>Feature sequence001 <1 1226 gene locus_tag LOCUS_00010 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028423.1:S41 family peptidase 1712 1203 gene locus_tag LOCUS_00020 gene ruvC 1712 1203 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887085.1 protein_id gnl|my_center|LOCUS_00020 1750 2553 gene locus_tag LOCUS_00030 1750 2553 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_00030 2667 3146 gene locus_tag LOCUS_00040 2667 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3140 3613 gene locus_tag LOCUS_00050 3140 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 3643 4116 gene locus_tag LOCUS_00060 3643 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4118 5140 gene locus_tag LOCUS_00070 4118 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5411 9292 gene locus_tag LOCUS_00080 5411 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10369 9359 gene locus_tag LOCUS_00090 gene gutB 10369 9359 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_00090 11382 10402 gene locus_tag LOCUS_00100 11382 10402 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_00100 11461 11745 gene locus_tag LOCUS_00110 gene rpoZ 11461 11745 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480122.1 protein_id gnl|my_center|LOCUS_00110 11752 12939 gene locus_tag LOCUS_00120 gene coaBC 11752 12939 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228764.1 protein_id gnl|my_center|LOCUS_00120 12947 13408 gene locus_tag LOCUS_00130 gene argR 12947 13408 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479994.1 protein_id gnl|my_center|LOCUS_00130 13408 14037 gene locus_tag LOCUS_00140 13408 14037 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_00140 14135 15058 gene locus_tag LOCUS_00150 14135 15058 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888164.1 protein_id gnl|my_center|LOCUS_00150 15151 15693 gene locus_tag LOCUS_00160 15151 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16827 15598 gene locus_tag LOCUS_00170 16827 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16930 18111 gene locus_tag LOCUS_00180 16930 18111 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350363.1 protein_id gnl|my_center|LOCUS_00180 18189 18464 gene locus_tag LOCUS_00190 18189 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18531 19568 gene locus_tag LOCUS_00200 18531 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20296 19562 gene locus_tag LOCUS_00210 20296 19562 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350944.1 protein_id gnl|my_center|LOCUS_00210 20983 20324 gene locus_tag LOCUS_00220 20983 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21280 22200 gene locus_tag LOCUS_00230 21280 22200 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_00230 22197 22853 gene locus_tag LOCUS_00240 22197 22853 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_00240 >Feature sequence002 1110 76 gene locus_tag LOCUS_00250 1110 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 1202 1903 gene locus_tag LOCUS_00260 1202 1903 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_00260 1911 3149 gene locus_tag LOCUS_00270 1911 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2643 2652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8823 3223 gene locus_tag LOCUS_00280 8823 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 10075 9353 gene locus_tag LOCUS_00290 10075 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_00290 10049 10058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11015 10107 gene locus_tag LOCUS_00300 11015 10107 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_00300 12483 11053 gene locus_tag LOCUS_00310 12483 11053 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228361.1 protein_id gnl|my_center|LOCUS_00310 12889 12515 gene locus_tag LOCUS_00320 12889 12515 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172987.1 protein_id gnl|my_center|LOCUS_00320 13054 13953 gene locus_tag LOCUS_00330 13054 13953 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_00330 14579 13968 gene locus_tag LOCUS_00340 14579 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 15187 14576 gene locus_tag LOCUS_00350 15187 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 16128 15190 gene locus_tag LOCUS_00360 16128 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 16470 16174 gene locus_tag LOCUS_00370 16470 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 16588 17328 gene locus_tag LOCUS_00380 16588 17328 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887221.1 protein_id gnl|my_center|LOCUS_00380 17466 19304 gene locus_tag LOCUS_00390 17466 19304 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567123.1 protein_id gnl|my_center|LOCUS_00390 19286 19789 gene locus_tag LOCUS_00400 19286 19789 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351160.1 protein_id gnl|my_center|LOCUS_00400 19746 20687 gene locus_tag LOCUS_00410 19746 20687 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480164.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 20345 20354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20671 20817 gene locus_tag LOCUS_00420 20671 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 <21670 20792 gene locus_tag LOCUS_00430 <21670 20792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039017.1:tRNA dihydrouridine(20/20a) synthase DusA >Feature sequence003 554 1579 gene locus_tag LOCUS_00440 554 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 1587 2462 gene locus_tag LOCUS_00450 1587 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2459 3211 gene locus_tag LOCUS_00460 2459 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 3266 3757 gene locus_tag LOCUS_00470 3266 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 3754 4200 gene locus_tag LOCUS_00480 3754 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4175 5059 gene locus_tag LOCUS_00490 4175 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5056 7047 gene locus_tag LOCUS_00500 5056 7047 CDS product DUF4900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229178.1 protein_id gnl|my_center|LOCUS_00500 7099 8382 gene locus_tag LOCUS_00510 7099 8382 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769085.1 protein_id gnl|my_center|LOCUS_00510 8620 9897 gene locus_tag LOCUS_00520 8620 9897 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_00520 10027 10920 gene locus_tag LOCUS_00530 10027 10920 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_00530 10917 11753 gene locus_tag LOCUS_00540 10917 11753 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_00540 11770 14643 gene locus_tag LOCUS_00550 11770 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 14646 15860 gene locus_tag LOCUS_00560 14646 15860 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence004 529 1740 gene locus_tag LOCUS_00570 529 1740 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886724.1 protein_id gnl|my_center|LOCUS_00570 1948 1751 gene locus_tag LOCUS_00580 1948 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 2614 2024 gene locus_tag LOCUS_00590 2614 2024 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228626.1 protein_id gnl|my_center|LOCUS_00590 3903 2611 gene locus_tag LOCUS_00600 3903 2611 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228625.1 protein_id gnl|my_center|LOCUS_00600 4702 3965 gene locus_tag LOCUS_00610 4702 3965 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228624.1 protein_id gnl|my_center|LOCUS_00610 5585 4734 gene locus_tag LOCUS_00620 5585 4734 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975348.1 protein_id gnl|my_center|LOCUS_00620 7084 5633 gene locus_tag LOCUS_00630 7084 5633 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_00630 9176 7074 gene locus_tag LOCUS_00640 9176 7074 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_00640 7332 7341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10382 9204 gene locus_tag LOCUS_00650 gene rhaI 10382 9204 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_00650 10768 10379 gene locus_tag LOCUS_00660 10768 10379 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_00660 11556 10765 gene locus_tag LOCUS_00670 11556 10765 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_00670 11968 12972 gene locus_tag LOCUS_00680 11968 12972 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742142.1 protein_id gnl|my_center|LOCUS_00680 13039 14535 gene locus_tag LOCUS_00690 13039 14535 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 protein_id gnl|my_center|LOCUS_00690 14548 15555 gene locus_tag LOCUS_00700 14548 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15552 16505 gene locus_tag LOCUS_00710 15552 16505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082684.1 protein_id gnl|my_center|LOCUS_00710 16529 16816 gene locus_tag LOCUS_00720 16529 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence005 385 86 gene locus_tag LOCUS_00730 385 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3000 397 gene locus_tag LOCUS_00740 gene pulA 3000 397 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_00740 3685 3191 gene locus_tag LOCUS_00750 gene ispF 3685 3191 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886876.1 protein_id gnl|my_center|LOCUS_00750 3721 4851 gene locus_tag LOCUS_00760 3721 4851 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480363.1 protein_id gnl|my_center|LOCUS_00760 4994 6181 gene locus_tag LOCUS_00770 4994 6181 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_00770 6188 7138 gene locus_tag LOCUS_00780 6188 7138 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_00780 7138 8052 gene locus_tag LOCUS_00790 7138 8052 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888751.1 protein_id gnl|my_center|LOCUS_00790 8036 8794 gene locus_tag LOCUS_00800 8036 8794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_00800 8794 9510 gene locus_tag LOCUS_00810 8794 9510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_00810 9982 9521 gene locus_tag LOCUS_00820 9982 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 10087 10791 gene locus_tag LOCUS_00830 10087 10791 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229019.1 protein_id gnl|my_center|LOCUS_00830 10788 11936 gene locus_tag LOCUS_00840 10788 11936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_00840 11958 12542 gene locus_tag LOCUS_00850 gene plsY 11958 12542 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_00850 15930 12574 gene locus_tag LOCUS_00860 15930 12574 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228151.1 protein_id gnl|my_center|LOCUS_00860 17132 15927 gene locus_tag LOCUS_00870 17132 15927 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870666.1 protein_id gnl|my_center|LOCUS_00870 18133 17129 gene locus_tag LOCUS_00880 18133 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence006 <1 1258 gene locus_tag LOCUS_00890 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480228.1:2-isopropylmalate synthase 1293 2972 gene locus_tag LOCUS_00900 gene ilvD 1293 2972 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_00900 2999 3709 gene locus_tag LOCUS_00910 gene rlmB 2999 3709 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_00910 3741 4280 gene locus_tag LOCUS_00920 3741 4280 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888217.1 protein_id gnl|my_center|LOCUS_00920 4280 5269 gene locus_tag LOCUS_00930 gene queA 4280 5269 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173135.1 protein_id gnl|my_center|LOCUS_00930 5266 6156 gene locus_tag LOCUS_00940 5266 6156 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 protein_id gnl|my_center|LOCUS_00940 6149 6775 gene locus_tag LOCUS_00950 6149 6775 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_00950 6772 7545 gene locus_tag LOCUS_00960 6772 7545 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888160.1 protein_id gnl|my_center|LOCUS_00960 7676 8134 gene locus_tag LOCUS_00970 7676 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 8197 8598 gene locus_tag LOCUS_00980 8197 8598 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887511.1 protein_id gnl|my_center|LOCUS_00980 8704 10452 gene locus_tag LOCUS_00990 8704 10452 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479832.1 protein_id gnl|my_center|LOCUS_00990 10478 12571 gene locus_tag LOCUS_01000 10478 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 13391 12543 gene locus_tag LOCUS_01010 13391 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01010 15407 13410 gene locus_tag LOCUS_01020 15407 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 15408 15566 gene locus_tag LOCUS_01030 15408 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 15670 16329 gene locus_tag LOCUS_01040 gene rpe 15670 16329 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence007 1035 364 gene locus_tag LOCUS_01050 1035 364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480061.1 protein_id gnl|my_center|LOCUS_01050 1394 1023 gene locus_tag LOCUS_01060 1394 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2742 1396 gene locus_tag LOCUS_01070 gene rimO 2742 1396 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889448.1 protein_id gnl|my_center|LOCUS_01070 3075 2743 gene locus_tag LOCUS_01080 3075 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3545 3072 gene locus_tag LOCUS_01090 3545 3072 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887664.1 protein_id gnl|my_center|LOCUS_01090 4609 3647 gene locus_tag LOCUS_01100 4609 3647 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_01100 6737 4749 gene locus_tag LOCUS_01110 6737 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8136 7078 gene locus_tag LOCUS_01120 8136 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8675 9289 gene locus_tag LOCUS_01130 8675 9289 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 protein_id gnl|my_center|LOCUS_01130 9286 10209 gene locus_tag LOCUS_01140 9286 10209 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_01140 14548 10679 gene locus_tag LOCUS_01150 14548 10679 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_01150 16515 14548 gene locus_tag LOCUS_01160 16515 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 >Feature sequence008 366 980 gene locus_tag LOCUS_01170 gene ldrP 366 980 CDS product transcriptional regulator LdrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229195.1 protein_id gnl|my_center|LOCUS_01170 977 1867 gene locus_tag LOCUS_01180 977 1867 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479830.1 protein_id gnl|my_center|LOCUS_01180 1951 2781 gene locus_tag LOCUS_01190 1951 2781 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_01190 3451 2696 gene locus_tag LOCUS_01200 gene surE 3451 2696 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_01200 4186 3488 gene locus_tag LOCUS_01210 4186 3488 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_01210 4995 4264 gene locus_tag LOCUS_01220 4995 4264 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720123.1 protein_id gnl|my_center|LOCUS_01220 5090 5350 gene locus_tag LOCUS_01230 5090 5350 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_01230 5430 7286 gene locus_tag LOCUS_01240 gene uvrC 5430 7286 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887995.1 protein_id gnl|my_center|LOCUS_01240 7437 8003 gene locus_tag LOCUS_01250 7437 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 8000 8782 gene locus_tag LOCUS_01260 8000 8782 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480253.1 protein_id gnl|my_center|LOCUS_01260 8748 9584 gene locus_tag LOCUS_01270 gene parB 8748 9584 CDS product ParB/RepB/Spo0J family partition protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886660.1 protein_id gnl|my_center|LOCUS_01270 10382 9735 gene locus_tag LOCUS_01280 10382 9735 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886771.1 protein_id gnl|my_center|LOCUS_01280 10448 13570 gene locus_tag LOCUS_01290 10448 13570 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082402.1 protein_id gnl|my_center|LOCUS_01290 14999 13527 gene locus_tag LOCUS_01300 gene gcvPB 14999 13527 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228003.1 protein_id gnl|my_center|LOCUS_01300 <15548 14992 gene locus_tag LOCUS_01310 <15548 14992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172605.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence009 1586 321 gene locus_tag LOCUS_01320 1586 321 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_01320 2689 1658 gene locus_tag LOCUS_01330 2689 1658 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707764.1 protein_id gnl|my_center|LOCUS_01330 5232 2995 gene locus_tag LOCUS_01340 5232 2995 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_01340 6823 5279 gene locus_tag LOCUS_01350 6823 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7269 6820 gene locus_tag LOCUS_01360 7269 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8434 7826 gene locus_tag LOCUS_01370 8434 7826 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888961.1 protein_id gnl|my_center|LOCUS_01370 8588 9769 gene locus_tag LOCUS_01380 8588 9769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_01380 9913 9922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10103 10936 gene locus_tag LOCUS_01390 gene aroB 10103 10936 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887423.1 protein_id gnl|my_center|LOCUS_01390 10982 11410 gene locus_tag LOCUS_01400 gene aroQ 10982 11410 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887424.1 protein_id gnl|my_center|LOCUS_01400 11520 11948 gene locus_tag LOCUS_01410 gene rplM 11520 11948 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886820.1 protein_id gnl|my_center|LOCUS_01410 11945 12334 gene locus_tag LOCUS_01420 gene rpsI 11945 12334 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886821.1 protein_id gnl|my_center|LOCUS_01420 13657 12395 gene locus_tag LOCUS_01430 13657 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence010 2751 571 gene locus_tag LOCUS_01440 2751 571 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479822.1 protein_id gnl|my_center|LOCUS_01440 2888 2897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2963 3331 gene locus_tag LOCUS_01450 2963 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3864 3343 gene locus_tag LOCUS_01460 3864 3343 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_01460 4565 3861 gene locus_tag LOCUS_01470 gene pgeF 4565 3861 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888599.1 protein_id gnl|my_center|LOCUS_01470 4612 5418 gene locus_tag LOCUS_01480 4612 5418 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_01480 5525 5785 gene locus_tag LOCUS_01490 5525 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 6585 5797 gene locus_tag LOCUS_01500 6585 5797 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918580.1 protein_id gnl|my_center|LOCUS_01500 6650 7807 gene locus_tag LOCUS_01510 gene kch 6650 7807 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931563.1 protein_id gnl|my_center|LOCUS_01510 8465 7914 gene locus_tag LOCUS_01520 8465 7914 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772562.1 protein_id gnl|my_center|LOCUS_01520 9654 8479 gene locus_tag LOCUS_01530 9654 8479 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_01530 9749 10885 gene locus_tag LOCUS_01540 9749 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10875 11978 gene locus_tag LOCUS_01550 10875 11978 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249072.1 protein_id gnl|my_center|LOCUS_01550 11978 12439 gene locus_tag LOCUS_01560 11978 12439 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532979.1 protein_id gnl|my_center|LOCUS_01560 12457 13773 gene locus_tag LOCUS_01570 12457 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 >Feature sequence011 193 789 gene locus_tag LOCUS_01580 193 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4663 863 gene locus_tag LOCUS_01590 gene dnaE 4663 863 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887152.1 protein_id gnl|my_center|LOCUS_01590 4885 7554 gene locus_tag LOCUS_01600 4885 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9443 7569 gene locus_tag LOCUS_01610 9443 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9490 9717 gene locus_tag LOCUS_01620 9490 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9730 9927 gene locus_tag LOCUS_01630 9730 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 9971 10957 gene locus_tag LOCUS_01640 9971 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11288 11722 gene locus_tag LOCUS_01650 gene mog 11288 11722 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_01650 13672 11984 gene locus_tag LOCUS_01660 13672 11984 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence012 1470 1264 gene locus_tag LOCUS_01670 1470 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1373 2509 gene locus_tag LOCUS_01680 1373 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3669 2605 gene locus_tag LOCUS_01690 gene gutB 3669 2605 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_01690 4415 3663 gene locus_tag LOCUS_01700 4415 3663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 protein_id gnl|my_center|LOCUS_01700 5387 4425 gene locus_tag LOCUS_01710 5387 4425 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_01710 5268 5618 gene locus_tag LOCUS_01720 5268 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5901 8744 gene locus_tag LOCUS_01730 5901 8744 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_01730 9373 8750 gene locus_tag LOCUS_01740 9373 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 10976 10257 gene locus_tag LOCUS_01750 10976 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 11240 11575 gene locus_tag LOCUS_01760 11240 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173720.1 protein_id gnl|my_center|LOCUS_01760 11717 13120 gene locus_tag LOCUS_01770 11717 13120 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889307.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence013 101 27 gene locus_tag LOCUS_t00010 101 27 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 230 2089 gene locus_tag LOCUS_01780 230 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2283 2077 gene locus_tag LOCUS_01790 2283 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 2676 2685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2712 3395 gene locus_tag LOCUS_01800 2712 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 4450 3674 gene locus_tag LOCUS_01810 4450 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4665 6086 gene locus_tag LOCUS_01820 4665 6086 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480316.1 protein_id gnl|my_center|LOCUS_01820 6123 6132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7520 6135 gene locus_tag LOCUS_01830 7520 6135 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888074.1 protein_id gnl|my_center|LOCUS_01830 8356 7517 gene locus_tag LOCUS_01840 gene rapZ 8356 7517 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888073.1 protein_id gnl|my_center|LOCUS_01840 8582 10066 gene locus_tag LOCUS_01850 8582 10066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_01850 10078 11091 gene locus_tag LOCUS_01860 10078 11091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_01860 11088 12011 gene locus_tag LOCUS_01870 11088 12011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082669.1 protein_id gnl|my_center|LOCUS_01870 12645 12181 gene locus_tag LOCUS_01880 12645 12181 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_01880 <13356 12683 gene locus_tag LOCUS_01890 <13356 12683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113751.1:arsenical efflux pump membrane protein ArsB >Feature sequence014 133 342 gene locus_tag LOCUS_01900 133 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 361 2436 gene locus_tag LOCUS_01910 361 2436 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888537.1 protein_id gnl|my_center|LOCUS_01910 2472 2951 gene locus_tag LOCUS_01920 2472 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2958 3953 gene locus_tag LOCUS_01930 2958 3953 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887482.1 protein_id gnl|my_center|LOCUS_01930 3970 5760 gene locus_tag LOCUS_01940 3970 5760 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349776.1 protein_id gnl|my_center|LOCUS_01940 8226 5770 gene locus_tag LOCUS_01950 8226 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6844 6853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9435 8266 gene locus_tag LOCUS_01960 gene kynU 9435 8266 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_01960 10028 9432 gene locus_tag LOCUS_01970 gene kynB 10028 9432 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_01970 10135 10398 gene locus_tag LOCUS_01980 10135 10398 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272681.1 protein_id gnl|my_center|LOCUS_01980 11693 10428 gene locus_tag LOCUS_01990 11693 10428 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143468.1 protein_id gnl|my_center|LOCUS_01990 <13321 12091 gene locus_tag LOCUS_02000 <13321 12091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887096.1:glutamine synthetase family protein >Feature sequence015 348 1439 gene locus_tag LOCUS_02010 348 1439 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967719.1 protein_id gnl|my_center|LOCUS_02010 1436 2809 gene locus_tag LOCUS_02020 1436 2809 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967718.1 protein_id gnl|my_center|LOCUS_02020 2836 4626 gene locus_tag LOCUS_02030 2836 4626 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173582854.1 protein_id gnl|my_center|LOCUS_02030 4717 7131 gene locus_tag LOCUS_02040 gene lon 4717 7131 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886994.1 protein_id gnl|my_center|LOCUS_02040 7163 8113 gene locus_tag LOCUS_02050 7163 8113 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 protein_id gnl|my_center|LOCUS_02050 9883 8129 gene locus_tag LOCUS_02060 gene dnaG 9883 8129 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887246.1 protein_id gnl|my_center|LOCUS_02060 10985 9942 gene locus_tag LOCUS_02070 10985 9942 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172495.1 protein_id gnl|my_center|LOCUS_02070 11966 10986 gene locus_tag LOCUS_02080 gene ruvB 11966 10986 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887241.1 protein_id gnl|my_center|LOCUS_02080 12547 11963 gene locus_tag LOCUS_02090 12547 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence016 1598 660 gene locus_tag LOCUS_02100 gene thrB 1598 660 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_02100 2635 1595 gene locus_tag LOCUS_02110 gene thrC 2635 1595 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729257.1 protein_id gnl|my_center|LOCUS_02110 3817 2858 gene locus_tag LOCUS_02120 3817 2858 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_02120 3816 4058 gene locus_tag LOCUS_02130 3816 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4934 4074 gene locus_tag LOCUS_02140 gene pstA 4934 4074 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_02140 5892 4918 gene locus_tag LOCUS_02150 gene pstC 5892 4918 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_02150 6991 5945 gene locus_tag LOCUS_02160 gene pstS 6991 5945 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_02160 7726 7100 gene locus_tag LOCUS_02170 gene sodA 7726 7100 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_02170 7797 8453 gene locus_tag LOCUS_02180 7797 8453 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888582.1 protein_id gnl|my_center|LOCUS_02180 8547 10493 gene locus_tag LOCUS_02190 8547 10493 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_02190 10980 10456 gene locus_tag LOCUS_02200 10980 10456 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349616.1 protein_id gnl|my_center|LOCUS_02200 11608 10985 gene locus_tag LOCUS_02210 11608 10985 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 protein_id gnl|my_center|LOCUS_02210 <12566 11619 gene locus_tag LOCUS_02220 <12566 11619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887641.1:Mrp/NBP35 family ATP-binding protein >Feature sequence017 61 1392 gene locus_tag LOCUS_02230 61 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 1416 2771 gene locus_tag LOCUS_02240 1416 2771 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169107222.1 protein_id gnl|my_center|LOCUS_02240 2778 3071 gene locus_tag LOCUS_02250 2778 3071 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 protein_id gnl|my_center|LOCUS_02250 3103 4800 gene locus_tag LOCUS_02260 3103 4800 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228019.1 protein_id gnl|my_center|LOCUS_02260 5738 4797 gene locus_tag LOCUS_02270 5738 4797 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351104.1 protein_id gnl|my_center|LOCUS_02270 6637 5711 gene locus_tag LOCUS_02280 gene hslO 6637 5711 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479663.1 protein_id gnl|my_center|LOCUS_02280 6910 9225 gene locus_tag LOCUS_02290 6910 9225 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480129.1 protein_id gnl|my_center|LOCUS_02290 9227 9778 gene locus_tag LOCUS_02300 9227 9778 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101932.1 protein_id gnl|my_center|LOCUS_02300 9771 10961 gene locus_tag LOCUS_02310 9771 10961 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889105.