330 gene fmt 23900 24820 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_31330 25165 25506 gene locus_tag LOCUS_31340 25165 25506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 25831 25514 gene locus_tag LOCUS_31350 25831 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 25722 26630 gene locus_tag LOCUS_31360 25722 26630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 28292 26859 gene locus_tag LOCUS_31370 28292 26859 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_31370 28310 28564 gene locus_tag LOCUS_31380 28310 28564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 28697 29689 gene locus_tag LOCUS_31390 28697 29689 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_31390 33115 29840 gene locus_tag LOCUS_31400 gene dnaE2 33115 29840 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_31400 34744 33152 gene locus_tag LOCUS_31410 34744 33152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 35753 34770 gene locus_tag LOCUS_31420 35753 34770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 36634 35888 gene locus_tag LOCUS_31430 36634 35888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence29 191 358 gene locus_tag LOCUS_31440 191 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1076 564 gene locus_tag LOCUS_31450 1076 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1020 1235 gene locus_tag LOCUS_31460 1020 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1346 1263 gene locus_tag LOCUS_t00470 1346 1263 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2572 4227 gene locus_tag LOCUS_31470 2572 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 4285 4557 gene locus_tag LOCUS_31480 4285 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 4804 5166 gene locus_tag LOCUS_31490 4804 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 5391 6263 gene locus_tag LOCUS_31500 gene nirK 5391 6263 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_31500 6651 6727 gene locus_tag LOCUS_t00480 6651 6727 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6822 7781 gene locus_tag LOCUS_31510 6822 7781 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_31510 7933 8640 gene locus_tag LOCUS_31520 7933 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 8921 12379 gene locus_tag LOCUS_31530 gene dnaE 8921 12379 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_31530 13223 14428 gene locus_tag LOCUS_31540 gene hflX 13223 14428 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_31540 14456 15067 gene locus_tag LOCUS_31550 14456 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 15242 16021 gene locus_tag LOCUS_31560 15242 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 17069 16305 gene locus_tag LOCUS_31570 17069 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 18176 17574 gene locus_tag LOCUS_31580 18176 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 18536 18183 gene locus_tag LOCUS_31590 18536 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 18930 18616 gene locus_tag LOCUS_31600 18930 18616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 19361 19636 gene locus_tag LOCUS_31610 19361 19636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 19633 20058 gene locus_tag LOCUS_31620 19633 20058 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_31620 20475 21152 gene locus_tag LOCUS_31630 20475 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 22367 21192 gene locus_tag LOCUS_31640 22367 21192 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814783.1 protein_id gnl|my_center|LOCUS_31640 23349 22504 gene locus_tag LOCUS_31650 23349 22504 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_31650 23705 24763 gene locus_tag LOCUS_31660 23705 24763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 25239 26984 gene locus_tag LOCUS_31670 25239 26984 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_31670 28637 27399 gene locus_tag LOCUS_31680 28637 27399 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_31680 30508 29870 gene locus_tag LOCUS_31690 30508 29870 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815819.1 protein_id gnl|my_center|LOCUS_31690 30965 30522 gene locus_tag LOCUS_31700 gene rplI 30965 30522 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_31700 32313 31837 gene locus_tag LOCUS_31710 32313 31837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 33274 32882 gene locus_tag LOCUS_31720 gene erpA 33274 32882 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence30 531 631 gene locus_tag LOCUS_r00010 531 631 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1065 1718 gene locus_tag LOCUS_31730 gene pyrR 1065 1718 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_31730 1732 3696 gene locus_tag LOCUS_31740 1732 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 3753 5060 gene locus_tag LOCUS_31750 3753 5060 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_31750 5057 6256 gene locus_tag LOCUS_31760 gene carA 5057 6256 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_31760 6326 9514 gene locus_tag LOCUS_31770 gene carB 6326 9514 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_31770 9499 11643 gene locus_tag LOCUS_31780 gene recG 9499 11643 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_31780 13125 11686 gene locus_tag LOCUS_31790 13125 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 