>Feature sequence001 262 618 gene locus_tag LOCUS_00010 262 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 692 979 gene locus_tag LOCUS_00020 692 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 979 1125 gene locus_tag LOCUS_00030 979 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1079 1258 gene locus_tag LOCUS_00040 1079 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 1255 1671 gene locus_tag LOCUS_00050 1255 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 1716 2375 gene locus_tag LOCUS_00060 1716 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 2317 2547 gene locus_tag LOCUS_00070 2317 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 2492 2659 gene locus_tag LOCUS_00080 2492 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 2649 2969 gene locus_tag LOCUS_00090 2649 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 2971 3411 gene locus_tag LOCUS_00100 2971 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 3445 4086 gene locus_tag LOCUS_00110 3445 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 4150 4545 gene locus_tag LOCUS_00120 4150 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 4837 7629 gene locus_tag LOCUS_00130 4837 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7629 7970 gene locus_tag LOCUS_00140 7629 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7967 8584 gene locus_tag LOCUS_00150 7967 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8584 8970 gene locus_tag LOCUS_00160 8584 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 8963 14056 gene locus_tag LOCUS_00170 8963 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14234 14425 gene locus_tag LOCUS_00180 14234 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14412 15032 gene locus_tag LOCUS_00190 14412 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15047 15373 gene locus_tag LOCUS_00200 15047 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15375 16412 gene locus_tag LOCUS_00210 15375 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18392 16917 gene locus_tag LOCUS_00220 18392 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18840 18394 gene locus_tag LOCUS_00230 18840 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19482 19069 gene locus_tag LOCUS_00240 19482 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 19967 19491 gene locus_tag LOCUS_00250 19967 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 20107 20277 gene locus_tag LOCUS_00260 20107 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 20627 20247 gene locus_tag LOCUS_00270 20627 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 20750 21040 gene locus_tag LOCUS_00280 20750 21040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 21040 21264 gene locus_tag LOCUS_00290 21040 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 21388 21651 gene locus_tag LOCUS_00300 21388 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 21660 22220 gene locus_tag LOCUS_00310 21660 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 22224 22361 gene locus_tag LOCUS_00320 22224 22361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 22358 22510 gene locus_tag LOCUS_00330 22358 22510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22668 22916 gene locus_tag LOCUS_00340 22668 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 22913 23098 gene locus_tag LOCUS_00350 22913 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 23177 23536 gene locus_tag LOCUS_00360 23177 23536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 23536 24075 gene locus_tag LOCUS_00370 23536 24075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 24075 24869 gene locus_tag LOCUS_00380 24075 24869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 25294 25533 gene locus_tag LOCUS_00390 25294 25533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 25530 25892 gene locus_tag LOCUS_00400 25530 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 25889 26599 gene locus_tag LOCUS_00410 25889 26599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475630.1 protein_id gnl|my_center|LOCUS_00410 26990 28819 gene locus_tag LOCUS_00420 26990 28819 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940141.1 protein_id gnl|my_center|LOCUS_00420 29222 31720 gene locus_tag LOCUS_00430 29222 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 31922 32542 gene locus_tag LOCUS_00440 31922 32542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 32612 32830 gene locus_tag LOCUS_00450 32612 32830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 32991 33482 gene locus_tag LOCUS_00460 32991 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 33479 33685 gene locus_tag LOCUS_00470 33479 33685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 33769 34362 gene locus_tag LOCUS_00480 33769 34362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 34475 34744 gene locus_tag LOCUS_00490 34475 34744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 34837 35016 gene locus_tag LOCUS_00500 34837 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 35197 35916 gene locus_tag LOCUS_00510 35197 35916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 35967 37130 gene locus_tag LOCUS_00520 35967 37130 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_00520 37127 37390 gene locus_tag LOCUS_00530 37127 37390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 37387 38832 gene locus_tag LOCUS_00540 37387 38832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 38829 38993 gene locus_tag LOCUS_00550 38829 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 38993 39742 gene locus_tag LOCUS_00560 38993 39742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 39739 41640 gene locus_tag LOCUS_00570 39739 41640 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190275051.1 protein_id gnl|my_center|LOCUS_00570 41666 41977 gene locus_tag LOCUS_00580 41666 41977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 42121 42354 gene locus_tag LOCUS_00590 42121 42354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 42354 43979 gene locus_tag LOCUS_00600 42354 43979 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940132.1 protein_id gnl|my_center|LOCUS_00600 43976 45244 gene locus_tag LOCUS_00610 43976 45244 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001516225.1 protein_id gnl|my_center|LOCUS_00610 45284 45652 gene locus_tag LOCUS_00620 45284 45652 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975798.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence002 <1 1373 gene locus_tag LOCUS_00630 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365367.1:ATP-dependent chaperone ClpB 2936 1530 gene locus_tag LOCUS_00640 2936 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 3222 3839 gene locus_tag LOCUS_00650 gene wrbA 3222 3839 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_00650 3876 4379 gene locus_tag LOCUS_00660 3876 4379 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_00660 5857 4643 gene locus_tag LOCUS_00670 5857 4643 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_00670 5942 6475 gene locus_tag LOCUS_00680 5942 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6499 7362 gene locus_tag LOCUS_00690 6499 7362 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546070.1 protein_id gnl|my_center|LOCUS_00690 7394 7684 gene locus_tag LOCUS_00700 7394 7684 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072432.1 protein_id gnl|my_center|LOCUS_00700 7696 8160 gene locus_tag LOCUS_00710 7696 8160 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_00710 10612 8222 gene locus_tag LOCUS_00720 10612 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10908 10832 gene locus_tag LOCUS_t00010 10908 10832 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11451 11005 gene locus_tag LOCUS_00730 11451 11005 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_00730 12268 11543 gene locus_tag LOCUS_00740 12268 11543 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943939.1 protein_id gnl|my_center|LOCUS_00740 13000 12482 gene locus_tag LOCUS_00750 13000 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 15051 13009 gene locus_tag LOCUS_00760 gene ligA 15051 13009 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_00760 15155 15967 gene locus_tag LOCUS_00770 15155 15967 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_00770 16001 16978 gene locus_tag LOCUS_00780 gene pdhA 16001 16978 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_00780 16971 17957 gene locus_tag LOCUS_00790 16971 17957 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_00790 18014 19279 gene locus_tag LOCUS_00800 18014 19279 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_00800 19384 21846 gene locus_tag LOCUS_00810 19384 21846 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_00810 21998 22402 gene locus_tag LOCUS_00820 21998 22402 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_00820 22632 22453 gene locus_tag LOCUS_00830 22632 22453 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_00830 23673 22783 gene locus_tag LOCUS_00840 23673 22783 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_00840 25266 23683 gene locus_tag LOCUS_00850 25266 23683 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942732.1 protein_id gnl|my_center|LOCUS_00850 25487 26515 gene locus_tag LOCUS_00860 25487 26515 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942549.1 protein_id gnl|my_center|LOCUS_00860 26839 27711 gene locus_tag LOCUS_00870 gene dapA 26839 27711 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_00870 27852 28655 gene locus_tag LOCUS_00880 gene dapB 27852 28655 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_00880 28739 30325 gene locus_tag LOCUS_00890 28739 30325 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943967.1 protein_id gnl|my_center|LOCUS_00890 30375 31607 gene locus_tag LOCUS_00900 30375 31607 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_00900 31980 32342 gene locus_tag LOCUS_00910 31980 32342 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940839.1 protein_id gnl|my_center|LOCUS_00910 32409 32720 gene locus_tag LOCUS_00920 32409 32720 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_00920 33172 33489 gene locus_tag LOCUS_00930 33172 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 33482 33880 gene locus_tag LOCUS_00940 33482 33880 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172718.1 protein_id gnl|my_center|LOCUS_00940 33911 34678 gene locus_tag LOCUS_00950 33911 34678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence003 3046 749 gene locus_tag LOCUS_00960 gene rnr 3046 749 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_00960 3679 3278 gene locus_tag LOCUS_00970 3679 3278 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938720.1 protein_id gnl|my_center|LOCUS_00970 4294 3857 gene locus_tag LOCUS_00980 4294 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5396 4584 gene locus_tag LOCUS_00990 5396 4584 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_00990 6576 5461 gene locus_tag LOCUS_01000 6576 5461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_01000 7868 6711 gene locus_tag LOCUS_01010 7868 6711 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_01010 9157 8003 gene locus_tag LOCUS_01020 9157 8003 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_01020 9954 9208 gene locus_tag LOCUS_01030 9954 9208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195814.1 protein_id gnl|my_center|LOCUS_01030 11708 9954 gene locus_tag LOCUS_01040 11708 9954 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 protein_id gnl|my_center|LOCUS_01040 12727 11708 gene locus_tag LOCUS_01050 12727 11708 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_01050 13396 14661 gene locus_tag LOCUS_01060 13396 14661 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 protein_id gnl|my_center|LOCUS_01060 14673 15905 gene locus_tag LOCUS_01070 14673 15905 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_01070 16010 16891 gene locus_tag LOCUS_01080 16010 16891 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_01080 18574 16964 gene locus_tag LOCUS_01090 gene cimA 18574 16964 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_01090 19837 18620 gene locus_tag LOCUS_01100 19837 18620 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_01100 20227 20541 gene locus_tag LOCUS_01110 20227 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 20667 20984 gene locus_tag LOCUS_01120 20667 20984 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_01120 20998 21456 gene locus_tag LOCUS_01130 20998 21456 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546412.1 protein_id gnl|my_center|LOCUS_01130 21453 22451 gene locus_tag LOCUS_01140 gene dsrM 21453 22451 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_01140 22444 24060 gene locus_tag LOCUS_01150 22444 24060 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_01150 24053 24478 gene locus_tag LOCUS_01160 gene dsrJ 24053 24478 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_01160 24475 25239 gene locus_tag LOCUS_01170 24475 25239 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_01170 25254 26405 gene locus_tag LOCUS_01180 gene nrfD 25254 26405 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_01180 26418 27629 gene locus_tag LOCUS_01190 26418 27629 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_01190 27741 28499 gene locus_tag LOCUS_01200 27741 28499 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_01200 28622 31237 gene locus_tag LOCUS_01210 28622 31237 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_01210 31234 32046 gene locus_tag LOCUS_01220 31234 32046 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809159.1 protein_id gnl|my_center|LOCUS_01220 32172 32924 gene locus_tag LOCUS_01230 32172 32924 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 protein_id gnl|my_center|LOCUS_01230 32990 34621 gene locus_tag LOCUS_01240 32990 34621 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence004 2018 1143 gene locus_tag LOCUS_01250 gene dapA 2018 1143 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_01250 4591 3293 gene locus_tag LOCUS_01260 4591 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5905 4781 gene locus_tag LOCUS_01270 5905 4781 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_01270 7078 6068 gene locus_tag LOCUS_01280 7078 6068 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_01280 7401 8570 gene locus_tag LOCUS_01290 7401 8570 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_01290 8575 9450 gene locus_tag LOCUS_01300 8575 9450 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_01300 9461 10345 gene locus_tag LOCUS_01310 9461 10345 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944004.1 protein_id gnl|my_center|LOCUS_01310 10345 11121 gene locus_tag LOCUS_01320 10345 11121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944003.1 protein_id gnl|my_center|LOCUS_01320 11114 11824 gene locus_tag LOCUS_01330 11114 11824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_01330 11862 12263 gene locus_tag LOCUS_01340 11862 12263 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942308.1 protein_id gnl|my_center|LOCUS_01340 12362 12844 gene locus_tag LOCUS_01350 12362 12844 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_01350 12935 13279 gene locus_tag LOCUS_01360 12935 13279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940862.1 protein_id gnl|my_center|LOCUS_01360 14513 13389 gene locus_tag LOCUS_01370 14513 13389 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_01370 14740 15228 gene locus_tag LOCUS_01380 14740 15228 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940871.1 protein_id gnl|my_center|LOCUS_01380 15320 15760 gene locus_tag LOCUS_01390 15320 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:15509..15511,aa:Sec) note codon on position 64 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01390 16243 15863 gene locus_tag LOCUS_01400 16243 15863 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_01400 17513 16281 gene locus_tag LOCUS_01410 17513 16281 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826550.1 protein_id gnl|my_center|LOCUS_01410 18626 17544 gene locus_tag LOCUS_01420 18626 17544 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_01420 19037 19462 gene locus_tag LOCUS_01430 19037 19462 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_01430 19676 20584 gene locus_tag LOCUS_01440 19676 20584 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_01440 20630 21421 gene locus_tag LOCUS_01450 20630 21421 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_01450 21847 21449 gene locus_tag LOCUS_01460 21847 21449 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_01460 23579 22581 gene locus_tag LOCUS_01470 gene amrS 23579 22581 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_01470 23746 24948 gene locus_tag LOCUS_01480 23746 24948 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941586.1 protein_id gnl|my_center|LOCUS_01480 25436 24957 gene locus_tag LOCUS_01490 25436 24957 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 protein_id gnl|my_center|LOCUS_01490 25435 25596 gene locus_tag LOCUS_01500 25435 25596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 25798 27360 gene locus_tag LOCUS_01510 25798 27360 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940849.1 protein_id gnl|my_center|LOCUS_01510 27416 27631 gene locus_tag LOCUS_01520 27416 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 27903 28238 gene locus_tag LOCUS_01530 27903 28238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 28522 28743 gene locus_tag LOCUS_01540 28522 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 29584 28958 gene locus_tag LOCUS_01550 29584 28958 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_01550 30152 29691 gene locus_tag LOCUS_01560 30152 29691 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_01560 31026 30181 gene locus_tag LOCUS_01570 31026 30181 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence005 347 177 gene locus_tag LOCUS_01580 347 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 634 344 gene locus_tag LOCUS_01590 634 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 796 635 gene locus_tag LOCUS_01600 796 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 1001 738 gene locus_tag LOCUS_01610 1001 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 1312 998 gene locus_tag LOCUS_01620 1312 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1702 1322 gene locus_tag LOCUS_01630 1702 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1970 1680 gene locus_tag LOCUS_01640 1970 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2666 2214 gene locus_tag LOCUS_01650 2666 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 3048 3449 gene locus_tag LOCUS_01660 3048 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3638 3489 gene locus_tag LOCUS_01670 3638 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3784 4125 gene locus_tag LOCUS_01680 3784 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4149 4541 gene locus_tag LOCUS_01690 4149 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4815 6026 gene locus_tag LOCUS_01700 4815 6026 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_01700 6902 6213 gene locus_tag LOCUS_01710 6902 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 7149 6871 gene locus_tag LOCUS_01720 7149 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7869 7171 gene locus_tag LOCUS_01730 7869 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8476 8018 gene locus_tag LOCUS_01740 8476 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8825 8571 gene locus_tag LOCUS_01750 8825 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9298 8816 gene locus_tag LOCUS_01760 9298 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9975 9295 gene locus_tag LOCUS_01770 9975 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 11602 10223 gene locus_tag LOCUS_01780 11602 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 11853 11593 gene locus_tag LOCUS_01790 11853 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 12239 11841 gene locus_tag LOCUS_01800 12239 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 12406 12236 gene locus_tag LOCUS_01810 12406 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 23420 12471 gene locus_tag LOCUS_01820 23420 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 24901 23423 gene locus_tag LOCUS_01830 24901 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 25053 25805 gene locus_tag LOCUS_01840 25053 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 27085 25817 gene locus_tag LOCUS_01850 27085 25817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence006 357 566 gene locus_tag LOCUS_01860 357 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 1452 661 gene locus_tag LOCUS_01870 1452 661 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_01870 1851 2792 gene locus_tag LOCUS_01880 1851 2792 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_01880 2968 4326 gene locus_tag LOCUS_01890 2968 4326 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 4232 4450 gene locus_tag LOCUS_01900 4232 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01900 4703 6178 gene locus_tag LOCUS_01910 gene cysS 4703 6178 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_01910 6296 7921 gene locus_tag LOCUS_01920 6296 7921 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943864.1 protein_id gnl|my_center|LOCUS_01920 7918 8298 gene locus_tag LOCUS_01930 7918 8298 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943865.1 protein_id gnl|my_center|LOCUS_01930 8392 10896 gene locus_tag LOCUS_01940 8392 10896 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_01940 10971 13163 gene locus_tag LOCUS_01950 10971 13163 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_01950 13232 14257 gene locus_tag LOCUS_01960 gene galT 13232 14257 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943868.1 protein_id gnl|my_center|LOCUS_01960 14261 15127 gene locus_tag LOCUS_01970 14261 15127 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_01970 15239 16798 gene locus_tag LOCUS_01980 15239 16798 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943347.1 protein_id gnl|my_center|LOCUS_01980 17723 17037 gene locus_tag LOCUS_01990 17723 17037 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_01990 18171 19388 gene locus_tag LOCUS_02000 18171 19388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_02000 19487 21136 gene locus_tag LOCUS_02010 gene mdcA 19487 21136 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_02010 21184 21501 gene locus_tag LOCUS_02020 gene mdcC 21184 21501 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038694.1 protein_id gnl|my_center|LOCUS_02020 21857 21570 gene locus_tag LOCUS_02030 21857 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 21738 22409 gene locus_tag LOCUS_02040 21738 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 22406 23110 gene locus_tag LOCUS_02050 gene mdcE 22406 23110 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_02050 23111 23812 gene locus_tag LOCUS_02060 gene mdcG 23111 23812 CDS product malonate decarboxylase holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084091.1 protein_id gnl|my_center|LOCUS_02060 23785 24696 gene locus_tag LOCUS_02070 gene mdcB 23785 24696 CDS product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084090.1 protein_id gnl|my_center|LOCUS_02070 24713 25642 gene locus_tag LOCUS_02080 gene mdcH 24713 25642 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 protein_id gnl|my_center|LOCUS_02080 26249 25761 gene locus_tag LOCUS_02090 26249 25761 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_02090 26781 26467 gene locus_tag LOCUS_02100 26781 26467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 27220 26768 gene locus_tag LOCUS_02110 27220 26768 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence007 273 818 gene locus_tag LOCUS_02120 273 818 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_02120 2514 952 gene locus_tag LOCUS_02130 2514 952 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_02130 3749 2511 gene locus_tag LOCUS_02140 3749 2511 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_02140 4397 4960 gene locus_tag LOCUS_02150 4397 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5036 6217 gene locus_tag LOCUS_02160 gene aroC 5036 6217 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_02160 6210 6728 gene locus_tag LOCUS_02170 6210 6728 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_02170 6725 7804 gene locus_tag LOCUS_02180 gene aroB 6725 7804 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_02180 7808 8767 gene locus_tag LOCUS_02190 7808 8767 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044866.1 protein_id gnl|my_center|LOCUS_02190 8758 9120 gene locus_tag LOCUS_02200 8758 9120 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_02200 9122 9556 gene locus_tag LOCUS_02210 gene aroQ 9122 9556 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_02210 9634 10701 gene locus_tag LOCUS_02220 9634 10701 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_02220 10748 11218 gene locus_tag LOCUS_02230 gene accB 10748 11218 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_02230 11239 12579 gene locus_tag LOCUS_02240 gene accC 11239 12579 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_02240 12585 12971 gene locus_tag LOCUS_02250 gene gcvH 12585 12971 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_02250 13044 14528 gene locus_tag LOCUS_02260 13044 14528 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_02260 14528 15391 gene locus_tag LOCUS_02270 14528 15391 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_02270 15900 15433 gene locus_tag LOCUS_02280 15900 15433 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_02280 16266 15973 gene locus_tag LOCUS_02290 16266 15973 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_02290 16440 17858 gene locus_tag LOCUS_02300 16440 17858 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_02300 17959 18831 gene locus_tag LOCUS_02310 gene nifU 17959 18831 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_02310 18828 20003 gene locus_tag LOCUS_02320 gene nifS 18828 20003 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_02320 20126 21436 gene locus_tag LOCUS_02330 gene odhB 20126 21436 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_02330 21504 22928 gene locus_tag LOCUS_02340 gene lpdA 21504 22928 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943085.1 protein_id gnl|my_center|LOCUS_02340 23033 24973 gene locus_tag LOCUS_02350 23033 24973 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_02350 24970 26412 gene locus_tag LOCUS_02360 gene pyk 24970 26412 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence008 1101 40 gene locus_tag LOCUS_02370 1101 40 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_02370 1976 1098 gene locus_tag LOCUS_02380 1976 1098 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_02380 3994 1973 gene locus_tag LOCUS_02390 3994 1973 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942856.1 protein_id gnl|my_center|LOCUS_02390 4695 4231 gene locus_tag LOCUS_02400 4695 4231 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942858.1 protein_id gnl|my_center|LOCUS_02400 5483 4737 gene locus_tag LOCUS_02410 5483 4737 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942860.1 protein_id gnl|my_center|LOCUS_02410 6293 5493 gene locus_tag LOCUS_02420 6293 5493 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_02420 8407 6299 gene locus_tag LOCUS_02430 8407 6299 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_02430 8815 8435 gene locus_tag LOCUS_02440 8815 8435 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_02440 9902 8847 gene locus_tag LOCUS_02450 9902 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11333 9987 gene locus_tag LOCUS_02460 gene der 11333 9987 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_02460 12747 11440 gene locus_tag LOCUS_02470 12747 11440 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_02470 14667 12940 gene locus_tag LOCUS_02480 14667 12940 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_02480 15910 14873 gene locus_tag LOCUS_02490 gene ispG 15910 14873 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_02490 17326 16079 gene locus_tag LOCUS_02500 17326 16079 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_02500 17950 17504 gene locus_tag LOCUS_02510 gene rpiB 17950 17504 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_02510 19282 18047 gene locus_tag LOCUS_02520 gene fabF 19282 18047 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_02520 19599 19366 gene locus_tag LOCUS_02530 gene acpP 19599 19366 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_02530 20449 19709 gene locus_tag LOCUS_02540 gene fabG 20449 19709 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_02540 21390 20446 gene locus_tag LOCUS_02550 gene fabD 21390 20446 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_02550 22414 21431 gene locus_tag LOCUS_02560 22414 21431 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_02560 23441 22425 gene locus_tag LOCUS_02570 gene plsX 23441 22425 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_02570 23681 23496 gene locus_tag LOCUS_02580 gene rpmF 23681 23496 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_02580 24271 23729 gene locus_tag LOCUS_02590 24271 23729 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_02590 25850 24345 gene locus_tag LOCUS_02600 gene malQ 25850 24345 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence009 <1 924 gene locus_tag LOCUS_02610 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126140198.1:pectinesterase family protein 1162 992 gene locus_tag LOCUS_02620 1162 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2370 1159 gene locus_tag LOCUS_02630 2370 1159 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_02630 5585 2589 gene locus_tag LOCUS_02640 gene pruA 5585 2589 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944006.1 protein_id gnl|my_center|LOCUS_02640 6123 5680 gene locus_tag LOCUS_02650 6123 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7400 6120 gene locus_tag LOCUS_02660 7400 6120 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943814.1 protein_id gnl|my_center|LOCUS_02660 8351 7476 gene locus_tag LOCUS_02670 8351 7476 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044926.1 protein_id gnl|my_center|LOCUS_02670 8571 9455 gene locus_tag LOCUS_02680 8571 9455 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944036.1 protein_id gnl|my_center|LOCUS_02680 10252 9476 gene locus_tag LOCUS_02690 10252 9476 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_02690 10335 11306 gene locus_tag LOCUS_02700 10335 11306 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_02700 12462 11257 gene locus_tag LOCUS_02710 gene coaBC 12462 11257 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_02710 13098 12475 gene locus_tag LOCUS_02720 13098 12475 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_02720 13225 13383 gene locus_tag LOCUS_02730 13225 13383 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943806.1 protein_id gnl|my_center|LOCUS_02730 13598 13419 gene locus_tag LOCUS_02740 13598 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943807.1 protein_id gnl|my_center|LOCUS_02740 14713 13640 gene locus_tag LOCUS_02750 14713 13640 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_02750 15032 16879 gene locus_tag LOCUS_02760 15032 16879 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_02760 17445 17224 gene locus_tag LOCUS_02770 17445 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 17905 17462 gene locus_tag LOCUS_02780 17905 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 18268 18005 gene locus_tag LOCUS_02790 18268 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 18721 18338 gene locus_tag LOCUS_02800 18721 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 19534 18755 gene locus_tag LOCUS_02810 gene nrfC 19534 18755 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466518.1 protein_id gnl|my_center|LOCUS_02810 20803 19583 gene locus_tag LOCUS_02820 20803 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 21290 20865 gene locus_tag LOCUS_02830 21290 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 22939 21593 gene locus_tag LOCUS_02840 gene orpR 22939 21593 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_02840 23269 23012 gene locus_tag LOCUS_02850 23269 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 25341 23527 gene locus_tag LOCUS_02860 25341 23527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 25811 25449 gene locus_tag LOCUS_02870 25811 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence010 1054 3552 gene locus_tag LOCUS_02880 1054 3552 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943129.1 protein_id gnl|my_center|LOCUS_02880 3612 4982 gene locus_tag LOCUS_02890 3612 4982 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_02890 5589 5017 gene locus_tag LOCUS_02900 5589 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 6068 7219 gene locus_tag LOCUS_02910 6068 7219 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_02910 7299 7538 gene locus_tag LOCUS_02920 7299 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02920 7614 8165 gene locus_tag LOCUS_02930 7614 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02930 8183 9343 gene locus_tag LOCUS_02940 8183 9343 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_02940 9343 10056 gene locus_tag LOCUS_02950 9343 10056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_02950 10071 10775 gene locus_tag LOCUS_02960 10071 10775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_02960 10888 11313 gene locus_tag LOCUS_02970 10888 11313 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942653.1 protein_id gnl|my_center|LOCUS_02970 12207 11347 gene locus_tag LOCUS_02980 12207 11347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_02980 13190 12204 gene locus_tag LOCUS_02990 13190 12204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_02990 14807 13191 gene locus_tag LOCUS_03000 14807 13191 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_03000 16513 14804 gene locus_tag LOCUS_03010 16513 14804 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_03010 16655 18214 gene locus_tag LOCUS_03020 16655 18214 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_03020 18216 18473 gene locus_tag LOCUS_03030 18216 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942077.1 protein_id gnl|my_center|LOCUS_03030 18470 21718 gene locus_tag LOCUS_03040 18470 21718 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942076.1 protein_id gnl|my_center|LOCUS_03040 21738 22073 gene locus_tag LOCUS_03050 21738 22073 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_03050 22127 22555 gene locus_tag LOCUS_03060 22127 22555 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_03060 23052 22552 gene locus_tag LOCUS_03070 23052 22552 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_03070 23816 23151 gene locus_tag LOCUS_03080 gene cybH 23816 23151 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_03080 <25078 23831 gene locus_tag LOCUS_03090 <25078 23831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940798.1:nickel-dependent hydrogenase large subunit >Feature sequence011 <1 1204 gene locus_tag LOCUS_03100 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545470.1:S-layer homology domain-containing protein 1235 2137 gene locus_tag LOCUS_03110 1235 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546408.1 protein_id gnl|my_center|LOCUS_03110 2369 3301 gene locus_tag LOCUS_03120 2369 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3401 4291 gene locus_tag LOCUS_03130 3401 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4292 4810 gene locus_tag LOCUS_03140 4292 4810 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389161.1 protein_id gnl|my_center|LOCUS_03140 4967 5305 gene locus_tag LOCUS_03150 4967 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5283 6146 gene locus_tag LOCUS_03160 5283 6146 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_03160 6365 6189 gene locus_tag LOCUS_03170 6365 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7498 6467 gene locus_tag LOCUS_03180 7498 6467 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942639.1 protein_id gnl|my_center|LOCUS_03180 7681 8505 gene locus_tag LOCUS_03190 gene nadC 7681 8505 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_03190 8510 9487 gene locus_tag LOCUS_03200 8510 9487 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_03200 9489 10253 gene locus_tag LOCUS_03210 9489 10253 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_03210 10292 12388 gene locus_tag LOCUS_03220 gene fusA 10292 12388 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_03220 12468 13535 gene locus_tag LOCUS_03230 12468 13535 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942577.1 protein_id gnl|my_center|LOCUS_03230 13542 14480 gene locus_tag LOCUS_03240 13542 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942576.1 protein_id gnl|my_center|LOCUS_03240 14495 15370 gene locus_tag LOCUS_03250 14495 15370 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942575.1 protein_id gnl|my_center|LOCUS_03250 15381 16079 gene locus_tag LOCUS_03260 15381 16079 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_03260 16689 16057 gene locus_tag LOCUS_03270 16689 16057 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_03270 16773 17600 gene locus_tag LOCUS_03280 16773 17600 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942570.1 protein_id gnl|my_center|LOCUS_03280 18469 17582 gene locus_tag LOCUS_03290 18469 17582 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_03290 18548 19204 gene locus_tag LOCUS_03300 18548 19204 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_03300 19348 20214 gene locus_tag LOCUS_03310 19348 20214 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942097.1 protein_id gnl|my_center|LOCUS_03310 20294 21898 gene locus_tag LOCUS_03320 20294 21898 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943925.1 protein_id gnl|my_center|LOCUS_03320 22033 22881 gene locus_tag LOCUS_03330 gene rpoH 22033 22881 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941316.1 protein_id gnl|my_center|LOCUS_03330 23023 23098 gene locus_tag LOCUS_t00020 23023 23098 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23124 23209 gene locus_tag LOCUS_t00030 23124 23209 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 23317 23393 gene locus_tag LOCUS_t00040 23317 23393 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23401 23476 gene locus_tag LOCUS_t00050 23401 23476 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 994 266 gene locus_tag LOCUS_03340 994 266 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943929.1 protein_id gnl|my_center|LOCUS_03340 1716 997 gene locus_tag LOCUS_03350 gene ccsA 1716 997 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_03350 2447 1800 gene locus_tag LOCUS_03360 2447 1800 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_03360 2618 3529 gene locus_tag LOCUS_03370 2618 3529 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_03370 3692 6079 gene locus_tag LOCUS_03380 3692 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6347 6538 gene locus_tag LOCUS_03390 6347 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8896 6593 gene locus_tag LOCUS_03400 8896 6593 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_03400 9073 10122 gene locus_tag LOCUS_03410 9073 10122 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546851.1 protein_id gnl|my_center|LOCUS_03410 10189 12282 gene locus_tag LOCUS_03420 10189 12282 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_03420 12463 13221 gene locus_tag LOCUS_03430 12463 13221 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_03430 13227 14009 gene locus_tag LOCUS_03440 13227 14009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545061.1 protein_id gnl|my_center|LOCUS_03440 14136 15080 gene locus_tag LOCUS_03450 14136 15080 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_03450 15098 15391 gene locus_tag LOCUS_03460 15098 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942296.1 protein_id gnl|my_center|LOCUS_03460 16524 15478 gene locus_tag LOCUS_03470 16524 15478 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_03470 18685 16517 gene locus_tag LOCUS_03480 18685 16517 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942299.1 protein_id gnl|my_center|LOCUS_03480 18921 21329 gene locus_tag LOCUS_03490 18921 21329 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_03490 21552 22931 gene locus_tag LOCUS_03500 21552 22931 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942302.