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence018 818 189 gene locus_tag LOCUS_02320 818 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 861 2381 gene locus_tag LOCUS_02330 861 2381 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889445.1 protein_id gnl|my_center|LOCUS_02330 3414 2386 gene locus_tag LOCUS_02340 3414 2386 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_02340 4455 3451 gene locus_tag LOCUS_02350 4455 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5153 4467 gene locus_tag LOCUS_02360 gene thyX 5153 4467 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_02360 5645 5166 gene locus_tag LOCUS_02370 5645 5166 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887211.1 protein_id gnl|my_center|LOCUS_02370 5716 6444 gene locus_tag LOCUS_02380 5716 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6696 7304 gene locus_tag LOCUS_02390 6696 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7347 7356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7434 7841 gene locus_tag LOCUS_02400 7434 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7838 8617 gene locus_tag LOCUS_02410 7838 8617 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_02410 8644 10143 gene locus_tag LOCUS_02420 8644 10143 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_02420 10808 10149 gene locus_tag LOCUS_02430 10808 10149 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888011.1 protein_id gnl|my_center|LOCUS_02430 10968 11462 gene locus_tag LOCUS_02440 10968 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 >Feature sequence019 1149 166 gene locus_tag LOCUS_02450 1149 166 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097548.1 protein_id gnl|my_center|LOCUS_02450 1805 1143 gene locus_tag LOCUS_02460 gene pxpB 1805 1143 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_02460 1995 2912 gene locus_tag LOCUS_02470 gene cysK 1995 2912 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887435.1 protein_id gnl|my_center|LOCUS_02470 2909 3586 gene locus_tag LOCUS_02480 2909 3586 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 protein_id gnl|my_center|LOCUS_02480 3643 4284 gene locus_tag LOCUS_02490 3643 4284 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403754.1 protein_id gnl|my_center|LOCUS_02490 5529 4270 gene locus_tag LOCUS_02500 5529 4270 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883969.1 protein_id gnl|my_center|LOCUS_02500 6469 5540 gene locus_tag LOCUS_02510 6469 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7263 6469 gene locus_tag LOCUS_02520 7263 6469 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_02520 7976 7260 gene locus_tag LOCUS_02530 7976 7260 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_02530 8751 8032 gene locus_tag LOCUS_02540 8751 8032 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480283.1 protein_id gnl|my_center|LOCUS_02540 8873 11035 gene locus_tag LOCUS_02550 8873 11035 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_02550 11261 11187 gene locus_tag LOCUS_t00020 11261 11187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11341 11267 gene locus_tag LOCUS_t00030 11341 11267 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 <12178 11504 gene locus_tag LOCUS_02560 <12178 11504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392514.1:MFS transporter >Feature sequence020 3331 1421 gene locus_tag LOCUS_02570 3331 1421 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173259.1 protein_id gnl|my_center|LOCUS_02570 3828 3328 gene locus_tag LOCUS_02580 3828 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4604 3828 gene locus_tag LOCUS_02590 gene mreC 4604 3828 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 protein_id gnl|my_center|LOCUS_02590 5212 4601 gene locus_tag LOCUS_02600 5212 4601 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142709.1 protein_id gnl|my_center|LOCUS_02600 5941 5213 gene locus_tag LOCUS_02610 gene deoC 5941 5213 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_02610 6249 6719 gene locus_tag LOCUS_02620 6249 6719 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887492.1 protein_id gnl|my_center|LOCUS_02620 7148 7975 gene locus_tag LOCUS_02630 7148 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 8037 8717 gene locus_tag LOCUS_02640 8037 8717 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_02640 8714 9829 gene locus_tag LOCUS_02650 8714 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 10280 10942 gene locus_tag LOCUS_02660 gene sdaAB 10280 10942 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479548.1 protein_id gnl|my_center|LOCUS_02660 11140 12015 gene locus_tag LOCUS_02670 gene sdaAA 11140 12015 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479580.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence021 1 129 gene locus_tag LOCUS_02680 1 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 508 1938 gene locus_tag LOCUS_02690 508 1938 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_02690 2450 2653 gene locus_tag LOCUS_02700 2450 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2653 2946 gene locus_tag LOCUS_02710 gene vapD 2653 2946 CDS product virulence-associated protein VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693712.1 protein_id gnl|my_center|LOCUS_02710 3038 3877 gene locus_tag LOCUS_02720 3038 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3906 4400 gene locus_tag LOCUS_02730 3906 4400 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_02730 4453 4707 gene locus_tag LOCUS_02740 4453 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5136 4786 gene locus_tag LOCUS_02750 5136 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6009 5395 gene locus_tag LOCUS_02760 6009 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7552 6038 gene locus_tag LOCUS_02770 7552 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 10341 7621 gene locus_tag LOCUS_02780 10341 7621 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926106.1 protein_id gnl|my_center|LOCUS_02780 11181 10585 gene locus_tag LOCUS_02790 11181 10585 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931294.1 protein_id gnl|my_center|LOCUS_02790 11197 11206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence022 61 1446 gene locus_tag LOCUS_02800 61 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1465 2490 gene locus_tag LOCUS_02810 1465 2490 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_02810 3485 2487 gene locus_tag LOCUS_02820 3485 2487 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 protein_id gnl|my_center|LOCUS_02820 3540 4451 gene locus_tag LOCUS_02830 3540 4451 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_02830 5823 4453 gene locus_tag LOCUS_02840 5823 4453 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889272.1 protein_id gnl|my_center|LOCUS_02840 5898 6335 gene locus_tag LOCUS_02850 5898 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6463 8406 gene locus_tag LOCUS_02860 6463 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8411 9697 gene locus_tag LOCUS_02870 8411 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9765 10625 gene locus_tag LOCUS_02880 gene iaaA 9765 10625 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence023 176 1777 gene locus_tag LOCUS_02890 176 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1777 3612 gene locus_tag LOCUS_02900 1777 3612 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_02900 3756 6302 gene locus_tag LOCUS_02910 3756 6302 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267734.1 protein_id gnl|my_center|LOCUS_02910 6455 7597 gene locus_tag LOCUS_02920 6455 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 8583 7660 gene locus_tag LOCUS_02930 8583 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 <11393 9139 gene locus_tag LOCUS_02940 <11393 9139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233100.1:helicase-exonuclease AddAB subunit AddA >Feature sequence024 288 1253 gene locus_tag LOCUS_02950 288 1253 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889475.1 protein_id gnl|my_center|LOCUS_02950 1250 2104 gene locus_tag LOCUS_02960 gene murQ 1250 2104 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_02960 2101 3033 gene locus_tag LOCUS_02970 2101 3033 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_02970 3033 3866 gene locus_tag LOCUS_02980 3033 3866 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_02980 3952 5247 gene locus_tag LOCUS_02990 3952 5247 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_02990 5244 6326 gene locus_tag LOCUS_03000 5244 6326 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_03000 6333 7202 gene locus_tag LOCUS_03010 6333 7202 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528576.1 protein_id gnl|my_center|LOCUS_03010 7474 7322 gene locus_tag LOCUS_03020 7474 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 7626 7489 gene locus_tag LOCUS_03030 7626 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 7601 9034 gene locus_tag LOCUS_03040 7601 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9330 10478 gene locus_tag LOCUS_03050 9330 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 >Feature sequence025 1137 952 gene locus_tag LOCUS_03060 1137 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1120 1800 gene locus_tag LOCUS_03070 1120 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03070 1822 2241 gene locus_tag LOCUS_03080 1822 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03080 3319 6321 gene locus_tag LOCUS_03090 3319 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6370 8628 gene locus_tag LOCUS_03100 6370 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 8537 9634 gene locus_tag LOCUS_03110 8537 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence026 <1 688 gene locus_tag LOCUS_03120 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869242.1:S41 family peptidase 1311 697 gene locus_tag LOCUS_03130 1311 697 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479800.1 protein_id gnl|my_center|LOCUS_03130 1937 1308 gene locus_tag LOCUS_03140 1937 1308 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479904.1 protein_id gnl|my_center|LOCUS_03140 2736 1963 gene locus_tag LOCUS_03150 2736 1963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_03150 3740 2793 gene locus_tag LOCUS_03160 3740 2793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247679.1 protein_id gnl|my_center|LOCUS_03160 5295 3766 gene locus_tag LOCUS_03170 5295 3766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_03170 4138 4147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5741 6898 gene locus_tag LOCUS_03180 5741 6898 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_03180 5776 5785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6917 8536 gene locus_tag LOCUS_03190 6917 8536 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_03190 8538 9485 gene locus_tag LOCUS_03200 8538 9485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_03200 9487 10362 gene locus_tag LOCUS_03210 gene appC 9487 10362 CDS product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 protein_id gnl|my_center|LOCUS_03210 10781 10371 gene locus_tag LOCUS_03220 10781 10371 CDS product phosphomannose isomerase type II C-terminal cupin domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017550.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence027 425 222 gene locus_tag LOCUS_03230 425 222 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 protein_id gnl|my_center|LOCUS_03230 650 2461 gene locus_tag LOCUS_03240 650 2461 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872038.1 protein_id gnl|my_center|LOCUS_03240 2433 3671 gene locus_tag LOCUS_03250 gene icd 2433 3671 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_03250 4777 3668 gene locus_tag LOCUS_03260 4777 3668 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926069.1 protein_id gnl|my_center|LOCUS_03260 5056 6570 gene locus_tag LOCUS_03270 gene purH 5056 6570 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443404.1 protein_id gnl|my_center|LOCUS_03270 6567 7430 gene locus_tag LOCUS_03280 6567 7430 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887513.1 protein_id gnl|my_center|LOCUS_03280 7420 7986 gene locus_tag LOCUS_03290 7420 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9008 7983 gene locus_tag LOCUS_03300 gene leuB 9008 7983 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888420.1 protein_id gnl|my_center|LOCUS_03300 9486 9001 gene locus_tag LOCUS_03310 9486 9001 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888419.1 protein_id gnl|my_center|LOCUS_03310 10738 9473 gene locus_tag LOCUS_03320 10738 9473 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888413.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence028 539 769 gene locus_tag LOCUS_03330 539 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 948 757 gene locus_tag LOCUS_03340 948 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479506.1 protein_id gnl|my_center|LOCUS_03340 1346 945 gene locus_tag LOCUS_03350 1346 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1426 1872 gene locus_tag LOCUS_03360 1426 1872 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_03360 1955 3406 gene locus_tag LOCUS_03370 gene gatB 1955 3406 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480100.1 protein_id gnl|my_center|LOCUS_03370 3424 4344 gene locus_tag LOCUS_03380 gene fba 3424 4344 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888228.1 protein_id gnl|my_center|LOCUS_03380 4341 4625 gene locus_tag LOCUS_03390 4341 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5731 4604 gene locus_tag LOCUS_03400 5731 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 6299 5718 gene locus_tag LOCUS_03410 6299 5718 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_03410 6349 6702 gene locus_tag LOCUS_03420 6349 6702 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926073.1 protein_id gnl|my_center|LOCUS_03420 7439 6699 gene locus_tag LOCUS_03430 7439 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7754 7455 gene locus_tag LOCUS_03440 7754 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8930 7887 gene locus_tag LOCUS_03450 gene hemW 8930 7887 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886778.1 protein_id gnl|my_center|LOCUS_03450 9511 8999 gene locus_tag LOCUS_03460 9511 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 9552 10304 gene locus_tag LOCUS_03470 9552 10304 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence029 4300 638 gene locus_tag LOCUS_03480 4300 638 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_03480 7173 4393 gene locus_tag LOCUS_03490 7173 4393 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_03490 <10528 7170 gene locus_tag LOCUS_03500 <10528 7170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883981.1:DEAD/DEAH box helicase >Feature sequence030 994 86 gene locus_tag LOCUS_03510 994 86 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_03510 1310 1675 gene locus_tag LOCUS_03520 1310 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3135 1960 gene locus_tag LOCUS_03530 3135 1960 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_03530 3802 3269 gene locus_tag LOCUS_03540 3802 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3943 4641 gene locus_tag LOCUS_03550 3943 4641 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889412.1 protein_id gnl|my_center|LOCUS_03550 4638 5840 gene locus_tag LOCUS_03560 4638 5840 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 protein_id gnl|my_center|LOCUS_03560 5940 7280 gene locus_tag LOCUS_03570 5940 7280 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_03570 7277 7960 gene locus_tag LOCUS_03580 7277 7960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140495.1 protein_id gnl|my_center|LOCUS_03580 7957 9189 gene locus_tag LOCUS_03590 7957 9189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_03590 10432 9338 gene locus_tag LOCUS_03600 gene ychF 10432 9338 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888025.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence031 <1 842 gene locus_tag LOCUS_03610 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350387.1:alpha-amylase family glycosyl hydrolase 1943 861 gene locus_tag LOCUS_03620 gene cobT 1943 861 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889499.1 protein_id gnl|my_center|LOCUS_03620 2455 1940 gene locus_tag LOCUS_03630 2455 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03630 3867 2449 gene locus_tag LOCUS_03640 3867 2449 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_03640 4837 3854 gene locus_tag LOCUS_03650 4837 3854 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883990.1 protein_id gnl|my_center|LOCUS_03650 5765 4830 gene locus_tag LOCUS_03660 gene cbiB 5765 4830 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351275.1 protein_id gnl|my_center|LOCUS_03660 6402 5755 gene locus_tag LOCUS_03670 gene bluB 6402 5755 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631426.1 protein_id gnl|my_center|LOCUS_03670 7028 6402 gene locus_tag LOCUS_03680 gene cobO 7028 6402 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081799310.1 protein_id gnl|my_center|LOCUS_03680 7618 7070 gene locus_tag LOCUS_03690 7618 7070 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 protein_id gnl|my_center|LOCUS_03690 8330 7608 gene locus_tag LOCUS_03700 8330 7608 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889498.1 protein_id gnl|my_center|LOCUS_03700 8377 9396 gene locus_tag LOCUS_03710 8377 9396 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349607.1 protein_id gnl|my_center|LOCUS_03710 10151 9393 gene locus_tag LOCUS_03720 10151 9393 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence032 1575 271 gene locus_tag LOCUS_03730 gene purB 1575 271 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888809.1 protein_id gnl|my_center|LOCUS_03730 2809 1598 gene locus_tag LOCUS_03740 2809 1598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_03740 5108 2871 gene locus_tag LOCUS_03750 5108 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6053 5109 gene locus_tag LOCUS_03760 6053 5109 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888315.1 protein_id gnl|my_center|LOCUS_03760 6541 6050 gene locus_tag LOCUS_03770 6541 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 7437 6718 gene locus_tag LOCUS_03780 gene ubiE 7437 6718 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_03780 7509 9998 gene locus_tag LOCUS_03790 gene polA 7509 9998 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228405.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence033 1142 417 gene locus_tag LOCUS_03800 1142 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1181 1828 gene locus_tag LOCUS_03810 gene cmk 1181 1828 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480105.1 protein_id gnl|my_center|LOCUS_03810 1807 2349 gene locus_tag LOCUS_03820 1807 2349 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871511.1 protein_id gnl|my_center|LOCUS_03820 2361 2951 gene locus_tag LOCUS_03830 2361 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2964 3434 gene locus_tag LOCUS_03840 2964 3434 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_03840 4746 3418 gene locus_tag LOCUS_03850 4746 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 5504 4836 gene locus_tag LOCUS_03860 5504 4836 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887427.1 protein_id gnl|my_center|LOCUS_03860 6661 5615 gene locus_tag LOCUS_03870 6661 5615 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889181.1 protein_id gnl|my_center|LOCUS_03870 6821 7831 gene locus_tag LOCUS_03880 6821 7831 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_03880 7841 8629 gene locus_tag LOCUS_03890 7841 8629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_03890 <10081 8631 gene locus_tag LOCUS_03900 <10081 8631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152423524.1:S8 family serine peptidase >Feature sequence034 1883 618 gene locus_tag LOCUS_03910 1883 618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_03910 2652 1912 gene locus_tag LOCUS_03920 2652 1912 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_03920 3703 2771 gene locus_tag LOCUS_03930 3703 2771 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 protein_id gnl|my_center|LOCUS_03930 3869 6415 gene locus_tag LOCUS_03940 3869 6415 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887024.1 protein_id gnl|my_center|LOCUS_03940 6440 7747 gene locus_tag LOCUS_03950 gene ffh 6440 7747 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888471.1 protein_id gnl|my_center|LOCUS_03950 7824 8876 gene locus_tag LOCUS_03960 7824 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 8922 9419 gene locus_tag LOCUS_03970 8922 9419 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence035 3 386 gene locus_tag LOCUS_03980 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 457 1545 gene locus_tag LOCUS_03990 457 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228882.1 protein_id gnl|my_center|LOCUS_03990 3111 1549 gene locus_tag LOCUS_04000 3111 1549 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887958.1 protein_id gnl|my_center|LOCUS_04000 3524 3141 gene locus_tag LOCUS_04010 3524 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4567 3521 gene locus_tag LOCUS_04020 gene fni 4567 3521 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870894.1 protein_id gnl|my_center|LOCUS_04020 5097 4564 gene locus_tag LOCUS_04030 5097 4564 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_04030 5447 5124 gene locus_tag LOCUS_04040 5447 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6204 5455 gene locus_tag LOCUS_04050 6204 5455 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351130.1 protein_id gnl|my_center|LOCUS_04050 7310 6201 gene locus_tag LOCUS_04060 gene menC 7310 6201 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480242.1 protein_id gnl|my_center|LOCUS_04060 7941 7333 gene locus_tag LOCUS_04070 7941 7333 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_04070 8058 8579 gene locus_tag LOCUS_04080 8058 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence036 1233 1997 gene locus_tag LOCUS_04090 1233 1997 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926063.1 protein_id gnl|my_center|LOCUS_04090 1997 4051 gene locus_tag LOCUS_04100 1997 4051 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886706.1 protein_id gnl|my_center|LOCUS_04100 4059 5066 gene locus_tag LOCUS_04110 4059 5066 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887472.1 protein_id gnl|my_center|LOCUS_04110 5468 5082 gene locus_tag LOCUS_04120 5468 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6677 5478 gene locus_tag LOCUS_04130 gene hemA 6677 5478 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480102.1 protein_id gnl|my_center|LOCUS_04130 7240 6674 gene locus_tag LOCUS_04140 7240 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7318 9501 gene locus_tag LOCUS_04150 7318 9501 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926052.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence037 682 939 gene locus_tag LOCUS_04160 682 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 986 1495 gene locus_tag LOCUS_04170 986 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3422 1725 gene locus_tag LOCUS_04180 3422 1725 CDS product copper amine oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177726.1 protein_id gnl|my_center|LOCUS_04180 3519 4484 gene locus_tag LOCUS_04190 gene argF 3519 4484 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177765.1 protein_id gnl|my_center|LOCUS_04190 4481 5470 gene locus_tag LOCUS_04200 gene argC 4481 5470 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173267.1 protein_id gnl|my_center|LOCUS_04200 5537 5896 gene locus_tag LOCUS_04210 5537 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 5880 5889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5932 6615 gene locus_tag LOCUS_04220 5932 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04220 7685 6618 gene locus_tag LOCUS_04230 7685 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8217 7777 gene locus_tag LOCUS_04240 8217 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9597 8293 gene locus_tag LOCUS_04250 gene groL 9597 8293 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887252.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence038 1595 90 gene locus_tag LOCUS_04260 gene zwf 1595 90 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888234.1 protein_id gnl|my_center|LOCUS_04260 2500 1592 gene locus_tag LOCUS_04270 gene gnd 2500 1592 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_04270 2597 4663 gene locus_tag LOCUS_04280 2597 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5119 4724 gene locus_tag LOCUS_04290 5119 4724 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172656.1 protein_id gnl|my_center|LOCUS_04290 5308 6243 gene locus_tag LOCUS_04300 gene miaA 5308 6243 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888325.1 protein_id gnl|my_center|LOCUS_04300 6359 7774 gene locus_tag LOCUS_04310 gene lnt 6359 7774 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119347.1 protein_id gnl|my_center|LOCUS_04310 7803 8225 gene locus_tag LOCUS_04320 gene smpB 7803 8225 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480230.1 protein_id gnl|my_center|LOCUS_04320 8233 9480 gene locus_tag LOCUS_04330 8233 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence039 841 1611 gene locus_tag LOCUS_04340 841 1611 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887106.1 protein_id gnl|my_center|LOCUS_04340 1676 2785 gene locus_tag LOCUS_04350 gene dnaJ 1676 2785 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927968.1 protein_id gnl|my_center|LOCUS_04350 2970 3842 gene locus_tag LOCUS_04360 2970 3842 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767767.1 protein_id gnl|my_center|LOCUS_04360 5051 3849 gene locus_tag LOCUS_04370 5051 3849 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_04370 5778 5248 gene locus_tag LOCUS_04380 5778 5248 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479526.1 protein_id gnl|my_center|LOCUS_04380 6350 5814 gene locus_tag LOCUS_04390 6350 5814 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_04390 6551 7276 gene locus_tag LOCUS_04400 6551 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9000 7345 gene locus_tag LOCUS_04410 9000 7345 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887436.