13778 13122 gene locus_tag LOCUS_31800 13778 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 13972 15135 gene locus_tag LOCUS_31810 13972 15135 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_31810 15350 16252 gene locus_tag LOCUS_31820 gene folD 15350 16252 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_31820 16806 16426 gene locus_tag LOCUS_31830 16806 16426 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_31830 17184 19466 gene locus_tag LOCUS_31840 17184 19466 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_31840 20055 19540 gene locus_tag LOCUS_31850 20055 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 20138 20593 gene locus_tag LOCUS_31860 gene mce 20138 20593 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_31860 20946 22625 gene locus_tag LOCUS_31870 gene argS 20946 22625 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_31870 23054 22776 gene locus_tag LOCUS_31880 23054 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 23152 23346 gene locus_tag LOCUS_31890 23152 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 25070 23403 gene locus_tag LOCUS_31900 25070 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_31900 26042 26266 gene locus_tag LOCUS_31910 26042 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 26781 27788 gene locus_tag LOCUS_31920 26781 27788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence31 110 1216 gene locus_tag LOCUS_31930 110 1216 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_31930 1277 2629 gene locus_tag LOCUS_31940 1277 2629 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_31940 3089 3532 gene locus_tag LOCUS_31950 3089 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3631 3541 gene locus_tag LOCUS_t00490 3631 3541 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5571 6104 gene locus_tag LOCUS_31960 5571 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 6091 7587 gene locus_tag LOCUS_31970 6091 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 7826 7990 gene locus_tag LOCUS_31980 7826 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 9719 8007 gene locus_tag LOCUS_31990 9719 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 10516 10037 gene locus_tag LOCUS_32000 gene ispF 10516 10037 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_32000 10960 11244 gene locus_tag LOCUS_32010 10960 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 12422 11178 gene locus_tag LOCUS_32020 12422 11178 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_32020 13368 12652 gene locus_tag LOCUS_32030 13368 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 13884 15089 gene locus_tag LOCUS_32040 gene gnfL 13884 15089 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_32040 17530 15167 gene locus_tag LOCUS_32050 gene ptsP 17530 15167 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_32050 18432 17764 gene locus_tag LOCUS_32060 18432 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 19112 18462 gene locus_tag LOCUS_32070 19112 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 19165 19995 gene locus_tag LOCUS_32080 19165 19995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 20094 20324 gene locus_tag LOCUS_32090 20094 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 20415 21011 gene locus_tag LOCUS_32100 20415 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 21606 21280 gene locus_tag LOCUS_32110 21606 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 21859 21581 gene locus_tag LOCUS_32120 21859 21581 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_32120 22295 21957 gene locus_tag LOCUS_32130 22295 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 23694 22417 gene locus_tag LOCUS_32140 23694 22417 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_32140 24310 24119 gene locus_tag LOCUS_32150 24310 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 25034 26023 gene locus_tag LOCUS_32160 25034 26023 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_32160 26286 27317 gene locus_tag LOCUS_32170 26286 27317 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence32 2081 1407 gene locus_tag LOCUS_32180 2081 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2168 2671 gene locus_tag LOCUS_32190 2168 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3911 2892 gene locus_tag LOCUS_32200 3911 2892 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_32200 4796 5305 gene locus_tag LOCUS_32210 4796 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 6437 9565 gene locus_tag LOCUS_32220 6437 9565 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_32220 10778 9621 gene locus_tag LOCUS_32230 gene hpnI 10778 9621 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743781.1 protein_id gnl|my_center|LOCUS_32230 12341 10896 gene locus_tag LOCUS_32240 gene hpnJ 12341 10896 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_32240 14527 12857 gene locus_tag LOCUS_32250 14527 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 15261 15037 gene locus_tag LOCUS_32260 15261 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 15178 15462 gene locus_tag LOCUS_32270 15178 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 15443 15775 gene locus_tag LOCUS_32280 15443 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 15772 16149 gene