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence013 <1 1527 gene locus_tag LOCUS_03510 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942111.1:NADP-dependent isocitrate dehydrogenase 1682 2794 gene locus_tag LOCUS_03520 1682 2794 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941447.1 protein_id gnl|my_center|LOCUS_03520 2778 3716 gene locus_tag LOCUS_03530 gene hybA 2778 3716 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941448.1 protein_id gnl|my_center|LOCUS_03530 3713 5020 gene locus_tag LOCUS_03540 gene hybB 3713 5020 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941449.1 protein_id gnl|my_center|LOCUS_03540 5202 6881 gene locus_tag LOCUS_03550 5202 6881 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_03550 6889 7449 gene locus_tag LOCUS_03560 6889 7449 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_03560 7480 7656 gene locus_tag LOCUS_03570 7480 7656 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941452.1 protein_id gnl|my_center|LOCUS_03570 7792 10875 gene locus_tag LOCUS_03580 7792 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 10866 11096 gene locus_tag LOCUS_03590 10866 11096 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_03590 11093 12184 gene locus_tag LOCUS_03600 gene hypD 11093 12184 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_03600 12348 13361 gene locus_tag LOCUS_03610 gene hypE 12348 13361 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_03610 13369 13647 gene locus_tag LOCUS_03620 13369 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 14605 13709 gene locus_tag LOCUS_03630 14605 13709 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_03630 16312 14921 gene locus_tag LOCUS_03640 16312 14921 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_03640 19020 16444 gene locus_tag LOCUS_03650 19020 16444 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214114.1 protein_id gnl|my_center|LOCUS_03650 19424 20077 gene locus_tag LOCUS_03660 19424 20077 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 protein_id gnl|my_center|LOCUS_03660 20074 21126 gene locus_tag LOCUS_03670 20074 21126 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176676.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence014 469 14 gene locus_tag LOCUS_03680 469 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1034 447 gene locus_tag LOCUS_03690 1034 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2019 1132 gene locus_tag LOCUS_03700 2019 1132 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 protein_id gnl|my_center|LOCUS_03700 2291 3040 gene locus_tag LOCUS_03710 gene larB 2291 3040 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_03710 3076 5631 gene locus_tag LOCUS_03720 3076 5631 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_03720 5811 6230 gene locus_tag LOCUS_03730 5811 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6250 7098 gene locus_tag LOCUS_03740 6250 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 7408 7743 gene locus_tag LOCUS_03750 7408 7743 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362471.1 protein_id gnl|my_center|LOCUS_03750 7759 8949 gene locus_tag LOCUS_03760 gene larC 7759 8949 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_03760 8946 10193 gene locus_tag LOCUS_03770 8946 10193 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_03770 10398 11243 gene locus_tag LOCUS_03780 10398 11243 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_03780 11306 11776 gene locus_tag LOCUS_03790 11306 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11742 12575 gene locus_tag LOCUS_03800 11742 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 12835 13857 gene locus_tag LOCUS_03810 gene recA 12835 13857 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_03810 13928 15082 gene locus_tag LOCUS_03820 13928 15082 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_03820 15063 15539 gene locus_tag LOCUS_03830 15063 15539 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940823.1 protein_id gnl|my_center|LOCUS_03830 15571 16761 gene locus_tag LOCUS_03840 15571 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 16773 18767 gene locus_tag LOCUS_03850 16773 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 18821 21034 gene locus_tag LOCUS_03860 18821 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence015 1164 2084 gene locus_tag LOCUS_03870 1164 2084 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_03870 2692 3963 gene locus_tag LOCUS_03880 2692 3963 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940858.1 protein_id gnl|my_center|LOCUS_03880 4014 4358 gene locus_tag LOCUS_03890 4014 4358 CDS product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940857.1 protein_id gnl|my_center|LOCUS_03890 4492 5430 gene locus_tag LOCUS_03900 4492 5430 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940856.1 protein_id gnl|my_center|LOCUS_03900 7063 5537 gene locus_tag LOCUS_03910 7063 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 7652 7086 gene locus_tag LOCUS_03920 7652 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 10774 7853 gene locus_tag LOCUS_03930 10774 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 11236 10787 gene locus_tag LOCUS_03940 11236 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 11649 11254 gene locus_tag LOCUS_03950 11649 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 11852 11679 gene locus_tag LOCUS_03960 11852 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 15592 12200 gene locus_tag LOCUS_03970 15592 12200 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_03970 16599 15589 gene locus_tag LOCUS_03980 16599 15589 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_03980 16828 18339 gene locus_tag LOCUS_03990 16828 18339 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044917.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence016 1571 141 gene locus_tag LOCUS_04000 1571 141 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_04000 2219 1578 gene locus_tag LOCUS_04010 2219 1578 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_04010 3133 2225 gene locus_tag LOCUS_04020 3133 2225 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_04020 5212 3236 gene locus_tag LOCUS_04030 5212 3236 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941399.1 protein_id gnl|my_center|LOCUS_04030 5390 5626 gene locus_tag LOCUS_04040 5390 5626 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941398.1 protein_id gnl|my_center|LOCUS_04040 5619 5957 gene locus_tag LOCUS_04050 5619 5957 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941397.1 protein_id gnl|my_center|LOCUS_04050 7765 6413 gene locus_tag LOCUS_04060 7765 6413 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_04060 8180 9043 gene locus_tag LOCUS_04070 gene mtnP 8180 9043 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_04070 9066 9989 gene locus_tag LOCUS_04080 9066 9989 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_04080 10070 10831 gene locus_tag LOCUS_04090 10070 10831 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_04090 10848 11711 gene locus_tag LOCUS_04100 10848 11711 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_04100 11909 12655 gene locus_tag LOCUS_04110 11909 12655 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941777.1 protein_id gnl|my_center|LOCUS_04110 12716 13090 gene locus_tag LOCUS_04120 12716 13090 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_04120 13120 13572 gene locus_tag LOCUS_04130 13120 13572 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_04130 13619 14809 gene locus_tag LOCUS_04140 13619 14809 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_04140 14886 15284 gene locus_tag LOCUS_04150 14886 15284 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941781.1 protein_id gnl|my_center|LOCUS_04150 15291 16901 gene locus_tag LOCUS_04160 15291 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_04160 17065 18165 gene locus_tag LOCUS_04170 17065 18165 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence017 2384 450 gene locus_tag LOCUS_04180 2384 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3541 2579 gene locus_tag LOCUS_04190 3541 2579 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545313.1 protein_id gnl|my_center|LOCUS_04190 4731 3547 gene locus_tag LOCUS_04200 gene purT 4731 3547 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_04200 5704 4769 gene locus_tag LOCUS_04210 5704 4769 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942569.1 protein_id gnl|my_center|LOCUS_04210 6852 5773 gene locus_tag LOCUS_04220 gene lptG 6852 5773 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_04220 8006 6849 gene locus_tag LOCUS_04230 gene lptF 8006 6849 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_04230 8491 8111 gene locus_tag LOCUS_04240 8491 8111 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_04240 9118 8540 gene locus_tag LOCUS_04250 9118 8540 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_04250 10595 9267 gene locus_tag LOCUS_04260 10595 9267 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_04260 12054 10858 gene locus_tag LOCUS_04270 12054 10858 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_04270 12144 12743 gene locus_tag LOCUS_04280 12144 12743 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943933.1 protein_id gnl|my_center|LOCUS_04280 12982 13947 gene locus_tag LOCUS_04290 12982 13947 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_04290 13947 14468 gene locus_tag LOCUS_04300 13947 14468 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_04300 14560 15126 gene locus_tag LOCUS_04310 14560 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 15186 15707 gene locus_tag LOCUS_04320 gene lptA 15186 15707 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_04320 15691 16431 gene locus_tag LOCUS_04330 gene lptB 15691 16431 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_04330 16496 17935 gene locus_tag LOCUS_04340 gene rpoN 16496 17935 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence018 379 2841 gene locus_tag LOCUS_04350 379 2841 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_04350 2852 3031 gene locus_tag LOCUS_04360 2852 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3946 3125 gene locus_tag LOCUS_04370 3946 3125 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943194.1 protein_id gnl|my_center|LOCUS_04370 4144 3953 gene locus_tag LOCUS_04380 4144 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 5790 4480 gene locus_tag LOCUS_04390 5790 4480 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947671.1 protein_id gnl|my_center|LOCUS_04390 7516 5918 gene locus_tag LOCUS_04400 7516 5918 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_04400 8835 7777 gene locus_tag LOCUS_04410 8835 7777 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_04410 9344 9526 gene locus_tag LOCUS_04420 9344 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9586 10002 gene locus_tag LOCUS_04430 9586 10002 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_04430 10111 11838 gene locus_tag LOCUS_04440 10111 11838 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_04440 12947 12060 gene locus_tag LOCUS_04450 12947 12060 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_04450 14701 12944 gene locus_tag LOCUS_04460 14701 12944 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_04460 15556 14720 gene locus_tag LOCUS_04470 15556 14720 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943197.1 protein_id gnl|my_center|LOCUS_04470 16101 15589 gene locus_tag LOCUS_04480 16101 15589 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_04480 17307 16240 gene locus_tag LOCUS_04490 17307 16240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_04490 <18275 17342 gene locus_tag LOCUS_04500 <18275 17342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546697.1:M28 family peptidase >Feature sequence019 <1 2084 gene locus_tag LOCUS_04510 <1 2084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942849.1:leucine--tRNA ligase 2290 2775 gene locus_tag LOCUS_04520 2290 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2777 3775 gene locus_tag LOCUS_04530 gene holA 2777 3775 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_04530 5006 3831 gene locus_tag LOCUS_04540 5006 3831 CDS product CdaR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368175.1 protein_id gnl|my_center|LOCUS_04540 5285 6619 gene locus_tag LOCUS_04550 5285 6619 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531968.1 protein_id gnl|my_center|LOCUS_04550 6642 7961 gene locus_tag LOCUS_04560 6642 7961 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_04560 8300 8037 gene locus_tag LOCUS_04570 gene rpsT 8300 8037 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_04570 9010 8390 gene locus_tag LOCUS_04580 gene purN 9010 8390 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_04580 10062 9010 gene locus_tag LOCUS_04590 gene purM 10062 9010 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_04590 10235 10828 gene locus_tag LOCUS_04600 10235 10828 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_04600 10833 11444 gene locus_tag LOCUS_04610 gene pgsA 10833 11444 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_04610 12107 11433 gene locus_tag LOCUS_04620 12107 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 13072 12104 gene locus_tag LOCUS_04630 13072 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 13213 14262 gene locus_tag LOCUS_04640 13213 14262 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_04640 15222 14317 gene locus_tag LOCUS_04650 gene epmA 15222 14317 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_04650 15859 15296 gene locus_tag LOCUS_04660 gene efp 15859 15296 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_04660 16169 15951 gene locus_tag LOCUS_04670 gene infA 16169 15951 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_04670 16879 16328 gene locus_tag LOCUS_04680 16879 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence020 217 1092 gene locus_tag LOCUS_04690 217 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1118 2959 gene locus_tag LOCUS_04700 1118 2959 CDS product TIGR04442 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943104.1 protein_id gnl|my_center|LOCUS_04700 4174 3119 gene locus_tag LOCUS_04710 4174 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_04710 5952 4171 gene locus_tag LOCUS_04720 5952 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6888 6118 gene locus_tag LOCUS_04730 6888 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6842 7039 gene locus_tag LOCUS_04740 6842 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 7413 10235 gene locus_tag LOCUS_04750 7413 10235 CDS product GPMC system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943112.1 protein_id gnl|my_center|LOCUS_04750 12591 10237 gene locus_tag LOCUS_04760 12591 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 12788 12609 gene locus_tag LOCUS_04770 12788 12609 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_04770 13067 14443 gene locus_tag LOCUS_04780 13067 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 14440 15099 gene locus_tag LOCUS_04790 14440 15099 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064417.1 protein_id gnl|my_center|LOCUS_04790 16738 15173 gene locus_tag LOCUS_04800 16738 15173 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence021 1281 3095 gene locus_tag LOCUS_04810 1281 3095 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_04810 3207 5597 gene locus_tag LOCUS_04820 3207 5597 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_04820 5706 6878 gene locus_tag LOCUS_04830 5706 6878 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_04830 6950 8731 gene locus_tag LOCUS_04840 6950 8731 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025016.1 protein_id gnl|my_center|LOCUS_04840 8815 9753 gene locus_tag LOCUS_04850 8815 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 9765 11774 gene locus_tag LOCUS_04860 9765 11774 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_04860 11833 12384 gene locus_tag LOCUS_04870 11833 12384 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_04870 12387 12794 gene locus_tag LOCUS_04880 12387 12794 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114776.1 protein_id gnl|my_center|LOCUS_04880 12791 13564 gene locus_tag LOCUS_04890 12791 13564 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_04890 13999 13601 gene locus_tag LOCUS_04900 13999 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 14238 16223 gene locus_tag LOCUS_04910 14238 16223 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence022 2088 523 gene locus_tag LOCUS_04920 gene murJ 2088 523 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_04920 2586 2218 gene locus_tag LOCUS_04930 2586 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4412 2679 gene locus_tag LOCUS_04940 4412 2679 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_04940 5772 4423 gene locus_tag LOCUS_04950 gene rmuC 5772 4423 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_04950 6101 6643 gene locus_tag LOCUS_04960 6101 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7497 6676 gene locus_tag LOCUS_04970 gene rsmA 7497 6676 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_04970 8516 7494 gene locus_tag LOCUS_04980 gene tsaD 8516 7494 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_04980 9928 8612 gene locus_tag LOCUS_04990 9928 8612 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_04990 11254 10106 gene locus_tag LOCUS_05000 11254 10106 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_05000 12778 11372 gene locus_tag LOCUS_05010 12778 11372 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942514.1 protein_id gnl|my_center|LOCUS_05010 13842 12775 gene locus_tag LOCUS_05020 13842 12775 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence023 908 180 gene locus_tag LOCUS_05030 gene recO 908 180 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_05030 3648 913 gene locus_tag LOCUS_05040 gene polA 3648 913 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_05040 3836 3645 gene locus_tag LOCUS_05050 3836 3645 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941208.1 protein_id gnl|my_center|LOCUS_05050 4732 3950 gene locus_tag LOCUS_05060 4732 3950 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_05060 4965 5420 gene locus_tag LOCUS_05070 4965 5420 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941183.1 protein_id gnl|my_center|LOCUS_05070 5655 6449 gene locus_tag LOCUS_05080 5655 6449 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_05080 6459 6662 gene locus_tag LOCUS_05090 6459 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943178.1 protein_id gnl|my_center|LOCUS_05090 7525 6713 gene locus_tag LOCUS_05100 gene proC 7525 6713 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_05100 8025 7645 gene locus_tag LOCUS_05110 8025 7645 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_05110 8887 8018 gene locus_tag LOCUS_05120 gene hpnK 8887 8018 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_05120 10314 8884 gene locus_tag LOCUS_05130 gene hpnJ 10314 8884 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_05130 10796 10452 gene locus_tag LOCUS_05140 10796 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11701 10856 gene locus_tag LOCUS_05150 11701 10856 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_05150 11852 12226 gene locus_tag LOCUS_05160 11852 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943064.1 protein_id gnl|my_center|LOCUS_05160 12262 13014 gene locus_tag LOCUS_05170 12262 13014 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_05170 14693 13155 gene locus_tag LOCUS_05180 14693 13155 CDS product R3H domain-containing nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244518.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence024 336 941 gene locus_tag LOCUS_05190 336 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 978 2267 gene locus_tag LOCUS_05200 978 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2400 3425 gene locus_tag LOCUS_05210 2400 3425 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210042844.1 protein_id gnl|my_center|LOCUS_05210 3439 4353 gene locus_tag LOCUS_05220 3439 4353 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_05220 5786 4566 gene locus_tag LOCUS_05230 5786 4566 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_05230 6005 7054 gene locus_tag LOCUS_05240 6005 7054 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_05240 7210 8358 gene locus_tag LOCUS_05250 7210 8358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_05250 8469 9050 gene locus_tag LOCUS_05260 8469 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 9069 9524 gene locus_tag LOCUS_05270 9069 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9793 10644 gene locus_tag LOCUS_05280 9793 10644 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_05280 11392 10667 gene locus_tag LOCUS_05290 11392 10667 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942542.1 protein_id gnl|my_center|LOCUS_05290 11513 11603 gene locus_tag LOCUS_t00060 11513 11603 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11958 13646 gene locus_tag LOCUS_05300 gene dnaX 11958 13646 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_05300 13711 14025 gene locus_tag LOCUS_05310 13711 14025 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_05310 14284 14877 gene locus_tag LOCUS_05320 gene recR 14284 14877 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940773.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence025 2686 4536 gene locus_tag LOCUS_05330 2686 4536 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940946.1 protein_id gnl|my_center|LOCUS_05330 4675 5829 gene locus_tag LOCUS_05340 4675 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6763 5840 gene locus_tag LOCUS_05350 6763 5840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_05350 6653 6949 gene locus_tag LOCUS_05360 6653 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7033 7206 gene locus_tag LOCUS_05370 7033 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943301.1 protein_id gnl|my_center|LOCUS_05370 8512 7292 gene locus_tag LOCUS_05380 8512 7292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_05380 9276 8509 gene locus_tag LOCUS_05390 9276 8509 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_05390 10220 9819 gene locus_tag LOCUS_05400 10220 9819 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_05400 10478 11197 gene locus_tag LOCUS_05410 10478 11197 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_05410 12505 11366 gene locus_tag LOCUS_05420 12505 11366 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_05420 13014 12502 gene locus_tag LOCUS_05430 13014 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 13640 13170 gene locus_tag LOCUS_05440 gene greB 13640 13170 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 protein_id gnl|my_center|LOCUS_05440 14532 13735 gene locus_tag LOCUS_05450 14532 13735 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_05450 14829 15002 gene locus_tag LOCUS_05460 14829 15002 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943975.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence026 139 1023 gene locus_tag LOCUS_05470 139 1023 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 protein_id gnl|my_center|LOCUS_05470 1111 3204 gene locus_tag LOCUS_05480 1111 3204 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_05480 5334 3208 gene locus_tag LOCUS_05490 gene lptD 5334 3208 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_05490 6624 5347 gene locus_tag LOCUS_05500 6624 5347 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_05500 7480 6626 gene locus_tag LOCUS_05510 gene accD 7480 6626 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_05510 8428 7625 gene locus_tag LOCUS_05520 gene trpA 8428 7625 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_05520 10630 8471 gene locus_tag LOCUS_05530 10630 8471 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943007.1 protein_id gnl|my_center|LOCUS_05530 11399 10782 gene locus_tag LOCUS_05540 11399 10782 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943009.1 protein_id gnl|my_center|LOCUS_05540 12857 11802 gene locus_tag LOCUS_05550 gene cydB 12857 11802 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_05550 14258 12861 gene locus_tag LOCUS_05560 14258 12861 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_05560 14851 14447 gene locus_tag LOCUS_05570 14851 14447 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence027 505 1515 gene locus_tag LOCUS_05580 505 1515 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_05580 1664 2386 gene locus_tag LOCUS_05590 1664 2386 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_05590 2379 2771 gene locus_tag LOCUS_05600 2379 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942394.1 protein_id gnl|my_center|LOCUS_05600 2768 4087 gene locus_tag LOCUS_05610 gene rlmD 2768 4087 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_05610 4099 5133 gene locus_tag LOCUS_05620 4099 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942392.1 protein_id gnl|my_center|LOCUS_05620 5173 5448 gene locus_tag LOCUS_05630 5173 5448 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_05630 5587 7230 gene locus_tag LOCUS_05640 5587 7230 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393317.1 protein_id gnl|my_center|LOCUS_05640 7220 8143 gene locus_tag LOCUS_05650 7220 8143 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_05650 9057 8092 gene locus_tag LOCUS_05660 9057 8092 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545926.1 protein_id gnl|my_center|LOCUS_05660 10030 9050 gene locus_tag LOCUS_05670 10030 9050 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546869.1 protein_id gnl|my_center|LOCUS_05670 10704 10027 gene locus_tag LOCUS_05680 10704 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 10885 12660 gene locus_tag LOCUS_05690 gene iorA 10885 12660 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_05690 12657 13235 gene locus_tag LOCUS_05700 12657 13235 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_05700 13247 13822 gene locus_tag LOCUS_05710 13247 13822 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence028 717 106 gene locus_tag LOCUS_05720 717 106 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_05720 1360 1088 gene locus_tag LOCUS_05730 1360 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 1547 1371 gene locus_tag LOCUS_05740 1547 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2706 1666 gene locus_tag LOCUS_05750 gene ftsY 2706 1666 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_05750 3062 2706 gene locus_tag LOCUS_05760 3062 2706 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941792.1 protein_id gnl|my_center|LOCUS_05760 6727 3197 gene locus_tag LOCUS_05770 gene smc 6727 3197 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_05770 9288 6898 gene locus_tag LOCUS_05780 9288 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 10001 9780 gene locus_tag LOCUS_05790 10001 9780 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_05790 11533 10079 gene locus_tag LOCUS_05800 11533 10079 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_05800 11713 12003 gene locus_tag LOCUS_05810 11713 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12000 12299 gene locus_tag LOCUS_05820 12000 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <14001 12742 gene locus_tag LOCUS_05830 <14001 12742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941590.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence029 1736 2014 gene locus_tag LOCUS_05840 1736 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 1977 2390 gene locus_tag LOCUS_05850 1977 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2411 3274 gene locus_tag LOCUS_05860 2411 3274 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582534.1 protein_id gnl|my_center|LOCUS_05860 3821 3573 gene locus_tag LOCUS_05870 3821 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 4008 4997 gene locus_tag LOCUS_05880 4008 4997 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_05880 5053 6291 gene locus_tag LOCUS_05890 5053 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6487 7356 gene locus_tag LOCUS_05900 6487 7356 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948463.1 protein_id gnl|my_center|LOCUS_05900 7358 8527 gene locus_tag LOCUS_05910 7358 8527 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 protein_id gnl|my_center|LOCUS_05910 8746 9399 gene locus_tag LOCUS_05920 gene elbB 8746 9399 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940751.1 protein_id gnl|my_center|LOCUS_05920 9502 10770 gene locus_tag LOCUS_05930 9502 10770 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_05930 13494 10807 gene locus_tag LOCUS_05940 13494 10807 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence030 1314 559 gene locus_tag LOCUS_05950 1314 559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_05950 2123 1311 gene locus_tag LOCUS_05960 gene cbiQ 2123 1311 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_05960 3280 2210 gene locus_tag LOCUS_05970 3280 2210 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_05970 3492 3698 gene locus_tag LOCUS_05980 3492 3698 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942507.1 protein_id gnl|my_center|LOCUS_05980 3729 4793 gene locus_tag LOCUS_05990 3729 4793 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_05990 4880 5623 gene locus_tag LOCUS_06000 4880 5623 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_06000 5637 6179 gene locus_tag LOCUS_06010 5637 6179 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942504.1 protein_id gnl|my_center|LOCUS_06010 6231 6304 gene locus_tag LOCUS_t00070 6231 6304 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6482 8284 gene locus_tag LOCUS_06020 gene lepA 6482 8284 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_06020 8302 8982 gene locus_tag LOCUS_06030 gene lepB 8302 8982 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_06030 9133 10917 gene locus_tag LOCUS_06040 gene aspS 9133 10917 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_06040 10928 11626 gene locus_tag LOCUS_06050 10928 11626 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942110.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence031 174 419 gene locus_tag LOCUS_06060 174 419 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943601.1 protein_id gnl|my_center|LOCUS_06060 424 1683 gene locus_tag LOCUS_06070 gene larA 424 1683 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_06070 3220 1955 gene locus_tag LOCUS_06080 3220 1955 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_06080 3452 4156 gene locus_tag LOCUS_06090 3452 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06090 4163 4429 gene locus_tag LOCUS_06100 4163 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06100 4606 5268 gene locus_tag LOCUS_06110 4606 5268 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966840.1 protein_id gnl|my_center|LOCUS_06110 5411 7231 gene locus_tag LOCUS_06120 5411 7231 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941997.1 protein_id gnl|my_center|LOCUS_06120 7396 8454 gene locus_tag LOCUS_06130 7396 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 8485 10860 gene locus_tag LOCUS_06140 8485 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 11236 13569 gene locus_tag LOCUS_06150 11236 13569 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948579.