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence040 1013 177 gene locus_tag LOCUS_04420 1013 177 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_04420 2167 1010 gene locus_tag LOCUS_04430 2167 1010 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229571.1 protein_id gnl|my_center|LOCUS_04430 2491 2285 gene locus_tag LOCUS_04440 2491 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2400 3728 gene locus_tag LOCUS_04450 2400 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 4480 3803 gene locus_tag LOCUS_04460 4480 3803 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 protein_id gnl|my_center|LOCUS_04460 6942 4477 gene locus_tag LOCUS_04470 6942 4477 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_04470 7053 8051 gene locus_tag LOCUS_04480 7053 8051 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_04480 8087 9046 gene locus_tag LOCUS_04490 8087 9046 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582676.1 protein_id gnl|my_center|LOCUS_04490 9054 9221 gene locus_tag LOCUS_04500 9054 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence041 614 159 gene locus_tag LOCUS_04510 gene rplO 614 159 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888746.1 protein_id gnl|my_center|LOCUS_04510 778 611 gene locus_tag LOCUS_04520 gene rpmD 778 611 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888745.1 protein_id gnl|my_center|LOCUS_04520 1278 775 gene locus_tag LOCUS_04530 gene rpsE 1278 775 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350334.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04530 1600 1262 gene locus_tag LOCUS_04540 gene rplR 1600 1262 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633391.1 protein_id gnl|my_center|LOCUS_04540 2163 1597 gene locus_tag LOCUS_04550 gene rplF 2163 1597 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888742.1 protein_id gnl|my_center|LOCUS_04550 2571 2176 gene locus_tag LOCUS_04560 gene rpsH 2571 2176 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888741.1 protein_id gnl|my_center|LOCUS_04560 2867 2682 gene locus_tag LOCUS_04570 2867 2682 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638073.1 protein_id gnl|my_center|LOCUS_04570 3420 2881 gene locus_tag LOCUS_04580 gene rplE 3420 2881 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886968.1 protein_id gnl|my_center|LOCUS_04580 3767 3429 gene locus_tag LOCUS_04590 gene rplX 3767 3429 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871863.1 protein_id gnl|my_center|LOCUS_04590 4165 3767 gene locus_tag LOCUS_04600 gene rplN 4165 3767 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886966.1 protein_id gnl|my_center|LOCUS_04600 4422 4168 gene locus_tag LOCUS_04610 gene rpsQ 4422 4168 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886965.1 protein_id gnl|my_center|LOCUS_04610 4625 4425 gene locus_tag LOCUS_04620 gene rpmC 4625 4425 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886964.1 protein_id gnl|my_center|LOCUS_04620 5037 4612 gene locus_tag LOCUS_04630 gene rplP 5037 4612 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567820.1 protein_id gnl|my_center|LOCUS_04630 5779 5024 gene locus_tag LOCUS_04640 gene rpsC 5779 5024 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886962.1 protein_id gnl|my_center|LOCUS_04640 6140 5769 gene locus_tag LOCUS_04650 gene rplV 6140 5769 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886961.1 protein_id gnl|my_center|LOCUS_04650 6427 6140 gene locus_tag LOCUS_04660 gene rpsS 6427 6140 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886960.1 protein_id gnl|my_center|LOCUS_04660 7281 6451 gene locus_tag LOCUS_04670 gene rplB 7281 6451 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_04670 7581 7294 gene locus_tag LOCUS_04680 7581 7294 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633421.1 protein_id gnl|my_center|LOCUS_04680 8204 7578 gene locus_tag LOCUS_04690 gene rplD 8204 7578 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886957.1 protein_id gnl|my_center|LOCUS_04690 8824 8204 gene locus_tag LOCUS_04700 gene rplC 8824 8204 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_04700 9141 8821 gene locus_tag LOCUS_04710 gene rpsJ 9141 8821 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886955.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence042 1047 103 gene locus_tag LOCUS_04720 1047 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1934 1044 gene locus_tag LOCUS_04730 1934 1044 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_04730 2110 1934 gene locus_tag LOCUS_04740 2110 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2171 2518 gene locus_tag LOCUS_04750 2171 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2574 2648 gene locus_tag LOCUS_t00040 2574 2648 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2676 3434 gene locus_tag LOCUS_04760 2676 3434 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887541.1 protein_id gnl|my_center|LOCUS_04760 3928 5115 gene locus_tag LOCUS_04770 3928 5115 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479853.1 protein_id gnl|my_center|LOCUS_04770 7008 5107 gene locus_tag LOCUS_04780 7008 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 7673 7044 gene locus_tag LOCUS_04790 7673 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632535.1 protein_id gnl|my_center|LOCUS_04790 <9278 7759 gene locus_tag LOCUS_04800 <9278 7759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000238573.1:aconitate hydratase AcnA >Feature sequence043 896 288 gene locus_tag LOCUS_04810 896 288 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887473.1 protein_id gnl|my_center|LOCUS_04810 1056 980 gene locus_tag LOCUS_t00050 1056 980 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2568 1093 gene locus_tag LOCUS_04820 2568 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3017 2700 gene locus_tag LOCUS_04830 3017 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2925 3122 gene locus_tag LOCUS_04840 2925 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2997 3006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3606 4232 gene locus_tag LOCUS_04850 gene clpP 3606 4232 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888605.1 protein_id gnl|my_center|LOCUS_04850 4216 5415 gene locus_tag LOCUS_04860 gene clpX 4216 5415 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888606.1 protein_id gnl|my_center|LOCUS_04860 5577 8000 gene locus_tag LOCUS_04870 gene lon 5577 8000 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888607.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence044 <1 585 gene locus_tag LOCUS_04880 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034351206.1:circularly permuted type 2 ATP-grasp protein 586 1497 gene locus_tag LOCUS_04890 586 1497 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_04890 1494 2327 gene locus_tag LOCUS_04900 1494 2327 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_04900 3478 5646 gene locus_tag LOCUS_04910 3478 5646 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_04910 5907 7526 gene locus_tag LOCUS_04920 gene casA 5907 7526 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_04920 7523 8131 gene locus_tag LOCUS_04930 gene casB 7523 8131 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence045 303 61 gene locus_tag LOCUS_04940 303 61 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479840.1 protein_id gnl|my_center|LOCUS_04940 692 303 gene locus_tag LOCUS_04950 692 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 747 1553 gene locus_tag LOCUS_04960 gene pstB 747 1553 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_04960 1553 2203 gene locus_tag LOCUS_04970 gene phoU 1553 2203 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174206.1 protein_id gnl|my_center|LOCUS_04970 2235 2828 gene locus_tag LOCUS_04980 gene hisB 2235 2828 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479567.1 protein_id gnl|my_center|LOCUS_04980 2825 3451 gene locus_tag LOCUS_04990 gene hisH 2825 3451 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_04990 3473 5656 gene locus_tag LOCUS_05000 gene glgB 3473 5656 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337498.1 protein_id gnl|my_center|LOCUS_05000 5659 5898 gene locus_tag LOCUS_05010 5659 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 5928 6956 gene locus_tag LOCUS_05020 5928 6956 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_05020 7203 6940 gene locus_tag LOCUS_05030 7203 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence046 494 1087 gene locus_tag LOCUS_05040 494 1087 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887826.1 protein_id gnl|my_center|LOCUS_05040 1087 1572 gene locus_tag LOCUS_05050 1087 1572 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_05050 1553 4075 gene locus_tag LOCUS_05060 1553 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4265 4023 gene locus_tag LOCUS_05070 4265 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4498 6714 gene locus_tag LOCUS_05080 4498 6714 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887760.1 protein_id gnl|my_center|LOCUS_05080 6715 8019 gene locus_tag LOCUS_05090 gene radA 6715 8019 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479626.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence047 2400 247 gene locus_tag LOCUS_05100 2400 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2706 3650 gene locus_tag LOCUS_05110 2706 3650 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_05110 3647 4096 gene locus_tag LOCUS_05120 3647 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4761 4318 gene locus_tag LOCUS_05130 4761 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4901 5854 gene locus_tag LOCUS_05140 4901 5854 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_05140 5851 7941 gene locus_tag LOCUS_05150 5851 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 8382 8687 gene locus_tag LOCUS_05160 8382 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05160 8707 8716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence048 1229 384 gene locus_tag LOCUS_05170 gene accD 1229 384 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_05170 1324 2202 gene locus_tag LOCUS_05180 gene era 1324 2202 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887291.1 protein_id gnl|my_center|LOCUS_05180 2204 3511 gene locus_tag LOCUS_05190 2204 3511 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_05190 4533 3499 gene locus_tag LOCUS_05200 4533 3499 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_05200 5132 4530 gene locus_tag LOCUS_05210 gene pth 5132 4530 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888998.1 protein_id gnl|my_center|LOCUS_05210 5572 5129 gene locus_tag LOCUS_05220 5572 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 7843 5627 gene locus_tag LOCUS_05230 7843 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7922 8389 gene locus_tag LOCUS_05240 7922 8389 CDS product DUF1999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887837.1 protein_id gnl|my_center|LOCUS_05240 8413 8622 gene locus_tag LOCUS_05250 8413 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888118.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence049 <1 549 gene locus_tag LOCUS_05260 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888149.1:ribosome recycling factor 576 1415 gene locus_tag LOCUS_05270 576 1415 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_05270 1443 2567 gene locus_tag LOCUS_05280 gene dxr 1443 2567 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888147.1 protein_id gnl|my_center|LOCUS_05280 2564 3643 gene locus_tag LOCUS_05290 2564 3643 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228247.1 protein_id gnl|my_center|LOCUS_05290 3704 4348 gene locus_tag LOCUS_05300 3704 4348 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887723.1 protein_id gnl|my_center|LOCUS_05300 4415 5581 gene locus_tag LOCUS_05310 4415 5581 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_05310 5578 6426 gene locus_tag LOCUS_05320 5578 6426 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_05320 <8725 6428 gene locus_tag LOCUS_05330 <8725 6428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887045.1:DNA translocase FtsK note possible pseudo, internal stop codon >Feature sequence050 565 990 gene locus_tag LOCUS_05340 565 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1033 1302 gene locus_tag LOCUS_05350 1033 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 1522 2775 gene locus_tag LOCUS_05360 1522 2775 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268537.1 protein_id gnl|my_center|LOCUS_05360 2856 3305 gene locus_tag LOCUS_05370 2856 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6018 3364 gene locus_tag LOCUS_05380 gene alaS 6018 3364 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888928.1 protein_id gnl|my_center|LOCUS_05380 6683 6036 gene locus_tag LOCUS_05390 6683 6036 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_05390 6739 7218 gene locus_tag LOCUS_05400 6739 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479844.1 protein_id gnl|my_center|LOCUS_05400 8119 7238 gene locus_tag LOCUS_05410 8119 7238 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582695.1 protein_id gnl|my_center|LOCUS_05410 8705 8166 gene locus_tag LOCUS_05420 8705 8166 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350371.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence051 2341 827 gene locus_tag LOCUS_05430 2341 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3449 2376 gene locus_tag LOCUS_05440 gene rlmN 3449 2376 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229030.1 protein_id gnl|my_center|LOCUS_05440 5731 3446 gene locus_tag LOCUS_05450 5731 3446 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479827.1 protein_id gnl|my_center|LOCUS_05450 6452 5871 gene locus_tag LOCUS_05460 6452 5871 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_05460 7391 6486 gene locus_tag LOCUS_05470 7391 6486 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_05470 7539 8135 gene locus_tag LOCUS_05480 7539 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 <8675 8153 gene locus_tag LOCUS_05490 <8675 8153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889326.1:CoA transferase subunit B >Feature sequence052 1 315 gene locus_tag LOCUS_05500 1 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 320 1021 gene locus_tag LOCUS_05510 320 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028978.1 protein_id gnl|my_center|LOCUS_05510 1083 1634 gene locus_tag LOCUS_05520 1083 1634 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_05520 1708 2460 gene locus_tag LOCUS_05530 1708 2460 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_05530 2598 3554 gene locus_tag LOCUS_05540 2598 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3608 3826 gene locus_tag LOCUS_05550 3608 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3834 4880 gene locus_tag LOCUS_05560 3834 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6848 4980 gene locus_tag LOCUS_05570 6848 4980 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_05570 7991 7374 gene locus_tag LOCUS_05580 7991 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8539 7991 gene locus_tag LOCUS_05590 8539 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence053 <1 662 gene locus_tag LOCUS_05600 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393545.1:phosphoribosylformylglycinamidine synthase subunit PurQ 659 2857 gene locus_tag LOCUS_05610 gene purL 659 2857 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886868.1 protein_id gnl|my_center|LOCUS_05610 2854 4356 gene locus_tag LOCUS_05620 gene purF 2854 4356 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906019.1 protein_id gnl|my_center|LOCUS_05620 5128 4358 gene locus_tag LOCUS_05630 5128 4358 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228649.1 protein_id gnl|my_center|LOCUS_05630 6531 5080 gene locus_tag LOCUS_05640 6531 5080 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869246.1 protein_id gnl|my_center|LOCUS_05640 7361 6531 gene locus_tag LOCUS_05650 7361 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 7690 7382 gene locus_tag LOCUS_05660 7690 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480244.1 protein_id gnl|my_center|LOCUS_05660 <8539 7687 gene locus_tag LOCUS_05670 <8539 7687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479957.1:polyribonucleotide nucleotidyltransferase note possible pseudo, frameshifted >Feature sequence054 <1 603 gene locus_tag LOCUS_05680 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027999.1:glycoside hydrolase family 15 protein 1940 594 gene locus_tag LOCUS_05690 gene hisD 1940 594 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_05690 2518 1937 gene locus_tag LOCUS_05700 2518 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228144.1 protein_id gnl|my_center|LOCUS_05700 2913 2515 gene locus_tag LOCUS_05710 2913 2515 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_05710 4049 2913 gene locus_tag LOCUS_05720 4049 2913 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479937.1 protein_id gnl|my_center|LOCUS_05720 4114 4881 gene locus_tag LOCUS_05730 gene lptB 4114 4881 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888765.1 protein_id gnl|my_center|LOCUS_05730 4882 6393 gene locus_tag LOCUS_05740 4882 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6940 6413 gene locus_tag LOCUS_05750 6940 6413 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_05750 7287 6973 gene locus_tag LOCUS_05760 7287 6973 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888258.1 protein_id gnl|my_center|LOCUS_05760 8242 7268 gene locus_tag LOCUS_05770 gene meaB 8242 7268 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence055 337 1011 gene locus_tag LOCUS_05780 337 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1570 1055 gene locus_tag LOCUS_05790 1570 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2835 1567 gene locus_tag LOCUS_05800 2835 1567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228791.1 protein_id gnl|my_center|LOCUS_05800 3497 2832 gene locus_tag LOCUS_05810 3497 2832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228792.1 protein_id gnl|my_center|LOCUS_05810 4484 3543 gene locus_tag LOCUS_05820 4484 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4734 6353 gene locus_tag LOCUS_05830 4734 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence056 3101 171 gene locus_tag LOCUS_05840 gene uvrA 3101 171 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888406.1 protein_id gnl|my_center|LOCUS_05840 4332 3181 gene locus_tag LOCUS_05850 4332 3181 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887506.1 protein_id gnl|my_center|LOCUS_05850 5090 4329 gene locus_tag LOCUS_05860 5090 4329 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_05860 6119 5112 gene locus_tag LOCUS_05870 6119 5112 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_05870 7109 6129 gene locus_tag LOCUS_05880 7109 6129 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_05880 <8304 7156 gene locus_tag LOCUS_05890 <8304 7156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338264.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence057 27 1034 gene locus_tag LOCUS_05900 27 1034 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480328.1 protein_id gnl|my_center|LOCUS_05900 1173 1457 gene locus_tag LOCUS_05910 1173 1457 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338575.1 protein_id gnl|my_center|LOCUS_05910 1454 2251 gene locus_tag LOCUS_05920 1454 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2354 3811 gene locus_tag LOCUS_05930 2354 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3901 5028 gene locus_tag LOCUS_05940 gene xylA 3901 5028 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_05940 5028 5945 gene locus_tag LOCUS_05950 5028 5945 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_05950 5942 7159 gene locus_tag LOCUS_05960 5942 7159 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence058 655 404 gene locus_tag LOCUS_05970 gene yidD 655 404 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172533.1 protein_id gnl|my_center|LOCUS_05970 1160 1026 gene locus_tag LOCUS_05980 gene rpmH 1160 1026 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_05980 1865 1209 gene locus_tag LOCUS_05990 gene gmk 1865 1209 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_05990 3816 1843 gene locus_tag LOCUS_06000 gene tkt 3816 1843 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888884.1 protein_id gnl|my_center|LOCUS_06000 3897 4601 gene locus_tag LOCUS_06010 3897 4601 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_06010 5201 4608 gene locus_tag LOCUS_06020 gene ruvA 5201 4608 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887917.1 protein_id gnl|my_center|LOCUS_06020 5243 5803 gene locus_tag LOCUS_06030 gene lepB 5243 5803 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887963.1 protein_id gnl|my_center|LOCUS_06030 5872 7518 gene locus_tag LOCUS_06040 gene rny 5872 7518 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889087.1 protein_id gnl|my_center|LOCUS_06040 5921 5930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence059 <1 856 gene locus_tag LOCUS_06050 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886794.1:valine--tRNA ligase 849 1847 gene locus_tag LOCUS_06060 849 1847 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869626.1 protein_id gnl|my_center|LOCUS_06060 1774 2127 gene locus_tag LOCUS_06070 1774 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2127 3839 gene locus_tag LOCUS_06080 gene kdpA 2127 3839 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_06080 3849 5870 gene locus_tag LOCUS_06090 gene kdpB 3849 5870 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388911.1 protein_id gnl|my_center|LOCUS_06090 5845 5854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5919 6500 gene locus_tag LOCUS_06100 gene kdpC 5919 6500 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930951.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence060 3164 1005 gene locus_tag LOCUS_06110 3164 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3455 3727 gene locus_tag LOCUS_06120 3455 3727 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630673.1 protein_id gnl|my_center|LOCUS_06120 3724 4959 gene locus_tag LOCUS_06130 3724 4959 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479925.1 protein_id gnl|my_center|LOCUS_06130 4981 6972 gene locus_tag LOCUS_06140 gene ligA 4981 6972 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871048.1 protein_id gnl|my_center|LOCUS_06140 7025 7477 gene locus_tag LOCUS_06150 7025 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7474 7920 gene locus_tag LOCUS_06160 7474 7920 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888697.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence061 976 1632 gene locus_tag LOCUS_06170 gene fsa 976 1632 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887978.1 protein_id gnl|my_center|LOCUS_06170 1629 2915 gene locus_tag LOCUS_06180 gene rho 1629 2915 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869108.1 protein_id gnl|my_center|LOCUS_06180 2936 3820 gene locus_tag LOCUS_06190 gene pdxS 2936 3820 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480030.1 protein_id gnl|my_center|LOCUS_06190 3801 4394 gene locus_tag LOCUS_06200 gene pdxT 3801 4394 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888007.1 protein_id gnl|my_center|LOCUS_06200 4468 5463 gene locus_tag LOCUS_06210 gene asd 4468 5463 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_06210 5548 5557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5569 6972 gene locus_tag LOCUS_06220 5569 6972 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888006.1 protein_id gnl|my_center|LOCUS_06220 7595 6897 gene locus_tag LOCUS_06230 7595 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence062 1781 3673 gene locus_tag LOCUS_06240 gene ftsH 1781 3673 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887228.1 protein_id gnl|my_center|LOCUS_06240 3674 4270 gene locus_tag LOCUS_06250 3674 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4367 5599 gene locus_tag LOCUS_06260 4367 5599 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228902.1 protein_id gnl|my_center|LOCUS_06260 5810 7468 gene locus_tag LOCUS_06270 gene ilvB 5810 7468 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177759.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence063 2106 1021 gene locus_tag LOCUS_06280 2106 1021 CDS product BioF/Kbl family PLP-dependent acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618850.1 protein_id gnl|my_center|LOCUS_06280 2223 2232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2402 3070 gene locus_tag LOCUS_06290 2402 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3070 4815 gene locus_tag LOCUS_06300 3070 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018111959.1 protein_id gnl|my_center|LOCUS_06300 4860 7403 gene locus_tag LOCUS_06310 4860 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7400 7852 gene locus_tag LOCUS_06320 7400 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence064 2356 2928 gene locus_tag LOCUS_06330 2356 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3364 3098 gene locus_tag LOCUS_06340 3364 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06340 4963 3446 gene locus_tag LOCUS_06350 gene dxs 4963 3446 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888114.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06350 5732 4992 gene locus_tag LOCUS_06360 5732 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227635.1 protein_id gnl|my_center|LOCUS_06360 6416 5751 gene locus_tag LOCUS_06370 6416 5751 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888112.1 protein_id gnl|my_center|LOCUS_06370 7544 6483 gene locus_tag LOCUS_06380 7544 6483 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence065 2871 1663 gene locus_tag LOCUS_06390 2871 1663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_06390 3847 2954 gene locus_tag LOCUS_06400 3847 2954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887299.1 protein_id gnl|my_center|LOCUS_06400 4024 5661 gene locus_tag LOCUS_06410 4024 5661 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479602.1 protein_id gnl|my_center|LOCUS_06410 5774 6886 gene locus_tag LOCUS_06420 gene ald 5774 6886 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479806.