locus_tag LOCUS_32290 15772 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 17779 16253 gene locus_tag LOCUS_32300 gene ggt 17779 16253 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929162.1 protein_id gnl|my_center|LOCUS_32300 18317 18646 gene locus_tag LOCUS_32310 18317 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 18793 21312 gene locus_tag LOCUS_32320 18793 21312 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_32320 21411 22814 gene locus_tag LOCUS_32330 21411 22814 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence33 1026 490 gene locus_tag LOCUS_32340 1026 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 2690 1128 gene locus_tag LOCUS_32350 gene rny 2690 1128 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_32350 3316 2720 gene locus_tag LOCUS_32360 3316 2720 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_32360 3890 3615 gene locus_tag LOCUS_32370 3890 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 4131 3898 gene locus_tag LOCUS_32380 4131 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 5735 4176 gene locus_tag LOCUS_32390 5735 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 7352 5973 gene locus_tag LOCUS_32400 7352 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 9214 7499 gene locus_tag LOCUS_32410 9214 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 10556 9585 gene locus_tag LOCUS_32420 10556 9585 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_32420 11116 10754 gene locus_tag LOCUS_32430 11116 10754 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_32430 12650 11265 gene locus_tag LOCUS_32440 12650 11265 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_32440 13372 12896 gene locus_tag LOCUS_32450 13372 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 13674 13369 gene locus_tag LOCUS_32460 13674 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 14884 13697 gene locus_tag LOCUS_32470 14884 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_32470 15372 14998 gene locus_tag LOCUS_32480 15372 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 16970 15618 gene locus_tag LOCUS_32490 16970 15618 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_32490 17456 16989 gene locus_tag LOCUS_32500 17456 16989 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943773.1 protein_id gnl|my_center|LOCUS_32500 17873 17514 gene locus_tag LOCUS_32510 17873 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 18319 18017 gene locus_tag LOCUS_32520 18319 18017 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_32520 19098 18379 gene locus_tag LOCUS_32530 19098 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 19419 19225 gene locus_tag LOCUS_32540 19419 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 19513 19947 gene locus_tag LOCUS_32550 19513 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 19995 20363 gene locus_tag LOCUS_32560 19995 20363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 20662 20423 gene locus_tag LOCUS_32570 20662 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 21185 20712 gene locus_tag LOCUS_32580 21185 20712 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence34 2161 1043 gene locus_tag LOCUS_32590 2161 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3042 2536 gene locus_tag LOCUS_32600 3042 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 4193 3042 gene locus_tag LOCUS_32610 gene acdA 4193 3042 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_32610 4682 4194 gene locus_tag LOCUS_32620 4682 4194 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929804.1 protein_id gnl|my_center|LOCUS_32620 5685 5840 gene locus_tag LOCUS_32630 5685 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 6078 6491 gene locus_tag LOCUS_32640 6078 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 6578 8422 gene locus_tag LOCUS_32650 6578 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 8800 8997 gene locus_tag LOCUS_32660 8800 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 9336 9665 gene locus_tag LOCUS_32670 9336 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 9761 10084 gene locus_tag LOCUS_32680 9761 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 10490 12199 gene locus_tag LOCUS_32690 10490 12199 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111158892.1 protein_id gnl|my_center|LOCUS_32690 12346 13374 gene locus_tag LOCUS_32700 12346 13374 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_32700 13409 14389 gene locus_tag LOCUS_32710 13409 14389 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_32710 14400 15818 gene locus_tag LOCUS_32720 14400 15818 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_32720 16862 15876 gene locus_tag LOCUS_32730 16862 15876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974859.1 protein_id gnl|my_center|LOCUS_32730 18479 16905 gene locus_tag LOCUS_32740 18479 16905 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974860.1 protein_id gnl|my_center|LOCUS_32740 19890 18550 gene locus_tag LOCUS_32750 19890 18550 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974861.1 protein_id gnl|my_center|LOCUS_32750 20991 19942 gene locus_tag LOCUS_32760 20991 19942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence35 302 2413 gene locus_tag LOCUS_32770 gene acs 302 2413 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_32770 