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence032 <1 1040 gene locus_tag LOCUS_06160 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942422.1:tetratricopeptide repeat protein 1066 1686 gene locus_tag LOCUS_06170 1066 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1742 2227 gene locus_tag LOCUS_06180 1742 2227 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_06180 2229 2699 gene locus_tag LOCUS_06190 2229 2699 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_06190 2704 3393 gene locus_tag LOCUS_06200 gene ftsE 2704 3393 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_06200 3350 4396 gene locus_tag LOCUS_06210 gene ftsX 3350 4396 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_06210 4320 5504 gene locus_tag LOCUS_06220 4320 5504 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_06220 5539 6903 gene locus_tag LOCUS_06230 5539 6903 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_06230 7255 7995 gene locus_tag LOCUS_06240 7255 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 9473 8067 gene locus_tag LOCUS_06250 9473 8067 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942412.1 protein_id gnl|my_center|LOCUS_06250 9596 10945 gene locus_tag LOCUS_06260 gene xseA 9596 10945 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_06260 10992 11222 gene locus_tag LOCUS_06270 10992 11222 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_06270 11303 12196 gene locus_tag LOCUS_06280 11303 12196 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence033 2027 1311 gene locus_tag LOCUS_06290 2027 1311 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941739.1 protein_id gnl|my_center|LOCUS_06290 3049 2030 gene locus_tag LOCUS_06300 gene ruvB 3049 2030 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_06300 3418 3197 gene locus_tag LOCUS_06310 3418 3197 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545978.1 protein_id gnl|my_center|LOCUS_06310 3885 3436 gene locus_tag LOCUS_06320 3885 3436 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_06320 5837 3882 gene locus_tag LOCUS_06330 gene hdrA 5837 3882 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_06330 6322 5834 gene locus_tag LOCUS_06340 6322 5834 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_06340 7806 6322 gene locus_tag LOCUS_06350 7806 6322 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_06350 8795 7803 gene locus_tag LOCUS_06360 8795 7803 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_06360 10802 9012 gene locus_tag LOCUS_06370 10802 9012 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 protein_id gnl|my_center|LOCUS_06370 11644 10988 gene locus_tag LOCUS_06380 11644 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13368 11680 gene locus_tag LOCUS_06390 13368 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence034 1624 245 gene locus_tag LOCUS_06400 1624 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1945 2196 gene locus_tag LOCUS_06410 1945 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2853 2344 gene locus_tag LOCUS_06420 2853 2344 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_06420 4421 2850 gene locus_tag LOCUS_06430 4421 2850 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_06430 4958 4551 gene locus_tag LOCUS_06440 4958 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5385 5074 gene locus_tag LOCUS_06450 5385 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5611 5378 gene locus_tag LOCUS_06460 5611 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 7270 5822 gene locus_tag LOCUS_06470 7270 5822 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_06470 7658 7275 gene locus_tag LOCUS_06480 7658 7275 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582525.1 protein_id gnl|my_center|LOCUS_06480 7993 7655 gene locus_tag LOCUS_06490 7993 7655 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_06490 8318 8058 gene locus_tag LOCUS_06500 8318 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 9052 8741 gene locus_tag LOCUS_06510 gene mazF3 9052 8741 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_06510 9267 9052 gene locus_tag LOCUS_06520 9267 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 10012 9347 gene locus_tag LOCUS_06530 10012 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_06530 10959 10015 gene locus_tag LOCUS_06540 10959 10015 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_06540 12998 10956 gene locus_tag LOCUS_06550 gene hyfB 12998 10956 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence035 1396 632 gene locus_tag LOCUS_06560 1396 632 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_06560 3616 1637 gene locus_tag LOCUS_06570 3616 1637 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942348.1 protein_id gnl|my_center|LOCUS_06570 4020 3646 gene locus_tag LOCUS_06580 4020 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5470 4190 gene locus_tag LOCUS_06590 5470 4190 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_06590 6269 6003 gene locus_tag LOCUS_06600 6269 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6168 6536 gene locus_tag LOCUS_06610 6168 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6551 7126 gene locus_tag LOCUS_06620 6551 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 7146 7646 gene locus_tag LOCUS_06630 7146 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 7643 8734 gene locus_tag LOCUS_06640 7643 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 8706 10691 gene locus_tag LOCUS_06650 8706 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 11760 10708 gene locus_tag LOCUS_06660 11760 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 11818 12843 gene locus_tag LOCUS_06670 gene mnmH 11818 12843 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941848.1 protein_id gnl|my_center|LOCUS_06670 12942 13096 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtaaagtttctttacgttt >Feature sequence036 4136 2097 gene locus_tag LOCUS_06680 4136 2097 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_06680 5646 4402 gene locus_tag LOCUS_06690 5646 4402 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807966.1 protein_id gnl|my_center|LOCUS_06690 6968 5805 gene locus_tag LOCUS_06700 6968 5805 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_06700 7796 6987 gene locus_tag LOCUS_06710 7796 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 9445 7787 gene locus_tag LOCUS_06720 9445 7787 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_06720 10844 9495 gene locus_tag LOCUS_06730 10844 9495 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_06730 11501 10860 gene locus_tag LOCUS_06740 11501 10860 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_06740 12585 11587 gene locus_tag LOCUS_06750 12585 11587 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808840.1 protein_id gnl|my_center|LOCUS_06750 13323 12781 gene locus_tag LOCUS_06760 13323 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence037 <1 1715 gene locus_tag LOCUS_06770 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583948.1:DNA polymerase/3'-5' exonuclease PolX 1807 2304 gene locus_tag LOCUS_06780 1807 2304 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_06780 2339 3025 gene locus_tag LOCUS_06790 2339 3025 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941386.1 protein_id gnl|my_center|LOCUS_06790 3884 3234 gene locus_tag LOCUS_06800 3884 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4237 5931 gene locus_tag LOCUS_06810 4237 5931 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393463.1 protein_id gnl|my_center|LOCUS_06810 5928 6680 gene locus_tag LOCUS_06820 5928 6680 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094988.1 protein_id gnl|my_center|LOCUS_06820 6830 6657 gene locus_tag LOCUS_06830 6830 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6925 8742 gene locus_tag LOCUS_06840 6925 8742 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_06840 8749 8940 gene locus_tag LOCUS_06850 8749 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 9142 8921 gene locus_tag LOCUS_06860 9142 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9444 10850 gene locus_tag LOCUS_06870 9444 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 11832 10882 gene locus_tag LOCUS_06880 11832 10882 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence038 541 2091 gene locus_tag LOCUS_06890 541 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06890 2049 3791 gene locus_tag LOCUS_06900 2049 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 4007 5053 gene locus_tag LOCUS_06910 4007 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5225 6391 gene locus_tag LOCUS_06920 5225 6391 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_06920 6785 7537 gene locus_tag LOCUS_06930 6785 7537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_06930 7530 8246 gene locus_tag LOCUS_06940 7530 8246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_06940 8279 9502 gene locus_tag LOCUS_06950 8279 9502 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 protein_id gnl|my_center|LOCUS_06950 9595 10500 gene locus_tag LOCUS_06960 9595 10500 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185119.1 protein_id gnl|my_center|LOCUS_06960 10506 11447 gene locus_tag LOCUS_06970 10506 11447 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_06970 11698 12318 gene locus_tag LOCUS_06980 11698 12318 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 12334 12981 gene locus_tag LOCUS_06990 12334 12981 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence039 1117 110 gene locus_tag LOCUS_07000 1117 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1303 2952 gene locus_tag LOCUS_07010 1303 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4232 3060 gene locus_tag LOCUS_07020 gene ftsZ 4232 3060 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_07020 5618 4380 gene locus_tag LOCUS_07030 gene ftsA 5618 4380 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_07030 6475 5651 gene locus_tag LOCUS_07040 6475 5651 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943690.1 protein_id gnl|my_center|LOCUS_07040 7403 6480 gene locus_tag LOCUS_07050 7403 6480 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_07050 8302 7400 gene locus_tag LOCUS_07060 gene murB 8302 7400 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_07060 9693 8311 gene locus_tag LOCUS_07070 gene murC 9693 8311 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_07070 10893 9781 gene locus_tag LOCUS_07080 gene murG 10893 9781 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_07080 12014 10890 gene locus_tag LOCUS_07090 gene ftsW 12014 10890 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_07090 <13077 12112 gene locus_tag LOCUS_07100 <13077 12112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943696.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence040 1054 1398 gene locus_tag LOCUS_07110 1054 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2308 1610 gene locus_tag LOCUS_07120 2308 1610 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941679.1 protein_id gnl|my_center|LOCUS_07120 3520 2315 gene locus_tag LOCUS_07130 3520 2315 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_07130 3913 3527 gene locus_tag LOCUS_07140 3913 3527 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941887.1 protein_id gnl|my_center|LOCUS_07140 4877 3963 gene locus_tag LOCUS_07150 4877 3963 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941886.1 protein_id gnl|my_center|LOCUS_07150 5758 4973 gene locus_tag LOCUS_07160 5758 4973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_07160 6216 5770 gene locus_tag LOCUS_07170 6216 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941882.1 protein_id gnl|my_center|LOCUS_07170 7284 6385 gene locus_tag LOCUS_07180 7284 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941881.1 protein_id gnl|my_center|LOCUS_07180 7544 7353 gene locus_tag LOCUS_07190 7544 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7873 7541 gene locus_tag LOCUS_07200 7873 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8920 7886 gene locus_tag LOCUS_07210 8920 7886 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_07210 9715 9200 gene locus_tag LOCUS_07220 9715 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10446 9631 gene locus_tag LOCUS_07230 10446 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941880.1 protein_id gnl|my_center|LOCUS_07230 11611 10451 gene locus_tag LOCUS_07240 11611 10451 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_07240 12080 11820 gene locus_tag LOCUS_07250 12080 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12415 12149 gene locus_tag LOCUS_07260 12415 12149 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_07260 12582 12412 gene locus_tag LOCUS_07270 12582 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence041 103 870 gene locus_tag LOCUS_07280 gene ygiD 103 870 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_07280 903 1106 gene locus_tag LOCUS_07290 903 1106 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944062.1 protein_id gnl|my_center|LOCUS_07290 1228 1677 gene locus_tag LOCUS_07300 1228 1677 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_07300 1833 2771 gene locus_tag LOCUS_07310 1833 2771 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_07310 2791 5457 gene locus_tag LOCUS_07320 2791 5457 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_07320 5483 6910 gene locus_tag LOCUS_07330 5483 6910 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942926.1 protein_id gnl|my_center|LOCUS_07330 6907 7509 gene locus_tag LOCUS_07340 gene pncA 6907 7509 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_07340 8620 7490 gene locus_tag LOCUS_07350 8620 7490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_07350 9754 8621 gene locus_tag LOCUS_07360 9754 8621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_07360 11358 9751 gene locus_tag LOCUS_07370 11358 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07370 12404 11421 gene locus_tag LOCUS_07380 12404 11421 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence042 1232 2212 gene locus_tag LOCUS_07390 1232 2212 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_07390 2306 2719 gene locus_tag LOCUS_07400 2306 2719 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_07400 2748 3215 gene locus_tag LOCUS_07410 2748 3215 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_07410 3234 4595 gene locus_tag LOCUS_07420 3234 4595 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_07420 4800 5285 gene locus_tag LOCUS_07430 gene rimP 4800 5285 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_07430 5330 6535 gene locus_tag LOCUS_07440 gene nusA 5330 6535 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_07440 6545 7156 gene locus_tag LOCUS_07450 6545 7156 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942232.1 protein_id gnl|my_center|LOCUS_07450 7153 9813 gene locus_tag LOCUS_07460 gene infB 7153 9813 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_07460 9975 10349 gene locus_tag LOCUS_07470 9975 10349 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_07470 10375 11277 gene locus_tag LOCUS_07480 10375 11277 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_07480 11274 12185 gene locus_tag LOCUS_07490 gene truB 11274 12185 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence043 <1 1157 gene locus_tag LOCUS_07500 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015337756.1:response regulator 1174 2247 gene locus_tag LOCUS_07510 gene cheB 1174 2247 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_07510 2313 4079 gene locus_tag LOCUS_07520 2313 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4209 4748 gene locus_tag LOCUS_07530 4209 4748 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_07530 4755 5795 gene locus_tag LOCUS_07540 4755 5795 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_07540 5960 6283 gene locus_tag LOCUS_07550 5960 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7857 6451 gene locus_tag LOCUS_07560 7857 6451 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_07560 8118 10106 gene locus_tag LOCUS_07570 8118 10106 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_07570 11030 10110 gene locus_tag LOCUS_07580 11030 10110 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_07580 12010 11120 gene locus_tag LOCUS_07590 12010 11120 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815123.1 protein_id gnl|my_center|LOCUS_07590 12336 12551 gene locus_tag LOCUS_07600 12336 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence044 320 2122 gene locus_tag LOCUS_07610 gene typA 320 2122 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_07610 2353 3570 gene locus_tag LOCUS_07620 2353 3570 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_07620 3570 4277 gene locus_tag LOCUS_07630 gene cobI 3570 4277 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_07630 5488 4421 gene locus_tag LOCUS_07640 5488 4421 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943926.1 protein_id gnl|my_center|LOCUS_07640 5812 6213 gene locus_tag LOCUS_07650 5812 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07650 6213 6926 gene locus_tag LOCUS_07660 6213 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 6931 7761 gene locus_tag LOCUS_07670 gene ttcA 6931 7761 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_07670 8716 7925 gene locus_tag LOCUS_07680 8716 7925 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_07680 9469 8723 gene locus_tag LOCUS_07690 9469 8723 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_07690 9796 9473 gene locus_tag LOCUS_07700 9796 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 10993 9902 gene locus_tag LOCUS_07710 10993 9902 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_07710 11335 11535 gene locus_tag LOCUS_07720 gene thiS 11335 11535 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence045 <1 528 gene locus_tag LOCUS_07730 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004556653.1:serine/threonine protein kinase 1633 563 gene locus_tag LOCUS_07740 1633 563 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_07740 1760 2581 gene locus_tag LOCUS_07750 1760 2581 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731349.1 protein_id gnl|my_center|LOCUS_07750 2678 2959 gene locus_tag LOCUS_07760 2678 2959 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615953.1 protein_id gnl|my_center|LOCUS_07760 3060 4319 gene locus_tag LOCUS_07770 3060 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4621 5724 gene locus_tag LOCUS_07780 4621 5724 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_07780 6777 5740 gene locus_tag LOCUS_07790 6777 5740 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095585.1 protein_id gnl|my_center|LOCUS_07790 6964 7332 gene locus_tag LOCUS_07800 6964 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 7474 7689 gene locus_tag LOCUS_07810 7474 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8716 8219 gene locus_tag LOCUS_07820 8716 8219 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940903.1 protein_id gnl|my_center|LOCUS_07820 9059 10870 gene locus_tag LOCUS_07830 9059 10870 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_07830 11031 11354 gene locus_tag LOCUS_07840 11031 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11934 11371 gene locus_tag LOCUS_07850 11934 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence046 725 60 gene locus_tag LOCUS_07860 725 60 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_07860 1429 707 gene locus_tag LOCUS_07870 1429 707 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940920.1 protein_id gnl|my_center|LOCUS_07870 2531 1617 gene locus_tag LOCUS_07880 gene cas6 2531 1617 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941839.1 protein_id gnl|my_center|LOCUS_07880 3399 2641 gene locus_tag LOCUS_07890 3399 2641 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941838.1 protein_id gnl|my_center|LOCUS_07890 5315 3399 gene locus_tag LOCUS_07900 5315 3399 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941837.1 protein_id gnl|my_center|LOCUS_07900 5991 5326 gene locus_tag LOCUS_07910 5991 5326 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_07910 6371 7498 gene locus_tag LOCUS_07920 gene tgt 6371 7498 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 protein_id gnl|my_center|LOCUS_07920 8099 7557 gene locus_tag LOCUS_07930 8099 7557 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942583.1 protein_id gnl|my_center|LOCUS_07930 9396 8089 gene locus_tag LOCUS_07940 9396 8089 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942582.1 protein_id gnl|my_center|LOCUS_07940 10379 9426 gene locus_tag LOCUS_07950 10379 9426 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_07950 12229 10700 gene locus_tag LOCUS_07960 12229 10700 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence047 1997 1626 gene locus_tag LOCUS_07970 1997 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_07970 2859 2104 gene locus_tag LOCUS_07980 2859 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3288 2956 gene locus_tag LOCUS_07990 3288 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4207 3317 gene locus_tag LOCUS_08000 4207 3317 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534908.1 protein_id gnl|my_center|LOCUS_08000 4451 4251 gene locus_tag LOCUS_08010 4451 4251 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365425.1 protein_id gnl|my_center|LOCUS_08010 6620 4464 gene locus_tag LOCUS_08020 6620 4464 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937757.1 protein_id gnl|my_center|LOCUS_08020 8044 6617 gene locus_tag LOCUS_08030 8044 6617 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105655.1 protein_id gnl|my_center|LOCUS_08030 8559 8224 gene locus_tag LOCUS_08040 8559 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9144 8719 gene locus_tag LOCUS_08050 9144 8719 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_08050 9374 11650 gene locus_tag LOCUS_08060 9374 11650 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943974.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence048 82 157 gene locus_tag LOCUS_t00080 82 157 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 213 289 gene locus_tag LOCUS_t00090 213 289 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 653 2386 gene locus_tag LOCUS_08070 653 2386 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454701.1 protein_id gnl|my_center|LOCUS_08070 2383 6837 gene locus_tag LOCUS_08080 2383 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8277 6898 gene locus_tag LOCUS_08090 8277 6898 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_08090 10376 8505 gene locus_tag LOCUS_08100 10376 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 <11892 11004 gene locus_tag LOCUS_08110 <11892 11004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942227.1:adenosylmethionine--8-amino-7-oxononanoate transaminase >Feature sequence049 337 858 gene locus_tag LOCUS_08120 gene tadA 337 858 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_08120 2215 842 gene locus_tag LOCUS_08130 gene fdhD 2215 842 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941444.1 protein_id gnl|my_center|LOCUS_08130 3517 2303 gene locus_tag LOCUS_08140 3517 2303 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_08140 4086 3595 gene locus_tag LOCUS_08150 gene tsaE 4086 3595 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_08150 4535 4083 gene locus_tag LOCUS_08160 4535 4083 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_08160 6130 4577 gene locus_tag LOCUS_08170 6130 4577 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_08170 6507 6127 gene locus_tag LOCUS_08180 6507 6127 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_08180 7375 6656 gene locus_tag LOCUS_08190 7375 6656 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_08190 8732 7377 gene locus_tag LOCUS_08200 gene glmM 8732 7377 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_08200 9175 8729 gene locus_tag LOCUS_08210 9175 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 9957 9172 gene locus_tag LOCUS_08220 gene cdaA 9957 9172 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942452.1 protein_id gnl|my_center|LOCUS_08220 11231 10008 gene locus_tag LOCUS_08230 11231 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 <11861 11233 gene locus_tag LOCUS_08240 <11861 11233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence050 1638 892 gene locus_tag LOCUS_08250 1638 892 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_08250 2499 1645 gene locus_tag LOCUS_08260 2499 1645 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943730.1 protein_id gnl|my_center|LOCUS_08260 4036 2516 gene locus_tag LOCUS_08270 4036 2516 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_08270 5469 4033 gene locus_tag LOCUS_08280 5469 4033 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_08280 6115 5474 gene locus_tag LOCUS_08290 6115 5474 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_08290 7028 6120 gene locus_tag LOCUS_08300 7028 6120 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_08300 9058 7073 gene locus_tag LOCUS_08310 9058 7073 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941399.1 protein_id gnl|my_center|LOCUS_08310 9245 9481 gene locus_tag LOCUS_08320 9245 9481 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941398.1 protein_id gnl|my_center|LOCUS_08320 9474 9839 gene locus_tag LOCUS_08330 9474 9839 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941397.1 protein_id gnl|my_center|LOCUS_08330 9848 10534 gene locus_tag LOCUS_08340 9848 10534 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence051 1152 433 gene locus_tag LOCUS_08350 1152 433 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_08350 1566 1306 gene locus_tag LOCUS_08360 1566 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1450 1866 gene locus_tag LOCUS_08370 1450 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1953 3131 gene locus_tag LOCUS_08380 1953 3131 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_08380 3149 3739 gene locus_tag LOCUS_08390 3149 3739 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_08390 3838 4509 gene locus_tag LOCUS_08400 3838 4509 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_08400 4547 5833 gene locus_tag LOCUS_08410 4547 5833 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943942.1 protein_id gnl|my_center|LOCUS_08410 5833 6594 gene locus_tag LOCUS_08420 5833 6594 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_08420 6625 7626 gene locus_tag LOCUS_08430 6625 7626 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_08430 8158 7598 gene locus_tag LOCUS_08440 8158 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 8941 8177 gene locus_tag LOCUS_08450 8941 8177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_08450 9875 8991 gene locus_tag LOCUS_08460 9875 8991 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_08460 10158 9961 gene locus_tag LOCUS_08470 10158 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11044 10169 gene locus_tag LOCUS_08480 gene hisG 11044 10169 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_08480 11449 11069 gene locus_tag LOCUS_08490 gene hisI 11449 11069 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942178.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence052 1379 801 gene locus_tag LOCUS_08500 1379 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1728 1390 gene locus_tag LOCUS_08510 1728 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3616 2318 gene locus_tag LOCUS_08520 3616 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5368 3620 gene locus_tag LOCUS_08530 gene rpoD 5368 3620 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_08530 7153 5399 gene locus_tag LOCUS_08540 gene dnaG 7153 5399 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_08540 7641 7150 gene locus_tag LOCUS_08550 7641 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 8187 7744 gene locus_tag LOCUS_08560 8187 7744 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_08560 8394 8197 gene locus_tag LOCUS_08570 gene rpsU 8394 8197 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_08570 8917 8591 gene locus_tag LOCUS_08580 8917 8591 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943715.1 protein_id gnl|my_center|LOCUS_08580 9692 8931 gene locus_tag LOCUS_08590 gene hisF 9692 8931 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_08590 10425 9694 gene locus_tag LOCUS_08600 gene hisA 10425 9694 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_08600 11249 10623 gene locus_tag LOCUS_08610 gene hisH 11249 10623 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence053 2274 475 gene locus_tag LOCUS_08620 2274 475 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_08620 2687 2274 gene locus_tag LOCUS_08630 2687 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2995 4674 gene locus_tag LOCUS_08640 gene ettA 2995 4674 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_08640 5172 4825 gene locus_tag LOCUS_08650 5172 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5811 5356 gene locus_tag LOCUS_08660 5811 5356 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941300.1 protein_id gnl|my_center|LOCUS_08660 6079 5813 gene locus_tag LOCUS_08670 6079 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459969.1 protein_id gnl|my_center|LOCUS_08670 6159 6476 gene locus_tag LOCUS_08680 6159 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6473 7057 gene locus_tag LOCUS_08690 gene yedF 6473 7057 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943158.1 protein_id gnl|my_center|LOCUS_08690 7148 8509 gene locus_tag LOCUS_08700 gene ffh 7148 8509 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_08700 8569 8835 gene locus_tag LOCUS_08710 gene rpsP 8569 8835 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_08710 8892 9122 gene locus_tag LOCUS_08720 8892 9122 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_08720 9122 9643 gene locus_tag LOCUS_08730 gene rimM 9122 9643 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_08730 9640 10383 gene locus_tag LOCUS_08740 gene trmD 9640 10383 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_08740 10373 10936 gene locus_tag LOCUS_08750 10373 10936 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence054 812 438 gene locus_tag LOCUS_08760 812 438 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_08760 2222 849 gene locus_tag LOCUS_08770 2222 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3546 2542 gene locus_tag LOCUS_08780 3546 2542 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_08780 5191 3539 gene locus_tag LOCUS_08790 5191 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5451 5642 gene locus_tag LOCUS_08800 5451 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5906 5724 gene locus_tag LOCUS_08810 5906 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6445 5921 gene locus_tag LOCUS_08820 6445 5921 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_08820 7952 6648 gene locus_tag LOCUS_08830 7952 6648 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_08830 8830 8228 gene locus_tag LOCUS_08840 8830 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940794.1 protein_id gnl|my_center|LOCUS_08840 9310 8840 gene locus_tag LOCUS_08850 9310 8840 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 protein_id gnl|my_center|LOCUS_08850 9721 9332 gene locus_tag LOCUS_08860 9721 9332 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 protein_id gnl|my_center|LOCUS_08860 10779 9757 gene locus_tag LOCUS_08870 gene hemE 10779 9757 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence055 2764 1232 gene locus_tag LOCUS_08880 2764 1232 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_08880 3061 2765 gene locus_tag LOCUS_08890 3061 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3409 3179 gene locus_tag LOCUS_08900 3409 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08900 3803 3306 gene locus_tag LOCUS_08910 3803 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 4031 4312 gene locus_tag LOCUS_08920 4031 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 4371 5138 gene locus_tag LOCUS_08930 4371 5138 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_08930 5461 6954 gene locus_tag LOCUS_08940 gene hflX 5461 6954 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_08940 7009 8394 gene locus_tag LOCUS_08950 7009 8394 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943097.1 protein_id gnl|my_center|LOCUS_08950 9260 8469 gene locus_tag LOCUS_08960 9260 8469 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_08960 9259 9714 gene locus_tag LOCUS_08970 9259 9714 CDS product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943094.1 protein_id gnl|my_center|LOCUS_08970 9724 10782 gene locus_tag LOCUS_08980 9724 10782 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943093.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence056 1501 488 gene locus_tag LOCUS_08990 1501 488 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_08990 3415 1595 gene locus_tag LOCUS_09000 3415 1595 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943122.1 protein_id gnl|my_center|LOCUS_09000 3818 4720 gene locus_tag LOCUS_09010 3818 4720 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943193.1 protein_id gnl|my_center|LOCUS_09010 4717 4950 gene locus_tag LOCUS_09020 4717 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 6703 5009 gene locus_tag LOCUS_09030 6703 5009 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_09030 6924 8192 gene locus_tag LOCUS_09040 gene serS 6924 8192 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_09040 8255 8340 gene locus_tag LOCUS_t00100 8255 8340 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8966 10591 gene locus_tag LOCUS_09050 8966 10591 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_09050 10693 11004 gene locus_tag LOCUS_09060 10693 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence057 <1 1147 gene locus_tag LOCUS_09070 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942482.1:ATP-dependent helicase HrpB 2843 1260 gene locus_tag LOCUS_09080 2843 1260 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_09080 3089 3511 gene locus_tag LOCUS_09090 3089 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4991 3702 gene locus_tag LOCUS_09100 gene eno 4991 3702 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_09100 6636 5113 gene locus_tag LOCUS_09110 6636 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 6635 7456 gene locus_tag LOCUS_09120 6635 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7807 9183 gene locus_tag LOCUS_09130 7807 9183 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_09130 9378 9584 gene locus_tag LOCUS_09140 9378 9584 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049786599.1 protein_id gnl|my_center|LOCUS_09140 9632 10000 gene locus_tag LOCUS_09150 9632 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 10066 10860 gene locus_tag LOCUS_09160 10066 10860 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence058 2133 415 gene locus_tag LOCUS_09170 2133 415 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_09170 3351 2143 gene locus_tag LOCUS_09180 3351 2143 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_09180 3616 3434 gene locus_tag LOCUS_09190 3616 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4350 3613 gene locus_tag LOCUS_09200 4350 3613 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_09200 4861 4520 gene locus_tag LOCUS_09210 4861 4520 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257604.1 protein_id gnl|my_center|LOCUS_09210 6233 4971 gene locus_tag LOCUS_09220 6233 4971 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_09220 7535 6435 gene locus_tag LOCUS_09230 gene rodA 7535 6435 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_09230 9447 7528 gene locus_tag LOCUS_09240 gene mrdA 9447 7528 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_09240 9920 9444 gene locus_tag LOCUS_09250 gene mreD 9920 9444 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942722.1 protein_id gnl|my_center|LOCUS_09250 <10663 9928 gene locus_tag LOCUS_09260 <10663 9928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942723.1:rod shape-determining protein MreC >Feature sequence059 294 1553 gene locus_tag LOCUS_09270 294 1553 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_09270 1578 2750 gene locus_tag LOCUS_09280 1578 2750 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_09280 2747 3949 gene locus_tag LOCUS_09290 2747 3949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_09290 3952 4683 gene locus_tag LOCUS_09300 3952 4683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_09300 5026 5238 gene locus_tag LOCUS_09310 5026 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_09310 6242 5283 gene locus_tag LOCUS_09320 6242 5283 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539843.1 protein_id gnl|my_center|LOCUS_09320 7545 6247 gene locus_tag LOCUS_09330 7545 6247 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_09330 9620 7695 gene locus_tag LOCUS_09340 gene cysN 9620 7695 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_09340 10522 9620 gene locus_tag LOCUS_09350 gene cysD 10522 9620 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175227789.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence060 273 282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1278 568 gene locus_tag LOCUS_09360 1278 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2038 1349 gene locus_tag LOCUS_09370 gene radC 2038 1349 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_09370 2242 2862 gene locus_tag LOCUS_09380 2242 2862 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_09380 2855 3856 gene locus_tag LOCUS_09390 2855 3856 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_09390 4453 3881 gene locus_tag LOCUS_09400 4453 3881 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941058.1 protein_id gnl|my_center|LOCUS_09400 4568 5242 gene locus_tag LOCUS_09410 4568 5242 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_09410 6450 5314 gene locus_tag LOCUS_09420 gene rlmN 6450 5314 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_09420 7388 6447 gene locus_tag LOCUS_09430 7388 6447 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360258.1 protein_id gnl|my_center|LOCUS_09430 8209 7511 gene locus_tag LOCUS_09440 8209 7511 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_09440 8416 8706 gene locus_tag LOCUS_09450 8416 8706 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence061 3372 2107 gene locus_tag LOCUS_09460 3372 2107 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_09460 4140 3568 gene locus_tag LOCUS_09470 4140 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09470 5018 4041 gene locus_tag LOCUS_09480 5018 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 5380 5168 gene locus_tag LOCUS_09490 5380 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6319 5402 gene locus_tag LOCUS_09500 6319 5402 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_09500 7071 6406 gene locus_tag LOCUS_09510 gene rpe 7071 6406 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_09510 8632 7274 gene locus_tag LOCUS_09520 gene rsmB 8632 7274 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_09520 9483 8629 gene locus_tag LOCUS_09530 gene htpX 9483 8629 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_09530 10029 9628 gene locus_tag LOCUS_09540 10029 9628 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846680.1 protein_id gnl|my_center|LOCUS_09540 10235 10008 gene locus_tag LOCUS_09550 10235 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence062 2087 540 gene locus_tag LOCUS_09560 2087 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2760 2266 gene locus_tag LOCUS_09570 2760 2266 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_09570 4826 2829 gene locus_tag LOCUS_09580 4826 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5544 4948 gene locus_tag LOCUS_09590 5544 4948 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_09590 6044 5550 gene locus_tag LOCUS_09600 6044 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6406 6041 gene locus_tag LOCUS_09610 6406 6041 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_09610 6768 6406 gene locus_tag LOCUS_09620 6768 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 8719 7013 gene locus_tag LOCUS_09630 8719 7013 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_09630 9764 8766 gene locus_tag LOCUS_09640 gene hpnH 9764 8766 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_09640 <10448 9803 gene locus_tag LOCUS_09650 <10448 9803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941346.