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence066 970 338 gene locus_tag LOCUS_06430 970 338 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888617.1 protein_id gnl|my_center|LOCUS_06430 1794 979 gene locus_tag LOCUS_06440 gene rsmA 1794 979 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618805.1 protein_id gnl|my_center|LOCUS_06440 2320 1814 gene locus_tag LOCUS_06450 2320 1814 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_06450 3712 2411 gene locus_tag LOCUS_06460 3712 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3790 5523 gene locus_tag LOCUS_06470 3790 5523 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886995.1 protein_id gnl|my_center|LOCUS_06470 5504 6652 gene locus_tag LOCUS_06480 5504 6652 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480170.1 protein_id gnl|my_center|LOCUS_06480 7507 6782 gene locus_tag LOCUS_06490 7507 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence067 1481 558 gene locus_tag LOCUS_06500 1481 558 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 protein_id gnl|my_center|LOCUS_06500 1538 2770 gene locus_tag LOCUS_06510 1538 2770 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 protein_id gnl|my_center|LOCUS_06510 2784 3746 gene locus_tag LOCUS_06520 2784 3746 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888504.1 protein_id gnl|my_center|LOCUS_06520 4125 3955 gene locus_tag LOCUS_06530 4125 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5068 4568 gene locus_tag LOCUS_06540 5068 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 6503 5034 gene locus_tag LOCUS_06550 gene csm6 6503 5034 CDS product type III-A CRISPR-associated protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229148.1 protein_id gnl|my_center|LOCUS_06550 6598 7827 gene locus_tag LOCUS_06560 6598 7827 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479813.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence068 <1 967 gene locus_tag LOCUS_06570 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479818.1:beta-ketoacyl-ACP synthase II 1095 1862 gene locus_tag LOCUS_06580 gene sufC 1095 1862 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_06580 1876 3276 gene locus_tag LOCUS_06590 gene sufB 1876 3276 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_06590 3276 4610 gene locus_tag LOCUS_06600 gene sufD 3276 4610 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888732.1 protein_id gnl|my_center|LOCUS_06600 4607 4921 gene locus_tag LOCUS_06610 4607 4921 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888583.1 protein_id gnl|my_center|LOCUS_06610 5294 5722 gene locus_tag LOCUS_06620 5294 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06620 6056 6652 gene locus_tag LOCUS_06630 6056 6652 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975929.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence069 <1 916 gene locus_tag LOCUS_06640 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479528.1:glutamate-1-semialdehyde 2,1-aminomutase 982 1359 gene locus_tag LOCUS_06650 982 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1394 1873 gene locus_tag LOCUS_06660 1394 1873 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888603.1 protein_id gnl|my_center|LOCUS_06660 1908 2192 gene locus_tag LOCUS_06670 1908 2192 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_06670 2204 3496 gene locus_tag LOCUS_06680 2204 3496 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887834.1 protein_id gnl|my_center|LOCUS_06680 3524 4969 gene locus_tag LOCUS_06690 3524 4969 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_06690 6900 4972 gene locus_tag LOCUS_06700 gene metG 6900 4972 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228577.1 protein_id gnl|my_center|LOCUS_06700 <7792 6908 gene locus_tag LOCUS_06710 <7792 6908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479947.1:S49 family peptidase >Feature sequence070 <1 1583 gene locus_tag LOCUS_06720 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080133.1:beta-galactosidase 1604 2635 gene locus_tag LOCUS_06730 gene galT 1604 2635 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_06730 3240 2683 gene locus_tag LOCUS_06740 3240 2683 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_06740 5305 3263 gene locus_tag LOCUS_06750 gene acs 5305 3263 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_06750 5910 5719 gene locus_tag LOCUS_06760 5910 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 6442 5942 gene locus_tag LOCUS_06770 6442 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 >Feature sequence071 499 1374 gene locus_tag LOCUS_06780 499 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1347 2621 gene locus_tag LOCUS_06790 1347 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2635 4719 gene locus_tag LOCUS_06800 gene ppk1 2635 4719 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479817.1 protein_id gnl|my_center|LOCUS_06800 5447 4722 gene locus_tag LOCUS_06810 5447 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888861.1 protein_id gnl|my_center|LOCUS_06810 5490 5819 gene locus_tag LOCUS_06820 5490 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5915 6289 gene locus_tag LOCUS_06830 5915 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632112.1 protein_id gnl|my_center|LOCUS_06830 6273 6899 gene locus_tag LOCUS_06840 6273 6899 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888386.1 protein_id gnl|my_center|LOCUS_06840 6904 7368 gene locus_tag LOCUS_06850 gene dtd 6904 7368 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887535.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence072 <1 1000 gene locus_tag LOCUS_06860 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886739.1:carotenoid 1,2-hydratase CruF 967 1617 gene locus_tag LOCUS_06870 967 1617 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886738.1 protein_id gnl|my_center|LOCUS_06870 1614 2705 gene locus_tag LOCUS_06880 1614 2705 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_06880 2717 4048 gene locus_tag LOCUS_06890 2717 4048 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871916.1 protein_id gnl|my_center|LOCUS_06890 4045 5193 gene locus_tag LOCUS_06900 4045 5193 CDS product beta-carotene 2-hydroxylase CYP287A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889098.1 protein_id gnl|my_center|LOCUS_06900 5166 6131 gene locus_tag LOCUS_06910 5166 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6998 6282 gene locus_tag LOCUS_06920 6998 6282 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_06920 7058 7375 gene locus_tag LOCUS_06930 7058 7375 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence073 2256 1147 gene locus_tag LOCUS_06940 gene dnaN 2256 1147 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480259.1 protein_id gnl|my_center|LOCUS_06940 3890 2568 gene locus_tag LOCUS_06950 gene dnaA 3890 2568 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480258.1 protein_id gnl|my_center|LOCUS_06950 5273 4083 gene locus_tag LOCUS_06960 5273 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6216 5344 gene locus_tag LOCUS_06970 6216 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_06970 6756 6292 gene locus_tag LOCUS_06980 6756 6292 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349510.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence074 2121 1213 gene locus_tag LOCUS_06990 2121 1213 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177599.1 protein_id gnl|my_center|LOCUS_06990 2821 2150 gene locus_tag LOCUS_07000 2821 2150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889187.1 protein_id gnl|my_center|LOCUS_07000 2967 3296 gene locus_tag LOCUS_07010 2967 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3286 3675 gene locus_tag LOCUS_07020 3286 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3814 5475 gene locus_tag LOCUS_07030 3814 5475 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479878.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence075 259 954 gene locus_tag LOCUS_07040 259 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1270 998 gene locus_tag LOCUS_07050 gene pprM 1270 998 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_07050 1470 2276 gene locus_tag LOCUS_07060 1470 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3235 2249 gene locus_tag LOCUS_07070 gene ispH 3235 2249 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888795.1 protein_id gnl|my_center|LOCUS_07070 3330 4493 gene locus_tag LOCUS_07080 3330 4493 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_07080 4499 5641 gene locus_tag LOCUS_07090 4499 5641 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_07090 5651 6403 gene locus_tag LOCUS_07100 5651 6403 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887616.1 protein_id gnl|my_center|LOCUS_07100 6400 7353 gene locus_tag LOCUS_07110 6400 7353 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence076 1327 1818 gene locus_tag LOCUS_07120 1327 1818 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887852.1 protein_id gnl|my_center|LOCUS_07120 2212 1769 gene locus_tag LOCUS_07130 2212 1769 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_07130 3417 2224 gene locus_tag LOCUS_07140 3417 2224 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_07140 3736 6036 gene locus_tag LOCUS_07150 3736 6036 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567519.1 protein_id gnl|my_center|LOCUS_07150 6029 6718 gene locus_tag LOCUS_07160 6029 6718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_07160 7160 6735 gene locus_tag LOCUS_07170 7160 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 7222 7371 gene locus_tag LOCUS_07180 7222 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence077 238 1020 gene locus_tag LOCUS_07190 238 1020 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887924.1 protein_id gnl|my_center|LOCUS_07190 1004 3472 gene locus_tag LOCUS_07200 1004 3472 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887926.1 protein_id gnl|my_center|LOCUS_07200 4728 4120 gene locus_tag LOCUS_07210 gene rdgB 4728 4120 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886825.1 protein_id gnl|my_center|LOCUS_07210 7075 5216 gene locus_tag LOCUS_07220 7075 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7063 7072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 397 1758 gene locus_tag LOCUS_07230 397 1758 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889289.1 protein_id gnl|my_center|LOCUS_07230 2174 1851 gene locus_tag LOCUS_07240 2174 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2635 2171 gene locus_tag LOCUS_07250 gene ybeY 2635 2171 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479950.1 protein_id gnl|my_center|LOCUS_07250 3552 2632 gene locus_tag LOCUS_07260 3552 2632 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871086.1 protein_id gnl|my_center|LOCUS_07260 4486 3668 gene locus_tag LOCUS_07270 4486 3668 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889229.1 protein_id gnl|my_center|LOCUS_07270 5121 4483 gene locus_tag LOCUS_07280 gene ispD 5121 4483 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889228.1 protein_id gnl|my_center|LOCUS_07280 5233 5742 gene locus_tag LOCUS_07290 5233 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 5755 6519 gene locus_tag LOCUS_07300 5755 6519 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174274.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence079 425 498 gene locus_tag LOCUS_t00060 425 498 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 580 1527 gene locus_tag LOCUS_07310 gene trxB 580 1527 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_07310 1524 2009 gene locus_tag LOCUS_07320 1524 2009 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479831.1 protein_id gnl|my_center|LOCUS_07320 2075 2149 gene locus_tag LOCUS_t00070 2075 2149 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2261 3205 gene locus_tag LOCUS_07330 2261 3205 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_07330 3693 3202 gene locus_tag LOCUS_07340 3693 3202 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887620.1 protein_id gnl|my_center|LOCUS_07340 4791 3709 gene locus_tag LOCUS_07350 gene prfA 4791 3709 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349619.1 protein_id gnl|my_center|LOCUS_07350 4903 5892 gene locus_tag LOCUS_07360 4903 5892 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887921.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence080 995 198 gene locus_tag LOCUS_07370 995 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1957 1034 gene locus_tag LOCUS_07380 1957 1034 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_07380 3262 1973 gene locus_tag LOCUS_07390 3262 1973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227893.1 protein_id gnl|my_center|LOCUS_07390 3321 4271 gene locus_tag LOCUS_07400 3321 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5121 4273 gene locus_tag LOCUS_07410 5121 4273 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_07410 <7233 5140 gene locus_tag LOCUS_07420 <7233 5140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404341.1:heavy metal translocating P-type ATPase >Feature sequence081 <1 1408 gene locus_tag LOCUS_07430 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019079516.1:ABC transporter substrate-binding protein 1481 2443 gene locus_tag LOCUS_07440 1481 2443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_07440 2443 3351 gene locus_tag LOCUS_07450 2443 3351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_07450 3409 3630 gene locus_tag LOCUS_07460 3409 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3689 4189 gene locus_tag LOCUS_07470 3689 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4253 4702 gene locus_tag LOCUS_07480 4253 4702 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173597.1 protein_id gnl|my_center|LOCUS_07480 4699 5856 gene locus_tag LOCUS_07490 gene tgt 4699 5856 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350581.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence082 82 516 gene locus_tag LOCUS_07500 gene rplK 82 516 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888678.1 protein_id gnl|my_center|LOCUS_07500 509 1189 gene locus_tag LOCUS_07510 gene rplA 509 1189 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888677.1 protein_id gnl|my_center|LOCUS_07510 1302 1790 gene locus_tag LOCUS_07520 gene rplJ 1302 1790 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888676.1 protein_id gnl|my_center|LOCUS_07520 1805 2173 gene locus_tag LOCUS_07530 gene rplL 1805 2173 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888675.1 protein_id gnl|my_center|LOCUS_07530 2432 5881 gene locus_tag LOCUS_07540 2432 5881 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479684.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence083 <1 867 gene locus_tag LOCUS_07550 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385610.1:ABC transporter ATP-binding protein 1004 1558 gene locus_tag LOCUS_07560 1004 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1644 2957 gene locus_tag LOCUS_07570 1644 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3230 3544 gene locus_tag LOCUS_07580 3230 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4925 3522 gene locus_tag LOCUS_07590 4925 3522 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_07590 5762 4944 gene locus_tag LOCUS_07600 5762 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6660 5755 gene locus_tag LOCUS_07610 6660 5755 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence084 <1 1138 gene locus_tag LOCUS_07620 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245240.1:formate dehydrogenase subunit alpha 1131 1592 gene locus_tag LOCUS_07630 1131 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1589 2467 gene locus_tag LOCUS_07640 gene fdhD 1589 2467 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229108.1 protein_id gnl|my_center|LOCUS_07640 2479 3618 gene locus_tag LOCUS_07650 gene sucC 2479 3618 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887890.1 protein_id gnl|my_center|LOCUS_07650 3615 4517 gene locus_tag LOCUS_07660 gene sucD 3615 4517 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887891.1 protein_id gnl|my_center|LOCUS_07660 4535 4999 gene locus_tag LOCUS_07670 4535 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5005 5850 gene locus_tag LOCUS_07680 5005 5850 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480376.1 protein_id gnl|my_center|LOCUS_07680 6956 5826 gene locus_tag LOCUS_07690 gene bshA 6956 5826 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence085 <1 611 gene locus_tag LOCUS_07700 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256247.1:DNA mismatch repair protein MutS 650 1123 gene locus_tag LOCUS_07710 650 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1180 2262 gene locus_tag LOCUS_07720 1180 2262 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479861.1 protein_id gnl|my_center|LOCUS_07720 2285 3061 gene locus_tag LOCUS_07730 2285 3061 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888203.1 protein_id gnl|my_center|LOCUS_07730 3085 3708 gene locus_tag LOCUS_07740 gene upp 3085 3708 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479860.1 protein_id gnl|my_center|LOCUS_07740 3713 4873 gene locus_tag LOCUS_07750 3713 4873 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888201.1 protein_id gnl|my_center|LOCUS_07750 5114 6019 gene locus_tag LOCUS_07760 5114 6019 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138789.1 protein_id gnl|my_center|LOCUS_07760 6742 5978 gene locus_tag LOCUS_07770 6742 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6826 6835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence086 1310 324 gene locus_tag LOCUS_07780 1310 324 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089090.1 protein_id gnl|my_center|LOCUS_07780 2164 1310 gene locus_tag LOCUS_07790 2164 1310 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 protein_id gnl|my_center|LOCUS_07790 3492 2161 gene locus_tag LOCUS_07800 3492 2161 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_07800 4352 3498 gene locus_tag LOCUS_07810 4352 3498 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_07810 5251 4349 gene locus_tag LOCUS_07820 5251 4349 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 protein_id gnl|my_center|LOCUS_07820 6544 5255 gene locus_tag LOCUS_07830 6544 5255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence087 89 352 gene locus_tag LOCUS_07840 89 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 233 242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 349 777 gene locus_tag LOCUS_07850 349 777 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_07850 976 797 gene locus_tag LOCUS_07860 976 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1037 1357 gene locus_tag LOCUS_07870 1037 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 3569 2601 gene locus_tag LOCUS_07880 3569 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480209.1 protein_id gnl|my_center|LOCUS_07880 3919 3566 gene locus_tag LOCUS_07890 3919 3566 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_07890 6208 3923 gene locus_tag LOCUS_07900 6208 3923 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence088 2 1330 gene locus_tag LOCUS_07910 2 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1318 2154 gene locus_tag LOCUS_07920 1318 2154 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545211.1 protein_id gnl|my_center|LOCUS_07920 2691 2113 gene locus_tag LOCUS_07930 2691 2113 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_07930 3501 2716 gene locus_tag LOCUS_07940 3501 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4277 3498 gene locus_tag LOCUS_07950 4277 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4858 4274 gene locus_tag LOCUS_07960 4858 4274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392688.1 protein_id gnl|my_center|LOCUS_07960 5306 4938 gene locus_tag LOCUS_07970 5306 4938 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687513.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence089 217 1011 gene locus_tag LOCUS_07980 217 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1121 2050 gene locus_tag LOCUS_07990 gene mraY 1121 2050 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888470.1 protein_id gnl|my_center|LOCUS_07990 2047 3348 gene locus_tag LOCUS_08000 gene murD 2047 3348 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889121.1 protein_id gnl|my_center|LOCUS_08000 3345 4508 gene locus_tag LOCUS_08010 3345 4508 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889122.1 protein_id gnl|my_center|LOCUS_08010 4533 5699 gene locus_tag LOCUS_08020 4533 5699 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228809.1 protein_id gnl|my_center|LOCUS_08020 <6960 5677 gene locus_tag LOCUS_08030 <6960 5677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480111.1:dihydrolipoyl dehydrogenase >Feature sequence090 358 588 gene locus_tag LOCUS_08040 358 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 590 1612 gene locus_tag LOCUS_08050 gene moaA 590 1612 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466103.1 protein_id gnl|my_center|LOCUS_08050 1702 2397 gene locus_tag LOCUS_08060 1702 2397 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480290.1 protein_id gnl|my_center|LOCUS_08060 2772 2413 gene locus_tag LOCUS_08070 2772 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3161 2793 gene locus_tag LOCUS_08080 3161 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3505 3158 gene locus_tag LOCUS_08090 3505 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4098 3505 gene locus_tag LOCUS_08100 gene recR 4098 3505 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886844.1 protein_id gnl|my_center|LOCUS_08100 4401 4102 gene locus_tag LOCUS_08110 4401 4102 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886845.1 protein_id gnl|my_center|LOCUS_08110 4757 4422 gene locus_tag LOCUS_08120 4757 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5437 4757 gene locus_tag LOCUS_08130 5437 4757 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886838.1 protein_id gnl|my_center|LOCUS_08130 6657 5434 gene locus_tag LOCUS_08140 6657 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 6666 6675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence091 1498 1271 gene locus_tag LOCUS_08150 1498 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1777 2421 gene locus_tag LOCUS_08160 1777 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3105 2452 gene locus_tag LOCUS_08170 3105 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3175 4011 gene locus_tag LOCUS_08180 3175 4011 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327693.1 protein_id gnl|my_center|LOCUS_08180 4906 4016 gene locus_tag LOCUS_08190 4906 4016 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_08190 6458 4974 gene locus_tag LOCUS_08200 6458 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence092 1926 940 gene locus_tag LOCUS_08210 1926 940 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228492.1 protein_id gnl|my_center|LOCUS_08210 1984 2409 gene locus_tag LOCUS_08220 gene ndk 1984 2409 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227764.1 protein_id gnl|my_center|LOCUS_08220 2866 5244 gene locus_tag LOCUS_08230 2866 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5264 6274 gene locus_tag LOCUS_08240 5264 6274 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence093 1052 423 gene locus_tag LOCUS_08250 1052 423 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172885.1 protein_id gnl|my_center|LOCUS_08250 1064 2290 gene locus_tag LOCUS_08260 1064 2290 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_08260 2902 3873 gene locus_tag LOCUS_08270 2902 3873 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889247.1 protein_id gnl|my_center|LOCUS_08270 5251 3947 gene locus_tag LOCUS_08280 5251 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4210 4219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5303 5312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6145 5543 gene locus_tag LOCUS_08290 gene fadR 6145 5543 CDS product TetR family transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227711.1 protein_id gnl|my_center|LOCUS_08290 <6700 6138 gene locus_tag LOCUS_08300 <6700 6138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888683.1:ABC transporter ATP-binding protein >Feature sequence094 1050 295 gene locus_tag LOCUS_08310 gene bshB1 1050 295 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888991.1 protein_id gnl|my_center|LOCUS_08310 2787 1363 gene locus_tag LOCUS_08320 2787 1363 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349984.1 protein_id gnl|my_center|LOCUS_08320 3678 2803 gene locus_tag LOCUS_08330 3678 2803 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975209.1 protein_id gnl|my_center|LOCUS_08330 4607 3675 gene locus_tag LOCUS_08340 4607 3675 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401253.1 protein_id gnl|my_center|LOCUS_08340 5953 4679 gene locus_tag LOCUS_08350 5953 4679 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_08350 6328 6110 gene locus_tag LOCUS_08360 gene xseB 6328 6110 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350868.1 protein_id gnl|my_center|LOCUS_08360 6368 6377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence095 1462 233 gene locus_tag LOCUS_08370 1462 233 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888248.1 protein_id gnl|my_center|LOCUS_08370 2649 1474 gene locus_tag LOCUS_08380 gene lysS 2649 1474 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480200.1 protein_id gnl|my_center|LOCUS_08380 2813 4471 gene locus_tag LOCUS_08390 2813 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5395 4481 gene locus_tag LOCUS_08400 5395 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 <6629 5485 gene locus_tag LOCUS_08410 <6629 5485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889306.1:O-antigen ligase family protein >Feature sequence096 1408 293 gene locus_tag LOCUS_08420 1408 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1513 2505 gene locus_tag LOCUS_08430 1513 2505 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_08430 2570 3352 gene locus_tag LOCUS_08440 2570 3352 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_08440 4627 3359 gene locus_tag LOCUS_08450 4627 3359 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887720.1 protein_id gnl|my_center|LOCUS_08450 5742 4627 gene locus_tag LOCUS_08460 5742 4627 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_08460 <6581 5797 gene locus_tag LOCUS_08470 <6581 5797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479632.1:LptF/LptG family permease >Feature sequence097 1334 81 gene locus_tag LOCUS_08480 1334 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3089 1365 gene locus_tag LOCUS_08490 gene infB 3089 1365 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888434.1 protein_id gnl|my_center|LOCUS_08490 4602 3361 gene locus_tag LOCUS_08500 gene nusA 4602 3361 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350009.1 protein_id gnl|my_center|LOCUS_08500 3494 3503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5060 4617 gene locus_tag LOCUS_08510 gene rimP 5060 4617 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888431.1 protein_id gnl|my_center|LOCUS_08510 5602 5234 gene locus_tag LOCUS_08520 5602 5234 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480312.1 protein_id gnl|my_center|LOCUS_08520 5717 6337 gene locus_tag LOCUS_08530 5717 6337 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480313.