3593 4363 gene locus_tag LOCUS_32780 3593 4363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_32780 4367 5083 gene locus_tag LOCUS_32790 4367 5083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_32790 5097 5978 gene locus_tag LOCUS_32800 5097 5978 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_32800 5981 7126 gene locus_tag LOCUS_32810 5981 7126 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090550.1 protein_id gnl|my_center|LOCUS_32810 7223 8452 gene locus_tag LOCUS_32820 7223 8452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_32820 8582 9829 gene locus_tag LOCUS_32830 8582 9829 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_32830 9983 11623 gene locus_tag LOCUS_32840 9983 11623 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926032.1 protein_id gnl|my_center|LOCUS_32840 12176 11961 gene locus_tag LOCUS_32850 12176 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 12341 12637 gene locus_tag LOCUS_32860 12341 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 13765 13088 gene locus_tag LOCUS_32870 13765 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 14226 14029 gene locus_tag LOCUS_32880 gene rpsU 14226 14029 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941574.1 protein_id gnl|my_center|LOCUS_32880 14480 15250 gene locus_tag LOCUS_32890 14480 15250 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence36 1426 266 gene locus_tag LOCUS_32900 gene mqnC 1426 266 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228432.1 protein_id gnl|my_center|LOCUS_32900 2624 1515 gene locus_tag LOCUS_32910 2624 1515 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_32910 3940 2621 gene locus_tag LOCUS_32920 3940 2621 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_32920 4608 3937 gene locus_tag LOCUS_32930 4608 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 5464 4958 gene locus_tag LOCUS_32940 5464 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 5796 5464 gene locus_tag LOCUS_32950 5796 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 6912 6076 gene locus_tag LOCUS_32960 6912 6076 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_32960 7385 7029 gene locus_tag LOCUS_32970 7385 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 8874 7375 gene locus_tag LOCUS_32980 8874 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 10095 9184 gene locus_tag LOCUS_32990 10095 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 11078 10092 gene locus_tag LOCUS_33000 11078 10092 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_33000 12026 12715 gene locus_tag LOCUS_33010 12026 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33010 14055 12850 gene locus_tag LOCUS_33020 14055 12850 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_33020 14138 15427 gene locus_tag LOCUS_33030 14138 15427 CDS product IS630-like element ISBj5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082855.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence37 1043 828 gene locus_tag LOCUS_33040 1043 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 1557 1369 gene locus_tag LOCUS_33050 1557 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 6009 1594 gene locus_tag LOCUS_33060 6009 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 7493 6393 gene locus_tag LOCUS_33070 7493 6393 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_33070 9449 8052 gene locus_tag LOCUS_33080 gene miaB 9449 8052 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_33080 9725 10531 gene locus_tag LOCUS_33090 9725 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_33090 10531 12351 gene locus_tag LOCUS_33100 10531 12351 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_33100 12348 13121 gene locus_tag LOCUS_33110 12348 13121 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence38 294 905 gene locus_tag LOCUS_33120 294 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 1053 1358 gene locus_tag LOCUS_33130 1053 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3277 1763 gene locus_tag LOCUS_33140 gene tcuA 3277 1763 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_33140 4504 3491 gene locus_tag LOCUS_33150 4504 3491 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393222.1 protein_id gnl|my_center|LOCUS_33150 4644 5261 gene locus_tag LOCUS_33160 gene clpP 4644 5261 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_33160 7130 5526 gene locus_tag LOCUS_33170 7130 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 8593 8252 gene locus_tag LOCUS_33180 8593 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 10676 8844 gene locus_tag LOCUS_33190 10676 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 12089 10710 gene locus_tag LOCUS_33200 12089 10710 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence39 393 689 gene locus_tag LOCUS_33210 393 689 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389170.1 protein_id gnl|my_center|LOCUS_33210 1219 857 gene locus_tag LOCUS_33220 1219 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 1584 1222 gene locus_tag LOCUS_33230 1584 1222 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_33230 1813 2790 gene locus_tag LOCUS_33240 1813 2790 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_33240 3187 2885 gene locus_tag LOCUS_33250 3187 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 7364 3231 gene locus_tag LOCUS_33260 7364 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 9790 8852 gene locus_tag LOCUS_33270 9790 8852 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 protein_id gnl|my_center|LOCUS_33270 10138 9833 gene locus_tag LOCUS_33280 10138 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 10785 10135 gene locus_tag LOCUS_33290 gene parA 10785 10135 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202825640.