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence063 1683 532 gene locus_tag LOCUS_09660 1683 532 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_09660 2635 1730 gene locus_tag LOCUS_09670 2635 1730 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_09670 3421 2645 gene locus_tag LOCUS_09680 3421 2645 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_09680 5479 3491 gene locus_tag LOCUS_09690 5479 3491 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_09690 6704 5502 gene locus_tag LOCUS_09700 6704 5502 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_09700 8254 6728 gene locus_tag LOCUS_09710 8254 6728 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_09710 9027 8257 gene locus_tag LOCUS_09720 9027 8257 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_09720 9770 9312 gene locus_tag LOCUS_09730 9770 9312 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113137.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence064 1802 2125 gene locus_tag LOCUS_09740 1802 2125 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583049.1 protein_id gnl|my_center|LOCUS_09740 2240 2653 gene locus_tag LOCUS_09750 gene ndk 2240 2653 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941771.1 protein_id gnl|my_center|LOCUS_09750 3626 2709 gene locus_tag LOCUS_09760 gene miaA 3626 2709 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_09760 5449 3623 gene locus_tag LOCUS_09770 gene uvrC 5449 3623 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_09770 5580 5774 gene locus_tag LOCUS_09780 5580 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5755 6957 gene locus_tag LOCUS_09790 5755 6957 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941878.1 protein_id gnl|my_center|LOCUS_09790 7121 9307 gene locus_tag LOCUS_09800 7121 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09800 9196 9654 gene locus_tag LOCUS_09810 9196 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 >Feature sequence065 1764 316 gene locus_tag LOCUS_09820 1764 316 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_09820 2576 1764 gene locus_tag LOCUS_09830 2576 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3929 2631 gene locus_tag LOCUS_09840 3929 2631 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943163.1 protein_id gnl|my_center|LOCUS_09840 4288 4091 gene locus_tag LOCUS_09850 4288 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5241 4285 gene locus_tag LOCUS_09860 gene cysK 5241 4285 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_09860 5479 6066 gene locus_tag LOCUS_09870 5479 6066 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_09870 6117 7277 gene locus_tag LOCUS_09880 6117 7277 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_09880 7284 7775 gene locus_tag LOCUS_09890 7284 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7864 9471 gene locus_tag LOCUS_09900 7864 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9583 9933 gene locus_tag LOCUS_09910 9583 9933 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence066 <1 1228 gene locus_tag LOCUS_09920 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943068.1:nodulation protein NfeD 1270 2037 gene locus_tag LOCUS_09930 1270 2037 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_09930 2034 2621 gene locus_tag LOCUS_09940 2034 2621 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941844.1 protein_id gnl|my_center|LOCUS_09940 4099 2708 gene locus_tag LOCUS_09950 4099 2708 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_09950 4275 5243 gene locus_tag LOCUS_09960 4275 5243 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_09960 5301 5819 gene locus_tag LOCUS_09970 5301 5819 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_09970 5830 6561 gene locus_tag LOCUS_09980 5830 6561 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_09980 6558 6980 gene locus_tag LOCUS_09990 6558 6980 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941977.1 protein_id gnl|my_center|LOCUS_09990 7470 8015 gene locus_tag LOCUS_10000 gene pyrR 7470 8015 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_10000 8030 8962 gene locus_tag LOCUS_10010 8030 8962 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence067 250 654 gene locus_tag LOCUS_10020 250 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10020 728 1624 gene locus_tag LOCUS_10030 728 1624 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_10030 2056 1697 gene locus_tag LOCUS_10040 2056 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2490 2056 gene locus_tag LOCUS_10050 2490 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2548 2820 gene locus_tag LOCUS_10060 2548 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10060 3097 3927 gene locus_tag LOCUS_10070 3097 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10070 3931 4212 gene locus_tag LOCUS_10080 3931 4212 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941818.1 protein_id gnl|my_center|LOCUS_10080 4356 6818 gene locus_tag LOCUS_10090 4356 6818 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_10090 6805 7305 gene locus_tag LOCUS_10100 6805 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 7245 7877 gene locus_tag LOCUS_10110 7245 7877 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_10110 7893 8747 gene locus_tag LOCUS_10120 7893 8747 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence068 2 214 gene locus_tag LOCUS_10130 2 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 214 846 gene locus_tag LOCUS_10140 214 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1512 952 gene locus_tag LOCUS_10150 1512 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1864 1520 gene locus_tag LOCUS_10160 1864 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2603 2070 gene locus_tag LOCUS_10170 2603 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3478 2648 gene locus_tag LOCUS_10180 3478 2648 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_10180 4605 3475 gene locus_tag LOCUS_10190 4605 3475 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941179.1 protein_id gnl|my_center|LOCUS_10190 4835 6853 gene locus_tag LOCUS_10200 4835 6853 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_10200 7021 9639 gene locus_tag LOCUS_10210 7021 9639 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence069 <1 1968 gene locus_tag LOCUS_10220 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:efflux RND transporter permease subunit 2133 2903 gene locus_tag LOCUS_10230 2133 2903 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_10230 2903 3649 gene locus_tag LOCUS_10240 2903 3649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_10240 3670 4119 gene locus_tag LOCUS_10250 gene mlaD 3670 4119 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_10250 4135 5514 gene locus_tag LOCUS_10260 4135 5514 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_10260 5528 6118 gene locus_tag LOCUS_10270 5528 6118 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_10270 6313 6516 gene locus_tag LOCUS_10280 6313 6516 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_10280 8482 6560 gene locus_tag LOCUS_10290 8482 6560 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_10290 9558 8518 gene locus_tag LOCUS_10300 gene argC 9558 8518 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence070 1532 861 gene locus_tag LOCUS_10310 1532 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942769.1 protein_id gnl|my_center|LOCUS_10310 2097 1570 gene locus_tag LOCUS_10320 2097 1570 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_10320 2679 3653 gene locus_tag LOCUS_10330 2679 3653 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_10330 3734 5209 gene locus_tag LOCUS_10340 3734 5209 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939204.1 protein_id gnl|my_center|LOCUS_10340 5219 5686 gene locus_tag LOCUS_10350 5219 5686 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_10350 5674 5940 gene locus_tag LOCUS_10360 5674 5940 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940700.1 protein_id gnl|my_center|LOCUS_10360 5928 6491 gene locus_tag LOCUS_10370 5928 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 6521 7354 gene locus_tag LOCUS_10380 gene tatC 6521 7354 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942132.1 protein_id gnl|my_center|LOCUS_10380 7418 7591 gene locus_tag LOCUS_10390 7418 7591 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_10390 7715 8047 gene locus_tag LOCUS_10400 gene hypA 7715 8047 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_10400 8197 8832 gene locus_tag LOCUS_10410 gene hypB 8197 8832 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence071 2207 786 gene locus_tag LOCUS_10420 2207 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3183 2617 gene locus_tag LOCUS_10430 3183 2617 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_10430 4721 3279 gene locus_tag LOCUS_10440 gene gnfM 4721 3279 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_10440 5871 4753 gene locus_tag LOCUS_10450 gene gnfL 5871 4753 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_10450 6838 5849 gene locus_tag LOCUS_10460 gene dusB 6838 5849 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_10460 7048 7341 gene locus_tag LOCUS_10470 7048 7341 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940700.1 protein_id gnl|my_center|LOCUS_10470 8088 7447 gene locus_tag LOCUS_10480 8088 7447 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_10480 8250 9248 gene locus_tag LOCUS_10490 8250 9248 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence072 297 2078 gene locus_tag LOCUS_10500 297 2078 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_10500 2294 3406 gene locus_tag LOCUS_10510 2294 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3693 4634 gene locus_tag LOCUS_10520 3693 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5203 4736 gene locus_tag LOCUS_10530 5203 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 6352 5288 gene locus_tag LOCUS_10540 6352 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943970.1 protein_id gnl|my_center|LOCUS_10540 6560 9121 gene locus_tag LOCUS_10550 6560 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence073 <1 1193 gene locus_tag LOCUS_10560 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943912.1:biotin carboxylase N-terminal domain-containing protein 1364 3016 gene locus_tag LOCUS_10570 1364 3016 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_10570 3025 3432 gene locus_tag LOCUS_10580 gene mce 3025 3432 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_10580 5000 3621 gene locus_tag LOCUS_10590 5000 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5476 5949 gene locus_tag LOCUS_10600 5476 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6019 6756 gene locus_tag LOCUS_10610 6019 6756 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_10610 7146 6907 gene locus_tag LOCUS_10620 7146 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7481 8752 gene locus_tag LOCUS_10630 7481 8752 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence074 693 97 gene locus_tag LOCUS_10640 693 97 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_10640 1406 687 gene locus_tag LOCUS_10650 gene rph 1406 687 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_10650 1703 1548 gene locus_tag LOCUS_10660 1703 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012648007.1 protein_id gnl|my_center|LOCUS_10660 2295 1831 gene locus_tag LOCUS_10670 2295 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4008 2455 gene locus_tag LOCUS_10680 gene cimA 4008 2455 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_10680 4255 7926 gene locus_tag LOCUS_10690 4255 7926 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941340.1 protein_id gnl|my_center|LOCUS_10690 7930 8160 gene locus_tag LOCUS_10700 7930 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence075 329 1702 gene locus_tag LOCUS_10710 329 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1650 2111 gene locus_tag LOCUS_10720 1650 2111 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_10720 2150 3652 gene locus_tag LOCUS_10730 2150 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3714 4622 gene locus_tag LOCUS_10740 3714 4622 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_10740 7037 4701 gene locus_tag LOCUS_10750 7037 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 <9164 7083 gene locus_tag LOCUS_10760 <9164 7083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence076 1796 522 gene locus_tag LOCUS_10770 1796 522 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941870.1 protein_id gnl|my_center|LOCUS_10770 2000 2221 gene locus_tag LOCUS_10780 2000 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940891.1 protein_id gnl|my_center|LOCUS_10780 2721 2320 gene locus_tag LOCUS_10790 2721 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3032 2727 gene locus_tag LOCUS_10800 3032 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3591 3022 gene locus_tag LOCUS_10810 gene sigM 3591 3022 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_10810 4076 3594 gene locus_tag LOCUS_10820 4076 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4260 4826 gene locus_tag LOCUS_10830 4260 4826 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_10830 4903 5556 gene locus_tag LOCUS_10840 4903 5556 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_10840 5635 6357 gene locus_tag LOCUS_10850 5635 6357 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_10850 6470 6946 gene locus_tag LOCUS_10860 6470 6946 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_10860 7137 8060 gene locus_tag LOCUS_10870 gene cysK 7137 8060 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_10870 8619 8134 gene locus_tag LOCUS_10880 8619 8134 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943354.1 protein_id gnl|my_center|LOCUS_10880 9107 8616 gene locus_tag LOCUS_10890 9107 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence077 2654 2740 gene locus_tag LOCUS_t00110 2654 2740 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2976 3404 gene locus_tag LOCUS_10900 2976 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941821.1 protein_id gnl|my_center|LOCUS_10900 3409 4032 gene locus_tag LOCUS_10910 3409 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4591 4106 gene locus_tag LOCUS_10920 4591 4106 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_10920 6204 4633 gene locus_tag LOCUS_10930 gene cobA 6204 4633 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_10930 7235 6279 gene locus_tag LOCUS_10940 gene hemC 7235 6279 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_10940 7977 7285 gene locus_tag LOCUS_10950 gene sfsA 7977 7285 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_10950 <9132 8014 gene locus_tag LOCUS_10960 <9132 8014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943895.1:glutamyl-tRNA reductase >Feature sequence078 1834 1124 gene locus_tag LOCUS_10970 1834 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2230 3009 gene locus_tag LOCUS_10980 gene cobM 2230 3009 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943624.1 protein_id gnl|my_center|LOCUS_10980 3011 4087 gene locus_tag LOCUS_10990 3011 4087 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_10990 4154 5155 gene locus_tag LOCUS_11000 gene pdxA 4154 5155 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_11000 5633 5160 gene locus_tag LOCUS_11010 5633 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6142 5855 gene locus_tag LOCUS_11020 6142 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6627 6208 gene locus_tag LOCUS_11030 6627 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8069 6639 gene locus_tag LOCUS_11040 8069 6639 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_11040 <9053 8066 gene locus_tag LOCUS_11050 <9053 8066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941595.1:pitrilysin family protein >Feature sequence079 2458 359 gene locus_tag LOCUS_11060 2458 359 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_11060 2900 2535 gene locus_tag LOCUS_11070 2900 2535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_11070 3259 2900 gene locus_tag LOCUS_11080 3259 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5172 3325 gene locus_tag LOCUS_11090 5172 3325 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044990.1 protein_id gnl|my_center|LOCUS_11090 5602 5204 gene locus_tag LOCUS_11100 5602 5204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_11100 6917 5694 gene locus_tag LOCUS_11110 6917 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7478 6999 gene locus_tag LOCUS_11120 7478 6999 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941939.1 protein_id gnl|my_center|LOCUS_11120 8909 7536 gene locus_tag LOCUS_11130 8909 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence080 <1 1440 gene locus_tag LOCUS_11140 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942996.1:malto-oligosyltrehalose synthase 1926 1480 gene locus_tag LOCUS_11150 1926 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 2330 1896 gene locus_tag LOCUS_11160 2330 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 2453 5764 gene locus_tag LOCUS_11170 gene treS 2453 5764 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942997.1 protein_id gnl|my_center|LOCUS_11170 7281 6124 gene locus_tag LOCUS_11180 7281 6124 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940963.1 protein_id gnl|my_center|LOCUS_11180 8378 7299 gene locus_tag LOCUS_11190 gene mqnE 8378 7299 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence081 1794 1033 gene locus_tag LOCUS_11200 1794 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2168 1836 gene locus_tag LOCUS_11210 2168 1836 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_11210 2820 3419 gene locus_tag LOCUS_11220 2820 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4358 3513 gene locus_tag LOCUS_11230 4358 3513 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_11230 5517 4516 gene locus_tag LOCUS_11240 5517 4516 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_11240 6546 5599 gene locus_tag LOCUS_11250 6546 5599 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_11250 7211 6711 gene locus_tag LOCUS_11260 7211 6711 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_11260 <8759 7366 gene locus_tag LOCUS_11270 <8759 7366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940767.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein >Feature sequence082 <1 514 gene locus_tag LOCUS_11280 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004804477.1:KilA-N domain-containing protein 524 1609 gene locus_tag LOCUS_11290 gene lpxK 524 1609 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_11290 1661 1855 gene locus_tag LOCUS_11300 1661 1855 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_11300 1852 2919 gene locus_tag LOCUS_11310 gene waaF 1852 2919 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_11310 2916 3926 gene locus_tag LOCUS_11320 2916 3926 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_11320 3919 4701 gene locus_tag LOCUS_11330 3919 4701 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_11330 4685 5608 gene locus_tag LOCUS_11340 4685 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5605 6417 gene locus_tag LOCUS_11350 5605 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6488 7501 gene locus_tag LOCUS_11360 gene rfaQ 6488 7501 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942892.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence083 <1 689 gene locus_tag LOCUS_11370 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258124.1:ABC transporter ATP-binding protein 849 1931 gene locus_tag LOCUS_11380 849 1931 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_11380 2658 1882 gene locus_tag LOCUS_11390 2658 1882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_11390 4136 2655 gene locus_tag LOCUS_11400 4136 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_11400 4322 5425 gene locus_tag LOCUS_11410 4322 5425 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942522.1 protein_id gnl|my_center|LOCUS_11410 6292 5486 gene locus_tag LOCUS_11420 gene fetB 6292 5486 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679265.1 protein_id gnl|my_center|LOCUS_11420 7065 6289 gene locus_tag LOCUS_11430 7065 6289 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_11430 7319 8218 gene locus_tag LOCUS_11440 7319 8218 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence084 1497 940 gene locus_tag LOCUS_11450 1497 940 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942672.1 protein_id gnl|my_center|LOCUS_11450 2077 1472 gene locus_tag LOCUS_11460 2077 1472 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_11460 2688 2107 gene locus_tag LOCUS_11470 2688 2107 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_11470 3740 2685 gene locus_tag LOCUS_11480 gene pilM 3740 2685 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_11480 3959 3759 gene locus_tag LOCUS_11490 3959 3759 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_11490 4808 4185 gene locus_tag LOCUS_11500 4808 4185 CDS product type IV pilus minor pilin PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942677.1 protein_id gnl|my_center|LOCUS_11500 6041 4821 gene locus_tag LOCUS_11510 6041 4821 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942678.1 protein_id gnl|my_center|LOCUS_11510 6450 6058 gene locus_tag LOCUS_11520 6450 6058 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942679.1 protein_id gnl|my_center|LOCUS_11520 6931 6437 gene locus_tag LOCUS_11530 6931 6437 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942680.1 protein_id gnl|my_center|LOCUS_11530 8353 6956 gene locus_tag LOCUS_11540 8353 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence085 2852 1638 gene locus_tag LOCUS_11550 2852 1638 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545964.1 protein_id gnl|my_center|LOCUS_11550 4501 2849 gene locus_tag LOCUS_11560 4501 2849 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546442.1 protein_id gnl|my_center|LOCUS_11560 6357 4609 gene locus_tag LOCUS_11570 gene mshL 6357 4609 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_11570 6833 6339 gene locus_tag LOCUS_11580 6833 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7387 6830 gene locus_tag LOCUS_11590 7387 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence086 727 86 gene locus_tag LOCUS_11600 727 86 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_11600 1490 645 gene locus_tag LOCUS_11610 1490 645 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_11610 3691 1517 gene locus_tag LOCUS_11620 3691 1517 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_11620 4155 3688 gene locus_tag LOCUS_11630 4155 3688 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_11630 4384 5601 gene locus_tag LOCUS_11640 4384 5601 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_11640 5681 6367 gene locus_tag LOCUS_11650 5681 6367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_11650 6372 6938 gene locus_tag LOCUS_11660 6372 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 6959 7525 gene locus_tag LOCUS_11670 6959 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 >Feature sequence087 2771 1470 gene locus_tag LOCUS_11680 2771 1470 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_11680 3688 2771 gene locus_tag LOCUS_11690 gene selD 3688 2771 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011366119.1 protein_id gnl|my_center|LOCUS_11690 5085 3952 gene locus_tag LOCUS_11700 gene alr 5085 3952 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_11700 5286 7214 gene locus_tag LOCUS_11710 5286 7214 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044948.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence088 429 680 gene locus_tag LOCUS_11720 429 680 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_11720 655 1038 gene locus_tag LOCUS_11730 655 1038 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941003.1 protein_id gnl|my_center|LOCUS_11730 1043 1732 gene locus_tag LOCUS_11740 1043 1732 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_11740 1791 2066 gene locus_tag LOCUS_11750 gene atpE 1791 2066 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941001.1 protein_id gnl|my_center|LOCUS_11750 2930 2169 gene locus_tag LOCUS_11760 2930 2169 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940833.1 protein_id gnl|my_center|LOCUS_11760 3690 2959 gene locus_tag LOCUS_11770 3690 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4574 3687 gene locus_tag LOCUS_11780 4574 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6135 4738 gene locus_tag LOCUS_11790 gene argH 6135 4738 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_11790 7301 6132 gene locus_tag LOCUS_11800 7301 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940831.1 protein_id gnl|my_center|LOCUS_11800 7755 7306 gene locus_tag LOCUS_11810 7755 7306 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940830.1 protein_id gnl|my_center|LOCUS_11810 <8511 7752 gene locus_tag LOCUS_11820 <8511 7752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940829.1:argininosuccinate synthase >Feature sequence089 1456 1103 gene locus_tag LOCUS_11830 1456 1103 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941214.1 protein_id gnl|my_center|LOCUS_11830 2693 1458 gene locus_tag LOCUS_11840 2693 1458 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_11840 3244 2690 gene locus_tag LOCUS_11850 3244 2690 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943966.1 protein_id gnl|my_center|LOCUS_11850 3407 4060 gene locus_tag LOCUS_11860 3407 4060 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942714.1 protein_id gnl|my_center|LOCUS_11860 4044 4547 gene locus_tag LOCUS_11870 gene rnhA 4044 4547 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942713.1 protein_id gnl|my_center|LOCUS_11870 5052 4573 gene locus_tag LOCUS_11880 5052 4573 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940716.1 protein_id gnl|my_center|LOCUS_11880 5180 5088 gene locus_tag LOCUS_t00120 5180 5088 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5622 5287 gene locus_tag LOCUS_11890 5622 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943272.1 protein_id gnl|my_center|LOCUS_11890 6289 5699 gene locus_tag LOCUS_11900 6289 5699 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_11900 6803 6312 gene locus_tag LOCUS_11910 6803 6312 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_11910 7015 8091 gene locus_tag LOCUS_11920 7015 8091 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944064.1 protein_id gnl|my_center|LOCUS_11920 8172 8247 gene locus_tag LOCUS_t00130 8172 8247 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8320 8496 gene locus_tag LOCUS_11930 8320 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence090 1411 398 gene locus_tag LOCUS_11940 gene hypE 1411 398 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_11940 1570 2895 gene locus_tag LOCUS_11950 1570 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941665.1 protein_id gnl|my_center|LOCUS_11950 2933 3670 gene locus_tag LOCUS_11960 2933 3670 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941169.1 protein_id gnl|my_center|LOCUS_11960 3678 4283 gene locus_tag LOCUS_11970 gene plsY 3678 4283 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_11970 4997 4287 gene locus_tag LOCUS_11980 gene ubiE 4997 4287 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_11980 5107 6378 gene locus_tag LOCUS_11990 5107 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6382 7797 gene locus_tag LOCUS_12000 gene cdaA 6382 7797 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence091 460 1512 gene locus_tag LOCUS_12010 460 1512 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_12010 1589 2992 gene locus_tag LOCUS_12020 1589 2992 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943883.1 protein_id gnl|my_center|LOCUS_12020 3400 4077 gene locus_tag LOCUS_12030 3400 4077 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_12030 4074 4403 gene locus_tag LOCUS_12040 4074 4403 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030566.1 protein_id gnl|my_center|LOCUS_12040 4397 5143 gene locus_tag LOCUS_12050 gene cbiQ 4397 5143 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_12050 5140 6003 gene locus_tag LOCUS_12060 5140 6003 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_12060 6075 6494 gene locus_tag LOCUS_12070 gene nikR 6075 6494 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_12070 7138 6572 gene locus_tag LOCUS_12080 7138 6572 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_12080 7596 7141 gene locus_tag LOCUS_12090 7596 7141 CDS product iron-sulfur cluster-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943298.1 protein_id gnl|my_center|LOCUS_12090 7866 7651 gene locus_tag LOCUS_12100 7866 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943297.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence092 291 1109 gene locus_tag LOCUS_12110 291 1109 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941047.1 protein_id gnl|my_center|LOCUS_12110 1106 1951 gene locus_tag LOCUS_12120 gene lipA 1106 1951 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 protein_id gnl|my_center|LOCUS_12120 2063 3241 gene locus_tag LOCUS_12130 2063 3241 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941584.1 protein_id gnl|my_center|LOCUS_12130 3468 8111 gene locus_tag LOCUS_12140 3468 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence093 380 2758 gene locus_tag LOCUS_12150 380 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2843 3148 gene locus_tag LOCUS_12160 2843 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3175 4311 gene locus_tag LOCUS_12170 3175 4311 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_12170 4580 5548 gene locus_tag LOCUS_12180 4580 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5647 6759 gene locus_tag LOCUS_12190 5647 6759 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545054.1 protein_id gnl|my_center|LOCUS_12190 8010 6781 gene locus_tag LOCUS_12200 8010 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence094 637 230 gene locus_tag LOCUS_12210 637 230 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_12210 1211 657 gene locus_tag LOCUS_12220 1211 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1619 1347 gene locus_tag LOCUS_12230 1619 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2249 1761 gene locus_tag LOCUS_12240 2249 1761 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941845.1 protein_id gnl|my_center|LOCUS_12240 2568 3674 gene locus_tag LOCUS_12250 2568 3674 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940810.1 protein_id gnl|my_center|LOCUS_12250 3743 3967 gene locus_tag LOCUS_12260 3743 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4828 4424 gene locus_tag LOCUS_12270 4828 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5679 5344 gene locus_tag LOCUS_12280 5679 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6108 5902 gene locus_tag LOCUS_12290 6108 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6449 6219 gene locus_tag LOCUS_12300 6449 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7160 8071 gene locus_tag LOCUS_12310 7160 8071 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941599.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence095 1683 1342 gene locus_tag LOCUS_12320 gene ftsL 1683 1342 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943701.1 protein_id gnl|my_center|LOCUS_12320 2738 1797 gene locus_tag LOCUS_12330 gene rsmH 2738 1797 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_12330 3218 2739 gene locus_tag LOCUS_12340 gene mraZ 3218 2739 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943703.1 protein_id gnl|my_center|LOCUS_12340 3924 3580 gene locus_tag LOCUS_12350 3924 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943704.1 protein_id gnl|my_center|LOCUS_12350 4506 4000 gene locus_tag LOCUS_12360 4506 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5677 4964 gene locus_tag LOCUS_12370 5677 4964 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_12370 6844 5714 gene locus_tag LOCUS_12380 6844 5714 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943706.1 protein_id gnl|my_center|LOCUS_12380 7036 6960 gene locus_tag LOCUS_t00140 7036 6960 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7597 7166 gene locus_tag LOCUS_12390 7597 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 <8286 7685 gene locus_tag LOCUS_12400 <8286 7685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941245.1:methyl-accepting chemotaxis protein >Feature sequence096 211 1488 gene locus_tag LOCUS_12410 gene purD 211 1488 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_12410 1633 2133 gene locus_tag LOCUS_12420 gene purE 1633 2133 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_12420 2209 2469 gene locus_tag LOCUS_12430 2209 2469 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_12430 2663 4027 gene locus_tag LOCUS_12440 2663 4027 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_12440 4045 4902 gene locus_tag LOCUS_12450 gene ccsB 4045 4902 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_12450 5127 6080 gene locus_tag LOCUS_12460 5127 6080 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941284.1 protein_id gnl|my_center|LOCUS_12460 6162 7106 gene locus_tag LOCUS_12470 6162 7106 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence097 3 1067 gene locus_tag LOCUS_12480 3 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1071 1952 gene locus_tag LOCUS_12490 1071 1952 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_12490 1949 3349 gene locus_tag LOCUS_12500 1949 3349 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_12500 3327 4769 gene locus_tag LOCUS_12510 3327 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4953 6305 gene locus_tag LOCUS_12520 4953 6305 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_12520 6305 7447 gene locus_tag LOCUS_12530 6305 7447 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_12530 7626 7444 gene locus_tag LOCUS_12540 7626 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942468.