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence098 42 1160 gene locus_tag LOCUS_08540 42 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1157 1705 gene locus_tag LOCUS_08550 1157 1705 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_08550 1934 1653 gene locus_tag LOCUS_08560 1934 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2127 3413 gene locus_tag LOCUS_08570 gene murA 2127 3413 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887766.1 protein_id gnl|my_center|LOCUS_08570 4177 3419 gene locus_tag LOCUS_08580 4177 3419 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_08580 5363 4209 gene locus_tag LOCUS_08590 5363 4209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887132.1 protein_id gnl|my_center|LOCUS_08590 5652 6197 gene locus_tag LOCUS_08600 5652 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence099 401 1825 gene locus_tag LOCUS_08610 401 1825 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888131.1 protein_id gnl|my_center|LOCUS_08610 1832 3700 gene locus_tag LOCUS_08620 1832 3700 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567324.1 protein_id gnl|my_center|LOCUS_08620 3697 4428 gene locus_tag LOCUS_08630 3697 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5477 4338 gene locus_tag LOCUS_08640 5477 4338 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349636.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence100 514 1560 gene locus_tag LOCUS_08650 gene ftsZ 514 1560 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887276.1 protein_id gnl|my_center|LOCUS_08650 1563 2030 gene locus_tag LOCUS_08660 gene ndx4 1563 2030 CDS product ADP-ribose pyrophosphatase Ndx4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172615.1 protein_id gnl|my_center|LOCUS_08660 2034 2945 gene locus_tag LOCUS_08670 gene ribF 2034 2945 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887651.1 protein_id gnl|my_center|LOCUS_08670 3457 2918 gene locus_tag LOCUS_08680 gene raiA 3457 2918 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887725.1 protein_id gnl|my_center|LOCUS_08680 4989 3475 gene locus_tag LOCUS_08690 gene guaA 4989 3475 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888509.1 protein_id gnl|my_center|LOCUS_08690 5053 5772 gene locus_tag LOCUS_08700 5053 5772 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence101 1420 236 gene locus_tag LOCUS_08710 1420 236 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480023.1 protein_id gnl|my_center|LOCUS_08710 2421 1420 gene locus_tag LOCUS_08720 gene gap 2421 1420 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228284.1 protein_id gnl|my_center|LOCUS_08720 3765 2470 gene locus_tag LOCUS_08730 gene asnS 3765 2470 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228137.1 protein_id gnl|my_center|LOCUS_08730 4567 3776 gene locus_tag LOCUS_08740 4567 3776 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887971.1 protein_id gnl|my_center|LOCUS_08740 6261 4564 gene locus_tag LOCUS_08750 gene aspS 6261 4564 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172809.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence102 <6382 194 gene locus_tag LOCUS_08760 <6382 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618893.1:translocation/assembly module TamB 1803 1812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence103 1297 1893 gene locus_tag LOCUS_08770 1297 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1863 1872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1877 2710 gene locus_tag LOCUS_08780 1877 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3145 4188 gene locus_tag LOCUS_08790 3145 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4569 5081 gene locus_tag LOCUS_08800 4569 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5303 5662 gene locus_tag LOCUS_08810 5303 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence104 2276 846 gene locus_tag LOCUS_08820 2276 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 3237 2278 gene locus_tag LOCUS_08830 3237 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3307 4089 gene locus_tag LOCUS_08840 3307 4089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932815.1 protein_id gnl|my_center|LOCUS_08840 4133 4831 gene locus_tag LOCUS_08850 gene recO 4133 4831 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887465.1 protein_id gnl|my_center|LOCUS_08850 5408 4938 gene locus_tag LOCUS_08860 5408 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5558 5983 gene locus_tag LOCUS_08870 gene mscL 5558 5983 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence105 <1 2327 gene locus_tag LOCUS_08880 <1 2327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227833.1:S8 family serine peptidase 3699 2380 gene locus_tag LOCUS_08890 3699 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081492.1 protein_id gnl|my_center|LOCUS_08890 4370 3696 gene locus_tag LOCUS_08900 4370 3696 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_08900 5126 4380 gene locus_tag LOCUS_08910 5126 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence106 827 459 gene locus_tag LOCUS_08920 827 459 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_08920 1214 3163 gene locus_tag LOCUS_08930 1214 3163 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479701.1 protein_id gnl|my_center|LOCUS_08930 3728 5026 gene locus_tag LOCUS_08940 gene miaB 3728 5026 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479611.1 protein_id gnl|my_center|LOCUS_08940 5607 5032 gene locus_tag LOCUS_08950 5607 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence107 1256 135 gene locus_tag LOCUS_08960 1256 135 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_08960 1231 1389 gene locus_tag LOCUS_08970 1231 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1621 2808 gene locus_tag LOCUS_08980 gene malE 1621 2808 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080109.1 protein_id gnl|my_center|LOCUS_08980 2897 3898 gene locus_tag LOCUS_08990 2897 3898 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_08990 4866 4009 gene locus_tag LOCUS_09000 4866 4009 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384269.1 protein_id gnl|my_center|LOCUS_09000 6076 4868 gene locus_tag LOCUS_09010 6076 4868 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence108 1298 300 gene locus_tag LOCUS_09020 1298 300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084174.1 protein_id gnl|my_center|LOCUS_09020 2177 1299 gene locus_tag LOCUS_09030 2177 1299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_09030 3210 2182 gene locus_tag LOCUS_09040 3210 2182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383586.1 protein_id gnl|my_center|LOCUS_09040 4814 3228 gene locus_tag LOCUS_09050 4814 3228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383585.1 protein_id gnl|my_center|LOCUS_09050 5949 4855 gene locus_tag LOCUS_09060 5949 4855 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence109 293 302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2874 1024 gene locus_tag LOCUS_09070 2874 1024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618939.1 protein_id gnl|my_center|LOCUS_09070 4653 2980 gene locus_tag LOCUS_09080 4653 2980 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_09080 4722 5618 gene locus_tag LOCUS_09090 4722 5618 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence110 1627 476 gene locus_tag LOCUS_09100 1627 476 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 protein_id gnl|my_center|LOCUS_09100 2129 1629 gene locus_tag LOCUS_09110 2129 1629 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173648.1 protein_id gnl|my_center|LOCUS_09110 2767 2150 gene locus_tag LOCUS_09120 gene tmk 2767 2150 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_09120 3522 2764 gene locus_tag LOCUS_09130 3522 2764 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_09130 4289 3687 gene locus_tag LOCUS_09140 gene tam 4289 3687 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312207.1 protein_id gnl|my_center|LOCUS_09140 5580 4480 gene locus_tag LOCUS_09150 5580 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence111 567 2414 gene locus_tag LOCUS_09160 gene ftsH 567 2414 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480146.1 protein_id gnl|my_center|LOCUS_09160 2491 3054 gene locus_tag LOCUS_09170 2491 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3292 4092 gene locus_tag LOCUS_09180 gene minD 3292 4092 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479992.1 protein_id gnl|my_center|LOCUS_09180 4092 4343 gene locus_tag LOCUS_09190 gene minE 4092 4343 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887397.1 protein_id gnl|my_center|LOCUS_09190 4406 5458 gene locus_tag LOCUS_09200 gene rodA 4406 5458 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228544.1 protein_id gnl|my_center|LOCUS_09200 <5934 5431 gene locus_tag LOCUS_09210 <5934 5431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480296.1:GTPase HflX >Feature sequence112 732 16 gene locus_tag LOCUS_09220 gene tmpR 732 16 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_09220 1133 729 gene locus_tag LOCUS_09230 1133 729 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 protein_id gnl|my_center|LOCUS_09230 1189 2565 gene locus_tag LOCUS_09240 1189 2565 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889146.1 protein_id gnl|my_center|LOCUS_09240 2562 4079 gene locus_tag LOCUS_09250 2562 4079 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence113 <1 562 gene locus_tag LOCUS_09260 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228563.1:V-type ATP synthase subunit E 568 1548 gene locus_tag LOCUS_09270 568 1548 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480006.1 protein_id gnl|my_center|LOCUS_09270 1541 1864 gene locus_tag LOCUS_09280 1541 1864 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887344.1 protein_id gnl|my_center|LOCUS_09280 1881 3620 gene locus_tag LOCUS_09290 1881 3620 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887345.1 protein_id gnl|my_center|LOCUS_09290 3629 5038 gene locus_tag LOCUS_09300 3629 5038 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887346.1 protein_id gnl|my_center|LOCUS_09300 5057 5725 gene locus_tag LOCUS_09310 5057 5725 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887347.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence114 749 1543 gene locus_tag LOCUS_09320 gene proC 749 1543 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888161.1 protein_id gnl|my_center|LOCUS_09320 1540 2094 gene locus_tag LOCUS_09330 1540 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926046.1 protein_id gnl|my_center|LOCUS_09330 2091 2639 gene locus_tag LOCUS_09340 2091 2639 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_09340 2636 2878 gene locus_tag LOCUS_09350 2636 2878 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886705.1 protein_id gnl|my_center|LOCUS_09350 2914 3873 gene locus_tag LOCUS_09360 2914 3873 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350359.1 protein_id gnl|my_center|LOCUS_09360 3860 5314 gene locus_tag LOCUS_09370 gene glmU 3860 5314 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479974.1 protein_id gnl|my_center|LOCUS_09370 5347 5559 gene locus_tag LOCUS_09380 5347 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5566 5820 gene locus_tag LOCUS_09390 5566 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence115 209 1951 gene locus_tag LOCUS_09400 209 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence116 1355 597 gene locus_tag LOCUS_09410 1355 597 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480190.1 protein_id gnl|my_center|LOCUS_09410 1563 2093 gene locus_tag LOCUS_09420 1563 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056491.1 protein_id gnl|my_center|LOCUS_09420 2090 2974 gene locus_tag LOCUS_09430 2090 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888947.1 protein_id gnl|my_center|LOCUS_09430 3001 3738 gene locus_tag LOCUS_09440 3001 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3816 3890 gene locus_tag LOCUS_t00080 3816 3890 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4808 4248 gene locus_tag LOCUS_09450 gene dcd 4808 4248 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174218.1 protein_id gnl|my_center|LOCUS_09450 5314 4805 gene locus_tag LOCUS_09460 5314 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence117 521 1216 gene locus_tag LOCUS_09470 521 1216 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_09470 1253 2293 gene locus_tag LOCUS_09480 gene recF 1253 2293 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887732.1 protein_id gnl|my_center|LOCUS_09480 2290 3105 gene locus_tag LOCUS_09490 2290 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3102 3599 gene locus_tag LOCUS_09500 3102 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence118 358 1506 gene locus_tag LOCUS_09510 358 1506 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480247.1 protein_id gnl|my_center|LOCUS_09510 1503 2474 gene locus_tag LOCUS_09520 1503 2474 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886678.1 protein_id gnl|my_center|LOCUS_09520 2478 3797 gene locus_tag LOCUS_09530 2478 3797 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227796.1 protein_id gnl|my_center|LOCUS_09530 3840 5234 gene locus_tag LOCUS_09540 gene lpdA 3840 5234 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888996.1 protein_id gnl|my_center|LOCUS_09540 5540 5244 gene locus_tag LOCUS_09550 5540 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence119 676 1881 gene locus_tag LOCUS_09560 676 1881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 protein_id gnl|my_center|LOCUS_09560 1881 2474 gene locus_tag LOCUS_09570 1881 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2505 3212 gene locus_tag LOCUS_09580 2505 3212 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228966.1 protein_id gnl|my_center|LOCUS_09580 3209 4750 gene locus_tag LOCUS_09590 3209 4750 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence120 <1 824 gene locus_tag LOCUS_09600 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816113.1:sugar ABC transporter permease 821 1696 gene locus_tag LOCUS_09610 821 1696 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_09610 1696 2346 gene locus_tag LOCUS_09620 1696 2346 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_09620 2343 3287 gene locus_tag LOCUS_09630 2343 3287 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089272.1 protein_id gnl|my_center|LOCUS_09630 3297 4445 gene locus_tag LOCUS_09640 gene dgoD 3297 4445 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_09640 4439 5320 gene locus_tag LOCUS_09650 4439 5320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence121 225 1196 gene locus_tag LOCUS_09660 225 1196 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_09660 1205 1684 gene locus_tag LOCUS_09670 1205 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1700 1990 gene locus_tag LOCUS_09680 1700 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 1945 2775 gene locus_tag LOCUS_09690 1945 2775 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889086.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 3476 2772 gene locus_tag LOCUS_09700 gene hisA 3476 2772 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 protein_id gnl|my_center|LOCUS_09700 3611 4429 gene locus_tag LOCUS_09710 gene menB 3611 4429 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256004.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence122 <1 538 gene locus_tag LOCUS_09720 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889411.1:urocanate hydratase 535 1455 gene locus_tag LOCUS_09730 535 1455 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889409.1 protein_id gnl|my_center|LOCUS_09730 1452 2642 gene locus_tag LOCUS_09740 gene hutI 1452 2642 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_09740 2648 4168 gene locus_tag LOCUS_09750 gene hutH 2648 4168 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_09750 4194 5309 gene locus_tag LOCUS_09760 gene wecB 4194 5309 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119483.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence123 319 705 gene locus_tag LOCUS_09770 319 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1646 669 gene locus_tag LOCUS_09780 gene meaB 1646 669 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 protein_id gnl|my_center|LOCUS_09780 2058 1672 gene locus_tag LOCUS_09790 gene crcB 2058 1672 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392062.1 protein_id gnl|my_center|LOCUS_09790 2820 2113 gene locus_tag LOCUS_09800 2820 2113 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_09800 3845 2817 gene locus_tag LOCUS_09810 gene purM 3845 2817 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177712.1 protein_id gnl|my_center|LOCUS_09810 4139 5107 gene locus_tag LOCUS_09820 gene crtE 4139 5107 CDS product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence124 <1 681 gene locus_tag LOCUS_09830 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015370098.1:ABC transporter permease 678 1535 gene locus_tag LOCUS_09840 678 1535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_09840 1643 2833 gene locus_tag LOCUS_09850 1643 2833 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304593.1 protein_id gnl|my_center|LOCUS_09850 4905 3109 gene locus_tag LOCUS_09860 4905 3109 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_09860 5222 5231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence125 <1 637 gene locus_tag LOCUS_09870 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227010.1:L-glyceraldehyde 3-phosphate reductase 1833 766 gene locus_tag LOCUS_09880 1833 766 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_09880 3153 1840 gene locus_tag LOCUS_09890 3153 1840 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_09890 4599 3256 gene locus_tag LOCUS_09900 4599 3256 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_09900 <5490 4725 gene locus_tag LOCUS_09910 <5490 4725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026977.1:carbohydrate ABC transporter permease >Feature sequence126 46 711 gene locus_tag LOCUS_09920 46 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 708 1328 gene locus_tag LOCUS_09930 708 1328 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_09930 2667 1690 gene locus_tag LOCUS_09940 2667 1690 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_09940 3021 2791 gene locus_tag LOCUS_09950 3021 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3512 3225 gene locus_tag LOCUS_09960 3512 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09960 3818 3600 gene locus_tag LOCUS_09970 3818 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09970 4953 4450 gene locus_tag LOCUS_09980 4953 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5270 4980 gene locus_tag LOCUS_09990 5270 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence127 360 1358 gene locus_tag LOCUS_10000 360 1358 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177598.1 protein_id gnl|my_center|LOCUS_10000 1355 1714 gene locus_tag LOCUS_10010 1355 1714 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173441.1 protein_id gnl|my_center|LOCUS_10010 1885 2724 gene locus_tag LOCUS_10020 1885 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2725 3753 gene locus_tag LOCUS_10030 2725 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4601 3759 gene locus_tag LOCUS_10040 4601 3759 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479803.1 protein_id gnl|my_center|LOCUS_10040 5227 4598 gene locus_tag LOCUS_10050 5227 4598 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479802.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence128 1726 260 gene locus_tag LOCUS_10060 gene cysS 1726 260 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479901.1 protein_id gnl|my_center|LOCUS_10060 1809 3017 gene locus_tag LOCUS_10070 1809 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3784 3341 gene locus_tag LOCUS_10080 3784 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5080 4208 gene locus_tag LOCUS_10090 5080 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence129 239 727 gene locus_tag LOCUS_10100 gene rnhA 239 727 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887544.1 protein_id gnl|my_center|LOCUS_10100 767 1408 gene locus_tag LOCUS_10110 767 1408 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391993.1 protein_id gnl|my_center|LOCUS_10110 2423 1416 gene locus_tag LOCUS_10120 2423 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3229 2471 gene locus_tag LOCUS_10130 3229 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3299 4108 gene locus_tag LOCUS_10140 3299 4108 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_10140 4273 4815 gene locus_tag LOCUS_10150 4273 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4837 5232 gene locus_tag LOCUS_10160 4837 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10160 >Feature sequence130 <1 762 gene locus_tag LOCUS_10170 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229244.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 829 2124 gene locus_tag LOCUS_10180 829 2124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_10180 2208 3122 gene locus_tag LOCUS_10190 2208 3122 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975883.1 protein_id gnl|my_center|LOCUS_10190 3132 4013 gene locus_tag LOCUS_10200 3132 4013 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_10200 4267 5328 gene locus_tag LOCUS_10210 4267 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence131 <1 1057 gene locus_tag LOCUS_10220 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065752.1:chloride channel protein 2173 1442 gene locus_tag LOCUS_10230 2173 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2648 3613 gene locus_tag LOCUS_10240 2648 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3973 3644 gene locus_tag LOCUS_10250 3973 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence132 1196 525 gene locus_tag LOCUS_10260 gene hisG 1196 525 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888084.1 protein_id gnl|my_center|LOCUS_10260 2299 1193 gene locus_tag LOCUS_10270 2299 1193 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888083.1 protein_id gnl|my_center|LOCUS_10270 2365 2970 gene locus_tag LOCUS_10280 2365 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3728 2982 gene locus_tag LOCUS_10290 3728 2982 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_10290 4652 3783 gene locus_tag LOCUS_10300 gene aguB 4652 3783 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_10300 <5269 4645 gene locus_tag LOCUS_10310 <5269 4645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055966.1:agmatine deiminase family protein >Feature sequence133 <1 1402 gene locus_tag LOCUS_10320 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479771.1:ABC transporter substrate-binding protein 1410 2378 gene locus_tag LOCUS_10330 1410 2378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479770.1 protein_id gnl|my_center|LOCUS_10330 2375 3421 gene locus_tag LOCUS_10340 2375 3421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889467.1 protein_id gnl|my_center|LOCUS_10340 3486 4118 gene locus_tag LOCUS_10350 3486 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4092 4101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4139 4834 gene locus_tag LOCUS_10360 4139 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence134 1116 19 gene locus_tag LOCUS_10370 1116 19 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887806.1 protein_id gnl|my_center|LOCUS_10370 1928 1113 gene locus_tag LOCUS_10380 gene panC 1928 1113 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887807.1 protein_id gnl|my_center|LOCUS_10380 2301 1951 gene locus_tag LOCUS_10390 2301 1951 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887808.1 protein_id gnl|my_center|LOCUS_10390 2705 2298 gene locus_tag LOCUS_10400 2705 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3543 2791 gene locus_tag LOCUS_10410 3543 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5173 3632 gene locus_tag LOCUS_10420 5173 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence135 1161 850 gene locus_tag LOCUS_10430 1161 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1493 1158 gene locus_tag LOCUS_10440 1493 1158 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_10440 2372 3631 gene locus_tag LOCUS_10450 2372 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 <5234 3833 gene locus_tag LOCUS_10460 <5234 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530523.1:glycoside hydrolase family 127 protein >Feature sequence136 175 489 gene locus_tag LOCUS_10470 175 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 886 509 gene locus_tag LOCUS_10480 886 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1042 967 gene locus_tag LOCUS_t00090 1042 967 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1886 1080 gene locus_tag LOCUS_10490 1886 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2749 1931 gene locus_tag LOCUS_10500 2749 1931 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228629.1 protein_id gnl|my_center|LOCUS_10500 2868 3653 gene locus_tag LOCUS_10510 gene lepB 2868 3653 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350452.1 protein_id gnl|my_center|LOCUS_10510 3679 4671 gene locus_tag LOCUS_10520 3679 4671 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_10520 <5229 4715 gene locus_tag LOCUS_10530 <5229 4715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530368.1:MIP family channel protein >Feature sequence137 115 1200 gene locus_tag LOCUS_10540 115 1200 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_10540 2261 3331 gene locus_tag LOCUS_10550 2261 3331 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_10550 3328 4050 gene locus_tag LOCUS_10560 3328 4050 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349836.1 protein_id gnl|my_center|LOCUS_10560 4038 4580 gene locus_tag LOCUS_10570 4038 4580 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889303.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence138 245 646 gene locus_tag LOCUS_10580 245 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2013 643 gene locus_tag LOCUS_10590 2013 643 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228206.1 protein_id gnl|my_center|LOCUS_10590 3331 2003 gene locus_tag LOCUS_10600 3331 2003 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_10600 4036 3341 gene locus_tag LOCUS_10610 4036 3341 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_10610 4934 4044 gene locus_tag LOCUS_10620 4934 4044 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888924.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence139 398 1396 gene locus_tag LOCUS_10630 398 1396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948861.1 protein_id gnl|my_center|LOCUS_10630 1407 2300 gene locus_tag LOCUS_10640 1407 2300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047036674.1 protein_id gnl|my_center|LOCUS_10640 2313 3239 gene locus_tag LOCUS_10650 2313 3239 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804461.1 protein_id gnl|my_center|LOCUS_10650 3714 4535 gene locus_tag LOCUS_10660 3714 4535 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014630030.