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence40 311 664 gene locus_tag LOCUS_33300 311 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 657 950 gene locus_tag LOCUS_33310 657 950 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626476.1 protein_id gnl|my_center|LOCUS_33310 1180 1863 gene locus_tag LOCUS_33320 1180 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 1873 2121 gene locus_tag LOCUS_33330 1873 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 2406 2738 gene locus_tag LOCUS_33340 2406 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2796 3011 gene locus_tag LOCUS_33350 2796 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3024 3114 gene locus_tag LOCUS_t00500 3024 3114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3299 4534 gene locus_tag LOCUS_33360 3299 4534 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_33360 5740 4613 gene locus_tag LOCUS_33370 5740 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 6021 6716 gene locus_tag LOCUS_33380 gene trbF 6021 6716 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 protein_id gnl|my_center|LOCUS_33380 6729 7664 gene locus_tag LOCUS_33390 6729 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 7668 8801 gene locus_tag LOCUS_33400 7668 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 8837 9124 gene locus_tag LOCUS_33410 8837 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 9135 9761 gene locus_tag LOCUS_33420 gene traF 9135 9761 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 protein_id gnl|my_center|LOCUS_33420 9765 10157 gene locus_tag LOCUS_33430 9765 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence41 634 215 gene locus_tag LOCUS_33440 634 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 869 609 gene locus_tag LOCUS_33450 869 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2692 1031 gene locus_tag LOCUS_33460 2692 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4001 3018 gene locus_tag LOCUS_33470 4001 3018 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404004.1 protein_id gnl|my_center|LOCUS_33470 4620 5135 gene locus_tag LOCUS_33480 4620 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 5523 5819 gene locus_tag LOCUS_33490 5523 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 5838 6149 gene locus_tag LOCUS_33500 5838 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 7155 6742 gene locus_tag LOCUS_33510 7155 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 7834 7211 gene locus_tag LOCUS_33520 7834 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 8136 7891 gene locus_tag LOCUS_33530 8136 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 8842 8168 gene locus_tag LOCUS_33540 8842 8168 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_33540 8999 10147 gene locus_tag LOCUS_33550 8999 10147 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence42 2283 718 gene locus_tag LOCUS_33560 2283 718 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_33560 2910 2296 gene locus_tag LOCUS_33570 2910 2296 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 protein_id gnl|my_center|LOCUS_33570 3875 2907 gene locus_tag LOCUS_33580 3875 2907 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_33580 4714 3869 gene locus_tag LOCUS_33590 4714 3869 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_33590 5402 4719 gene locus_tag LOCUS_33600 5402 4719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_33600 6162 5395 gene locus_tag LOCUS_33610 6162 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33610 7429 6215 gene locus_tag LOCUS_33620 7429 6215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810076.1 protein_id gnl|my_center|LOCUS_33620 9516 7462 gene locus_tag LOCUS_33630 9516 7462 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence43 221 2506 gene locus_tag LOCUS_33640 221 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 2595 3176 gene locus_tag LOCUS_33650 2595 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3572 4735 gene locus_tag LOCUS_33660 3572 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 4732 4953 gene locus_tag LOCUS_33670 4732 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 5361 5585 gene locus_tag LOCUS_33680 5361 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 5628 5876 gene locus_tag LOCUS_33690 5628 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 6118 8376 gene locus_tag LOCUS_33700 6118 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence44 <1 595 gene locus_tag LOCUS_33710 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000163274.1:zincin-like metallopeptidase domain-containing protein 1228 2052 gene locus_tag LOCUS_33720 1228 2052 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267865.1 protein_id gnl|my_center|LOCUS_33720 2579 2980 gene locus_tag LOCUS_33730 2579 