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence098 1055 1492 gene locus_tag LOCUS_12550 1055 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940749.1 protein_id gnl|my_center|LOCUS_12550 1497 2636 gene locus_tag LOCUS_12560 1497 2636 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941708.1 protein_id gnl|my_center|LOCUS_12560 3023 2706 gene locus_tag LOCUS_12570 3023 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3223 4383 gene locus_tag LOCUS_12580 3223 4383 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_12580 4545 7157 gene locus_tag LOCUS_12590 gene mutS 4545 7157 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence099 1661 744 gene locus_tag LOCUS_12600 1661 744 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943779.1 protein_id gnl|my_center|LOCUS_12600 3660 1675 gene locus_tag LOCUS_12610 3660 1675 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_12610 4072 5319 gene locus_tag LOCUS_12620 gene rho 4072 5319 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_12620 5418 5618 gene locus_tag LOCUS_12630 gene rpmE 5418 5618 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_12630 5708 6400 gene locus_tag LOCUS_12640 gene thyX 5708 6400 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_12640 6413 7384 gene locus_tag LOCUS_12650 6413 7384 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence100 1062 694 gene locus_tag LOCUS_12660 1062 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4362 1225 gene locus_tag LOCUS_12670 4362 1225 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_12670 5890 4499 gene locus_tag LOCUS_12680 5890 4499 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_12680 7209 5935 gene locus_tag LOCUS_12690 7209 5935 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_12690 7743 7564 gene locus_tag LOCUS_12700 7743 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence101 1185 721 gene locus_tag LOCUS_12710 1185 721 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940846.1 protein_id gnl|my_center|LOCUS_12710 1816 1292 gene locus_tag LOCUS_12720 1816 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 2922 1813 gene locus_tag LOCUS_12730 2922 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 3172 3846 gene locus_tag LOCUS_12740 gene cysE 3172 3846 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_12740 3919 4788 gene locus_tag LOCUS_12750 gene lpxC 3919 4788 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941392.1 protein_id gnl|my_center|LOCUS_12750 <7964 4805 gene locus_tag LOCUS_12760 <7964 4805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941537.1:AsmA-like C-terminal domain-containing protein >Feature sequence102 875 453 gene locus_tag LOCUS_12770 875 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 984 1322 gene locus_tag LOCUS_12780 984 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1407 1751 gene locus_tag LOCUS_12790 1407 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2022 2228 gene locus_tag LOCUS_12800 2022 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2917 2285 gene locus_tag LOCUS_12810 2917 2285 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_12810 4289 3105 gene locus_tag LOCUS_12820 4289 3105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228104.1 protein_id gnl|my_center|LOCUS_12820 4427 5332 gene locus_tag LOCUS_12830 4427 5332 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940939.1 protein_id gnl|my_center|LOCUS_12830 7267 5423 gene locus_tag LOCUS_12840 7267 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7776 7267 gene locus_tag LOCUS_12850 7776 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence103 1036 113 gene locus_tag LOCUS_12860 gene secF 1036 113 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_12860 2643 1051 gene locus_tag LOCUS_12870 gene secD 2643 1051 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_12870 2994 2671 gene locus_tag LOCUS_12880 gene yajC 2994 2671 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_12880 4195 2999 gene locus_tag LOCUS_12890 gene tgt 4195 2999 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_12890 5258 4227 gene locus_tag LOCUS_12900 gene queA 5258 4227 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_12900 6411 5272 gene locus_tag LOCUS_12910 6411 5272 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence104 674 249 gene locus_tag LOCUS_12920 674 249 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_12920 1680 826 gene locus_tag LOCUS_12930 1680 826 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_12930 2446 1673 gene locus_tag LOCUS_12940 2446 1673 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_12940 2623 2931 gene locus_tag LOCUS_12950 2623 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3834 2947 gene locus_tag LOCUS_12960 3834 2947 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943965.1 protein_id gnl|my_center|LOCUS_12960 3954 4511 gene locus_tag LOCUS_12970 3954 4511 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_12970 4513 5664 gene locus_tag LOCUS_12980 gene hpnI 4513 5664 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_12980 5750 6328 gene locus_tag LOCUS_12990 5750 6328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_12990 6421 7614 gene locus_tag LOCUS_13000 6421 7614 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence105 2141 1566 gene locus_tag LOCUS_13010 gene grpE 2141 1566 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940710.1 protein_id gnl|my_center|LOCUS_13010 3209 2178 gene locus_tag LOCUS_13020 gene hrcA 3209 2178 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_13020 3420 4235 gene locus_tag LOCUS_13030 gene murI 3420 4235 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_13030 4242 4862 gene locus_tag LOCUS_13040 4242 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4859 7279 gene locus_tag LOCUS_13050 4859 7279 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence106 1752 1000 gene locus_tag LOCUS_13060 1752 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941113.1 protein_id gnl|my_center|LOCUS_13060 2687 1941 gene locus_tag LOCUS_13070 2687 1941 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_13070 3613 2684 gene locus_tag LOCUS_13080 gene prmA 3613 2684 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_13080 3774 4583 gene locus_tag LOCUS_13090 3774 4583 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_13090 4628 5302 gene locus_tag LOCUS_13100 4628 5302 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_13100 5434 6855 gene locus_tag LOCUS_13110 5434 6855 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_13110 6923 7582 gene locus_tag LOCUS_13120 6923 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence107 621 1463 gene locus_tag LOCUS_13130 gene ispE 621 1463 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_13130 1549 1623 gene locus_tag LOCUS_t00150 1549 1623 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1659 2603 gene locus_tag LOCUS_13140 1659 2603 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_13140 2692 3279 gene locus_tag LOCUS_13150 2692 3279 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_13150 3298 3879 gene locus_tag LOCUS_13160 gene pth 3298 3879 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_13160 3883 4977 gene locus_tag LOCUS_13170 gene ychF 3883 4977 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_13170 5049 5543 gene locus_tag LOCUS_13180 5049 5543 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_13180 5599 7587 gene locus_tag LOCUS_13190 gene feoB 5599 7587 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence108 <1 869 gene locus_tag LOCUS_13200 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719380.1:adenylosuccinate lyase 862 1953 gene locus_tag LOCUS_13210 862 1953 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_13210 2137 2541 gene locus_tag LOCUS_13220 2137 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2542 3663 gene locus_tag LOCUS_13230 2542 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3685 6678 gene locus_tag LOCUS_13240 3685 6678 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence109 361 786 gene locus_tag LOCUS_13250 361 786 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_13250 1245 2651 gene locus_tag LOCUS_13260 1245 2651 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_13260 2913 5717 gene locus_tag LOCUS_13270 2913 5717 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_13270 5961 6254 gene locus_tag LOCUS_13280 5961 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6321 6506 gene locus_tag LOCUS_13290 6321 6506 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_13290 6533 6946 gene locus_tag LOCUS_13300 6533 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence110 2102 315 gene locus_tag LOCUS_13310 2102 315 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_13310 2309 2139 gene locus_tag LOCUS_13320 2309 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4437 2437 gene locus_tag LOCUS_13330 4437 2437 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942267.1 protein_id gnl|my_center|LOCUS_13330 4802 5353 gene locus_tag LOCUS_13340 4802 5353 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545973.1 protein_id gnl|my_center|LOCUS_13340 5350 7485 gene locus_tag LOCUS_13350 5350 7485 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545063.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence111 654 514 gene locus_tag LOCUS_13360 654 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1896 1042 gene locus_tag LOCUS_13370 1896 1042 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942785.1 protein_id gnl|my_center|LOCUS_13370 2816 1968 gene locus_tag LOCUS_13380 2816 1968 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941990.1 protein_id gnl|my_center|LOCUS_13380 3727 2813 gene locus_tag LOCUS_13390 3727 2813 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207485.1 protein_id gnl|my_center|LOCUS_13390 4498 4022 gene locus_tag LOCUS_13400 4498 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941987.1 protein_id gnl|my_center|LOCUS_13400 6125 4752 gene locus_tag LOCUS_13410 6125 4752 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_13410 7264 6122 gene locus_tag LOCUS_13420 7264 6122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence112 1708 452 gene locus_tag LOCUS_13430 gene clpX 1708 452 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_13430 2304 1705 gene locus_tag LOCUS_13440 gene clpP 2304 1705 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_13440 3629 2319 gene locus_tag LOCUS_13450 gene tig 3629 2319 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_13450 3783 3701 gene locus_tag LOCUS_t00160 3783 3701 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4246 7383 gene locus_tag LOCUS_13460 4246 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence113 <1 879 gene locus_tag LOCUS_13470 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943687.1:radical SAM protein 876 1055 gene locus_tag LOCUS_13480 876 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943922.1 protein_id gnl|my_center|LOCUS_13480 1611 1898 gene locus_tag LOCUS_13490 1611 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2022 2513 gene locus_tag LOCUS_13500 2022 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2557 3807 gene locus_tag LOCUS_13510 2557 3807 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942369.1 protein_id gnl|my_center|LOCUS_13510 3810 6251 gene locus_tag LOCUS_13520 3810 6251 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942370.1 protein_id gnl|my_center|LOCUS_13520 6696 6349 gene locus_tag LOCUS_13530 6696 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13530 >Feature sequence114 <1 571 gene locus_tag LOCUS_13540 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941404.1:hydrogenase 719 1243 gene locus_tag LOCUS_13550 719 1243 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_13550 1240 1422 gene locus_tag LOCUS_13560 1240 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1716 2540 gene locus_tag LOCUS_13570 1716 2540 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_13570 2560 3591 gene locus_tag LOCUS_13580 2560 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3650 5575 gene locus_tag LOCUS_13590 3650 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_13590 6748 5669 gene locus_tag LOCUS_13600 6748 5669 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_13600 <7393 6884 gene locus_tag LOCUS_13610 <7393 6884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941663.1:replicative DNA helicase >Feature sequence115 <1 634 gene locus_tag LOCUS_13620 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941571.1:HDOD domain-containing protein 627 2795 gene locus_tag LOCUS_13630 627 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3137 4273 gene locus_tag LOCUS_13640 3137 4273 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941612.1 protein_id gnl|my_center|LOCUS_13640 4420 5553 gene locus_tag LOCUS_13650 4420 5553 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_13650 5560 6366 gene locus_tag LOCUS_13660 gene thiF 5560 6366 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence116 518 793 gene locus_tag LOCUS_13670 518 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1437 790 gene locus_tag LOCUS_13680 1437 790 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944026.1 protein_id gnl|my_center|LOCUS_13680 2327 1434 gene locus_tag LOCUS_13690 2327 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3043 2324 gene locus_tag LOCUS_13700 3043 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4549 3128 gene locus_tag LOCUS_13710 4549 3128 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_13710 5861 4770 gene locus_tag LOCUS_13720 gene modC 5861 4770 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943591.1 protein_id gnl|my_center|LOCUS_13720 6546 5863 gene locus_tag LOCUS_13730 gene modB 6546 5863 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943592.1 protein_id gnl|my_center|LOCUS_13730 <7364 6553 gene locus_tag LOCUS_13740 <7364 6553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943593.1:molybdate ABC transporter substrate-binding protein >Feature sequence117 2227 1115 gene locus_tag LOCUS_13750 2227 1115 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_13750 3869 2367 gene locus_tag LOCUS_13760 3869 2367 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_13760 4568 3960 gene locus_tag LOCUS_13770 4568 3960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_13770 6098 4668 gene locus_tag LOCUS_13780 gene adeC 6098 4668 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_13780 <7292 6100 gene locus_tag LOCUS_13790 <7292 6100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943334.1:efflux RND transporter permease subunit >Feature sequence118 188 940 gene locus_tag LOCUS_13800 188 940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_13800 1027 1860 gene locus_tag LOCUS_13810 1027 1860 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_13810 2423 1878 gene locus_tag LOCUS_13820 gene rfbC 2423 1878 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_13820 2547 3824 gene locus_tag LOCUS_13830 2547 3824 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_13830 3942 4550 gene locus_tag LOCUS_13840 gene gmk 3942 4550 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_13840 4607 4816 gene locus_tag LOCUS_13850 gene rpoZ 4607 4816 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_13850 4918 7068 gene locus_tag LOCUS_13860 4918 7068 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence119 2632 1508 gene locus_tag LOCUS_13870 gene lpxB 2632 1508 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_13870 3743 2649 gene locus_tag LOCUS_13880 3743 2649 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_13880 4713 3775 gene locus_tag LOCUS_13890 4713 3775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_13890 5489 4710 gene locus_tag LOCUS_13900 gene lpxA 5489 4710 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_13900 5975 5532 gene locus_tag LOCUS_13910 gene fabZ 5975 5532 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_13910 <7210 6151 gene locus_tag LOCUS_13920 <7210 6151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942906.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence120 2427 700 gene locus_tag LOCUS_13930 2427 700 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_13930 3656 2424 gene locus_tag LOCUS_13940 3656 2424 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_13940 3837 4562 gene locus_tag LOCUS_13950 gene ybgF 3837 4562 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_13950 4595 5611 gene locus_tag LOCUS_13960 4595 5611 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_13960 5675 6766 gene locus_tag LOCUS_13970 gene dprA 5675 6766 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence121 <1 1916 gene locus_tag LOCUS_13980 <1 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941801.1:methyl-accepting chemotaxis protein 1950 2432 gene locus_tag LOCUS_13990 1950 2432 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_13990 2545 3447 gene locus_tag LOCUS_14000 2545 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3493 4362 gene locus_tag LOCUS_14010 3493 4362 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_14010 4368 5438 gene locus_tag LOCUS_14020 4368 5438 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_14020 5449 6690 gene locus_tag LOCUS_14030 5449 6690 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence122 3 599 gene locus_tag LOCUS_14040 3 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 599 1099 gene locus_tag LOCUS_14050 599 1099 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_14050 1110 2033 gene locus_tag LOCUS_14060 1110 2033 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_14060 2042 3046 gene locus_tag LOCUS_14070 2042 3046 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_14070 3067 3915 gene locus_tag LOCUS_14080 3067 3915 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence123 1722 898 gene locus_tag LOCUS_14090 1722 898 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942981.1 protein_id gnl|my_center|LOCUS_14090 2394 1918 gene locus_tag LOCUS_14100 2394 1918 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941052.1 protein_id gnl|my_center|LOCUS_14100 3018 2506 gene locus_tag LOCUS_14110 3018 2506 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_14110 3242 4096 gene locus_tag LOCUS_14120 gene prmC 3242 4096 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_14120 6028 4133 gene locus_tag LOCUS_14130 6028 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence124 1931 645 gene locus_tag LOCUS_14140 1931 645 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_14140 2903 1998 gene locus_tag LOCUS_14150 2903 1998 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943124.1 protein_id gnl|my_center|LOCUS_14150 3106 4512 gene locus_tag LOCUS_14160 gene merA 3106 4512 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944034.1 protein_id gnl|my_center|LOCUS_14160 4806 4606 gene locus_tag LOCUS_14170 4806 4606 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_14170 5159 5482 gene locus_tag LOCUS_14180 5159 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6478 5576 gene locus_tag LOCUS_14190 6478 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence125 1746 217 gene locus_tag LOCUS_14200 1746 217 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_14200 2153 1833 gene locus_tag LOCUS_14210 2153 1833 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_14210 2994 2188 gene locus_tag LOCUS_14220 gene pgeF 2994 2188 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_14220 3736 3113 gene locus_tag LOCUS_14230 3736 3113 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_14230 3973 5805 gene locus_tag LOCUS_14240 3973 5805 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_14240 5823 6224 gene locus_tag LOCUS_14250 5823 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence126 1442 342 gene locus_tag LOCUS_14260 1442 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2455 1472 gene locus_tag LOCUS_14270 gene holB 2455 1472 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_14270 3098 2442 gene locus_tag LOCUS_14280 gene tmk 3098 2442 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_14280 3272 3970 gene locus_tag LOCUS_14290 3272 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3967 5022 gene locus_tag LOCUS_14300 3967 5022 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_14300 5027 6100 gene locus_tag LOCUS_14310 5027 6100 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence127 1645 1202 gene locus_tag LOCUS_14320 gene rplI 1645 1202 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_14320 2629 1670 gene locus_tag LOCUS_14330 2629 1670 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941328.1 protein_id gnl|my_center|LOCUS_14330 2937 2644 gene locus_tag LOCUS_14340 gene rpsR 2937 2644 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941327.1 protein_id gnl|my_center|LOCUS_14340 3366 2959 gene locus_tag LOCUS_14350 3366 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4379 3495 gene locus_tag LOCUS_14360 4379 3495 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941707.1 protein_id gnl|my_center|LOCUS_14360 4477 5670 gene locus_tag LOCUS_14370 4477 5670 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_14370 6446 5916 gene locus_tag LOCUS_14380 6446 5916 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941689.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence128 <1 668 gene locus_tag LOCUS_14390 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941609.1:nitrogen fixation two-component system sensor histidine kinase GnfK 801 2039 gene locus_tag LOCUS_14400 801 2039 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_14400 2608 2120 gene locus_tag LOCUS_14410 2608 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3583 2699 gene locus_tag LOCUS_14420 3583 2699 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_14420 5474 3663 gene locus_tag LOCUS_14430 gene recD 5474 3663 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_14430 6565 5474 gene locus_tag LOCUS_14440 6565 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence129 282 956 gene locus_tag LOCUS_14450 gene rsmG 282 956 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944072.1 protein_id gnl|my_center|LOCUS_14450 1300 1704 gene locus_tag LOCUS_14460 1300 1704 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_14460 1769 2854 gene locus_tag LOCUS_14470 gene mqnC 1769 2854 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044953.1 protein_id gnl|my_center|LOCUS_14470 2851 4017 gene locus_tag LOCUS_14480 2851 4017 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_14480 4084 5019 gene locus_tag LOCUS_14490 4084 5019 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869033.1 protein_id gnl|my_center|LOCUS_14490 5003 5938 gene locus_tag LOCUS_14500 5003 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6095 6289 gene locus_tag LOCUS_14510 6095 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6282 6674 gene locus_tag LOCUS_14520 6282 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence130 599 84 gene locus_tag LOCUS_14530 599 84 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_14530 2923 635 gene locus_tag LOCUS_14540 gene bamA 2923 635 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_14540 3616 2945 gene locus_tag LOCUS_14550 3616 2945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_14550 4871 3609 gene locus_tag LOCUS_14560 4871 3609 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_14560 6353 4878 gene locus_tag LOCUS_14570 gene lysS 6353 4878 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence131 144 1442 gene locus_tag LOCUS_14580 gene gptM 144 1442 CDS product geopeptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942092.1 protein_id gnl|my_center|LOCUS_14580 2027 2386 gene locus_tag LOCUS_14590 2027 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2376 2936 gene locus_tag LOCUS_14600 2376 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2976 3476 gene locus_tag LOCUS_14610 2976 3476 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_14610 3539 3838 gene locus_tag LOCUS_14620 3539 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3926 5074 gene locus_tag LOCUS_14630 3926 5074 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073502.1 protein_id gnl|my_center|LOCUS_14630 5230 6000 gene locus_tag LOCUS_14640 5230 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 protein_id gnl|my_center|LOCUS_14640 6011 6697 gene locus_tag LOCUS_14650 6011 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence132 1407 562 gene locus_tag LOCUS_14660 gene pstA 1407 562 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_14660 2339 1404 gene locus_tag LOCUS_14670 gene pstC 2339 1404 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_14670 3654 2626 gene locus_tag LOCUS_14680 gene pstS 3654 2626 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_14680 5523 3766 gene locus_tag LOCUS_14690 gene phoR 5523 3766 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_14690 6211 5528 gene locus_tag LOCUS_14700 6211 5528 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_14700 6430 6612 gene locus_tag LOCUS_14710 6430 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943195.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence133 <1 1550 gene locus_tag LOCUS_14720 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944060.1:glutamate synthase-related protein 2038 1466 gene locus_tag LOCUS_14730 2038 1466 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_14730 2374 2565 gene locus_tag LOCUS_14740 2374 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941632.1 protein_id gnl|my_center|LOCUS_14740 2700 2951 gene locus_tag LOCUS_14750 2700 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941633.1 protein_id gnl|my_center|LOCUS_14750 3040 4089 gene locus_tag LOCUS_14760 3040 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941634.1 protein_id gnl|my_center|LOCUS_14760 4279 5421 gene locus_tag LOCUS_14770 4279 5421 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_14770 5443 5772 gene locus_tag LOCUS_14780 5443 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5776 6288 gene locus_tag LOCUS_14790 5776 6288 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_14790 6296 6520 gene locus_tag LOCUS_14800 6296 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence134 <1 1089 gene locus_tag LOCUS_14810 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940708.1:radical SAM family heme chaperone HemW 2188 2526 gene locus_tag LOCUS_14820 2188 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2695 3174 gene locus_tag LOCUS_14830 gene nuoE 2695 3174 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_14830 5310 3316 gene locus_tag LOCUS_14840 5310 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence135 1327 836 gene locus_tag LOCUS_14850 gene ilvN 1327 836 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_14850 2374 1433 gene locus_tag LOCUS_14860 2374 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 2754 3110 gene locus_tag LOCUS_14870 2754 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5022 3361 gene locus_tag LOCUS_14880 gene ilvD 5022 3361 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942557.1 protein_id gnl|my_center|LOCUS_14880 5626 5255 gene locus_tag LOCUS_14890 5626 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6025 5642 gene locus_tag LOCUS_14900 6025 5642 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_14900 6546 6139 gene locus_tag LOCUS_14910 6546 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence136 <1 1188 gene locus_tag LOCUS_14920 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941031.1:ATP-dependent DNA helicase DinG 1642 1160 gene locus_tag LOCUS_14930 1642 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941030.1 protein_id gnl|my_center|LOCUS_14930 1785 2720 gene locus_tag LOCUS_14940 1785 2720 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_14940 2806 3513 gene locus_tag LOCUS_14950 2806 3513 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_14950 3514 5424 gene locus_tag LOCUS_14960 gene selB 3514 5424 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_14960 5466 5708 gene locus_tag LOCUS_14970 5466 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5752 6576 gene locus_tag LOCUS_14980 5752 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence137 822 289 gene locus_tag LOCUS_14990 gene def 822 289 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 protein_id gnl|my_center|LOCUS_14990 1014 1595 gene locus_tag LOCUS_15000 1014 1595 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_15000 1670 2254 gene locus_tag LOCUS_15010 1670 2254 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_15010 2251 3180 gene locus_tag LOCUS_15020 2251 3180 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_15020 3241 4446 gene locus_tag LOCUS_15030 3241 4446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_15030 5828 4476 gene locus_tag LOCUS_15040 5828 4476 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence138 2038 341 gene locus_tag LOCUS_15050 2038 341 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545097.1 protein_id gnl|my_center|LOCUS_15050 2203 2664 gene locus_tag LOCUS_15060 2203 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3448 2681 gene locus_tag LOCUS_15070 3448 2681 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_15070 4033 3467 gene locus_tag LOCUS_15080 4033 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6090 4279 gene locus_tag LOCUS_15090 gene ftsH 6090 4279 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941840.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence139 95 2422 gene locus_tag LOCUS_15100 95 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2605 3960 gene locus_tag LOCUS_15110 2605 3960 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940953.1 protein_id gnl|my_center|LOCUS_15110 4375 5175 gene locus_tag LOCUS_15120 4375 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence140 2042 2953 gene locus_tag LOCUS_15130 2042 2953 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_15130 3041 4435 gene locus_tag LOCUS_15140 gene ahcY 3041 4435 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_15140 4698 5171 gene locus_tag LOCUS_15150 4698 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5439 6065 gene locus_tag LOCUS_15160 5439 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence141 731 1132 gene locus_tag LOCUS_15170 731 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941888.1 protein_id gnl|my_center|LOCUS_15170 1160 2086 gene locus_tag LOCUS_15180 1160 2086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_15180 2167 3006 gene locus_tag LOCUS_15190 2167 3006 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942933.1 protein_id gnl|my_center|LOCUS_15190 3025 3912 gene locus_tag LOCUS_15200 3025 3912 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942148.1 protein_id gnl|my_center|LOCUS_15200 3909 4811 gene locus_tag LOCUS_15210 3909 4811 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942149.1 protein_id gnl|my_center|LOCUS_15210 4816 5640 gene locus_tag LOCUS_15220 4816 5640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence142 796 1776 gene locus_tag LOCUS_15230 796 1776 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_15230 1851 4169 gene locus_tag LOCUS_15240 1851 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 4147 5508 gene locus_tag LOCUS_15250 4147 5508 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940953.1 protein_id gnl|my_center|LOCUS_15250 5682 5957 gene locus_tag LOCUS_15260 5682 5957 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence143 2602 848 gene locus_tag LOCUS_15270 2602 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2924 2610 gene locus_tag LOCUS_15280 2924 2610 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_15280 3445 3053 gene locus_tag LOCUS_15290 3445 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6278 3615 gene locus_tag LOCUS_15300 6278 3615 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence144 1386 397 gene locus_tag LOCUS_15310 1386 397 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_15310 3512 1464 gene locus_tag LOCUS_15320 gene shc 3512 1464 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_15320 3903 4226 gene locus_tag LOCUS_15330 gene yhbY 3903 4226 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_15330 4223 4873 gene locus_tag LOCUS_15340 4223 4873 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence145 664 347 gene locus_tag LOCUS_15350 664 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 596 2527 gene locus_tag LOCUS_15360 596 2527 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15360 2766 3164 gene locus_tag LOCUS_15370 2766 3164 CDS product exosortase system-associated protein, TIGR04073 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943857.1 protein_id gnl|my_center|LOCUS_15370 4206 3343 gene locus_tag LOCUS_15380 gene galU 4206 3343 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_15380 5297 4425 gene locus_tag LOCUS_15390 5297 4425 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_15390 5948 5301 gene locus_tag LOCUS_15400 5948 5301 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence146 <1 1175 gene locus_tag LOCUS_15410 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810456.1:nitrate reductase subunit beta 1172 1717 gene locus_tag LOCUS_15420 1172 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1711 2379 gene locus_tag LOCUS_15430 gene narI 1711 2379 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810453.1 protein_id gnl|my_center|LOCUS_15430 2440 3957 gene locus_tag LOCUS_15440 2440 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4002 5387 gene locus_tag LOCUS_15450 4002 5387 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468297.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence147 748 134 gene locus_tag LOCUS_15460 748 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1055 979 gene locus_tag LOCUS_t00170 1055 979 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1225 1139 gene locus_tag LOCUS_t00180 1225 1139 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1538 1260 gene locus_tag LOCUS_15470 1538 1260 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_15470 3299 1563 gene locus_tag LOCUS_15480 3299 1563 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_15480 4230 3388 gene locus_tag LOCUS_15490 gene ispH 4230 3388 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_15490 4928 4227 gene locus_tag LOCUS_15500 gene cmk 4928 4227 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_15500 6223 4934 gene locus_tag LOCUS_15510 gene aroA 6223 4934 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence148 2355 106 gene locus_tag LOCUS_15520 gene priA 2355 106 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_15520 2649 2440 gene locus_tag LOCUS_15530 2649 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941200.1 protein_id gnl|my_center|LOCUS_15530 3243 2800 gene locus_tag LOCUS_15540 3243 2800 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_15540 3482 3240 gene locus_tag LOCUS_15550 3482 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3927 3598 gene locus_tag LOCUS_15560 3927 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4076 4804 gene locus_tag LOCUS_15570 4076 4804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence149 307 77 gene locus_tag LOCUS_15580 307 77 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941962.1 protein_id gnl|my_center|LOCUS_15580 825 304 gene locus_tag LOCUS_15590 825 304 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941961.1 protein_id gnl|my_center|LOCUS_15590 1664 885 gene locus_tag LOCUS_15600 gene lgt 1664 885 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_15600 3305 1680 gene locus_tag LOCUS_15610 gene serA 3305 1680 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941855.1 protein_id gnl|my_center|LOCUS_15610 3458 3931 gene locus_tag LOCUS_15620 3458 3931 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_15620 4233 4466 gene locus_tag LOCUS_15630 4233 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4511 5707 gene locus_tag LOCUS_15640 gene truD 4511 5707 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence150 1521 856 gene locus_tag LOCUS_15650 1521 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2524 1553 gene locus_tag LOCUS_15660 2524 1553 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942172.1 protein_id gnl|my_center|LOCUS_15660 3209 2547 gene locus_tag LOCUS_15670 3209 2547 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_15670 4068 3325 gene locus_tag LOCUS_15680 gene surE 4068 3325 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_15680 4253 5239 gene locus_tag LOCUS_15690 4253 5239 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943275.1 protein_id gnl|my_center|LOCUS_15690 5277 5693 gene locus_tag LOCUS_15700 5277 5693 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence151 1690 1154 gene locus_tag LOCUS_15710 1690 1154 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_15710 1885 2721 gene locus_tag LOCUS_15720 gene dapF 1885 2721 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_15720 2729 3616 gene locus_tag LOCUS_15730 gene gspC 2729 3616 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940998.1 protein_id gnl|my_center|LOCUS_15730 3787 5754 gene locus_tag LOCUS_15740 gene gspD 3787 5754 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence152 <1 667 gene locus_tag LOCUS_15750 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941810.1:EAL domain-containing protein 1098 2573 gene locus_tag LOCUS_15760 gene thiD 1098 2573 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941267.1 protein_id gnl|my_center|LOCUS_15760 2587 3873 gene locus_tag LOCUS_15770 gene thiC 2587 3873 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_15770 4130 3933 gene locus_tag LOCUS_15780 4130 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4535 5410 gene locus_tag LOCUS_15790 4535 5410 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence153 666 436 gene locus_tag LOCUS_15800 666 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2252 669 gene locus_tag LOCUS_15810 2252 669 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_15810 2815 2369 gene locus_tag LOCUS_15820 2815 2369 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940812.1 protein_id gnl|my_center|LOCUS_15820 3253 2834 gene locus_tag LOCUS_15830 3253 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3396 3320 gene locus_tag LOCUS_t00190 3396 3320 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3551 4177 gene locus_tag LOCUS_15840 gene coaE 3551 4177 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_15840 4174 5358 gene locus_tag LOCUS_15850 4174 5358 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_15850 5991 5587 gene locus_tag LOCUS_15860 5991 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence154 932 243 gene locus_tag LOCUS_15870 932 243 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_15870 1255 4329 gene locus_tag LOCUS_15880 1255 4329 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_15880 4342 5502 gene locus_tag LOCUS_15890 4342 5502 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence155 <1 1075 gene locus_tag LOCUS_15900 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942835.1:IMP dehydrogenase 1075 2637 gene locus_tag LOCUS_15910 gene guaA 1075 2637 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_15910 2715 4457 gene locus_tag LOCUS_15920 2715 4457 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546350.1 protein_id gnl|my_center|LOCUS_15920 4500 4997 gene locus_tag LOCUS_15930 4500 4997 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942700.1 protein_id gnl|my_center|LOCUS_15930 4999 5658 gene locus_tag LOCUS_15940 4999 5658 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942283.