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence140 1333 2592 gene locus_tag LOCUS_10670 1333 2592 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 protein_id gnl|my_center|LOCUS_10670 2589 3869 gene locus_tag LOCUS_10680 2589 3869 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 protein_id gnl|my_center|LOCUS_10680 4101 4457 gene locus_tag LOCUS_10690 4101 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4460 4747 gene locus_tag LOCUS_10700 4460 4747 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969543.1 protein_id gnl|my_center|LOCUS_10700 4760 4987 gene locus_tag LOCUS_10710 4760 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10710 >Feature sequence141 250 1167 gene locus_tag LOCUS_10720 gene folP 250 1167 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886814.1 protein_id gnl|my_center|LOCUS_10720 1188 2138 gene locus_tag LOCUS_10730 1188 2138 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_10730 2132 2788 gene locus_tag LOCUS_10740 2132 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4496 2850 gene locus_tag LOCUS_10750 4496 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence142 1648 668 gene locus_tag LOCUS_10760 1648 668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_10760 3360 1678 gene locus_tag LOCUS_10770 3360 1678 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_10770 4410 3478 gene locus_tag LOCUS_10780 4410 3478 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence143 <1 1984 gene locus_tag LOCUS_10790 <1 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479810.1:ATP-dependent DNA helicase RecG 2048 2737 gene locus_tag LOCUS_10800 gene rpiA 2048 2737 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632746.1 protein_id gnl|my_center|LOCUS_10800 2769 3200 gene locus_tag LOCUS_10810 2769 3200 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479850.1 protein_id gnl|my_center|LOCUS_10810 3219 4874 gene locus_tag LOCUS_10820 gene treS 3219 4874 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224468.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence144 2520 3719 gene locus_tag LOCUS_10830 2520 3719 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887319.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence145 1769 102 gene locus_tag LOCUS_10840 1769 102 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208002274.1 protein_id gnl|my_center|LOCUS_10840 1956 3368 gene locus_tag LOCUS_10850 1956 3368 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228014.1 protein_id gnl|my_center|LOCUS_10850 3781 3365 gene locus_tag LOCUS_10860 3781 3365 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085003.1 protein_id gnl|my_center|LOCUS_10860 4191 3847 gene locus_tag LOCUS_10870 4191 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4252 4338 gene locus_tag LOCUS_t00100 4252 4338 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <5062 4374 gene locus_tag LOCUS_10880 <5062 4374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249928.1:alpha-amylase family glycosyl hydrolase >Feature sequence146 164 1897 gene locus_tag LOCUS_10890 gene lepA 164 1897 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887788.1 protein_id gnl|my_center|LOCUS_10890 1900 2928 gene locus_tag LOCUS_10900 1900 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10900 2937 3524 gene locus_tag LOCUS_10910 2937 3524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887536.1 protein_id gnl|my_center|LOCUS_10910 3693 4082 gene locus_tag LOCUS_10920 3693 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence147 402 52 gene locus_tag LOCUS_10930 gene rplQ 402 52 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888760.1 protein_id gnl|my_center|LOCUS_10930 1391 438 gene locus_tag LOCUS_10940 1391 438 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888759.1 protein_id gnl|my_center|LOCUS_10940 2020 1403 gene locus_tag LOCUS_10950 gene rpsD 2020 1403 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888758.1 protein_id gnl|my_center|LOCUS_10950 2417 2025 gene locus_tag LOCUS_10960 gene rpsK 2417 2025 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888757.1 protein_id gnl|my_center|LOCUS_10960 2797 2417 gene locus_tag LOCUS_10970 gene rpsM 2797 2417 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_10970 3234 2980 gene locus_tag LOCUS_10980 gene infA 3234 2980 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479941.1 protein_id gnl|my_center|LOCUS_10980 3860 3270 gene locus_tag LOCUS_10990 3860 3270 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888748.1 protein_id gnl|my_center|LOCUS_10990 <5035 3850 gene locus_tag LOCUS_11000 <5035 3850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888747.1:preprotein translocase subunit SecY >Feature sequence148 645 349 gene locus_tag LOCUS_11010 gene cas2 645 349 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_11010 841 656 gene locus_tag LOCUS_11020 841 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2288 1680 gene locus_tag LOCUS_11030 gene cas4 2288 1680 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_11030 3473 2484 gene locus_tag LOCUS_11040 gene cas7c 3473 2484 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_11040 <5035 3538 gene locus_tag LOCUS_11050 <5035 3538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176708.1:type I-C CRISPR-associated protein Cas8c/Csd1 >Feature sequence149 7 1335 gene locus_tag LOCUS_11060 gene trmFO 7 1335 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350703.1 protein_id gnl|my_center|LOCUS_11060 1310 2299 gene locus_tag LOCUS_11070 1310 2299 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888469.1 protein_id gnl|my_center|LOCUS_11070 2423 3055 gene locus_tag LOCUS_11080 2423 3055 CDS product DUF2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888467.1 protein_id gnl|my_center|LOCUS_11080 3091 3975 gene locus_tag LOCUS_11090 3091 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888466.1 protein_id gnl|my_center|LOCUS_11090 3979 4704 gene locus_tag LOCUS_11100 3979 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence150 1050 160 gene locus_tag LOCUS_11110 1050 160 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_11110 1334 2032 gene locus_tag LOCUS_11120 1334 2032 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_11120 2029 2427 gene locus_tag LOCUS_11130 2029 2427 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887102.1 protein_id gnl|my_center|LOCUS_11130 2495 3913 gene locus_tag LOCUS_11140 2495 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11140 3951 4661 gene locus_tag LOCUS_11150 3951 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887104.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence151 2637 193 gene locus_tag LOCUS_11160 2637 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence152 140 607 gene locus_tag LOCUS_11170 gene dps 140 607 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 protein_id gnl|my_center|LOCUS_11170 625 2127 gene locus_tag LOCUS_11180 gene ilvA 625 2127 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258444.1 protein_id gnl|my_center|LOCUS_11180 2150 2824 gene locus_tag LOCUS_11190 gene moaD 2150 2824 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889231.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence153 1650 775 gene locus_tag LOCUS_11200 1650 775 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228998.1 protein_id gnl|my_center|LOCUS_11200 1759 3543 gene locus_tag LOCUS_11210 gene typA 1759 3543 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence154 179 1135 gene locus_tag LOCUS_11220 179 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1135 2013 gene locus_tag LOCUS_11230 1135 2013 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583080.1 protein_id gnl|my_center|LOCUS_11230 2051 2479 gene locus_tag LOCUS_11240 2051 2479 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_11240 3526 2486 gene locus_tag LOCUS_11250 3526 2486 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_11250 <4769 3533 gene locus_tag LOCUS_11260 <4769 3533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887081.1:cytochrome bc complex cytochrome b subunit >Feature sequence155 175 1395 gene locus_tag LOCUS_11270 175 1395 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889249.1 protein_id gnl|my_center|LOCUS_11270 2571 1360 gene locus_tag LOCUS_11280 2571 1360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228265.1 protein_id gnl|my_center|LOCUS_11280 3903 2659 gene locus_tag LOCUS_11290 3903 2659 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_11290 <4764 3904 gene locus_tag LOCUS_11300 <4764 3904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889201.1:manganese-dependent inorganic pyrophosphatase >Feature sequence156 259 1689 gene locus_tag LOCUS_11310 259 1689 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350448.1 protein_id gnl|my_center|LOCUS_11310 1752 2891 gene locus_tag LOCUS_11320 1752 2891 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_11320 2943 3599 gene locus_tag LOCUS_11330 2943 3599 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence157 3385 1919 gene locus_tag LOCUS_11340 gene guaB 3385 1919 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888513.1 protein_id gnl|my_center|LOCUS_11340 4056 3382 gene locus_tag LOCUS_11350 4056 3382 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_11350 4522 4049 gene locus_tag LOCUS_11360 gene greA 4522 4049 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887805.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence158 <1 941 gene locus_tag LOCUS_11370 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887268.1:pyridoxal phosphate-dependent aminotransferase 1155 2483 gene locus_tag LOCUS_11380 1155 2483 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_11380 2551 3414 gene locus_tag LOCUS_11390 2551 3414 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804057.1 protein_id gnl|my_center|LOCUS_11390 3411 4250 gene locus_tag LOCUS_11400 3411 4250 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence159 <1 592 gene locus_tag LOCUS_11410 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950166.1:heavy metal-binding domain-containing protein 651 1859 gene locus_tag LOCUS_11420 gene metK 651 1859 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887285.1 protein_id gnl|my_center|LOCUS_11420 2400 1861 gene locus_tag LOCUS_11430 gene msrA 2400 1861 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_11430 2492 3973 gene locus_tag LOCUS_11440 gene cobA 2492 3973 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349821.1 protein_id gnl|my_center|LOCUS_11440 2591 2600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence160 2 364 gene locus_tag LOCUS_11450 2 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 333 761 gene locus_tag LOCUS_11460 333 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 770 1015 gene locus_tag LOCUS_11470 770 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1012 2943 gene locus_tag LOCUS_11480 1012 2943 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_11480 2940 4388 gene locus_tag LOCUS_11490 2940 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence161 <1 835 gene locus_tag LOCUS_11500 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480260.1:tyrosine--tRNA ligase 881 2521 gene locus_tag LOCUS_11510 881 2521 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480060.1 protein_id gnl|my_center|LOCUS_11510 3138 2524 gene locus_tag LOCUS_11520 3138 2524 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_11520 4082 3135 gene locus_tag LOCUS_11530 4082 3135 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227789.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence162 1703 1233 gene locus_tag LOCUS_11540 gene rpsG 1703 1233 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886951.1 protein_id gnl|my_center|LOCUS_11540 2115 1741 gene locus_tag LOCUS_11550 gene rpsL 2115 1741 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886950.1 protein_id gnl|my_center|LOCUS_11550 2965 2318 gene locus_tag LOCUS_11560 2965 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 <4488 3224 gene locus_tag LOCUS_11570 <4488 3224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228526.1:pilus assembly PilX N-terminal domain-containing protein >Feature sequence163 <1 1034 gene locus_tag LOCUS_11580 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144196.1:PAS domain S-box protein 1031 1696 gene locus_tag LOCUS_11590 gene phoU 1031 1696 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888872.1 protein_id gnl|my_center|LOCUS_11590 1841 1765 gene locus_tag LOCUS_t00110 1841 1765 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence164 1101 205 gene locus_tag LOCUS_11600 1101 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1335 1874 gene locus_tag LOCUS_11610 1335 1874 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034358328.1 protein_id gnl|my_center|LOCUS_11610 1871 2692 gene locus_tag LOCUS_11620 gene panB 1871 2692 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_11620 2689 3873 gene locus_tag LOCUS_11630 2689 3873 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence165 1747 182 gene locus_tag LOCUS_11640 gene serA 1747 182 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887934.1 protein_id gnl|my_center|LOCUS_11640 1873 2397 gene locus_tag LOCUS_11650 1873 2397 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_11650 3287 2403 gene locus_tag LOCUS_11660 gene rbsK 3287 2403 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_11660 <4363 3300 gene locus_tag LOCUS_11670 <4363 3300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195336.1:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence166 637 563 gene locus_tag LOCUS_t00120 637 563 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 714 639 gene locus_tag LOCUS_t00130 714 639 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 839 1240 gene locus_tag LOCUS_11680 839 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1283 2641 gene locus_tag LOCUS_11690 1283 2641 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479518.1 protein_id gnl|my_center|LOCUS_11690 3050 2628 gene locus_tag LOCUS_11700 3050 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3149 4126 gene locus_tag LOCUS_11710 3149 4126 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence167 98 289 gene locus_tag LOCUS_11720 98 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 922 1833 gene locus_tag LOCUS_11730 922 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2103 3266 gene locus_tag LOCUS_11740 2103 3266 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence168 3 587 gene locus_tag LOCUS_11750 3 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 584 1567 gene locus_tag LOCUS_11760 gene mltG 584 1567 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889177.1 protein_id gnl|my_center|LOCUS_11760 1567 2133 gene locus_tag LOCUS_11770 1567 2133 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888450.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence169 917 471 gene locus_tag LOCUS_11780 gene accB 917 471 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 protein_id gnl|my_center|LOCUS_11780 1474 917 gene locus_tag LOCUS_11790 gene efp 1474 917 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_11790 2463 1471 gene locus_tag LOCUS_11800 2463 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480038.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence170 <1 788 gene locus_tag LOCUS_11810 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888139.1:NADH-quinone oxidoreductase subunit NuoF 785 2911 gene locus_tag LOCUS_11820 gene nuoG 785 2911 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888138.1 protein_id gnl|my_center|LOCUS_11820 2908 4038 gene locus_tag LOCUS_11830 gene nuoH 2908 4038 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888137.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence171 >Feature sequence172 3448 122 gene locus_tag LOCUS_11840 3448 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3702 3448 gene locus_tag LOCUS_11850 3702 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence173 <1 703 gene locus_tag LOCUS_11860 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479917.1:orotidine-5'-phosphate decarboxylase 713 1636 gene locus_tag LOCUS_11870 713 1636 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 protein_id gnl|my_center|LOCUS_11870 3060 1642 gene locus_tag LOCUS_11880 3060 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4153 3173 gene locus_tag LOCUS_11890 4153 3173 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889245.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence174 1693 821 gene locus_tag LOCUS_11900 1693 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2363 2992 gene locus_tag LOCUS_11910 2363 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3119 3625 gene locus_tag LOCUS_11920 3119 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence175 1833 2303 gene locus_tag LOCUS_11930 1833 2303 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_11930 2315 3091 gene locus_tag LOCUS_11940 2315 3091 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence176 259 183 gene locus_tag LOCUS_t00140 259 183 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 298 2199 gene locus_tag LOCUS_11950 298 2199 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350791.1 protein_id gnl|my_center|LOCUS_11950 3610 2228 gene locus_tag LOCUS_11960 3610 2228 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence177 2450 906 gene locus_tag LOCUS_11970 2450 906 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_11970 2648 3814 gene locus_tag LOCUS_11980 2648 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence178 644 1600 gene locus_tag LOCUS_11990 644 1600 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887460.1 protein_id gnl|my_center|LOCUS_11990 1645 3063 gene locus_tag LOCUS_12000 1645 3063 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_12000 <4080 3064 gene locus_tag LOCUS_12010 <4080 3064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888712.1:threonine--tRNA ligase >Feature sequence179 915 670 gene locus_tag LOCUS_12020 915 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886772.1 protein_id gnl|my_center|LOCUS_12020 966 1691 gene locus_tag LOCUS_12030 966 1691 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_12030 1716 2099 gene locus_tag LOCUS_12040 1716 2099 CDS product S-adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172919.1 protein_id gnl|my_center|LOCUS_12040 2109 3056 gene locus_tag LOCUS_12050 gene speE 2109 3056 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172918.1 protein_id gnl|my_center|LOCUS_12050 3053 3607 gene locus_tag LOCUS_12060 gene hpt 3053 3607 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888017.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence180 1610 357 gene locus_tag LOCUS_12070 1610 357 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_12070 2377 1631 gene locus_tag LOCUS_12080 2377 1631 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888897.1 protein_id gnl|my_center|LOCUS_12080 2794 2381 gene locus_tag LOCUS_12090 2794 2381 CDS product DUF3197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349644.1 protein_id gnl|my_center|LOCUS_12090 2898 3602 gene locus_tag LOCUS_12100 2898 3602 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479982.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence181 347 1111 gene locus_tag LOCUS_12110 347 1111 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 protein_id gnl|my_center|LOCUS_12110 1159 2157 gene locus_tag LOCUS_12120 1159 2157 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906069.1 protein_id gnl|my_center|LOCUS_12120 2249 3238 gene locus_tag LOCUS_12130 2249 3238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence182 2572 998 gene locus_tag LOCUS_12140 2572 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3989 2685 gene locus_tag LOCUS_12150 3989 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence183 398 473 gene locus_tag LOCUS_t00150 398 473 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2451 3584 gene locus_tag LOCUS_12160 2451 3584 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385612.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence184 113 583 gene locus_tag LOCUS_12170 gene ccmE 113 583 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_12170 600 2579 gene locus_tag LOCUS_12180 600 2579 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_12180 2576 3109 gene locus_tag LOCUS_12190 2576 3109 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_12190 3106 3570 gene locus_tag LOCUS_12200 3106 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence185 <1 1959 gene locus_tag LOCUS_12210 <1 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887233.1:AAA family ATPase 2494 1961 gene locus_tag LOCUS_12220 2494 1961 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403143.1 protein_id gnl|my_center|LOCUS_12220 3390 2485 gene locus_tag LOCUS_12230 3390 2485 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479524.1 protein_id gnl|my_center|LOCUS_12230 3944 3399 gene locus_tag LOCUS_12240 3944 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence186 1398 331 gene locus_tag LOCUS_12250 1398 331 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228426.1 protein_id gnl|my_center|LOCUS_12250 2695 1406 gene locus_tag LOCUS_12260 2695 1406 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228148.1 protein_id gnl|my_center|LOCUS_12260 2821 3432 gene locus_tag LOCUS_12270 2821 3432 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229199.1 protein_id gnl|my_center|LOCUS_12270 <3953 3419 gene locus_tag LOCUS_12280 <3953 3419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887017.1:lysine--tRNA ligase >Feature sequence187 >Feature sequence188 292 1350 gene locus_tag LOCUS_12290 292 1350 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228369.1 protein_id gnl|my_center|LOCUS_12290 1354 2616 gene locus_tag LOCUS_12300 1354 2616 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870666.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence189 1026 226 gene locus_tag LOCUS_12310 1026 226 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_12310 1852 1010 gene locus_tag LOCUS_12320 gene iolB 1852 1010 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_12320 2859 1849 gene locus_tag LOCUS_12330 gene iolG 2859 1849 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_12330 3779 2856 gene locus_tag LOCUS_12340 3779 2856 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence190 1 3069 gene locus_tag LOCUS_12350 1 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence191 <1 1337 gene locus_tag LOCUS_12360 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092263432.1:ammonium transporter 1591 1905 gene locus_tag LOCUS_12370 1591 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1934 3904 gene locus_tag LOCUS_12380 1934 3904 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887340.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence192 1166 141 gene locus_tag LOCUS_12390 1166 141 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228309.1 protein_id gnl|my_center|LOCUS_12390 2224 1163 gene locus_tag LOCUS_12400 gene pdhA 2224 1163 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228310.1 protein_id gnl|my_center|LOCUS_12400 2627 3046 gene locus_tag LOCUS_12410 2627 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence193 529 230 gene locus_tag LOCUS_12420 gene clpS 529 230 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_12420 1147 545 gene locus_tag LOCUS_12430 1147 545 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_12430 2166 1192 gene locus_tag LOCUS_12440 2166 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence194 188 1762 gene locus_tag LOCUS_12450 188 1762 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889290.1 protein_id gnl|my_center|LOCUS_12450 1764 3047 gene locus_tag LOCUS_12460 1764 3047 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889381.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence195 435 1379 gene locus_tag LOCUS_12470 435 1379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776186.1 protein_id gnl|my_center|LOCUS_12470 1424 2761 gene locus_tag LOCUS_12480 1424 2761 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_12480 3057 2770 gene locus_tag LOCUS_12490 3057 2770 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633933.1 protein_id gnl|my_center|LOCUS_12490 3727 3059 gene locus_tag LOCUS_12500 3727 3059 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228234.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence196 125 655 gene locus_tag LOCUS_12510 125 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1587 721 gene locus_tag LOCUS_12520 1587 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2855 1686 gene locus_tag LOCUS_12530 2855 1686 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337440.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence197 <1 1196 gene locus_tag LOCUS_12540 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479890.1:bacillithiol biosynthesis cysteine-adding enzyme BshC <3794 1325 gene locus_tag LOCUS_12550 <3794 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228416.1:isoleucine--tRNA ligase >Feature sequence198 1682 531 gene locus_tag LOCUS_12560 1682 531 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763164.1 protein_id gnl|my_center|LOCUS_12560 1838 3244 gene locus_tag LOCUS_12570 gene trpE 1838 3244 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888426.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence199 1092 175 gene locus_tag LOCUS_12580 gene truB 1092 175 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887965.1 protein_id gnl|my_center|LOCUS_12580 1578 1162 gene locus_tag LOCUS_12590 1578 1162 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618785.1 protein_id gnl|my_center|LOCUS_12590 1795 2337 gene locus_tag LOCUS_12600 gene pyrR 1795 2337 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_12600 2334 3257 gene locus_tag LOCUS_12610 2334 3257 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887752.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence200 444 541 gene locus_tag LOCUS_t00160 444 541 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 690 1532 gene locus_tag LOCUS_12620 690 1532 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 protein_id gnl|my_center|LOCUS_12620 1529 2401 gene locus_tag LOCUS_12630 1529 2401 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479973.1 protein_id gnl|my_center|LOCUS_12630 3530 3539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence201 1355 231 gene locus_tag LOCUS_12640 1355 231 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350047.1 protein_id gnl|my_center|LOCUS_12640 1592 2173 gene locus_tag LOCUS_12650 gene coaE 1592 2173 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888527.1 protein_id gnl|my_center|LOCUS_12650 <3772 2185 gene locus_tag LOCUS_12660 <3772 2185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888212.1:CTP synthase >Feature sequence202 1768 1187 gene locus_tag LOCUS_12670 1768 1187 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391573.1 protein_id gnl|my_center|LOCUS_12670 2612 1803 gene locus_tag LOCUS_12680 2612 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence203 1632 835 gene locus_tag LOCUS_12690 gene trpA 1632 835 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887587.1 protein_id gnl|my_center|LOCUS_12690 2870 1629 gene locus_tag LOCUS_12700 gene trpB 2870 1629 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349629.1 protein_id gnl|my_center|LOCUS_12700 3323 2913 gene locus_tag LOCUS_12710 3323 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3368 3616 gene locus_tag LOCUS_12720 3368 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence204 1199 21 gene locus_tag LOCUS_12730 1199 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2003 1482 gene locus_tag LOCUS_12740 2003 1482 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 protein_id gnl|my_center|LOCUS_12740 2929 2726 gene locus_tag LOCUS_12750 2929 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence205 1514 336 gene locus_tag LOCUS_12760 1514 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 364 373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1948 1550 gene locus_tag LOCUS_12770 1948 1550 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887598.1 protein_id gnl|my_center|LOCUS_12770 2304 1948 gene locus_tag LOCUS_12780 gene sdhC 2304 1948 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887599.1 protein_id gnl|my_center|LOCUS_12780 2667 3110 gene locus_tag LOCUS_12790 gene speD 2667 3110 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence206 <1 791 gene locus_tag LOCUS_12800 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640367.1:NADH-quinone oxidoreductase subunit NuoN 1738 788 gene locus_tag LOCUS_12810 1738 788 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_12810 2439 1738 gene locus_tag LOCUS_12820 2439 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence207 1424 528 gene locus_tag LOCUS_12830 1424 528 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887392.1 protein_id gnl|my_center|LOCUS_12830 1507 1881 gene locus_tag LOCUS_12840 1507 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1878 3035 gene locus_tag LOCUS_12850 1878 3035 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence208 1237 983 gene locus_tag LOCUS_12860 1237 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1667 1248 gene locus_tag LOCUS_12870 1667 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 <3717 1678 gene locus_tag LOCUS_12880 <3717 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889506.1:MDR family MFS transporter >Feature sequence209 1158 22 gene locus_tag LOCUS_12890 1158 22 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_12890 1656 1297 gene locus_tag LOCUS_12900 1656 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888253.1 protein_id gnl|my_center|LOCUS_12900 2573 1653 gene locus_tag LOCUS_12910 2573 1653 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886774.1 protein_id gnl|my_center|LOCUS_12910 3284 2595 gene locus_tag LOCUS_12920 3284 2595 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138697.