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 3177 4670 gene locus_tag LOCUS_33740 3177 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 5027 5692 gene locus_tag LOCUS_33750 5027 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 5705 6646 gene locus_tag LOCUS_33760 5705 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 6650 7783 gene locus_tag LOCUS_33770 6650 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 7819 8106 gene locus_tag LOCUS_33780 7819 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 8144 8743 gene locus_tag LOCUS_33790 8144 8743 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 protein_id gnl|my_center|LOCUS_33790 8747 9139 gene locus_tag LOCUS_33800 8747 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence45 1345 359 gene locus_tag LOCUS_33810 1345 359 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_33810 1338 1496 gene locus_tag LOCUS_33820 1338 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 2626 1625 gene locus_tag LOCUS_33830 2626 1625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974859.1 protein_id gnl|my_center|LOCUS_33830 4189 2648 gene locus_tag LOCUS_33840 4189 2648 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974860.1 protein_id gnl|my_center|LOCUS_33840 5630 4287 gene locus_tag LOCUS_33850 5630 4287 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974861.1 protein_id gnl|my_center|LOCUS_33850 6738 5686 gene locus_tag LOCUS_33860 6738 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 8128 6824 gene locus_tag LOCUS_33870 gene hisD 8128 6824 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 protein_id gnl|my_center|LOCUS_33870 >Feature sequence46 1579 548 gene locus_tag LOCUS_33880 1579 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 2234 2061 gene locus_tag LOCUS_33890 2234 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 2837 2424 gene locus_tag LOCUS_33900 gene ribH 2837 2424 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496458.1 protein_id gnl|my_center|LOCUS_33900 3634 2834 gene locus_tag LOCUS_33910 gene hisF 3634 2834 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_33910 4260 3646 gene locus_tag LOCUS_33920 gene hisH 4260 3646 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256250.1 protein_id gnl|my_center|LOCUS_33920 5296 4358 gene locus_tag LOCUS_33930 5296 4358 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_33930 7382 5592 gene locus_tag LOCUS_33940 7382 5592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_33940 8595 7414 gene locus_tag LOCUS_33950 8595 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence47 947 144 gene locus_tag LOCUS_33960 947 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 954 1139 gene locus_tag LOCUS_33970 954 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 1955 1119 gene locus_tag LOCUS_33980 1955 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3172 2015 gene locus_tag LOCUS_33990 3172 2015 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933049.1 protein_id gnl|my_center|LOCUS_33990 3445 3705 gene locus_tag LOCUS_34000 3445 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 4695 3592 gene locus_tag LOCUS_34010 4695 3592 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_34010 5681 4695 gene locus_tag LOCUS_34020 5681 4695 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_34020 6669 5698 gene locus_tag LOCUS_34030 gene pdhA 6669 5698 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_34030 7304 6669 gene locus_tag LOCUS_34040 7304 6669 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795339.1 protein_id gnl|my_center|LOCUS_34040 8135 7353 gene locus_tag LOCUS_34050 8135 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence48 <1 2043 gene locus_tag LOCUS_34060 <1 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255980.1:CRISPR-associated helicase/endonuclease Cas3 2036 3772 gene locus_tag LOCUS_34070 2036 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 3787 4794 gene locus_tag LOCUS_34080 3787 4794 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255977.1 protein_id gnl|my_center|LOCUS_34080 4800 5606 gene locus_tag LOCUS_34090 4800 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255976.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence49 230 2941 gene locus_tag LOCUS_34100 230 2941 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_34100 2953 4191 gene locus_tag LOCUS_34110 2953 4191 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence50 690 986 gene locus_tag LOCUS_34120 690 986 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_34120 1618 1448 gene locus_tag LOCUS_34130 1618 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 1694 4600 gene locus_tag LOCUS_34140 1694 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence51 499 2220 gene locus_tag LOCUS_34150 499 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3086 2640 gene locus_tag LOCUS_34160 3086 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence52 271 579 gene locus_tag LOCUS_34170 271 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 576 1037 gene locus_tag LOCUS_34180 576 1037 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899362.1 protein_id gnl|my_center|LOCUS_34180 2895 1603 gene locus_tag LOCUS_34190 2895 1603 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078903565.1 protein_id gnl|my_center|LOCUS_34190