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence156 261 455 gene locus_tag LOCUS_15950 261 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940932.1 protein_id gnl|my_center|LOCUS_15950 730 1998 gene locus_tag LOCUS_15960 730 1998 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_15960 1995 3038 gene locus_tag LOCUS_15970 1995 3038 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_15970 3127 4416 gene locus_tag LOCUS_15980 3127 4416 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_15980 4732 5283 gene locus_tag LOCUS_15990 4732 5283 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence157 1568 789 gene locus_tag LOCUS_16000 1568 789 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940704.1 protein_id gnl|my_center|LOCUS_16000 1981 1568 gene locus_tag LOCUS_16010 gene tolR 1981 1568 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_16010 2659 1985 gene locus_tag LOCUS_16020 gene tolQ 2659 1985 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_16020 3526 2747 gene locus_tag LOCUS_16030 3526 2747 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_16030 5890 3539 gene locus_tag LOCUS_16040 5890 3539 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence158 1019 459 gene locus_tag LOCUS_16050 gene pal 1019 459 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_16050 1126 1575 gene locus_tag LOCUS_16060 1126 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1572 2897 gene locus_tag LOCUS_16070 1572 2897 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403834.1 protein_id gnl|my_center|LOCUS_16070 2926 3546 gene locus_tag LOCUS_16080 2926 3546 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546278.1 protein_id gnl|my_center|LOCUS_16080 3799 3617 gene locus_tag LOCUS_16090 3799 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5723 3951 gene locus_tag LOCUS_16100 5723 3951 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_16100 6028 5720 gene locus_tag LOCUS_16110 6028 5720 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091547.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence159 379 1248 gene locus_tag LOCUS_16120 379 1248 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942917.1 protein_id gnl|my_center|LOCUS_16120 1305 2546 gene locus_tag LOCUS_16130 1305 2546 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_16130 2557 3375 gene locus_tag LOCUS_16140 2557 3375 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_16140 3395 4618 gene locus_tag LOCUS_16150 3395 4618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_16150 4615 5292 gene locus_tag LOCUS_16160 4615 5292 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_16160 <6056 5270 gene locus_tag LOCUS_16170 <6056 5270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940720.1:DNA polymerase IV >Feature sequence160 412 1290 gene locus_tag LOCUS_16180 412 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1287 3599 gene locus_tag LOCUS_16190 1287 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3599 5653 gene locus_tag LOCUS_16200 3599 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence161 198 1406 gene locus_tag LOCUS_16210 198 1406 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_16210 1407 3056 gene locus_tag LOCUS_16220 1407 3056 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_16220 3053 4432 gene locus_tag LOCUS_16230 3053 4432 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_16230 4532 5368 gene locus_tag LOCUS_16240 gene rfbD 4532 5368 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_16240 5372 5725 gene locus_tag LOCUS_16250 5372 5725 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943000.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence162 206 280 gene locus_tag LOCUS_t00200 206 280 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2769 406 gene locus_tag LOCUS_16260 2769 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3927 2770 gene locus_tag LOCUS_16270 3927 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence163 3 245 gene locus_tag LOCUS_16280 3 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 529 867 gene locus_tag LOCUS_16290 529 867 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_16290 925 1797 gene locus_tag LOCUS_16300 925 1797 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704666.1 protein_id gnl|my_center|LOCUS_16300 1800 3020 gene locus_tag LOCUS_16310 1800 3020 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939122.1 protein_id gnl|my_center|LOCUS_16310 3832 3074 gene locus_tag LOCUS_16320 3832 3074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944065.1 protein_id gnl|my_center|LOCUS_16320 4779 3829 gene locus_tag LOCUS_16330 4779 3829 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940689.1 protein_id gnl|my_center|LOCUS_16330 5006 4920 gene locus_tag LOCUS_t00210 5006 4920 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5479 5081 gene locus_tag LOCUS_16340 5479 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence164 <1 839 gene locus_tag LOCUS_16350 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941539.1:diacylglycerol kinase family protein 1091 1288 gene locus_tag LOCUS_16360 1091 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1374 1634 gene locus_tag LOCUS_16370 1374 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1696 2412 gene locus_tag LOCUS_16380 1696 2412 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_16380 2430 2939 gene locus_tag LOCUS_16390 2430 2939 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_16390 3192 2983 gene locus_tag LOCUS_16400 3192 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942473.1 protein_id gnl|my_center|LOCUS_16400 3541 3260 gene locus_tag LOCUS_16410 3541 3260 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_16410 5219 3624 gene locus_tag LOCUS_16420 gene nadB 5219 3624 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_16420 5518 5826 gene locus_tag LOCUS_16430 5518 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence165 2232 607 gene locus_tag LOCUS_16440 2232 607 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_16440 2550 2371 gene locus_tag LOCUS_16450 2550 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942313.1 protein_id gnl|my_center|LOCUS_16450 2689 3207 gene locus_tag LOCUS_16460 2689 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3345 3575 gene locus_tag LOCUS_16470 3345 3575 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_16470 3669 3887 gene locus_tag LOCUS_16480 3669 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940932.1 protein_id gnl|my_center|LOCUS_16480 3869 4159 gene locus_tag LOCUS_16490 3869 4159 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940931.1 protein_id gnl|my_center|LOCUS_16490 4170 4547 gene locus_tag LOCUS_16500 4170 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941788.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence166 <1 1008 gene locus_tag LOCUS_16510 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor 1065 2018 gene locus_tag LOCUS_16520 1065 2018 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_16520 2125 3210 gene locus_tag LOCUS_16530 2125 3210 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_16530 4168 3428 gene locus_tag LOCUS_16540 4168 3428 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941751.1 protein_id gnl|my_center|LOCUS_16540 5714 4320 gene locus_tag LOCUS_16550 gene rfaE1 5714 4320 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence167 <1 1496 gene locus_tag LOCUS_16560 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941068.1:methyl-accepting chemotaxis protein 1915 2331 gene locus_tag LOCUS_16570 1915 2331 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_16570 2421 3248 gene locus_tag LOCUS_16580 2421 3248 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940967.1 protein_id gnl|my_center|LOCUS_16580 4697 3369 gene locus_tag LOCUS_16590 4697 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5663 4713 gene locus_tag LOCUS_16600 5663 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5581 5823 gene locus_tag LOCUS_16610 5581 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence168 <1 2176 gene locus_tag LOCUS_16620 <1 2176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940774.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 2261 3148 gene locus_tag LOCUS_16630 2261 3148 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_16630 3145 3816 gene locus_tag LOCUS_16640 3145 3816 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_16640 4030 4518 gene locus_tag LOCUS_16650 gene folK 4030 4518 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_16650 4533 4790 gene locus_tag LOCUS_16660 4533 4790 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943607.1 protein_id gnl|my_center|LOCUS_16660 4880 5527 gene locus_tag LOCUS_16670 gene fsa 4880 5527 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence169 407 946 gene locus_tag LOCUS_16680 407 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1741 2955 gene locus_tag LOCUS_16690 gene sat 1741 2955 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_16690 3057 3524 gene locus_tag LOCUS_16700 gene aprB 3057 3524 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_16700 3602 5524 gene locus_tag LOCUS_16710 gene aprA 3602 5524 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence170 <1 783 gene locus_tag LOCUS_16720 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113465.1:DMT family transporter 1374 919 gene locus_tag LOCUS_16730 1374 919 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941146.1 protein_id gnl|my_center|LOCUS_16730 2152 1502 gene locus_tag LOCUS_16740 2152 1502 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_16740 3307 2153 gene locus_tag LOCUS_16750 3307 2153 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_16750 3844 3431 gene locus_tag LOCUS_16760 3844 3431 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_16760 4077 3841 gene locus_tag LOCUS_16770 4077 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5381 4347 gene locus_tag LOCUS_16780 5381 4347 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence171 401 1771 gene locus_tag LOCUS_16790 401 1771 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943217.1 protein_id gnl|my_center|LOCUS_16790 1824 2234 gene locus_tag LOCUS_16800 1824 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2377 2880 gene locus_tag LOCUS_16810 2377 2880 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_16810 2952 3128 gene locus_tag LOCUS_16820 2952 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4067 3171 gene locus_tag LOCUS_16830 4067 3171 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_16830 4207 5613 gene locus_tag LOCUS_16840 gene hemG 4207 5613 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence172 <1 972 gene locus_tag LOCUS_16850 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942342.1:tetratricopeptide repeat protein 3360 1111 gene locus_tag LOCUS_16860 3360 1111 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_16860 3580 4065 gene locus_tag LOCUS_16870 3580 4065 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_16870 4077 5033 gene locus_tag LOCUS_16880 4077 5033 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence173 323 493 gene locus_tag LOCUS_16890 323 493 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_16890 528 716 gene locus_tag LOCUS_16900 528 716 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941445.1 protein_id gnl|my_center|LOCUS_16900 713 1936 gene locus_tag LOCUS_16910 713 1936 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_16910 1923 2903 gene locus_tag LOCUS_16920 gene moaA 1923 2903 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943768.1 protein_id gnl|my_center|LOCUS_16920 2918 3352 gene locus_tag LOCUS_16930 2918 3352 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_16930 3445 4377 gene locus_tag LOCUS_16940 3445 4377 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632430.1 protein_id gnl|my_center|LOCUS_16940 5580 4531 gene locus_tag LOCUS_16950 gene arsB 5580 4531 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence174 264 1112 gene locus_tag LOCUS_16960 264 1112 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_16960 1112 1933 gene locus_tag LOCUS_16970 1112 1933 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_16970 1938 2276 gene locus_tag LOCUS_16980 1938 2276 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_16980 5037 2323 gene locus_tag LOCUS_16990 5037 2323 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_16990 <5652 5090 gene locus_tag LOCUS_17000 <5652 5090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130104.1:ATP-binding protein >Feature sequence175 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 343 522 gene locus_tag LOCUS_17010 343 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 735 1856 gene locus_tag LOCUS_17020 gene dnaN 735 1856 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_17020 1866 2978 gene locus_tag LOCUS_17030 gene recF 1866 2978 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_17030 2971 5376 gene locus_tag LOCUS_17040 gene gyrB 2971 5376 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence176 377 1957 gene locus_tag LOCUS_17050 377 1957 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940683.1 protein_id gnl|my_center|LOCUS_17050 1944 2960 gene locus_tag LOCUS_17060 1944 2960 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_17060 3094 3966 gene locus_tag LOCUS_17070 gene dinD 3094 3966 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687842.1 protein_id gnl|my_center|LOCUS_17070 4059 4790 gene locus_tag LOCUS_17080 4059 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4889 5368 gene locus_tag LOCUS_17090 gene ispF 4889 5368 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence177 <1 623 gene locus_tag LOCUS_17100 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526222.1:ATP-binding protein 1024 788 gene locus_tag LOCUS_17110 1024 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 911 2086 gene locus_tag LOCUS_17120 911 2086 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_17120 2083 3120 gene locus_tag LOCUS_17130 2083 3120 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence178 <1 1434 gene locus_tag LOCUS_17140 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943433.1:bifunctional nitrogenase iron-molybdenum cofactor biosynthesis protein NifEN 1637 2023 gene locus_tag LOCUS_17150 gene nifX 1637 2023 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943432.1 protein_id gnl|my_center|LOCUS_17150 2115 2378 gene locus_tag LOCUS_17160 gene fdxB 2115 2378 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943431.1 protein_id gnl|my_center|LOCUS_17160 2446 2775 gene locus_tag LOCUS_17170 2446 2775 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943430.1 protein_id gnl|my_center|LOCUS_17170 2858 3655 gene locus_tag LOCUS_17180 2858 3655 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_17180 4285 3731 gene locus_tag LOCUS_17190 4285 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence179 671 528 gene locus_tag LOCUS_17200 671 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1944 898 gene locus_tag LOCUS_17210 1944 898 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941127.1 protein_id gnl|my_center|LOCUS_17210 2969 1941 gene locus_tag LOCUS_17220 2969 1941 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_17220 2865 3191 gene locus_tag LOCUS_17230 2865 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3886 3146 gene locus_tag LOCUS_17240 3886 3146 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941129.1 protein_id gnl|my_center|LOCUS_17240 4505 3999 gene locus_tag LOCUS_17250 4505 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102045240.1 protein_id gnl|my_center|LOCUS_17250 4784 5026 gene locus_tag LOCUS_17260 4784 5026 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_17260 5026 5328 gene locus_tag LOCUS_17270 5026 5328 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence180 325 59 gene locus_tag LOCUS_17280 325 59 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943882.1 protein_id gnl|my_center|LOCUS_17280 1230 658 gene locus_tag LOCUS_17290 1230 658 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_17290 2707 1232 gene locus_tag LOCUS_17300 gene trpE 2707 1232 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_17300 2884 3825 gene locus_tag LOCUS_17310 2884 3825 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941542.1 protein_id gnl|my_center|LOCUS_17310 4114 5121 gene locus_tag LOCUS_17320 gene aroF 4114 5121 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence181 114 1280 gene locus_tag LOCUS_17330 114 1280 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_17330 1348 2517 gene locus_tag LOCUS_17340 gene bioF 1348 2517 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_17340 2517 3341 gene locus_tag LOCUS_17350 2517 3341 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_17350 3325 4161 gene locus_tag LOCUS_17360 gene bioC 3325 4161 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943265.1 protein_id gnl|my_center|LOCUS_17360 4433 4158 gene locus_tag LOCUS_17370 4433 4158 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943263.1 protein_id gnl|my_center|LOCUS_17370 <5464 4536 gene locus_tag LOCUS_17380 <5464 4536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943262.1:ATP-binding cassette domain-containing protein >Feature sequence182 <1 675 gene locus_tag LOCUS_17390 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941098.1:type VI secretion system baseplate subunit TssK 678 1814 gene locus_tag LOCUS_17400 678 1814 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943788.1 protein_id gnl|my_center|LOCUS_17400 1814 2479 gene locus_tag LOCUS_17410 1814 2479 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943789.1 protein_id gnl|my_center|LOCUS_17410 2476 3495 gene locus_tag LOCUS_17420 2476 3495 CDS product T6SS immunity protein Tli4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943790.1 protein_id gnl|my_center|LOCUS_17420 3508 5157 gene locus_tag LOCUS_17430 3508 5157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943791.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence183 1242 10 gene locus_tag LOCUS_17440 1242 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3109 1310 gene locus_tag LOCUS_17450 3109 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4389 3106 gene locus_tag LOCUS_17460 4389 3106 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_17460 4747 5226 gene locus_tag LOCUS_17470 4747 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943763.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence184 252 2768 gene locus_tag LOCUS_17480 252 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2758 3831 gene locus_tag LOCUS_17490 2758 3831 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_17490 <5361 3840 gene locus_tag LOCUS_17500 <5361 3840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944054.1:NADH-quinone oxidoreductase subunit B/C/D >Feature sequence185 2334 826 gene locus_tag LOCUS_17510 2334 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3394 2348 gene locus_tag LOCUS_17520 3394 2348 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_17520 5089 3398 gene locus_tag LOCUS_17530 5089 3398 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081682.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence186 1814 1614 gene locus_tag LOCUS_17540 1814 1614 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_17540 2102 1902 gene locus_tag LOCUS_17550 gene rpsU 2102 1902 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941574.1 protein_id gnl|my_center|LOCUS_17550 2533 3912 gene locus_tag LOCUS_17560 gene dctA 2533 3912 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence187 1235 186 gene locus_tag LOCUS_17570 1235 186 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_17570 1321 2097 gene locus_tag LOCUS_17580 1321 2097 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_17580 2216 2584 gene locus_tag LOCUS_17590 2216 2584 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943945.1 protein_id gnl|my_center|LOCUS_17590 2730 2933 gene locus_tag LOCUS_17600 2730 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3011 3343 gene locus_tag LOCUS_17610 gene hypA 3011 3343 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_17610 4996 3404 gene locus_tag LOCUS_17620 gene pckA 4996 3404 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence188 1021 2274 gene locus_tag LOCUS_17630 1021 2274 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_17630 2851 2318 gene locus_tag LOCUS_17640 2851 2318 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_17640 3087 3392 gene locus_tag LOCUS_17650 3087 3392 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941456.1 protein_id gnl|my_center|LOCUS_17650 4151 3396 gene locus_tag LOCUS_17660 4151 3396 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_17660 4588 4244 gene locus_tag LOCUS_17670 4588 4244 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943861.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence189 <1 1156 gene locus_tag LOCUS_17680 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940844.1:ATP-binding cassette domain-containing protein 1797 1252 gene locus_tag LOCUS_17690 1797 1252 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942734.1 protein_id gnl|my_center|LOCUS_17690 1962 3182 gene locus_tag LOCUS_17700 gene rpsA 1962 3182 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_17700 3194 3466 gene locus_tag LOCUS_17710 3194 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3831 3568 gene locus_tag LOCUS_17720 3831 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942312.1 protein_id gnl|my_center|LOCUS_17720 4395 3889 gene locus_tag LOCUS_17730 4395 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence190 2449 725 gene locus_tag LOCUS_17740 2449 725 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_17740 3191 2628 gene locus_tag LOCUS_17750 3191 2628 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_17750 4601 3321 gene locus_tag LOCUS_17760 4601 3321 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943909.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence191 733 1770 gene locus_tag LOCUS_17770 733 1770 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_17770 1767 4835 gene locus_tag LOCUS_17780 1767 4835 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence192 1068 718 gene locus_tag LOCUS_17790 1068 718 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_17790 2088 1126 gene locus_tag LOCUS_17800 gene pfkA 2088 1126 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942710.1 protein_id gnl|my_center|LOCUS_17800 3595 2144 gene locus_tag LOCUS_17810 3595 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4955 3615 gene locus_tag LOCUS_17820 4955 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence193 1715 963 gene locus_tag LOCUS_17830 1715 963 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_17830 2503 1748 gene locus_tag LOCUS_17840 2503 1748 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_17840 3060 2503 gene locus_tag LOCUS_17850 gene frr 3060 2503 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_17850 3781 3062 gene locus_tag LOCUS_17860 gene pyrH 3781 3062 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_17860 4631 3981 gene locus_tag LOCUS_17870 gene tsf 4631 3981 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence194 <1 516 gene locus_tag LOCUS_17880 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944019.1:low specificity L-threonine aldolase 2843 525 gene locus_tag LOCUS_17890 gene recG 2843 525 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_17890 3256 3059 gene locus_tag LOCUS_17900 3256 3059 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941933.1 protein_id gnl|my_center|LOCUS_17900 3826 3350 gene locus_tag LOCUS_17910 gene greA 3826 3350 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_17910 <5040 3935 gene locus_tag LOCUS_17920 <5040 3935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941931.1:carbamoyl-phosphate synthase large subunit >Feature sequence195 802 350 gene locus_tag LOCUS_17930 802 350 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941718.1 protein_id gnl|my_center|LOCUS_17930 1380 898 gene locus_tag LOCUS_17940 gene lspA 1380 898 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_17940 4260 1471 gene locus_tag LOCUS_17950 gene ileS 4260 1471 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence196 801 58 gene locus_tag LOCUS_17960 801 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1846 857 gene locus_tag LOCUS_17970 1846 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2110 2661 gene locus_tag LOCUS_17980 2110 2661 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_17980 4842 2854 gene locus_tag LOCUS_17990 4842 2854 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence197 113 1552 gene locus_tag LOCUS_18000 113 1552 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_18000 1549 3069 gene locus_tag LOCUS_18010 1549 3069 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_18010 <4962 3140 gene locus_tag LOCUS_18020 <4962 3140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941245.1:methyl-accepting chemotaxis protein >Feature sequence198 693 250 gene locus_tag LOCUS_18030 693 250 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_18030 814 1275 gene locus_tag LOCUS_18040 gene rimI 814 1275 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_18040 1276 2094 gene locus_tag LOCUS_18050 1276 2094 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_18050 2082 3014 gene locus_tag LOCUS_18060 2082 3014 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_18060 3200 4708 gene locus_tag LOCUS_18070 3200 4708 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence199 749 222 gene locus_tag LOCUS_18080 gene cobO 749 222 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_18080 2405 1074 gene locus_tag LOCUS_18090 2405 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2797 2405 gene locus_tag LOCUS_18100 2797 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 <4881 2790 gene locus_tag LOCUS_18110 <4881 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940320.1:PAS domain-containing protein >Feature sequence200 1986 2546 gene locus_tag LOCUS_18120 1986 2546 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_18120 2550 3056 gene locus_tag LOCUS_18130 gene def 2550 3056 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_18130 3113 3661 gene locus_tag LOCUS_18140 gene amrA 3113 3661 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence201 4460 903 gene locus_tag LOCUS_18150 gene mfd 4460 903 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence202 211 136 gene locus_tag LOCUS_t00220 211 136 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 416 835 gene locus_tag LOCUS_18160 416 835 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_18160 854 1957 gene locus_tag LOCUS_18170 854 1957 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_18170 1954 2778 gene locus_tag LOCUS_18180 1954 2778 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942292.1 protein_id gnl|my_center|LOCUS_18180 2846 3649 gene locus_tag LOCUS_18190 2846 3649 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence203 358 1245 gene locus_tag LOCUS_18200 gene sppA 358 1245 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_18200 2383 1331 gene locus_tag LOCUS_18210 2383 1331 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_18210 2513 3142 gene locus_tag LOCUS_18220 2513 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3153 3716 gene locus_tag LOCUS_18230 gene gmhB 3153 3716 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_18230 3779 4675 gene locus_tag LOCUS_18240 gene rfbA 3779 4675 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence204 1592 210 gene locus_tag LOCUS_18250 1592 210 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_18250 1764 2333 gene locus_tag LOCUS_18260 1764 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence205 192 2183 gene locus_tag LOCUS_18270 192 2183 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_18270 2209 2985 gene locus_tag LOCUS_18280 2209 2985 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_18280 2995 3906 gene locus_tag LOCUS_18290 2995 3906 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_18290 4122 4046 gene locus_tag LOCUS_t00230 4122 4046 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 <1 1618 gene locus_tag LOCUS_18300 <1 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193360261.1:threonine--tRNA ligase 1698 2201 gene locus_tag LOCUS_18310 gene infC 1698 2201 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_18310 2251 2448 gene locus_tag LOCUS_18320 gene rpmI 2251 2448 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_18320 2524 2877 gene locus_tag LOCUS_18330 gene rplT 2524 2877 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_18330 2954 3970 gene locus_tag LOCUS_18340 gene pheS 2954 3970 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence207 <1 2369 gene locus_tag LOCUS_18350 <1 2369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit 2369 2797 gene locus_tag LOCUS_18360 2369 2797 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941063.1 protein_id gnl|my_center|LOCUS_18360 2912 3136 gene locus_tag LOCUS_18370 2912 3136 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_18370 3133 3966 gene locus_tag LOCUS_18380 3133 3966 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence208 642 472 gene locus_tag LOCUS_18390 642 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 957 658 gene locus_tag LOCUS_18400 957 658 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942459.1 protein_id gnl|my_center|LOCUS_18400 1897 962 gene locus_tag LOCUS_18410 1897 962 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_18410 3254 1899 gene locus_tag LOCUS_18420 3254 1899 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_18420 4221 3325 gene locus_tag LOCUS_18430 gene rsmI 4221 3325 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence209 283 292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2213 588 gene locus_tag LOCUS_18440 gene serA 2213 588 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941855.1 protein_id gnl|my_center|LOCUS_18440 2329 2811 gene locus_tag LOCUS_18450 2329 2811 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_18450 2836 4032 gene locus_tag LOCUS_18460 gene truD 2836 4032 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence210 <1 1311 gene locus_tag LOCUS_18470 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919356.1:sulfate adenylyltransferase subunit CysN 1469 2755 gene locus_tag LOCUS_18480 1469 2755 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880413.1 protein_id gnl|my_center|LOCUS_18480 3763 2891 gene locus_tag LOCUS_18490 3763 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence211 739 74 gene locus_tag LOCUS_18500 739 74 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022565.1 protein_id gnl|my_center|LOCUS_18500 1559 756 gene locus_tag LOCUS_18510 1559 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3086 1794 gene locus_tag LOCUS_18520 gene eno 3086 1794 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_18520 4321 3338 gene locus_tag LOCUS_18530 4321 3338 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence212 2531 228 gene locus_tag LOCUS_18540 2531 228 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_18540 2789 4000 gene locus_tag LOCUS_18550 2789 4000 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940972.1 protein_id gnl|my_center|LOCUS_18550 <4619 4045 gene locus_tag LOCUS_18560 <4619 4045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064119.1:AEC family transporter >Feature sequence213 4100 2907 gene locus_tag LOCUS_18570 4100 2907 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence214 206 2599 gene locus_tag LOCUS_18580 206 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2615 4489 gene locus_tag LOCUS_18590 2615 4489 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence215 1370 864 gene locus_tag LOCUS_18600 1370 864 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_18600 1732 1367 gene locus_tag LOCUS_18610 1732 1367 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_18610 3320 1911 gene locus_tag LOCUS_18620 3320 1911 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_18620 3609 3340 gene locus_tag LOCUS_18630 3609 3340 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941037.1 protein_id gnl|my_center|LOCUS_18630 4525 3596 gene locus_tag LOCUS_18640 4525 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence216 <1 378 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagcgcccgtcctacctggacgggcgaggattgaaac 515 919 gene locus_tag LOCUS_18650 515 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941023.1 protein_id gnl|my_center|LOCUS_18650 1001 1624 gene locus_tag LOCUS_18660 gene msrA 1001 1624 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_18660 1908 1660 gene locus_tag LOCUS_18670 1908 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2242 1934 gene locus_tag LOCUS_18680 2242 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942311.1 protein_id gnl|my_center|LOCUS_18680 2967 2269 gene locus_tag LOCUS_18690 2967 2269 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_18690 3611 2964 gene locus_tag LOCUS_18700 3611 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 <4492 3833 gene locus_tag LOCUS_18710 <4492 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870115.1:response regulator >Feature sequence217 1488 733 gene locus_tag LOCUS_18720 1488 733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_18720 1952 1485 gene locus_tag LOCUS_18730 1952 1485 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 protein_id gnl|my_center|LOCUS_18730 2527 1949 gene locus_tag LOCUS_18740 2527 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2915 2796 gene locus_tag LOCUS_18750 2915 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 3643 3035 gene locus_tag LOCUS_18760 3643 3035 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_18760 4474 3701 gene locus_tag LOCUS_18770 4474 3701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence218 1766 2455 gene locus_tag LOCUS_18780 1766 2455 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_18780 3536 2523 gene locus_tag LOCUS_18790 gene hemH 3536 2523 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_18790 3802 3665 gene locus_tag LOCUS_18800 3802 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 <4442 3814 gene locus_tag LOCUS_18810 <4442 3814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942191.1:DUF2845 domain-containing protein >Feature sequence219 238 363 gene locus_tag LOCUS_18820 238 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 452 1057 gene locus_tag LOCUS_18830 gene yfbR 452 1057 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 protein_id gnl|my_center|LOCUS_18830 2168 1149 gene locus_tag LOCUS_18840 2168 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3226 2219 gene locus_tag LOCUS_18850 3226 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_18850 3829 3380 gene locus_tag LOCUS_18860 3829 3380 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943773.1 protein_id gnl|my_center|LOCUS_18860 4413 3862 gene locus_tag LOCUS_18870 4413 3862 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence220 85 1197 gene locus_tag LOCUS_18880 85 1197 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940918.1 protein_id gnl|my_center|LOCUS_18880 1197 2552 gene locus_tag LOCUS_18890 1197 2552 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_18890 2575 3480 gene locus_tag LOCUS_18900 2575 3480 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_18900 3592 3849 gene locus_tag LOCUS_18910 3592 3849 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence221 157 459 gene locus_tag LOCUS_18920 157 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2045 2932 gene locus_tag LOCUS_18930 2045 2932 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942203.1 protein_id gnl|my_center|LOCUS_18930 <4333 3072 gene locus_tag LOCUS_18940 <4333 3072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161799876.1:DUF445 domain-containing protein >Feature sequence222 144 713 gene locus_tag LOCUS_18950 144 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1663 884 gene locus_tag LOCUS_18960 gene scpB 1663 884 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816217.1 protein_id gnl|my_center|LOCUS_18960 3614 1905 gene locus_tag LOCUS_18970 3614 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence223 288 37 gene locus_tag LOCUS_18980 288 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 652 1812 gene locus_tag LOCUS_18990 652 1812 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_18990 2416 1835 gene locus_tag LOCUS_19000 2416 1835 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_19000 2921 4009 gene locus_tag LOCUS_19010 2921 4009 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942730.