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence210 <1 1516 gene locus_tag LOCUS_12930 <1 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017871314.1:DUF5693 family protein 1513 2487 gene locus_tag LOCUS_12940 gene csaB 1513 2487 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_12940 2484 2936 gene locus_tag LOCUS_12950 2484 2936 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889032.1 protein_id gnl|my_center|LOCUS_12950 3283 2939 gene locus_tag LOCUS_12960 3283 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3310 3696 gene locus_tag LOCUS_12970 3310 3696 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350530.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence211 1261 179 gene locus_tag LOCUS_12980 gene proB 1261 179 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888462.1 protein_id gnl|my_center|LOCUS_12980 2484 1258 gene locus_tag LOCUS_12990 2484 1258 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_12990 2952 2485 gene locus_tag LOCUS_13000 2952 2485 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227752.1 protein_id gnl|my_center|LOCUS_13000 3277 3654 gene locus_tag LOCUS_13010 3277 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence212 <1 916 gene locus_tag LOCUS_13020 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetate--CoA ligase 1085 1948 gene locus_tag LOCUS_13030 1085 1948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_13030 2010 2082 gene locus_tag LOCUS_t00170 2010 2082 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2695 3378 gene locus_tag LOCUS_13040 2695 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence213 489 1505 gene locus_tag LOCUS_13050 gene galE 489 1505 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_13050 1556 2992 gene locus_tag LOCUS_13060 1556 2992 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_13060 <3669 2986 gene locus_tag LOCUS_13070 <3669 2986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245496.1:ABC transporter ATP-binding protein >Feature sequence214 1365 34 gene locus_tag LOCUS_13080 1365 34 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888503.1 protein_id gnl|my_center|LOCUS_13080 1685 1356 gene locus_tag LOCUS_13090 1685 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2551 1682 gene locus_tag LOCUS_13100 gene rsmH 2551 1682 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888501.1 protein_id gnl|my_center|LOCUS_13100 2979 2551 gene locus_tag LOCUS_13110 gene mraZ 2979 2551 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888500.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence215 1672 1124 gene locus_tag LOCUS_13120 1672 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2839 1943 gene locus_tag LOCUS_13130 2839 1943 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_13130 <3657 2850 gene locus_tag LOCUS_13140 <3657 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888234.1:glucose-6-phosphate dehydrogenase >Feature sequence216 10 567 gene locus_tag LOCUS_13150 10 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 601 1362 gene locus_tag LOCUS_13160 601 1362 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887189.1 protein_id gnl|my_center|LOCUS_13160 1359 1622 gene locus_tag LOCUS_13170 1359 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2398 1859 gene locus_tag LOCUS_13180 2398 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2438 3607 gene locus_tag LOCUS_13190 2438 3607 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618807.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence217 <3649 604 gene locus_tag LOCUS_13200 <3649 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480229.1:chromosome segregation SMC family protein >Feature sequence218 1218 307 gene locus_tag LOCUS_13210 1218 307 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228784.1 protein_id gnl|my_center|LOCUS_13210 1359 1946 gene locus_tag LOCUS_13220 1359 1946 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887361.1 protein_id gnl|my_center|LOCUS_13220 1969 2523 gene locus_tag LOCUS_13230 gene pyrE 1969 2523 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228883.1 protein_id gnl|my_center|LOCUS_13230 2523 3575 gene locus_tag LOCUS_13240 gene mnmA 2523 3575 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480311.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence219 >Feature sequence220 761 1096 gene locus_tag LOCUS_13250 761 1096 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480222.1 protein_id gnl|my_center|LOCUS_13250 1087 1626 gene locus_tag LOCUS_13260 1087 1626 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 protein_id gnl|my_center|LOCUS_13260 1623 2186 gene locus_tag LOCUS_13270 1623 2186 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888143.1 protein_id gnl|my_center|LOCUS_13270 2183 3388 gene locus_tag LOCUS_13280 gene nuoD 2183 3388 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888142.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence221 2121 793 gene locus_tag LOCUS_13290 2121 793 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_13290 2986 2144 gene locus_tag LOCUS_13300 2986 2144 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_13300 <3598 2983 gene locus_tag LOCUS_13310 <3598 2983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803811.1:sugar ABC transporter permease >Feature sequence222 <1 577 gene locus_tag LOCUS_13320 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338938.1:fasciclin domain-containing protein 1187 546 gene locus_tag LOCUS_13330 gene pcp 1187 546 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_13330 1909 1184 gene locus_tag LOCUS_13340 1909 1184 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869459.1 protein_id gnl|my_center|LOCUS_13340 2230 2421 gene locus_tag LOCUS_13350 2230 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2460 3383 gene locus_tag LOCUS_13360 2460 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence223 425 434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 449 670 gene locus_tag LOCUS_13370 449 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 972 568 gene locus_tag LOCUS_13380 972 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1141 1818 gene locus_tag LOCUS_13390 gene lipB 1141 1818 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_13390 1811 2758 gene locus_tag LOCUS_13400 gene lipA 1811 2758 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887411.1 protein_id gnl|my_center|LOCUS_13400 <3558 2811 gene locus_tag LOCUS_13410 <3558 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552051.1:glycosyltransferase >Feature sequence224 <1 1070 gene locus_tag LOCUS_13420 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119127.1:chloride channel protein 1143 2579 gene locus_tag LOCUS_13430 1143 2579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence225 1776 448 gene locus_tag LOCUS_13440 gene der 1776 448 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888936.1 protein_id gnl|my_center|LOCUS_13440 3209 1776 gene locus_tag LOCUS_13450 3209 1776 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_13450 3248 3257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence226 <1 500 gene locus_tag LOCUS_13460 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226711.1:twin-arginine translocase subunit TatC 566 1651 gene locus_tag LOCUS_13470 566 1651 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349615.1 protein_id gnl|my_center|LOCUS_13470 1833 2459 gene locus_tag LOCUS_13480 1833 2459 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886892.1 protein_id gnl|my_center|LOCUS_13480 2456 3283 gene locus_tag LOCUS_13490 gene prmC 2456 3283 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence227 <1 545 gene locus_tag LOCUS_13500 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943581.1:ABC transporter permease subunit 583 1887 gene locus_tag LOCUS_13510 583 1887 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943582.1 protein_id gnl|my_center|LOCUS_13510 2849 1839 gene locus_tag LOCUS_13520 gene queG 2849 1839 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480231.1 protein_id gnl|my_center|LOCUS_13520 <3515 2962 gene locus_tag LOCUS_13530 <3515 2962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939587.1:6-phosphogluconolactonase >Feature sequence228 <1 1030 gene locus_tag LOCUS_13540 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177182973.1:transglycosylase domain-containing protein 1027 1428 gene locus_tag LOCUS_13550 1027 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1448 2140 gene locus_tag LOCUS_13560 1448 2140 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887942.1 protein_id gnl|my_center|LOCUS_13560 2137 2781 gene locus_tag LOCUS_13570 gene ccmA 2137 2781 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_13570 2798 3475 gene locus_tag LOCUS_13580 2798 3475 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence229 2035 1304 gene locus_tag LOCUS_13590 2035 1304 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 protein_id gnl|my_center|LOCUS_13590 2163 3365 gene locus_tag LOCUS_13600 2163 3365 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence230 679 1104 gene locus_tag LOCUS_13610 679 1104 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886862.1 protein_id gnl|my_center|LOCUS_13610 2880 1153 gene locus_tag LOCUS_13620 2880 1153 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967661.1 protein_id gnl|my_center|LOCUS_13620 3017 2941 gene locus_tag LOCUS_t00180 3017 2941 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 171 896 gene locus_tag LOCUS_13630 171 896 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479676.1 protein_id gnl|my_center|LOCUS_13630 918 1247 gene locus_tag LOCUS_13640 918 1247 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480049.1 protein_id gnl|my_center|LOCUS_13640 1261 2730 gene locus_tag LOCUS_13650 1261 2730 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479527.1 protein_id gnl|my_center|LOCUS_13650 2801 3397 gene locus_tag LOCUS_13660 2801 3397 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350207.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence232 2636 57 gene locus_tag LOCUS_13670 2636 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 >Feature sequence233 39 1712 gene locus_tag LOCUS_13680 39 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2704 2339 gene locus_tag LOCUS_13690 2704 2339 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349502.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence234 656 126 gene locus_tag LOCUS_13700 656 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence235 285 1139 gene locus_tag LOCUS_13710 gene rocF 285 1139 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887296.1 protein_id gnl|my_center|LOCUS_13710 2688 1396 gene locus_tag LOCUS_13720 gene serS 2688 1396 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_13720 2976 2692 gene locus_tag LOCUS_13730 gene gatC 2976 2692 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence236 140 829 gene locus_tag LOCUS_13740 140 829 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887846.1 protein_id gnl|my_center|LOCUS_13740 848 1381 gene locus_tag LOCUS_13750 848 1381 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888229.1 protein_id gnl|my_center|LOCUS_13750 1332 2129 gene locus_tag LOCUS_13760 1332 2129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776063.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence237 1667 1281 gene locus_tag LOCUS_13770 1667 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2492 1701 gene locus_tag LOCUS_13780 2492 1701 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 protein_id gnl|my_center|LOCUS_13780 2595 2927 gene locus_tag LOCUS_13790 2595 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence238 476 60 gene locus_tag LOCUS_13800 476 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 632 708 gene locus_tag LOCUS_t00190 632 708 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 710 783 gene locus_tag LOCUS_t00200 710 783 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 786 862 gene locus_tag LOCUS_t00210 786 862 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1536 1009 gene locus_tag LOCUS_13810 1536 1009 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480322.1 protein_id gnl|my_center|LOCUS_13810 1770 2789 gene locus_tag LOCUS_13820 gene mutY 1770 2789 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888913.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence239 2546 1305 gene locus_tag LOCUS_13830 gene glgC 2546 1305 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence240 <1 520 gene locus_tag LOCUS_13840 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887194.1:replicative DNA helicase 590 1876 gene locus_tag LOCUS_13850 590 1876 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228985.1 protein_id gnl|my_center|LOCUS_13850 3035 1857 gene locus_tag LOCUS_13860 3035 1857 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence241 1128 397 gene locus_tag LOCUS_13870 1128 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2159 1128 gene locus_tag LOCUS_13880 2159 1128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021548.1 protein_id gnl|my_center|LOCUS_13880 3241 2330 gene locus_tag LOCUS_13890 3241 2330 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence242 625 813 gene locus_tag LOCUS_13900 625 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1338 754 gene locus_tag LOCUS_13910 1338 754 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_13910 1438 1719 gene locus_tag LOCUS_13920 1438 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1716 2123 gene locus_tag LOCUS_13930 1716 2123 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_13930 2260 2637 gene locus_tag LOCUS_13940 2260 2637 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480028.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence243 2585 1548 gene locus_tag LOCUS_13950 gene tdh 2585 1548 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 protein_id gnl|my_center|LOCUS_13950 <3272 2657 gene locus_tag LOCUS_13960 <3272 2657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886987.1:ubiquinol-cytochrome c reductase iron-sulfur subunit >Feature sequence244 2388 499 gene locus_tag LOCUS_13970 gene iolD 2388 499 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_13970 <3269 2385 gene locus_tag LOCUS_13980 <3269 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244942.1:scyllo-inositol 2-dehydrogenase >Feature sequence245 155 240 gene locus_tag LOCUS_t00220 155 240 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2803 245 gene locus_tag LOCUS_13990 gene clpB 2803 245 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479647.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence246 244 921 gene locus_tag LOCUS_14000 gene cas5e 244 921 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_14000 1073 1555 gene locus_tag LOCUS_14010 1073 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1572 2528 gene locus_tag LOCUS_14020 gene cas1e 1572 2528 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_14020 2974 3186 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccggtccatccccacgtgcgtggggaacgc >Feature sequence247 2605 1109 gene locus_tag LOCUS_14030 2605 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3037 2699 gene locus_tag LOCUS_14040 3037 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3036 3200 gene locus_tag LOCUS_14050 3036 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence248 427 1062 gene locus_tag LOCUS_14060 427 1062 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_14060 1659 1078 gene locus_tag LOCUS_14070 gene folE 1659 1078 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871165.1 protein_id gnl|my_center|LOCUS_14070 3005 1797 gene locus_tag LOCUS_14080 3005 1797 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886683.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence249 1153 227 gene locus_tag LOCUS_14090 1153 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1273 2805 gene locus_tag LOCUS_14100 1273 2805 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886741.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence250 343 699 gene locus_tag LOCUS_14110 343 699 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_14110 856 1812 gene locus_tag LOCUS_14120 856 1812 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_14120 1809 2459 gene locus_tag LOCUS_14130 1809 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence251 <1 707 gene locus_tag LOCUS_14140 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479857.1:S41 family peptidase 1988 897 gene locus_tag LOCUS_14150 1988 897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869840.1 protein_id gnl|my_center|LOCUS_14150 <3169 2106 gene locus_tag LOCUS_14160 <3169 2106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887765.1:prephenate dehydrogenase >Feature sequence252 642 148 gene locus_tag LOCUS_14170 642 148 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887521.1 protein_id gnl|my_center|LOCUS_14170 849 2342 gene locus_tag LOCUS_14180 849 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2842 2414 gene locus_tag LOCUS_14190 2842 2414 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889232.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence253 1707 502 gene locus_tag LOCUS_14200 1707 502 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349482.1 protein_id gnl|my_center|LOCUS_14200 1756 2325 gene locus_tag LOCUS_14210 1756 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2322 2876 gene locus_tag LOCUS_14220 gene tsaB 2322 2876 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887402.1 protein_id gnl|my_center|LOCUS_14220 2885 3082 gene locus_tag LOCUS_14230 2885 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence254 <1 654 gene locus_tag LOCUS_14240 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228195.1:dihydroorotase 647 1402 gene locus_tag LOCUS_14250 647 1402 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_14250 1399 2313 gene locus_tag LOCUS_14260 gene pyrD 1399 2313 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 protein_id gnl|my_center|LOCUS_14260 2753 2310 gene locus_tag LOCUS_14270 2753 2310 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence255 394 1731 gene locus_tag LOCUS_14280 394 1731 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_14280 2525 1728 gene locus_tag LOCUS_14290 gene map 2525 1728 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480012.1 protein_id gnl|my_center|LOCUS_14290 <3120 2562 gene locus_tag LOCUS_14300 <3120 2562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887031.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence256 681 223 gene locus_tag LOCUS_14310 681 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 816 2633 gene locus_tag LOCUS_14320 816 2633 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence257 <1 2439 gene locus_tag LOCUS_14330 <1 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888548.1:DNA gyrase subunit A >Feature sequence258 2141 1086 gene locus_tag LOCUS_14340 2141 1086 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_14340 <3074 2270 gene locus_tag LOCUS_14350 <3074 2270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889042.1:HAMP domain-containing sensor histidine kinase >Feature sequence259 578 333 gene locus_tag LOCUS_14360 578 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 1094 939 gene locus_tag LOCUS_14370 1094 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence260 2953 2636 gene locus_tag LOCUS_14380 2953 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence261 <1 558 gene locus_tag LOCUS_14390 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187767762.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 555 1514 gene locus_tag LOCUS_14400 555 1514 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887517.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence262 3040 1724 gene locus_tag LOCUS_14410 3040 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence263 1034 489 gene locus_tag LOCUS_14420 1034 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1136 2203 gene locus_tag LOCUS_14430 1136 2203 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479637.1 protein_id gnl|my_center|LOCUS_14430 2223 2999 gene locus_tag LOCUS_14440 2223 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence264 <1 1414 gene locus_tag LOCUS_14450 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889113.1:iron ABC transporter permease 1428 2399 gene locus_tag LOCUS_14460 1428 2399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886710.1 protein_id gnl|my_center|LOCUS_14460 2396 2950 gene locus_tag LOCUS_14470 2396 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence265 <1 1687 gene locus_tag LOCUS_14480 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582873.1:alpha-xylosidase 1710 2711 gene locus_tag LOCUS_14490 1710 2711 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence266 <2990 1332 gene locus_tag LOCUS_14500 <2990 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887578.1:alpha-amylase family protein >Feature sequence267 <1 712 gene locus_tag LOCUS_14510 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027927.1:winged helix-turn-helix domain-containing protein 957 882 gene locus_tag LOCUS_t00230 957 882 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1837 998 gene locus_tag LOCUS_14520 1837 998 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_14520 1931 2021 gene locus_tag LOCUS_t00240 1931 2021 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2687 2696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence268 >Feature sequence269 275 1813 gene locus_tag LOCUS_14530 275 1813 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_14530 2578 1829 gene locus_tag LOCUS_14540 2578 1829 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888493.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence270 2016 367 gene locus_tag LOCUS_14550 2016 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2898 2398 gene locus_tag LOCUS_14560 2898 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence271 406 588 gene locus_tag LOCUS_14570 gene rpmF 406 588 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_14570 643 1617 gene locus_tag LOCUS_14580 643 1617 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172506.1 protein_id gnl|my_center|LOCUS_14580 1614 2540 gene locus_tag LOCUS_14590 gene fabD 1614 2540 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888578.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence272 2013 775 gene locus_tag LOCUS_14600 2013 775 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_14600 <2877 2067 gene locus_tag LOCUS_14610 <2877 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615578.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence273 763 1698 gene locus_tag LOCUS_14620 763 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence274 <1 676 gene locus_tag LOCUS_14630 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887480.1:cyclic nucleotide-binding domain-containing protein 1513 683 gene locus_tag LOCUS_14640 1513 683 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_14640 1684 2730 gene locus_tag LOCUS_14650 1684 2730 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886907.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence275 1845 883 gene locus_tag LOCUS_14660 1845 883 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence276 <1 520 gene locus_tag LOCUS_14670 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008632942.1:2-phosphosulfolactate phosphatase 513 1250 gene locus_tag LOCUS_14680 513 1250 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172511.1 protein_id gnl|my_center|LOCUS_14680 <2860 1247 gene locus_tag LOCUS_14690 <2860 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887551.1:DNA gyrase subunit B >Feature sequence277 302 2410 gene locus_tag LOCUS_14700 gene glgX 302 2410 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403613.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence278 1247 2398 gene locus_tag LOCUS_14710 1247 2398 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence279 1230 1598 gene locus_tag LOCUS_14720 1230 1598 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618908.1 protein_id gnl|my_center|LOCUS_14720 1595 2380 gene locus_tag LOCUS_14730 1595 2380 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence280 292 8 gene locus_tag LOCUS_14740 gene rpsT 292 8 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887951.1 protein_id gnl|my_center|LOCUS_14740 928 425 gene locus_tag LOCUS_14750 gene coaD 928 425 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_14750 1541 975 gene locus_tag LOCUS_14760 1541 975 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479504.1 protein_id gnl|my_center|LOCUS_14760 1611 2258 gene locus_tag LOCUS_14770 1611 2258 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887290.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence281 1916 975 gene locus_tag LOCUS_14780 1916 975 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226614.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence282 897 1529 gene locus_tag LOCUS_14790 897 1529 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870755.1 protein_id gnl|my_center|LOCUS_14790 1526 2458 gene locus_tag LOCUS_14800 1526 2458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887655.