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence224 1496 192 gene locus_tag LOCUS_19020 1496 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2017 1499 gene locus_tag LOCUS_19030 2017 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 3528 2215 gene locus_tag LOCUS_19040 3528 2215 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_19040 <4237 3677 gene locus_tag LOCUS_19050 <4237 3677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102481.1:two-component system response regulator >Feature sequence225 45 2717 gene locus_tag LOCUS_19060 45 2717 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_19060 2821 3528 gene locus_tag LOCUS_19070 2821 3528 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence226 1490 300 gene locus_tag LOCUS_19080 1490 300 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_19080 2317 1487 gene locus_tag LOCUS_19090 2317 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3204 2326 gene locus_tag LOCUS_19100 gene argB 3204 2326 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_19100 <4232 3286 gene locus_tag LOCUS_19110 <4232 3286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940824.1:alanine--tRNA ligase >Feature sequence227 74 508 gene locus_tag LOCUS_19120 74 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 701 955 gene locus_tag LOCUS_19130 701 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1031 2332 gene locus_tag LOCUS_19140 1031 2332 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_19140 2431 3723 gene locus_tag LOCUS_19150 2431 3723 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence228 2263 1088 gene locus_tag LOCUS_19160 2263 1088 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_19160 3081 2263 gene locus_tag LOCUS_19170 3081 2263 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942481.1 protein_id gnl|my_center|LOCUS_19170 3195 3932 gene locus_tag LOCUS_19180 3195 3932 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence229 577 257 gene locus_tag LOCUS_19190 577 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1240 704 gene locus_tag LOCUS_19200 1240 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1546 2421 gene locus_tag LOCUS_19210 1546 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2418 3740 gene locus_tag LOCUS_19220 2418 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence230 <1 1289 gene locus_tag LOCUS_19230 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943976.1:cysteine--tRNA ligase 1359 2996 gene locus_tag LOCUS_19240 1359 2996 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943864.1 protein_id gnl|my_center|LOCUS_19240 2993 3370 gene locus_tag LOCUS_19250 2993 3370 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943865.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence231 257 1624 gene locus_tag LOCUS_19260 257 1624 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_19260 1621 2823 gene locus_tag LOCUS_19270 1621 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2892 3293 gene locus_tag LOCUS_19280 2892 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3286 3585 gene locus_tag LOCUS_19290 3286 3585 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258929.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence232 162 1 gene locus_tag LOCUS_19300 162 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1692 298 gene locus_tag LOCUS_19310 1692 298 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941631.1 protein_id gnl|my_center|LOCUS_19310 1952 2152 gene locus_tag LOCUS_19320 1952 2152 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_19320 2218 2592 gene locus_tag LOCUS_19330 2218 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2780 2514 gene locus_tag LOCUS_19340 2780 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 <4105 3134 gene locus_tag LOCUS_19350 <4105 3134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941630.1:cache domain-containing protein >Feature sequence233 <1 505 gene locus_tag LOCUS_19360 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943426.1:radical SAM protein 609 1433 gene locus_tag LOCUS_19370 609 1433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943425.1 protein_id gnl|my_center|LOCUS_19370 1463 2596 gene locus_tag LOCUS_19380 gene nifV 1463 2596 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_19380 2934 3800 gene locus_tag LOCUS_19390 gene nifH 2934 3800 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence234 622 317 gene locus_tag LOCUS_19400 622 317 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_19400 956 627 gene locus_tag LOCUS_19410 956 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1616 1350 gene locus_tag LOCUS_19420 1616 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1860 1579 gene locus_tag LOCUS_19430 1860 1579 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_19430 2834 1935 gene locus_tag LOCUS_19440 2834 1935 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943251.1 protein_id gnl|my_center|LOCUS_19440 <4080 2838 gene locus_tag LOCUS_19450 <4080 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943252.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence235 218 1687 gene locus_tag LOCUS_19460 gene nifK 218 1687 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943445.1 protein_id gnl|my_center|LOCUS_19460 2327 1779 gene locus_tag LOCUS_19470 2327 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2617 2429 gene locus_tag LOCUS_19480 2617 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2902 2702 gene locus_tag LOCUS_19490 2902 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3285 3683 gene locus_tag LOCUS_19500 3285 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence236 209 898 gene locus_tag LOCUS_19510 209 898 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_19510 1081 2094 gene locus_tag LOCUS_19520 gene aroF 1081 2094 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_19520 2827 2408 gene locus_tag LOCUS_19530 gene nikR 2827 2408 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_19530 3916 2831 gene locus_tag LOCUS_19540 gene cobD 3916 2831 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence237 <1 1335 gene locus_tag LOCUS_19550 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941826.1:phosphoenolpyruvate--protein phosphotransferase 1582 1373 gene locus_tag LOCUS_19560 1582 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942468.1 protein_id gnl|my_center|LOCUS_19560 2002 1607 gene locus_tag LOCUS_19570 2002 1607 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_19570 2239 2078 gene locus_tag LOCUS_19580 2239 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2540 2241 gene locus_tag LOCUS_19590 2540 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2930 2664 gene locus_tag LOCUS_19600 2930 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19600 3295 2939 gene locus_tag LOCUS_19610 3295 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 <4050 3288 gene locus_tag LOCUS_19620 <4050 3288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545613.1:class I SAM-dependent DNA methyltransferase >Feature sequence238 244 2205 gene locus_tag LOCUS_19630 244 2205 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070968.1 protein_id gnl|my_center|LOCUS_19630 2192 3664 gene locus_tag LOCUS_19640 2192 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence239 148 474 gene locus_tag LOCUS_19650 148 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 471 1067 gene locus_tag LOCUS_19660 471 1067 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_19660 1168 1455 gene locus_tag LOCUS_19670 1168 1455 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940896.1 protein_id gnl|my_center|LOCUS_19670 1465 2676 gene locus_tag LOCUS_19680 1465 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2673 3488 gene locus_tag LOCUS_19690 2673 3488 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940898.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence240 <1 1411 gene locus_tag LOCUS_19700 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:PBP1A family penicillin-binding protein 2686 1502 gene locus_tag LOCUS_19710 gene purT 2686 1502 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence241 631 167 gene locus_tag LOCUS_19720 631 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942646.1 protein_id gnl|my_center|LOCUS_19720 1640 642 gene locus_tag LOCUS_19730 1640 642 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 protein_id gnl|my_center|LOCUS_19730 2295 1819 gene locus_tag LOCUS_19740 2295 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2760 3338 gene locus_tag LOCUS_19750 2760 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence242 2565 2212 gene locus_tag LOCUS_19760 2565 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2935 2747 gene locus_tag LOCUS_19770 2935 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3220 3020 gene locus_tag LOCUS_19780 3220 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence243 81 650 gene locus_tag LOCUS_19790 81 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 647 1414 gene locus_tag LOCUS_19800 647 1414 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263561.1 protein_id gnl|my_center|LOCUS_19800 1536 3479 gene locus_tag LOCUS_19810 1536 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence244 >Feature sequence245 <1 1496 gene locus_tag LOCUS_19820 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942540.1:CTP synthase 1500 2318 gene locus_tag LOCUS_19830 gene kdsA 1500 2318 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_19830 2544 3155 gene locus_tag LOCUS_19840 2544 3155 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160062.1 protein_id gnl|my_center|LOCUS_19840 3310 3510 gene locus_tag LOCUS_19850 3310 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence246 167 1183 gene locus_tag LOCUS_19860 gene hgcA 167 1183 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_19860 1383 1673 gene locus_tag LOCUS_19870 gene hgcB 1383 1673 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_19870 1622 1774 gene locus_tag LOCUS_19880 1622 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1767 2570 gene locus_tag LOCUS_19890 gene mutM 1767 2570 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941662.1 protein_id gnl|my_center|LOCUS_19890 3606 2581 gene locus_tag LOCUS_19900 3606 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence247 1118 486 gene locus_tag LOCUS_19910 1118 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1452 1144 gene locus_tag LOCUS_19920 1452 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3774 1600 gene locus_tag LOCUS_19930 3774 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence248 1997 1560 gene locus_tag LOCUS_19940 1997 1560 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943317.1 protein_id gnl|my_center|LOCUS_19940 3210 2050 gene locus_tag LOCUS_19950 3210 2050 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_19950 <3901 3276 gene locus_tag LOCUS_19960 <3901 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943304.1:TetR/AcrR family transcriptional regulator >Feature sequence249 <1 896 gene locus_tag LOCUS_19970 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943878.1:UvrD-helicase domain-containing protein 924 2294 gene locus_tag LOCUS_19980 gene mnmE 924 2294 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence250 274 1650 gene locus_tag LOCUS_19990 gene prsR 274 1650 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_19990 1785 1709 gene locus_tag LOCUS_t00240 1785 1709 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3101 1833 gene locus_tag LOCUS_20000 3101 1833 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_20000 3405 3106 gene locus_tag LOCUS_20010 3405 3106 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence251 305 793 gene locus_tag LOCUS_20020 305 793 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_20020 2000 873 gene locus_tag LOCUS_20030 2000 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2929 1997 gene locus_tag LOCUS_20040 2929 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence252 273 1115 gene locus_tag LOCUS_20050 gene gspN 273 1115 CDS product type II secretion system protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940987.1 protein_id gnl|my_center|LOCUS_20050 1150 1800 gene locus_tag LOCUS_20060 gene nadD 1150 1800 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_20060 1791 2204 gene locus_tag LOCUS_20070 gene rsfS 1791 2204 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_20070 2201 2659 gene locus_tag LOCUS_20080 2201 2659 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence253 <1 1188 gene locus_tag LOCUS_20090 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941931.1:carbamoyl-phosphate synthase large subunit 1268 1744 gene locus_tag LOCUS_20100 gene greA 1268 1744 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_20100 1781 1981 gene locus_tag LOCUS_20110 1781 1981 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941933.1 protein_id gnl|my_center|LOCUS_20110 2110 2655 gene locus_tag LOCUS_20120 gene thpR 2110 2655 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence254 619 281 gene locus_tag LOCUS_20130 619 281 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_20130 2531 852 gene locus_tag LOCUS_20140 2531 852 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_20140 3176 2856 gene locus_tag LOCUS_20150 3176 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 <3810 3256 gene locus_tag LOCUS_20160 <3810 3256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088428.1:bifunctional serine/threonine-protein kinase/universal stress protein >Feature sequence255 1448 384 gene locus_tag LOCUS_20170 1448 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963531.1 protein_id gnl|my_center|LOCUS_20170 2928 1459 gene locus_tag LOCUS_20180 2928 1459 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_20180 3176 2943 gene locus_tag LOCUS_20190 3176 2943 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_20190 <3796 3173 gene locus_tag LOCUS_20200 <3796 3173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000862095.1:acetate--CoA ligase >Feature sequence256 1184 57 gene locus_tag LOCUS_20210 1184 57 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_20210 2461 1184 gene locus_tag LOCUS_20220 2461 1184 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_20220 2646 2864 gene locus_tag LOCUS_20230 2646 2864 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940870.1 protein_id gnl|my_center|LOCUS_20230 2869 3156 gene locus_tag LOCUS_20240 2869 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3451 3149 gene locus_tag LOCUS_20250 3451 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20250 >Feature sequence257 3398 603 gene locus_tag LOCUS_20260 3398 603 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938851.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence258 48 1211 gene locus_tag LOCUS_20270 48 1211 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_20270 1237 2211 gene locus_tag LOCUS_20280 1237 2211 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_20280 2213 3034 gene locus_tag LOCUS_20290 2213 3034 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_20290 3590 3174 gene locus_tag LOCUS_20300 3590 3174 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence259 214 1077 gene locus_tag LOCUS_20310 214 1077 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_20310 1082 2740 gene locus_tag LOCUS_20320 gene recN 1082 2740 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence260 171 3089 gene locus_tag LOCUS_20330 gene mdtC 171 3089 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667525.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence261 <1 737 gene locus_tag LOCUS_20340 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943992.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 835 2274 gene locus_tag LOCUS_20350 gene gatB 835 2274 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence262 16 534 gene locus_tag LOCUS_20360 gene tpx 16 534 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_20360 1161 586 gene locus_tag LOCUS_20370 1161 586 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_20370 3600 1180 gene locus_tag LOCUS_20380 3600 1180 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943091.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence263 <3625 2593 gene locus_tag LOCUS_20390 <3625 2593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943911.1:carboxyl transferase domain-containing protein >Feature sequence264 61 582 gene locus_tag LOCUS_20400 61 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 837 1340 gene locus_tag LOCUS_20410 837 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1498 2076 gene locus_tag LOCUS_20420 1498 2076 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence265 160 1341 gene locus_tag LOCUS_20430 gene argJ 160 1341 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_20430 1417 2592 gene locus_tag LOCUS_20440 1417 2592 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942690.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence266 259 1707 gene locus_tag LOCUS_20450 259 1707 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_20450 1729 1992 gene locus_tag LOCUS_20460 1729 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940758.1 protein_id gnl|my_center|LOCUS_20460 2074 3030 gene locus_tag LOCUS_20470 2074 3030 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence267 401 919 gene locus_tag LOCUS_20480 401 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 931 1179 gene locus_tag LOCUS_20490 931 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1192 1938 gene locus_tag LOCUS_20500 1192 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence268 144 809 gene locus_tag LOCUS_20510 144 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1206 820 gene locus_tag LOCUS_20520 1206 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1383 2063 gene locus_tag LOCUS_20530 gene gnfR 1383 2063 CDS product nitrogen fixation two-component system response regulator GnfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943448.1 protein_id gnl|my_center|LOCUS_20530 2901 1996 gene locus_tag LOCUS_20540 gene draG 2901 1996 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943427.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence269 <1 1826 gene locus_tag LOCUS_20550 <1 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942167.1:phenylalanine--tRNA ligase subunit beta 1908 2192 gene locus_tag LOCUS_20560 1908 2192 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_20560 2214 2570 gene locus_tag LOCUS_20570 2214 2570 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082021182.1 protein_id gnl|my_center|LOCUS_20570 2579 2655 gene locus_tag LOCUS_t00250 2579 2655 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2835 3278 gene locus_tag LOCUS_20580 2835 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence270 290 1405 gene locus_tag LOCUS_20590 290 1405 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919655.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence271 157 546 gene locus_tag LOCUS_20600 157 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1675 725 gene locus_tag LOCUS_20610 1675 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3392 2016 gene locus_tag LOCUS_20620 3392 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence272 918 238 gene locus_tag LOCUS_20630 gene cas4 918 238 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_20630 1938 949 gene locus_tag LOCUS_20640 gene cas7c 1938 949 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388586.1 protein_id gnl|my_center|LOCUS_20640 2322 1999 gene locus_tag LOCUS_20650 2322 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2687 2295 gene locus_tag LOCUS_20660 2687 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3201 2674 gene locus_tag LOCUS_20670 3201 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence273 531 1247 gene locus_tag LOCUS_20680 531 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence274 677 87 gene locus_tag LOCUS_20690 677 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20690 1378 641 gene locus_tag LOCUS_20700 1378 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20700 <3569 1472 gene locus_tag LOCUS_20710 <3569 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942209.1:NAD-glutamate dehydrogenase >Feature sequence275 <1 742 gene locus_tag LOCUS_20720 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942625.1:TIGR03016 family PEP-CTERM system-associated outer membrane protein 739 1602 gene locus_tag LOCUS_20730 739 1602 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_20730 1783 2496 gene locus_tag LOCUS_20740 1783 2496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence276 <1 896 gene locus_tag LOCUS_20750 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941617.1:efflux RND transporter periplasmic adaptor subunit 893 2095 gene locus_tag LOCUS_20760 893 2095 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_20760 2098 2790 gene locus_tag LOCUS_20770 2098 2790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_20770 <3536 3021 gene locus_tag LOCUS_20780 <3536 3021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005764073.1:EAL domain-containing protein >Feature sequence277 1 225 gene locus_tag LOCUS_20790 1 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 435 359 gene locus_tag LOCUS_t00260 435 359 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 506 1420 gene locus_tag LOCUS_20800 gene nadA 506 1420 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_20800 <3483 1515 gene locus_tag LOCUS_20810 <3483 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546101.1:methyl-accepting chemotaxis protein >Feature sequence278 933 370 gene locus_tag LOCUS_20820 933 370 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941133.1 protein_id gnl|my_center|LOCUS_20820 1538 1107 gene locus_tag LOCUS_20830 gene queF 1538 1107 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263288.1 protein_id gnl|my_center|LOCUS_20830 <3475 1674 gene locus_tag LOCUS_20840 <3475 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:PAS domain S-box protein >Feature sequence279 147 680 gene locus_tag LOCUS_20850 147 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence280 >Feature sequence281 225 2003 gene locus_tag LOCUS_20860 gene kdpA 225 2003 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943117.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence282 596 1225 gene locus_tag LOCUS_20870 596 1225 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_20870 1236 3152 gene locus_tag LOCUS_20880 1236 3152 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941837.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence283 1534 1094 gene locus_tag LOCUS_20890 1534 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2097 1531 gene locus_tag LOCUS_20900 2097 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2336 2587 gene locus_tag LOCUS_20910 2336 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2702 2983 gene locus_tag LOCUS_20920 2702 2983 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence284 492 1289 gene locus_tag LOCUS_20930 492 1289 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_20930 2719 1454 gene locus_tag LOCUS_20940 2719 1454 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_20940 2966 3133 gene locus_tag LOCUS_20950 2966 3133 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943346.1 protein_id gnl|my_center|LOCUS_20950 3356 3204 gene locus_tag LOCUS_20960 3356 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence285 1839 466 gene locus_tag LOCUS_20970 1839 466 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_20970 3365 1836 gene locus_tag LOCUS_20980 3365 1836 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence286 136 588 gene locus_tag LOCUS_20990 gene nrdR 136 588 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_20990 598 1704 gene locus_tag LOCUS_21000 gene ribD 598 1704 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_21000 1689 2327 gene locus_tag LOCUS_21010 1689 2327 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence287 837 1670 gene locus_tag LOCUS_21020 gene ybgF 837 1670 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_21020 2344 1757 gene locus_tag LOCUS_21030 gene hisB 2344 1757 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_21030 3159 2359 gene locus_tag LOCUS_21040 gene hisC 3159 2359 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence288 2871 2971 gene locus_tag LOCUS_t00270 2871 2971 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence289 <1 752 gene locus_tag LOCUS_21050 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942127.1:HlyD family secretion protein 830 2389 gene locus_tag LOCUS_21060 830 2389 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence290 180 974 gene locus_tag LOCUS_21070 180 974 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521932.1 protein_id gnl|my_center|LOCUS_21070 1176 1646 gene locus_tag LOCUS_21080 1176 1646 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_21080 2572 2282 gene locus_tag LOCUS_21090 2572 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3333 2875 gene locus_tag LOCUS_21100 3333 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence291 945 1823 gene locus_tag LOCUS_21110 945 1823 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_21110 2484 2020 gene locus_tag LOCUS_21120 gene dut 2484 2020 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011566231.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence292 <1 780 gene locus_tag LOCUS_21130 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147353.1:ATP synthase subunit B 1051 1341 gene locus_tag LOCUS_21140 1051 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3160 1445 gene locus_tag LOCUS_21150 3160 1445 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence293 179 727 gene locus_tag LOCUS_21160 179 727 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942328.1 protein_id gnl|my_center|LOCUS_21160 871 1950 gene locus_tag LOCUS_21170 gene pheA 871 1950 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_21170 1963 2826 gene locus_tag LOCUS_21180 1963 2826 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence294 2776 2483 gene locus_tag LOCUS_21190 2776 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3166 2831 gene locus_tag LOCUS_21200 3166 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence295 767 363 gene locus_tag LOCUS_21210 767 363 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941050.1 protein_id gnl|my_center|LOCUS_21210 933 1520 gene locus_tag LOCUS_21220 933 1520 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_21220 1582 2007 gene locus_tag LOCUS_21230 1582 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2782 2033 gene locus_tag LOCUS_21240 2782 2033 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence296 1375 530 gene locus_tag LOCUS_21250 1375 530 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 protein_id gnl|my_center|LOCUS_21250 2705 1530 gene locus_tag LOCUS_21260 2705 1530 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_21260 3225 2875 gene locus_tag LOCUS_21270 3225 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence297 794 177 gene locus_tag LOCUS_21280 794 177 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_21280 2297 942 gene locus_tag LOCUS_21290 2297 942 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_21290 <3223 2392 gene locus_tag LOCUS_21300 <3223 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942336.1:homoserine dehydrogenase >Feature sequence298 403 1125 gene locus_tag LOCUS_21310 403 1125 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943821.1 protein_id gnl|my_center|LOCUS_21310 1145 1630 gene locus_tag LOCUS_21320 1145 1630 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_21320 1646 2992 gene locus_tag LOCUS_21330 gene rimO 1646 2992 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence299 704 180 gene locus_tag LOCUS_21340 704 180 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_21340 1062 766 gene locus_tag LOCUS_21350 1062 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943182.1 protein_id gnl|my_center|LOCUS_21350 2494 1112 gene locus_tag LOCUS_21360 2494 1112 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence300 2360 738 gene locus_tag LOCUS_21370 2360 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence301 2107 452 gene locus_tag LOCUS_21380 2107 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 <3195 2310 gene locus_tag LOCUS_21390 <3195 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266949.1:hybrid sensor histidine kinase/response regulator >Feature sequence302 1164 649 gene locus_tag LOCUS_21400 gene def 1164 649 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_21400 1256 1462 gene locus_tag LOCUS_21410 1256 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2307 1459 gene locus_tag LOCUS_21420 2307 1459 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence303 945 478 gene locus_tag LOCUS_21430 gene msrA 945 478 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_21430 1738 995 gene locus_tag LOCUS_21440 1738 995 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_21440 1885 2241 gene locus_tag LOCUS_21450 1885 2241 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941734.1 protein_id gnl|my_center|LOCUS_21450 2295 2369 gene locus_tag LOCUS_t00280 2295 2369 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2522 2974 gene locus_tag LOCUS_21460 2522 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence304 480 1856 gene locus_tag LOCUS_21470 480 1856 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086404.1 protein_id gnl|my_center|LOCUS_21470 1899 2069 gene locus_tag LOCUS_21480 1899 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence305 1748 339 gene locus_tag LOCUS_21490 1748 339 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_21490 <3159 1771 gene locus_tag LOCUS_21500 <3159 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941040.1:sigma-54 dependent transcriptional regulator >Feature sequence306 <3154 621 gene locus_tag LOCUS_21510 <3154 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257283.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence307 1154 2185 gene locus_tag LOCUS_21520 gene rtcA 1154 2185 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_21520 2296 2466 gene locus_tag LOCUS_21530 2296 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2588 2794 gene locus_tag LOCUS_21540 2588 2794 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_21540 2791 3006 gene locus_tag LOCUS_21550 2791 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2871 2880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence308 <3127 1781 gene locus_tag LOCUS_21560 <3127 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938851.1:molybdopterin-dependent oxidoreductase >Feature sequence309 525 196 gene locus_tag LOCUS_21570 525 196 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_21570 1163 522 gene locus_tag LOCUS_21580 1163 522 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_21580 1777 1199 gene locus_tag LOCUS_21590 1777 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2142 1789 gene locus_tag LOCUS_21600 2142 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2624 2325 gene locus_tag LOCUS_21610 2624 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence310 696 334 gene locus_tag LOCUS_21620 gene dut 696 334 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21620 2056 800 gene locus_tag LOCUS_21630 2056 800 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_21630 3081 2191 gene locus_tag LOCUS_21640 3081 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence311 1659 412 gene locus_tag LOCUS_21650 1659 412 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_21650 2431 2000 gene locus_tag LOCUS_21660 2431 2000 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942323.1 protein_id gnl|my_center|LOCUS_21660 3111 2434 gene locus_tag LOCUS_21670 3111 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence312 <1 1520 gene locus_tag LOCUS_21680 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940997.1:type II secretion system secretin GspD 1517 3103 gene locus_tag LOCUS_21690 gene gspE 1517 3103 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence313 1983 394 gene locus_tag LOCUS_21700 1983 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2879 1986 gene locus_tag LOCUS_21710 2879 1986 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941545.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence314 783 1364 gene locus_tag LOCUS_21720 gene rsmG 783 1364 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161183.1 protein_id gnl|my_center|LOCUS_21720 2595 1411 gene locus_tag LOCUS_21730 2595 1411 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence315 <1 568 gene locus_tag LOCUS_21740 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114586.1:transposase >Feature sequence316 <1 2789 gene locus_tag LOCUS_21750 <1 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941263.1:alpha-amylase family glycosyl hydrolase >Feature sequence317 1395 343 gene locus_tag LOCUS_21760 1395 343 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942730.1 protein_id gnl|my_center|LOCUS_21760 2524 1481 gene locus_tag LOCUS_21770 2524 1481 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence318 <1 1310 gene locus_tag LOCUS_21780 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943797.1:type VI secretion system Vgr family protein >Feature sequence319 2723 1563 gene locus_tag LOCUS_21790 2723 1563 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence320 866 1165 gene locus_tag LOCUS_21800 866 1165 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943852.1 protein_id gnl|my_center|LOCUS_21800 1200 2618 gene locus_tag LOCUS_21810 gene cls 1200 2618 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence321 2031 295 gene locus_tag LOCUS_21820 2031 295 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_21820 <3042 2197 gene locus_tag LOCUS_21830 <3042 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083160.1:FIST N-terminal domain-containing protein >Feature sequence322 625 1608 gene locus_tag LOCUS_21840 gene trpS 625 1608 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_21840 1637 2428 gene locus_tag LOCUS_21850 1637 2428 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence323 594 385 gene locus_tag LOCUS_21860 594 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940891.1 protein_id gnl|my_center|LOCUS_21860 834 2489 gene locus_tag LOCUS_21870 834 2489 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_21870 2556 2960 gene locus_tag LOCUS_21880 gene mce 2556 2960 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence324 268 20 gene locus_tag LOCUS_21890 268 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 812 276 gene locus_tag LOCUS_21900 812 276 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220007.1 protein_id gnl|my_center|LOCUS_21900 1199 1624 gene locus_tag LOCUS_21910 1199 1624 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_21910 1827 2711 gene locus_tag LOCUS_21920 gene argB 1827 2711 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929778.1 protein_id gnl|my_center|LOCUS_21920 2962 2753 gene locus_tag LOCUS_21930 2962 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence325 595 1683 gene locus_tag LOCUS_21940 gene leuB 595 1683 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_21940 1715 2815 gene locus_tag LOCUS_21950 gene asd 1715 2815 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943507.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence326 2104 842 gene locus_tag LOCUS_21960 2104 842 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_21960 2481 2939 gene locus_tag LOCUS_21970 gene smpB 2481 2939 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence327 20 382 gene locus_tag LOCUS_21980 20 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941583.1 protein_id gnl|my_center|LOCUS_21980 420 2174 gene locus_tag LOCUS_21990 420 2174 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_21990 2714 2238 gene locus_tag LOCUS_22000 2714 2238 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence328 1454 78 gene locus_tag LOCUS_22010 1454 78 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_22010 2936 1455 gene locus_tag LOCUS_22020 2936 1455 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence329 <2920 1816 gene locus_tag LOCUS_22030 <2920 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease >Feature sequence330 <1 776 gene locus_tag LOCUS_22040 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943275.1:NAD(P)H-quinone oxidoreductase 1983 889 gene locus_tag LOCUS_22050 1983 889 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_22050 <2916 2164 gene locus_tag LOCUS_22060 <2916 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003238566.1:succinate--CoA ligase subunit alpha >Feature sequence331 <1 1625 gene locus_tag LOCUS_22070 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941450.1:nickel-dependent hydrogenase large subunit 1760 2242 gene locus_tag LOCUS_22080 1760 2242 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_22080 <2909 2285 gene locus_tag LOCUS_22090 <2909 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004540175.1:DJ-1/PfpI family protein >Feature sequence332 930 85 gene locus_tag LOCUS_22100 930 85 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970098.1 protein_id gnl|my_center|LOCUS_22100 2180 1005 gene locus_tag LOCUS_22110 2180 1005 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence333 805 470 gene locus_tag LOCUS_22120 gene nifX 805 470 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943432.1 protein_id gnl|my_center|LOCUS_22120 1741 878 gene locus_tag LOCUS_22130 gene nifH 1741 878 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_22130 2148 1927 gene locus_tag LOCUS_22140 2148 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 <2906 2361 gene locus_tag LOCUS_22150 <2906 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933415.1:ATP-binding cassette domain-containing protein >Feature sequence334 1402 134 gene locus_tag LOCUS_22160 1402 134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 protein_id gnl|my_center|LOCUS_22160 2460 1414 gene locus_tag LOCUS_22170 2460 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_22170 2878 2549 gene locus_tag LOCUS_22180 2878 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence335 1200 202 gene locus_tag LOCUS_22190 gene waaC 1200 202 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684682.1 protein_id gnl|my_center|LOCUS_22190 1802 1197 gene locus_tag LOCUS_22200 1802 1197 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939172.1 protein_id gnl|my_center|LOCUS_22200 <2880 2016 gene locus_tag LOCUS_22210 <2880 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942882.1:lipopolysaccharide heptosyltransferase I >Feature sequence336 >Feature sequence337 2283 1225 gene locus_tag LOCUS_22220 2283 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943970.1 protein_id gnl|my_center|LOCUS_22220 2702 2361 gene locus_tag LOCUS_22230 2702 2361 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence338 <2857 1138 gene locus_tag LOCUS_22240 <2857 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942408.