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence283 1650 604 gene locus_tag LOCUS_14810 1650 604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_14810 <2810 1658 gene locus_tag LOCUS_14820 <2810 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_180938250.1:iron ABC transporter permease >Feature sequence284 956 2293 gene locus_tag LOCUS_14830 956 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence285 1189 764 gene locus_tag LOCUS_14840 gene ruvX 1189 764 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889134.1 protein_id gnl|my_center|LOCUS_14840 1264 1340 gene locus_tag LOCUS_t00250 1264 1340 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2780 1374 gene locus_tag LOCUS_14850 gene gntK 2780 1374 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence286 248 1147 gene locus_tag LOCUS_14860 248 1147 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_14860 1144 2100 gene locus_tag LOCUS_14870 1144 2100 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence287 259 810 gene locus_tag LOCUS_14880 259 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 830 1486 gene locus_tag LOCUS_14890 830 1486 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_14890 1494 2189 gene locus_tag LOCUS_14900 1494 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14900 2193 2714 gene locus_tag LOCUS_14910 2193 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence288 693 1724 gene locus_tag LOCUS_14920 gene pheS 693 1724 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888980.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence289 <2719 1063 gene locus_tag LOCUS_14930 <2719 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025566951.1:NADH-quinone oxidoreductase subunit L >Feature sequence290 <2646 447 gene locus_tag LOCUS_14940 <2646 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479923.1:leucine--tRNA ligase >Feature sequence291 2508 649 gene locus_tag LOCUS_14950 2508 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence292 <1 1571 gene locus_tag LOCUS_14960 <1 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479846.1:gamma-glutamyltransferase family protein >Feature sequence293 1319 336 gene locus_tag LOCUS_14970 1319 336 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_14970 1757 1497 gene locus_tag LOCUS_14980 1757 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence294 507 283 gene locus_tag LOCUS_14990 507 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1356 517 gene locus_tag LOCUS_15000 gene truA 1356 517 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888918.1 protein_id gnl|my_center|LOCUS_15000 1355 2053 gene locus_tag LOCUS_15010 1355 2053 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence295 <1 636 gene locus_tag LOCUS_15020 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189262.1:carbohydrate kinase 1897 626 gene locus_tag LOCUS_15030 gene aspS 1897 626 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887698.1 protein_id gnl|my_center|LOCUS_15030 <2587 1894 gene locus_tag LOCUS_15040 <2587 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888658.1:dipeptidase >Feature sequence296 <1 1142 gene locus_tag LOCUS_15050 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618783.1:MFS transporter 1151 2026 gene locus_tag LOCUS_15060 1151 2026 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence297 981 1661 gene locus_tag LOCUS_15070 981 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2441 1665 gene locus_tag LOCUS_15080 2441 1665 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence298 862 2442 gene locus_tag LOCUS_15090 862 2442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339159.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence299 <1 865 gene locus_tag LOCUS_15100 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942080.1:peptide-binding protein 894 1841 gene locus_tag LOCUS_15110 894 1841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence300 984 82 gene locus_tag LOCUS_15120 984 82 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_15120 1772 990 gene locus_tag LOCUS_15130 1772 990 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_15130 2106 1783 gene locus_tag LOCUS_15140 2106 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2068 2262 gene locus_tag LOCUS_15150 2068 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence301 1352 102 gene locus_tag LOCUS_15160 1352 102 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_15160 2231 1395 gene locus_tag LOCUS_15170 2231 1395 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence302 132 947 gene locus_tag LOCUS_15180 gene menH 132 947 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_15180 1472 1481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1577 1491 gene locus_tag LOCUS_t00260 1577 1491 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1761 2309 gene locus_tag LOCUS_15190 1761 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence303 2457 1030 gene locus_tag LOCUS_15200 2457 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence304 <1 990 gene locus_tag LOCUS_15210 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888393.1:diaminopimelate decarboxylase 1769 969 gene locus_tag LOCUS_15220 1769 969 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence305 978 397 gene locus_tag LOCUS_15230 978 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1046 1450 gene locus_tag LOCUS_15240 1046 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1459 1881 gene locus_tag LOCUS_15250 1459 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349654.1 protein_id gnl|my_center|LOCUS_15250 1939 2253 gene locus_tag LOCUS_15260 1939 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15260 2227 2236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence306 1384 125 gene locus_tag LOCUS_15270 1384 125 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence307 2010 1264 gene locus_tag LOCUS_15280 2010 1264 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence308 736 356 gene locus_tag LOCUS_15290 736 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 735 2414 gene locus_tag LOCUS_15300 735 2414 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence309 >Feature sequence310 413 937 gene locus_tag LOCUS_15310 413 937 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_15310 1974 943 gene locus_tag LOCUS_15320 gene plsX 1974 943 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479836.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence311 69 713 gene locus_tag LOCUS_15330 gene hisIE 69 713 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887378.1 protein_id gnl|my_center|LOCUS_15330 2089 752 gene locus_tag LOCUS_15340 2089 752 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence312 691 53 gene locus_tag LOCUS_15350 691 53 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229094.1 protein_id gnl|my_center|LOCUS_15350 1205 681 gene locus_tag LOCUS_15360 1205 681 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence313 269 850 gene locus_tag LOCUS_15370 gene trmH 269 850 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888841.1 protein_id gnl|my_center|LOCUS_15370 847 1533 gene locus_tag LOCUS_15380 847 1533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228451.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence314 >Feature sequence315 494 2398 gene locus_tag LOCUS_15390 494 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence316 <1 928 gene locus_tag LOCUS_15400 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018211329.1:ABC transporter permease 1722 925 gene locus_tag LOCUS_15410 1722 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence317 429 1088 gene locus_tag LOCUS_15420 429 1088 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_15420 1740 988 gene locus_tag LOCUS_15430 1740 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 <2333 1737 gene locus_tag LOCUS_15440 <2333 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887203.1:tryptophan--tRNA ligase >Feature sequence318 >Feature sequence319 2280 850 gene locus_tag LOCUS_15450 gene pyk 2280 850 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889259.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence320 1020 517 gene locus_tag LOCUS_15460 1020 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1083 1406 gene locus_tag LOCUS_15470 1083 1406 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 protein_id gnl|my_center|LOCUS_15470 1403 1738 gene locus_tag LOCUS_15480 1403 1738 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence321 <1 1001 gene locus_tag LOCUS_15490 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887564.1:DUF58 domain-containing protein 1052 1798 gene locus_tag LOCUS_15500 1052 1798 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence322 3 584 gene locus_tag LOCUS_15510 3 584 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_15510 634 1068 gene locus_tag LOCUS_15520 634 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1068 1475 gene locus_tag LOCUS_15530 gene queD 1068 1475 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389277.1 protein_id gnl|my_center|LOCUS_15530 1477 2169 gene locus_tag LOCUS_15540 1477 2169 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126003.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence323 235 244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 517 1425 gene locus_tag LOCUS_15550 517 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1506 2210 gene locus_tag LOCUS_15560 1506 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence324 1530 847 gene locus_tag LOCUS_15570 gene ftsE 1530 847 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173352.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence325 <2272 1182 gene locus_tag LOCUS_15580 <2272 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584110.1:MFS transporter >Feature sequence326 30 1319 gene locus_tag LOCUS_15590 gene pchA 30 1319 CDS product isochorismate synthase PchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114686.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence327 507 58 gene locus_tag LOCUS_15600 gene rplI 507 58 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227802.1 protein_id gnl|my_center|LOCUS_15600 770 504 gene locus_tag LOCUS_15610 gene rpsR 770 504 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886749.1 protein_id gnl|my_center|LOCUS_15610 1658 804 gene locus_tag LOCUS_15620 1658 804 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480308.1 protein_id gnl|my_center|LOCUS_15620 1994 1686 gene locus_tag LOCUS_15630 gene rpsF 1994 1686 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886746.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence328 1205 318 gene locus_tag LOCUS_15640 1205 318 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 protein_id gnl|my_center|LOCUS_15640 <2229 1263 gene locus_tag LOCUS_15650 <2229 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226870.1:extracellular solute-binding protein >Feature sequence329 1398 649 gene locus_tag LOCUS_15660 1398 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1540 1616 gene locus_tag LOCUS_t00270 1540 1616 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1637 1722 gene locus_tag LOCUS_t00280 1637 1722 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1733 1808 gene locus_tag LOCUS_t00290 1733 1808 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1812 1886 gene locus_tag LOCUS_t00300 1812 1886 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence330 932 318 gene locus_tag LOCUS_15670 932 318 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence331 <1 1528 gene locus_tag LOCUS_15680 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972911.1:ABC transporter permease <2174 1551 gene locus_tag LOCUS_15690 <2174 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742152.1:SDR family oxidoreductase >Feature sequence332 <2167 1423 gene locus_tag LOCUS_15700 <2167 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867266.1:ABC transporter substrate-binding protein >Feature sequence333 <1 545 gene locus_tag LOCUS_15710 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804988.1:cell division protein ZapE 1590 607 gene locus_tag LOCUS_15720 1590 607 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence334 287 778 gene locus_tag LOCUS_15730 287 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480249.1 protein_id gnl|my_center|LOCUS_15730 795 1148 gene locus_tag LOCUS_15740 795 1148 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 protein_id gnl|my_center|LOCUS_15740 1789 1160 gene locus_tag LOCUS_15750 gene nth 1789 1160 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886934.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence335 89 1165 gene locus_tag LOCUS_15760 89 1165 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence336 217 1206 gene locus_tag LOCUS_15770 217 1206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945947.1 protein_id gnl|my_center|LOCUS_15770 1217 1993 gene locus_tag LOCUS_15780 1217 1993 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence337 406 1407 gene locus_tag LOCUS_15790 406 1407 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence338 147 1331 gene locus_tag LOCUS_15800 147 1331 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349521.1 protein_id gnl|my_center|LOCUS_15800 1369 1444 gene locus_tag LOCUS_t00310 1369 1444 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1888 >2097 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttccccacgcacgtggggatggaccg >Feature sequence339 93 452 gene locus_tag LOCUS_15810 93 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 468 632 gene locus_tag LOCUS_15820 gene lysW 468 632 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_15820 629 1477 gene locus_tag LOCUS_15830 gene lysX 629 1477 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479919.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence340 1469 258 gene locus_tag LOCUS_15840 1469 258 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_15840 1555 1938 gene locus_tag LOCUS_15850 1555 1938 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887084.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence341 214 438 gene locus_tag LOCUS_15860 214 438 CDS product DUF3248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888640.1 protein_id gnl|my_center|LOCUS_15860 648 493 gene locus_tag LOCUS_15870 648 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 607 924 gene locus_tag LOCUS_15880 607 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 927 1595 gene locus_tag LOCUS_15890 927 1595 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480256.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence342 <1 798 gene locus_tag LOCUS_15900 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227850.1:cytochrome c oxidase subunit II >Feature sequence343 >Feature sequence344 273 282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2016 1247 gene locus_tag LOCUS_15910 <2016 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181950125.1:hydrogenase 4 subunit F >Feature sequence345 >Feature sequence346 1 234 gene locus_tag LOCUS_15920 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence347 1616 426 gene locus_tag LOCUS_15930 gene obgE 1616 426 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886732.1 protein_id gnl|my_center|LOCUS_15930 1967 1707 gene locus_tag LOCUS_15940 gene rpmA 1967 1707 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886733.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence348 >Feature sequence349 <1947 521 gene locus_tag LOCUS_15950 <1947 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082981.1:L-arabinose isomerase >Feature sequence350 1040 180 gene locus_tag LOCUS_15960 1040 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence351 1206 286 gene locus_tag LOCUS_15970 1206 286 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886656.1 protein_id gnl|my_center|LOCUS_15970 <1936 1206 gene locus_tag LOCUS_15980 <1936 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162177770.1:diadenylate cyclase CdaA >Feature sequence352 >Feature sequence353 <1 647 gene locus_tag LOCUS_15990 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289154.1:cytochrome P450 648 1532 gene locus_tag LOCUS_16000 648 1532 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480339.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence354 1307 669 gene locus_tag LOCUS_16010 1307 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16010 <1900 1353 gene locus_tag LOCUS_16020 <1900 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888491.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA note possible pseudo, internal stop codon >Feature sequence355 413 610 gene locus_tag LOCUS_16030 gene rpmI 413 610 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888638.1 protein_id gnl|my_center|LOCUS_16030 610 975 gene locus_tag LOCUS_16040 gene rplT 610 975 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888637.1 protein_id gnl|my_center|LOCUS_16040 1814 1014 gene locus_tag LOCUS_16050 1814 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence356 861 88 gene locus_tag LOCUS_16060 861 88 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence357 >Feature sequence358 1075 1332 gene locus_tag LOCUS_16070 1075 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence359 178 1332 gene locus_tag LOCUS_16080 178 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence360 508 1212 gene locus_tag LOCUS_16090 508 1212 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence361 1773 493 gene locus_tag LOCUS_16100 1773 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence362 1040 336 gene locus_tag LOCUS_16110 1040 336 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 protein_id gnl|my_center|LOCUS_16110 <1828 1021 gene locus_tag LOCUS_16120 <1828 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035944.1:sensor histidine kinase KdpD >Feature sequence363 487 311 gene locus_tag LOCUS_16130 487 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 539 1210 gene locus_tag LOCUS_16140 539 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1356 1431 gene locus_tag LOCUS_t00320 1356 1431 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence364 104 1228 gene locus_tag LOCUS_16150 gene ribD 104 1228 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886799.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence365 <1 596 gene locus_tag LOCUS_16160 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814041.1:UxaA family hydrolase 610 1542 gene locus_tag LOCUS_16170 610 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence366 72 830 gene locus_tag LOCUS_16180 72 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16180 <1764 806 gene locus_tag LOCUS_16190 <1764 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534169.1:ion channel >Feature sequence367 >Feature sequence368 1341 31 gene locus_tag LOCUS_16200 1341 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence369 384 950 gene locus_tag LOCUS_16210 384 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392236.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence370 405 1418 gene locus_tag LOCUS_16220 405 1418 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence371 925 188 gene locus_tag LOCUS_16230 925 188 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence372 >Feature sequence373 >Feature sequence374 1037 438 gene locus_tag LOCUS_16240 1037 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence375 131 57 gene locus_tag LOCUS_t00330 131 57 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <1593 162 gene locus_tag LOCUS_16250 <1593 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926052.1:diguanylate cyclase >Feature sequence376 231 40 gene locus_tag LOCUS_16260 231 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 857 258 gene locus_tag LOCUS_16270 857 258 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence377 1428 976 gene locus_tag LOCUS_16280 1428 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence378 424 1227 gene locus_tag LOCUS_16290 424 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence379 995 432 gene locus_tag LOCUS_16300 995 432 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888898.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence380 658 53 gene locus_tag LOCUS_16310 658 53 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228230.1 protein_id gnl|my_center|LOCUS_16310 1305 658 gene locus_tag LOCUS_16320 1305 658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172926.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence381 1541 399 gene locus_tag LOCUS_16330 1541 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence382 >Feature sequence383 984 178 gene locus_tag LOCUS_16340 984 178 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_16340 <1488 981 gene locus_tag LOCUS_16350 <1488 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975580.1:sulfate ABC transporter permease subunit CysT >Feature sequence384 91 972 gene locus_tag LOCUS_16360 91 972 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931471.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence385 >Feature sequence386 <1465 124 gene locus_tag LOCUS_16370 <1465 124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618866.1:phosphodiester glycosidase family protein >Feature sequence387 974 255 gene locus_tag LOCUS_16380 974 255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence388 >Feature sequence389 100 1167 gene locus_tag LOCUS_16390 gene alr 100 1167 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479629.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence390 949 41 gene locus_tag LOCUS_16400 949 41 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_16400 1192 1016 gene locus_tag LOCUS_16410 1192 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence391 1172 768 gene locus_tag LOCUS_16420 1172 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence392 333 249 gene locus_tag LOCUS_t00340 333 249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 427 351 gene locus_tag LOCUS_t00350 427 351 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <1344 483 gene locus_tag LOCUS_16430 <1344 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350521.1:nucleotidyltransferase family protein >Feature sequence393 >Feature sequence394 >Feature sequence395 >Feature sequence396 795 433 gene locus_tag LOCUS_16440 795 433 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_16440 1150 1076 gene locus_tag LOCUS_t00360 1150 1076 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1235 1160 gene locus_tag LOCUS_t00370 1235 1160 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence397 <1 826 gene locus_tag LOCUS_16450 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887909.1:proline--tRNA ligase >Feature sequence398 91 477 gene locus_tag LOCUS_16460 91 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 474 683 gene locus_tag LOCUS_16470 474 683 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence399 1264 881 gene locus_tag LOCUS_16480 1264 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence400 >Feature sequence401 >Feature sequence402 >Feature sequence403 308 317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence404 <1214 343 gene locus_tag LOCUS_16490 <1214 343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479659.1:alanine--glyoxylate aminotransferase family protein >Feature sequence405 346 1017 gene locus_tag LOCUS_16500 346 1017 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842726.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence406 890 363 gene locus_tag LOCUS_16510 gene purE 890 363 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886671.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence407 >Feature sequence408 >Feature sequence409 891 511 gene locus_tag LOCUS_16520 891 511 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367486.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence410 <1109 540 gene locus_tag LOCUS_16530 <1109 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000544830.1:IS21-like element IS21 family helper ATPase IstB >Feature sequence411 914 582 gene locus_tag LOCUS_16540 914 582 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889215.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence412 775 68 gene locus_tag LOCUS_16550 775 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence413 910 401 gene locus_tag LOCUS_16560 910 401 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887500.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence414 >Feature sequence415 2 346 gene locus_tag LOCUS_16570 2 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 156 362 gene locus_tag LOCUS_16580 156 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence420 585 594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence421 628 637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence422 >Feature sequence423 <1 603 gene locus_tag LOCUS_16590 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393440.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence424 817 119 gene locus_tag LOCUS_16600 817 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence425 >Feature sequence426 >Feature sequence427 <839 277 gene locus_tag LOCUS_16610 <839 277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971468.1:lipoprotein >Feature sequence428 503 512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence429 511 520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence430 <1 732 gene locus_tag LOCUS_16620 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259656.1:triose-phosphate isomerase >Feature sequence431 <786 175 gene locus_tag LOCUS_16630 <786 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching protein GlgX note possible pseudo, frameshifted 322 331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence432 >Feature sequence433 336 261 gene locus_tag LOCUS_t00380 336 261 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence434 >Feature sequence435 512 521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence436 <751 163 gene locus_tag LOCUS_16640 <751 163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002985455.1:cell division ATP-binding protein FtsE >Feature sequence437 >Feature sequence438 >Feature sequence439 436 445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence440 >Feature sequence441 >Feature sequence442 395 404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence443 <1 519 gene locus_tag LOCUS_16650 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900236.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence444 >Feature sequence445 >Feature sequence446 603 139 gene locus_tag LOCUS_16660 603 139 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence447 >Feature sequence448 >Feature sequence449 >Feature sequence450 >Feature sequence451 >Feature sequence452 >Feature sequence453 >Feature sequence454 >Feature sequence455 >Feature sequence456 >Feature sequence457 >Feature sequence458 280 531 gene locus_tag LOCUS_16670 280 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence459 >Feature sequence460 >Feature sequence461 >Feature sequence462 >Feature sequence463 >Feature sequence464 >Feature sequence465 >Feature sequence466 >Feature sequence467 >Feature sequence468 79 282 gene locus_tag LOCUS_16680 79 282 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence469 >Feature sequence470 >Feature sequence471 >Feature sequence472 253 167 gene locus_tag LOCUS_t00390 253 167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence473 >Feature sequence474 >Feature sequence475 >Feature sequence476 >Feature sequence477 >Feature sequence478 >Feature sequence479 >Feature sequence480 >Feature sequence481 >Feature sequence482 >Feature sequence483 >Feature sequence484 >Feature sequence485 >Feature sequence486 >Feature sequence487 >Feature sequence488