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence339 643 335 gene locus_tag LOCUS_22250 643 335 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942988.1 protein_id gnl|my_center|LOCUS_22250 1502 732 gene locus_tag LOCUS_22260 1502 732 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_22260 2035 1703 gene locus_tag LOCUS_22270 2035 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence340 567 1034 gene locus_tag LOCUS_22280 567 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1062 2291 gene locus_tag LOCUS_22290 1062 2291 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence341 220 1413 gene locus_tag LOCUS_22300 220 1413 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_22300 2421 1552 gene locus_tag LOCUS_22310 gene nudC 2421 1552 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941705.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence342 92 1339 gene locus_tag LOCUS_22320 92 1339 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_22320 1348 2166 gene locus_tag LOCUS_22330 1348 2166 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940970.1 protein_id gnl|my_center|LOCUS_22330 <2790 2271 gene locus_tag LOCUS_22340 <2790 2271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943390.1:glycerol kinase GlpK >Feature sequence343 1654 572 gene locus_tag LOCUS_22350 gene cobD 1654 572 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_22350 2609 1638 gene locus_tag LOCUS_22360 gene cbiB 2609 1638 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence344 343 741 gene locus_tag LOCUS_22370 343 741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941781.1 protein_id gnl|my_center|LOCUS_22370 748 2397 gene locus_tag LOCUS_22380 748 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence345 <1 560 gene locus_tag LOCUS_22390 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942426.1:pilus assembly protein PilM 560 1099 gene locus_tag LOCUS_22400 560 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1096 1641 gene locus_tag LOCUS_22410 gene pilO 1096 1641 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942424.1 protein_id gnl|my_center|LOCUS_22410 1638 2243 gene locus_tag LOCUS_22420 1638 2243 CDS product type II secretion system protein PulP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942423.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence346 1803 730 gene locus_tag LOCUS_22430 gene cheB 1803 730 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_22430 <2761 1815 gene locus_tag LOCUS_22440 <2761 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015337756.1:response regulator >Feature sequence347 <1 528 gene locus_tag LOCUS_22450 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071874.1:3-oxoacyl-ACP synthase III 522 1433 gene locus_tag LOCUS_22460 522 1433 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence348 <1 631 gene locus_tag LOCUS_22470 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942181.1:exodeoxyribonuclease V subunit beta 896 2710 gene locus_tag LOCUS_22480 gene recD 896 2710 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence349 <2744 2142 gene locus_tag LOCUS_22490 <2744 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816723.1:glycosyltransferase family 4 protein >Feature sequence350 1141 317 gene locus_tag LOCUS_22500 1141 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2429 1194 gene locus_tag LOCUS_22510 2429 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence351 533 111 gene locus_tag LOCUS_22520 533 111 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944045.1 protein_id gnl|my_center|LOCUS_22520 1577 585 gene locus_tag LOCUS_22530 gene nuoH 1577 585 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_22530 1758 2348 gene locus_tag LOCUS_22540 gene yihA 1758 2348 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_22540 2675 2397 gene locus_tag LOCUS_22550 2675 2397 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941553.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence352 1158 214 gene locus_tag LOCUS_22560 1158 214 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_22560 1773 1273 gene locus_tag LOCUS_22570 1773 1273 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_22570 <2739 1858 gene locus_tag LOCUS_22580 <2739 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940767.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein >Feature sequence353 178 573 gene locus_tag LOCUS_22590 178 573 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943100.1 protein_id gnl|my_center|LOCUS_22590 570 890 gene locus_tag LOCUS_22600 570 890 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943099.1 protein_id gnl|my_center|LOCUS_22600 1083 1964 gene locus_tag LOCUS_22610 1083 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence354 15 1919 gene locus_tag LOCUS_22620 gene dxs 15 1919 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence355 1152 385 gene locus_tag LOCUS_22630 gene hypB 1152 385 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_22630 <2660 1342 gene locus_tag LOCUS_22640 <2660 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940777.1:ABC transporter ATP-binding protein >Feature sequence356 397 322 gene locus_tag LOCUS_t00290 397 322 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1880 504 gene locus_tag LOCUS_22650 1880 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2275 1919 gene locus_tag LOCUS_22660 gene dksA 2275 1919 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence357 <1 1923 gene locus_tag LOCUS_22670 <1 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530092.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence358 >Feature sequence359 <1 774 gene locus_tag LOCUS_22680 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941984.1:TolC family protein 856 2253 gene locus_tag LOCUS_22690 856 2253 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence360 1 579 gene locus_tag LOCUS_22700 1 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 635 1162 gene locus_tag LOCUS_22710 635 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1336 2244 gene locus_tag LOCUS_22720 1336 2244 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence361 62 2320 gene locus_tag LOCUS_22730 62 2320 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence362 469 152 gene locus_tag LOCUS_22740 469 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1073 447 gene locus_tag LOCUS_22750 1073 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2281 1079 gene locus_tag LOCUS_22760 2281 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence363 1686 1258 gene locus_tag LOCUS_22770 1686 1258 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence364 2577 2302 gene locus_tag LOCUS_22780 gene rpsO 2577 2302 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence365 871 650 gene locus_tag LOCUS_22790 871 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2303 915 gene locus_tag LOCUS_22800 2303 915 CDS product IS701-like element ISRba4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921909.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence366 273 1331 gene locus_tag LOCUS_22810 273 1331 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_22810 1612 1454 gene locus_tag LOCUS_22820 1612 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941841.1 protein_id gnl|my_center|LOCUS_22820 <2563 1746 gene locus_tag LOCUS_22830 <2563 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944019.1:low specificity L-threonine aldolase >Feature sequence367 <1 907 gene locus_tag LOCUS_22840 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941177.1:molybdopterin-dependent oxidoreductase >Feature sequence368 461 1165 gene locus_tag LOCUS_22850 461 1165 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_22850 1165 1350 gene locus_tag LOCUS_22860 1165 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1355 1756 gene locus_tag LOCUS_22870 1355 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943735.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence369 1073 255 gene locus_tag LOCUS_22880 1073 255 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_22880 1751 1119 gene locus_tag LOCUS_22890 1751 1119 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_22890 <2518 1780 gene locus_tag LOCUS_22900 <2518 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021708513.1:Ig-like domain-containing protein >Feature sequence370 536 72 gene locus_tag LOCUS_22910 536 72 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_22910 698 2206 gene locus_tag LOCUS_22920 698 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence371 >Feature sequence372 1132 212 gene locus_tag LOCUS_22930 gene fabD 1132 212 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_22930 2135 1149 gene locus_tag LOCUS_22940 2135 1149 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence373 947 429 gene locus_tag LOCUS_22950 gene moaC 947 429 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943342.1 protein_id gnl|my_center|LOCUS_22950 2148 1084 gene locus_tag LOCUS_22960 2148 1084 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence374 <2468 1640 gene locus_tag LOCUS_22970 <2468 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942136.1:shikimate dehydrogenase >Feature sequence375 <1 1279 gene locus_tag LOCUS_22980 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943972.1:transglutaminase-like domain-containing protein <2467 1311 gene locus_tag LOCUS_22990 <2467 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943971.1:pitrilysin family protein >Feature sequence376 >Feature sequence377 <1 1409 gene locus_tag LOCUS_23000 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940975.1:carbamoyltransferase HypF 1504 1734 gene locus_tag LOCUS_23010 1504 1734 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence378 1509 64 gene locus_tag LOCUS_23020 1509 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1960 1496 gene locus_tag LOCUS_23030 1960 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence379 >Feature sequence380 <1 621 gene locus_tag LOCUS_23040 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966601.1:Nramp family divalent metal transporter 1578 1042 gene locus_tag LOCUS_23050 1578 1042 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942072.1 protein_id gnl|my_center|LOCUS_23050 <2458 1619 gene locus_tag LOCUS_23060 <2458 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942068.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase >Feature sequence381 692 1615 gene locus_tag LOCUS_23070 gene bioB 692 1615 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_23070 1653 2369 gene locus_tag LOCUS_23080 gene bioD 1653 2369 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence382 519 1478 gene locus_tag LOCUS_23090 gene hprK 519 1478 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_23090 1481 2344 gene locus_tag LOCUS_23100 gene rapZ 1481 2344 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence383 <1 1970 gene locus_tag LOCUS_23110 <1 1970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948085.1:magnesium-translocating P-type ATPase >Feature sequence384 <1 600 gene locus_tag LOCUS_23120 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942124.1:TPM domain-containing protein 698 1813 gene locus_tag LOCUS_23130 698 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence385 <1 968 gene locus_tag LOCUS_23140 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941636.1:S41 family peptidase 1176 949 gene locus_tag LOCUS_23150 1176 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942095.1 protein_id gnl|my_center|LOCUS_23150 2010 1204 gene locus_tag LOCUS_23160 gene trpC 2010 1204 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence386 428 793 gene locus_tag LOCUS_23170 428 793 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942264.1 protein_id gnl|my_center|LOCUS_23170 831 1706 gene locus_tag LOCUS_23180 831 1706 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence387 1867 308 gene locus_tag LOCUS_23190 1867 308 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence388 >Feature sequence389 234 950 gene locus_tag LOCUS_23200 gene ispD 234 950 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_23200 947 1750 gene locus_tag LOCUS_23210 947 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2092 1835 gene locus_tag LOCUS_23220 2092 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence390 <1 719 gene locus_tag LOCUS_23230 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926880.1:AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor 977 1801 gene locus_tag LOCUS_23240 977 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941721.1 protein_id gnl|my_center|LOCUS_23240 <2390 1860 gene locus_tag LOCUS_23250 <2390 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176675.1:radical SAM/SPASM family putative metalloenzyme maturase >Feature sequence391 323 1861 gene locus_tag LOCUS_23260 323 1861 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence392 1691 546 gene locus_tag LOCUS_23270 1691 546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 protein_id gnl|my_center|LOCUS_23270 2148 1717 gene locus_tag LOCUS_23280 2148 1717 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence393 502 729 gene locus_tag LOCUS_23290 502 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence394 <1 899 gene locus_tag LOCUS_23300 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041913993.1:type II secretion system ATPase GspE 880 2091 gene locus_tag LOCUS_23310 gene gspF 880 2091 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence395 1637 618 gene locus_tag LOCUS_23320 1637 618 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence396 1801 1232 gene locus_tag LOCUS_23330 gene pal 1801 1232 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence397 <1 1193 gene locus_tag LOCUS_23340 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942455.1:tRNA lysidine(34) synthetase TilS >Feature sequence398 >Feature sequence399 <1 717 gene locus_tag LOCUS_23350 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011213317.1:macrophage infectivity potentiator Mip 1698 811 gene locus_tag LOCUS_23360 1698 811 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942225.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence400 <1 947 gene locus_tag LOCUS_23370 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943010.1:tryptophan synthase subunit beta 1071 2075 gene locus_tag LOCUS_23380 gene pta 1071 2075 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence401 442 2073 gene locus_tag LOCUS_23390 442 2073 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence402 <1 628 gene locus_tag LOCUS_23400 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943909.1:(Fe-S)-binding protein 830 1393 gene locus_tag LOCUS_23410 830 1393 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence403 2162 654 gene locus_tag LOCUS_23420 2162 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence404 <2148 1155 gene locus_tag LOCUS_23430 <2148 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942409.1:polyprenyl synthetase family protein >Feature sequence405 1942 1085 gene locus_tag LOCUS_23440 gene htpX 1942 1085 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence406 <1 614 gene locus_tag LOCUS_23450 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198379.1:SDR family oxidoreductase 636 1403 gene locus_tag LOCUS_23460 636 1403 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence407 973 359 gene locus_tag LOCUS_23470 gene wrbA 973 359 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_23470 1901 993 gene locus_tag LOCUS_23480 1901 993 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941599.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence408 217 1269 gene locus_tag LOCUS_23490 217 1269 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_23490 1681 1974 gene locus_tag LOCUS_23500 1681 1974 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence409 1589 165 gene locus_tag LOCUS_23510 1589 165 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence410 142 1080 gene locus_tag LOCUS_23520 gene miaA 142 1080 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_23520 1084 1308 gene locus_tag LOCUS_23530 gene hfq 1084 1308 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942642.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence411 <1 804 gene locus_tag LOCUS_23540 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943902.1:sodium-translocating pyrophosphatase 1245 934 gene locus_tag LOCUS_23550 1245 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1824 1327 gene locus_tag LOCUS_23560 1824 1327 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence412 <1 1947 gene locus_tag LOCUS_23570 <1 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence413 468 917 gene locus_tag LOCUS_23580 468 917 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence414 >Feature sequence415 <1 1191 gene locus_tag LOCUS_23590 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940814.1:peptide chain release factor 3 1201 1401 gene locus_tag LOCUS_23600 1201 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 <2024 1461 gene locus_tag LOCUS_23610 <2024 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940965.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence416 168 1220 gene locus_tag LOCUS_23620 168 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1627 1337 gene locus_tag LOCUS_23630 1627 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence417 848 366 gene locus_tag LOCUS_23640 848 366 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940845.1 protein_id gnl|my_center|LOCUS_23640 1548 1111 gene locus_tag LOCUS_23650 gene tnpA 1548 1111 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence418 910 1599 gene locus_tag LOCUS_23660 910 1599 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence419 260 454 gene locus_tag LOCUS_23670 260 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 264 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 444 740 gene locus_tag LOCUS_23680 444 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 853 1113 gene locus_tag LOCUS_23690 853 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1212 1490 gene locus_tag LOCUS_23700 1212 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence420 312 1226 gene locus_tag LOCUS_23710 312 1226 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_23710 1223 1906 gene locus_tag LOCUS_23720 1223 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence421 292 68 gene locus_tag LOCUS_23730 292 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 882 400 gene locus_tag LOCUS_23740 882 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 <1945 921 gene locus_tag LOCUS_23750 <1945 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940686.1:response regulator >Feature sequence422 213 491 gene locus_tag LOCUS_23760 213 491 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_23760 500 814 gene locus_tag LOCUS_23770 500 814 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_23770 1919 903 gene locus_tag LOCUS_23780 1919 903 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence423 458 111 gene locus_tag LOCUS_23790 458 111 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_23790 794 498 gene locus_tag LOCUS_23800 794 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1172 840 gene locus_tag LOCUS_23810 1172 840 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943372.1 protein_id gnl|my_center|LOCUS_23810 1687 1214 gene locus_tag LOCUS_23820 gene nuoE 1687 1214 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence424 1470 334 gene locus_tag LOCUS_23830 1470 334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence425 1598 276 gene locus_tag LOCUS_23840 1598 276 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence426 890 633 gene locus_tag LOCUS_23850 890 633 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942122.1 protein_id gnl|my_center|LOCUS_23850 1630 887 gene locus_tag LOCUS_23860 1630 887 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence427 1682 777 gene locus_tag LOCUS_23870 1682 777 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence428 1418 759 gene locus_tag LOCUS_23880 gene fkpA 1418 759 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838250.1 protein_id gnl|my_center|LOCUS_23880 1632 1868 gene locus_tag LOCUS_23890 1632 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence429 >Feature sequence430 <1 749 gene locus_tag LOCUS_23900 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941448.1:hydrogenase 2 operon protein HybA >Feature sequence431 <1853 477 gene locus_tag LOCUS_23910 <1853 477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit >Feature sequence432 >Feature sequence433 <1818 493 gene locus_tag LOCUS_23920 <1818 493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943809.1:tetratricopeptide repeat protein >Feature sequence434 <1 687 gene locus_tag LOCUS_23930 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545005.1:methyl-accepting chemotaxis protein 1646 780 gene locus_tag LOCUS_23940 1646 780 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence435 411 1367 gene locus_tag LOCUS_23950 gene meaB 411 1367 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence436 <1 1143 gene locus_tag LOCUS_23960 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940827.1:acetylornithine transaminase >Feature sequence437 1197 811 gene locus_tag LOCUS_23970 1197 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943064.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence438 >Feature sequence439 <1784 964 gene locus_tag LOCUS_23980 <1784 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727659.1:mycofactocin radical SAM maturase >Feature sequence440 567 196 gene locus_tag LOCUS_23990 gene gcvH 567 196 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941044.1 protein_id gnl|my_center|LOCUS_23990 <1770 785 gene locus_tag LOCUS_24000 <1770 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941043.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence441 1609 296 gene locus_tag LOCUS_24010 gene trmFO 1609 296 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence442 145 1143 gene locus_tag LOCUS_24020 145 1143 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964900.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence443 453 1265 gene locus_tag LOCUS_24030 453 1265 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence444 <1729 1034 gene locus_tag LOCUS_24040 <1729 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942474.1:AmmeMemoRadiSam system protein B >Feature sequence445 1361 207 gene locus_tag LOCUS_24050 1361 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1597 1358 gene locus_tag LOCUS_24060 1597 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence446 1165 464 gene locus_tag LOCUS_24070 1165 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence447 <1695 751 gene locus_tag LOCUS_24080 <1695 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942138.1:type IV pilus twitching motility protein PilT >Feature sequence448 <1 1049 gene locus_tag LOCUS_24090 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943259.1:SpoIID/LytB domain-containing protein >Feature sequence449 326 1333 gene locus_tag LOCUS_24100 326 1333 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence450 <1 1547 gene locus_tag LOCUS_24110 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence451 1253 570 gene locus_tag LOCUS_24120 1253 570 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence452 >Feature sequence453 1325 141 gene locus_tag LOCUS_24130 1325 141 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence454 242 997 gene locus_tag LOCUS_24140 242 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence455 >Feature sequence456 <1 1022 gene locus_tag LOCUS_24150 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941242.1:glycine--tRNA ligase subunit beta >Feature sequence457 569 12 gene locus_tag LOCUS_24160 gene rluE 569 12 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence458 >Feature sequence459 338 18 gene locus_tag LOCUS_24170 gene nuoK 338 18 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944042.1 protein_id gnl|my_center|LOCUS_24170 961 323 gene locus_tag LOCUS_24180 961 323 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944043.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence460 >Feature sequence461 491 871 gene locus_tag LOCUS_24190 491 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1129 980 gene locus_tag LOCUS_24200 1129 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence462 >Feature sequence463 967 545 gene locus_tag LOCUS_24210 967 545 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941198.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence464 594 749 gene locus_tag LOCUS_24220 594 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24220 >Feature sequence465 >Feature sequence466 802 23 gene locus_tag LOCUS_24230 802 23 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104707.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence467 676 685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence468 >Feature sequence469 262 555 gene locus_tag LOCUS_24240 262 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24240 >Feature sequence470 >Feature sequence471 786 265 gene locus_tag LOCUS_24250 786 265 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence472 1020 73 gene locus_tag LOCUS_24260 1020 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence473 >Feature sequence474 2 190 gene locus_tag LOCUS_24270 2 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence475 >Feature sequence476 >Feature sequence477 <1 838 gene locus_tag LOCUS_24280 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943987.1:diguanylate cyclase >Feature sequence478 201 584 gene locus_tag LOCUS_24290 201 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence479 >Feature sequence480 712 5 gene locus_tag LOCUS_24300 gene ubiE 712 5 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence481 683 510 gene locus_tag LOCUS_24310 683 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence482 >Feature sequence483 122 721 gene locus_tag LOCUS_24320 122 721 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence484 >Feature sequence485 230 239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence486 >Feature sequence487 <1 750 gene locus_tag LOCUS_24330 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943007.1:methyl-accepting chemotaxis protein >Feature sequence488 >Feature sequence489 >Feature sequence490 >Feature sequence491 >Feature sequence492 388 131 gene locus_tag LOCUS_24340 388 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942077.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence493 >Feature sequence494 649 389 gene locus_tag LOCUS_24350 649 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24350 424 433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence495 >Feature sequence496 >Feature sequence497 >Feature sequence498 335 344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence499 >Feature sequence500 >Feature sequence501 >Feature sequence502 >Feature sequence503 >Feature sequence504 77 598 gene locus_tag LOCUS_24360 77 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence505 >Feature sequence506 200 700 gene locus_tag LOCUS_24370 200 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943551.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence507 >Feature sequence508 384 1 gene locus_tag LOCUS_24380 384 1 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941887.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence509 209 499 gene locus_tag LOCUS_24390 gene hgcB 209 499 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence510 253 56 gene locus_tag LOCUS_24400 gene thiS 253 56 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941252.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence511 >Feature sequence512 >Feature sequence513 >Feature sequence514 716 408 gene locus_tag LOCUS_24410 716 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence515 >Feature sequence516 <733 43 gene locus_tag LOCUS_24420 <733 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942639.1:cytochrome c3 family protein >Feature sequence517 >Feature sequence518 357 282 gene locus_tag LOCUS_t00300 357 282 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence519 >Feature sequence520 >Feature sequence521 >Feature sequence522 >Feature sequence523 60 416 gene locus_tag LOCUS_24430 60 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence524 >Feature sequence525 >Feature sequence526 >Feature sequence527 >Feature sequence528 >Feature sequence529 >Feature sequence530 >Feature sequence531 >Feature sequence532 >Feature sequence533 >Feature sequence534 >Feature sequence535 >Feature sequence536 >Feature sequence537 >Feature sequence538 >Feature sequence539 >Feature sequence540 >Feature sequence541 247 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence542 >Feature sequence543 >Feature sequence544 >Feature sequence545 <1 628 gene locus_tag LOCUS_24440 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943489.1:elongation factor G >Feature sequence546 >Feature sequence547 >Feature sequence548 >Feature sequence549 <678 124 gene locus_tag LOCUS_24450 <678 124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210775.1:Bax inhibitor-1/YccA family protein >Feature sequence550 349 191 gene locus_tag LOCUS_24460 349 191 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943806.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence551 >Feature sequence552 >Feature sequence553 <674 139 gene locus_tag LOCUS_24470 <674 139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943718.1:imidazole glycerol phosphate synthase subunit HisH 237 246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence554 >Feature sequence555 >Feature sequence556 >Feature sequence557 >Feature sequence558 >Feature sequence559 17 271 gene locus_tag LOCUS_24480 17 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence560 <657 32 gene locus_tag LOCUS_24490 <657 32 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942126.1:MDR family MFS transporter >Feature sequence561 <652 142 gene locus_tag LOCUS_24500 <652 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941826.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence562 >Feature sequence563 >Feature sequence564 >Feature sequence565 >Feature sequence566 <637 100 gene locus_tag LOCUS_24510 <637 100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191635.1:peptidylprolyl isomerase >Feature sequence567 >Feature sequence568 >Feature sequence569 >Feature sequence570 >Feature sequence571 >Feature sequence572 >Feature sequence573 >Feature sequence574 372 381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence575 279 288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence576 >Feature sequence577 >Feature sequence578 >Feature sequence579 >Feature sequence580 >Feature sequence581 >Feature sequence582 617 240 gene locus_tag LOCUS_24520 617 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence583 <617 116 gene locus_tag LOCUS_24530 <617 116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090071.1:RluA family pseudouridine synthase >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 554 285 gene locus_tag LOCUS_24540 554 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence588 >Feature sequence589 >Feature sequence590 296 220 gene locus_tag LOCUS_t00310 296 220 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence591 >Feature sequence592 >Feature sequence593 >Feature sequence594 >Feature sequence595 >Feature sequence596 >Feature sequence597 <1 559 gene locus_tag LOCUS_24550 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942933.1:HDOD domain-containing protein >Feature sequence598 >Feature sequence599 457 305 gene locus_tag LOCUS_24560 457 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence600 204 280 gene locus_tag LOCUS_t00320 204 280 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence601 >Feature sequence602 342 351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence603 <1 531 gene locus_tag LOCUS_24570 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942639.1:cytochrome c3 family protein >Feature sequence604 >Feature sequence605 <1 528 gene locus_tag LOCUS_24580 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259118.1:EAL domain-containing protein >Feature sequence606 >Feature sequence607 >Feature sequence608 >Feature sequence609 >Feature sequence610 216 16 gene locus_tag LOCUS_24590 216 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence611 354 363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence612 >Feature sequence613 >Feature sequence614 >Feature sequence615 >Feature sequence616 131 442 gene locus_tag LOCUS_24600 gene fdxB 131 442 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533478.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence617 >Feature sequence618 261 449 gene locus_tag LOCUS_24610 261 449 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941445.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence619 >Feature sequence620 >Feature sequence621 >Feature sequence622 53 334 gene locus_tag LOCUS_24620 53 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence623 >Feature sequence624 >Feature sequence625 >Feature sequence626 283 292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence627 >Feature sequence628 >Feature sequence629 >Feature sequence630 >Feature sequence631 >Feature sequence632 >Feature sequence633 >Feature sequence634 >Feature sequence635 >Feature sequence636 >Feature sequence637 >Feature sequence638 >Feature sequence639 >Feature sequence640 >Feature sequence641 >Feature sequence642 310 >552 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgagcgcccgtcctacctggacgggcgaggattgaaac >Feature sequence643 >Feature sequence644 >Feature sequence645 >Feature sequence646 >Feature sequence647 >Feature sequence648 >Feature sequence649 >Feature sequence650 <1 530 gene locus_tag LOCUS_24630 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940679.1:DNA polymerase III subunit beta >Feature sequence651 >Feature sequence652 >Feature sequence653 >Feature sequence654 >Feature sequence655 >Feature sequence656 >Feature sequence657 >Feature sequence658 >Feature sequence659 >Feature sequence660 >Feature sequence661 >Feature sequence662 >Feature sequence663 >Feature sequence664 >Feature sequence665 >Feature sequence666 265 59 gene locus_tag LOCUS_24640 265 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence667 >Feature sequence668 458 204 gene locus_tag LOCUS_24650 458 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence669 >Feature sequence670 >Feature sequence671 >Feature sequence672 243 509 gene locus_tag LOCUS_24660 243 509 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943607.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence673 >Feature sequence674 >Feature sequence675 >Feature sequence676 <1 509 gene locus_tag LOCUS_24670 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:EAL domain-containing protein >Feature sequence677 >Feature sequence678 >Feature sequence679 >Feature sequence680 >Feature sequence681 >Feature sequence682 >Feature sequence683 >Feature sequence684 >Feature sequence685 >Feature sequence686 >Feature sequence687 >Feature sequence688 >Feature sequence689 >Feature sequence690 >Feature sequence691 442 56 gene locus_tag LOCUS_24680 442 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence692 >Feature sequence693 >Feature sequence694 >Feature sequence695 >Feature sequence696 >Feature sequence697 >Feature sequence698 >Feature sequence699 >Feature sequence700 >Feature sequence701 491 180 gene locus_tag LOCUS_24690 491 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence702 >Feature sequence703 >Feature sequence704 >Feature sequence705 >Feature sequence706 >Feature sequence707 187 444 gene locus_tag LOCUS_24700 187 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence708 230 239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence709 >Feature sequence710 >Feature sequence711 >Feature sequence712 >Feature sequence713 >Feature sequence714 >Feature sequence715 2 394 gene locus_tag LOCUS_24710 2 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence716